Slashdot Mirror


Wikipedia To Host Human Gene Repository

schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."

73 comments

  1. I saw it on Wikipedia by omnichad · · Score: 5, Funny

    It says that gene #45A79 controls glowing in the dark! It must be true!

    1. Re:I saw it on Wikipedia by voltel · · Score: 1, Funny

      It says that gene #45A79 controls glowing in the dark! It must be true!

      I for one welcome our new phosphorescent, dna-engineered overlords!

    2. Re:I saw it on Wikipedia by Anonymous Coward · · Score: 0, Funny

      Wow, how the hell did you ever come up with that one? Was it all on your own, by your lonesome? Genius, man. Pure fucking genius! I don't know how you do it. No one ever expects a "I for one welcome our $ADJECTIVES overlords" on Slashdot of all places! Ha ha ha, what a laugh riot! You douchebag.

    3. Re:I saw it on Wikipedia by Veggiesama · · Score: 1

      Well, I for one welcome our snooty, buzz-killing overlords.

    4. Re:I saw it on Wikipedia by Anonymous Coward · · Score: 0

      For all of you who read the joke and only sighed, mod parent up. Sure, he was a little mean and rude, but you know that it doesn't top the frustration you felt reading a terrible, overused joke.

    5. Re:I saw it on Wikipedia by voltel · · Score: 4, Funny

      Like we're fooled Anonymous Coward! Your just trying to make yourself look good after that epic fail!

    6. Re:I saw it on Wikipedia by Anonymous Coward · · Score: 0

      SAGE

  2. Original research? by coffeepriest · · Score: 2, Interesting

    the article states that the researchers hope to speed up research by doing this, and goes on to say that they're using a computer program to copy the information into Wikipedia... If the only thing they are doing is copying data to Wikipedia, how will this speed up research? It's against Wikipedia's rules to post original research, so I'm assuming this is all they CAN do. While it is neat, I'm not sure I understand how this will speed up new research...

    1. Re:Original research? by Chyeld · · Score: 5, Interesting

      Citation needed? ^_^

      Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

    2. Re:Original research? by omnichad · · Score: 3, Funny

      Well...anyone can post a gene. That means more information, right? I've already made up 50.

    3. Re:Original research? by Dunbal · · Score: 1, Funny

      This is all backwards and wiki should know better. The site will be more popular with less jeans.

      --
      Seven puppies were harmed during the making of this post.
    4. Re:Original research? by ILongForDarkness · · Score: 1
      They can now easy show prior art for patent claims. Thus getting more money, thus paying for more labrats/equipment to get more patents. Ad nausium.

      P.S. I work for a genetic facility :)

      P.P.S. the biggest need IMHO in the industry is a means to get a list of genes that are "similar" to the one that you are working for. It requires a bunch of complex manipulation of the data, I can't see how putting stuff in a simple text based search system will help.

    5. Re:Original research? by philspear · · Score: 5, Interesting

      I could be wrong, but doesn't wiki allow you to submit your research as long as it's been published somewhere you can reference? If you discover a gene, you're going to publish it somewhere you can put on your CV.

      Anyway, this will be pretty redundant. NCBI already has a gene database that is well crosslinked.

      http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene

      As this database is powered by published research and updated by a government sponsored organization, it also cannot easily be vandalized, unlike wiki.

      Lastly, a lot of researchers put information about their favorite gene up on wiki currently.
      Example: reelin. I couldn't help noticing the last time I looked that one of the major contributors was referencing her own (peer-reviewed published) research on reelin.

    6. Re:Original research? by philspear · · Score: 2, Informative

      P.P.S. the biggest need IMHO in the industry is a means to get a list of genes that are "similar" to the one that you are working for.

      That sounds like BLAST, which if you work in genetics you've undoubtedly heard of, so maybe I don't understand what you're talking about?

    7. Re:Original research? by Hatta · · Score: 1

      I have to agree, what NCBI has accomplished with Entrez is pretty amazing. Check out the 'Gene' page for any given gene. Not only do you get the sequence of the gene, transcript, and gene product, but they have literature references, a list of interacting proteins, all sorts of metadata from the Gene Ontology project. If that's not enough, just about any sequence analysis tool out there will accept an NCBI RefSeq ID, making it incredibly easy to use this data any way you want.

      --
      Give me Classic Slashdot or give me death!
    8. Re:Original research? by FooAtWFU · · Score: 1

      Is it going into Wikipedia proper, or is it a separate wiki hosted by the parent organization, the Wikimedia Foundation? I'm betting on the latter. Genes are largely unencyclopedic.

      --
      The World Wide Web is dying. Soon, we shall have only the Internet.
    9. Re:Original research? by Gat0r30y · · Score: 1

      Not to mention that the database you mention comes with a really bad ass set of tools for analyzing and downloading various datasets. Used it for a little project in school (trying to find the start of introns using Renyi entropy, it didn't work). You can get access to the database directly from the command line, or from Matlab. Which makes it much more useful than a wiki.

      --
      Prediction: The real iPhone killer is going to be sex robots from Japan. Think about it.
    10. Re:Original research? by Insightfill · · Score: 4, Funny

      Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

      Should we perhaps call it a gene pool?

    11. Re:Original research? by Achromatic1978 · · Score: 1

      He didn't say he worked in genetics, he said he worked in a genetic facility. I wouldn't expect the janitor to know what BLAST was. ;)

    12. Re:Original research? by Boghog · · Score: 1

      Several of the individual gene/protein articles have already been marked for deletion. For a discussion, see for example this discussion.

    13. Re:Original research? by Anonymous Coward · · Score: 0

      interesting that the person who started that discussion is blocked indefinitely.

    14. Re:Original research? by VanessaE · · Score: 1

      If someone is an expert in their field, and they're not posting something like an ad or promotional material, Wikipedia has guidelines to allow for that material to be added. No one in their right mind would, for example, deny Stephen Hawking adding to a physics article, even one that discusses Hawking Radiation.

    15. Re:Original research? by Chyeld · · Score: 1

      Even more intereseting is how it happened.

    16. Re:Original research? by Chyeld · · Score: 1

      Don't get me wrong, I think Wikipedia does serve a valuable purpose. But I'm sad that the stock knee-jerk joke concerning anything on Wikipedia the project turned out not to be a joke in this case. Seriously, sometimes following back scenes of that site makes me wonder if the inmates aren't running the asylum and getting ready to burn it to the ground.

    17. Re:Original research? by ILongForDarkness · · Score: 1

      Not a janitor an IT guy. We have a separate bioinformatics group which would have a much deeper understanding of BLAST than I, but from what I've seen of it it seems like a really crappy system that has become a standard that everyone is comfortable with and reluctant to give up. For example (may be it is the type of problem I don't know) but I know of groups that run blast queries and it pretty much touches every element in the database. It it was in a properly indexed database a lot of the data presumably would be able to be pruned out before it was actually touched.

  3. GATTA by BadAnalogyGuy · · Score: 3, Funny

    TAGGATTACACCT

    Yo Yo I gots my GAT
    rat a tat tat anotha nigga on his BAAACK

    Steve W sucks cock! lol!!!1

    16:04, 10 July 2008 86.75.30.9 (Talk) (3,808 bytes) (undo vandalism... maybe this shouldn't be a wiki)

    1. Re:GATTA by X0563511 · · Score: 1

      Parent is a statement about vandalism, this isn't a troll post. Read the last line and engage your brain for a few seconds.

      --
      For large sets, this will be our guide even unto death, for the LORD will work for each type of data it is applied to...
  4. I'm picturing.. by idontgno · · Score: 0

    the revert wars between evolutionists and creationists.

    "Ha ha, edit these articles and we can PROVE common ancestry between apes and humans!"

    "WTF, I've been reverted for vandalism!??!"

    --
    Welcome to the Panopticon. Used to be a prison, now it's your home.
  5. What could possibly go wrong? by SirGarlon · · Score: 3, Insightful

    I've seen enough errors, sloppiness, and outright sabotage on Wikipedia to be highly skeptical when, as TFA says,

    The stub articles are expected to seed the posting of more detailed information by Wikipedia users.

    What safeguards will be in place to make sure the information in this Wiki is trustworthy and reliable? Think for a moment about the potential consequences.

    --
    [Sir Garlon] is the marvellest knight that is now living, for he destroyeth many good knights, for he goeth invisible.
    1. Re:What could possibly go wrong? by omnichad · · Score: 1

      Genetic mutation? Wikipedia's got cancer!!!

    2. Re:What could possibly go wrong? by Darkness404 · · Score: 1

      Honestly in all my years of searching Wikipedia, there has been little inaccuracies that I have ever saw. Ignoring a few things that are obvious vandalism (for example, if you can't figure out that an article with "Llama" randomly in it isn't vandalism, then you should go back to first grade). But as for errors, I haven't noticed very many of them, about the only things are some weasel words here and there, but that doesn't change much about the information itself.

      --
      Taxation is legalized theft, no more, no less.
    3. Re:What could possibly go wrong? by Anonymous Coward · · Score: 0

      Depends where you look. For instance, the Mediaeval Warm Period in climatology is a distinct problem for the theory of Anthropic Global Warming.

      Look at the Wiki entry, and you'll find lots of claims that it was not a world-wide phenomenon, though current belief is that it was.

    4. Re:What could possibly go wrong? by jesdynf · · Score: 3, Funny

      Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.

      --
      Yahoo! Pipes are awesome. How awesome? http://pipes.yahoo.com/jesdynf/slashdot
    5. Re:What could possibly go wrong? by peragrin · · Score: 1

      >>Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.

      Intelligent Design. There can be no errors as God is perfect. Therefore your just not smart enough to understand it.

      Laugh as it is the best counter to ID ever.

      --
      i thought once I was found, but it was only a dream.
    6. Re:What could possibly go wrong? by AnonymousRobin · · Score: 1

      Wikipedia has been shown to be at least as reliable as other encyclopedic sources. Why would this be different for genes?

      I think the big fear is that genes are a highly specialized area, and I'd be very scared if a doctor of mine went on Wikipedia to try to cure a fatal genetic disease I had.

      Doctors are pretty bright people, though, and my bet is they'll use it the same way as other bright researchers. They'll use it to discover possibilities, get an overview of something, or find further sources to explore. If they're not bright enough with that, I think you have more to worry about in your researcher/doctor/whatever than "Jane iz cute1!!" being in the middle of a DNA sequence.

    7. Re:What could possibly go wrong? by somersault · · Score: 1

      While I am no longer a Christian, if I were I'd point out that in the bible, God introduced imperfection and suffering into the world after Adam and Eve fell. Damaging the gene structure seems a good way to introduce death and disease..

      As someone who's seen things from both side of the fence - and honestly believed them rather than just tried to understand those who believed them - that doesn't seem a good counter to me. I'd personally first point out more obvious things like the existence of the human appendix and residual human tail structure (actually I just googled it and apparently some humans are still born with actual tails.. eww) as more obvious evidence for pure natural selection over ID.

      --
      which is totally what she said
    8. Re:What could possibly go wrong? by Anonymous Coward · · Score: 0

      +0 Impartial

    9. Re:What could possibly go wrong? by philspear · · Score: 1

      There's the safeguard of "everything remotely relevant when it comes to genes is published and independantly verifyable." At best this will be a quickly searcheable index with a little blurby summary and links to the actual information. If you're wondering what a gene is and if it might possibly be relevant to your research, this might be quicker than doing a pubmed search and finding a 20 page review article detailing everything known about it.

      Of course, you can usually just read the intro or abstract to get that information, but it might be nice to have a more coherent summary page, which wiki is good for.

      Another safeguard is "who is going to want to vandalize the page on EST 3200321?" It's going to be pretty technical by nature. As long as immature researchers don't try to resolve a controversy via wiki vandalism instead of research and logic, there won't be much. If you're going to vandalize something, you're probably going to want do do it on something with a wider audience, like the page on George Bush, not zebrafish fibroblast growth factor 21A.

    10. Re:What could possibly go wrong? by SirGarlon · · Score: 1

      As long as immature researchers don't try to resolve a controversy via wiki vandalism instead of research and logic, there won't be much.

      I think you're underestimating the number of immature (or viciously competitive and unscrupulous) researchers out there.

      If you're going to vandalize something, you're probably going to want do do it on something with a wider audience, like the page on George Bush, not zebrafish fibroblast growth factor 21A.

      Unless you've found a way to make a buck off zebrafish fibroblast growth factor 21A, and you're willing to commit a major ethical breach to sabotage any possible competitors.

      --
      [Sir Garlon] is the marvellest knight that is now living, for he destroyeth many good knights, for he goeth invisible.
    11. Re:What could possibly go wrong? by philspear · · Score: 1

      Not to say that wikigene will always be accurate and there NEVER will be vandalism.

      Of course, this goes for peer-reviewed articles too. According to at least one guy, most of them are wrong.

      http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1182327

      So the potential for incorrect information really is not unique to this thing. Only the Pope claims infallibility, and frankly he's never proven it.

      But will wikigene be completely biological companies lying about their gene of interest and corrupt scientists trying to prove their research? Doubtful.

    12. Re:What could possibly go wrong? by Boghog · · Score: 1

      I've seen enough errors, sloppiness, and outright sabotage on Wikipedia to be highly skeptical.

      Sloppiness certainly, but outright sabotage on highly technical articles is fairly rare.

      What safeguards will be in place to make sure the information in this Wiki is trustworthy and reliable?

      None, except for the conscientious efforts of good samaritan editors.

      Think for a moment about the potential consequences.

      Articles about more important genes are likely to attract a lot of attention. And as RMS once said "Given enough eyeballs, all bugs are shallow".

    13. Re:What could possibly go wrong? by SirGarlon · · Score: 1

      But will wikigene be completely biological companies lying about their gene of interest and corrupt scientists trying to prove their research? Doubtful.

      Agreed. My point is, the risks of open access (fraud, sabotage, bad research) seem pretty significant. People's lives are potentially at stake. Do you really trust the commons that much? I don't.

      --
      [Sir Garlon] is the marvellest knight that is now living, for he destroyeth many good knights, for he goeth invisible.
    14. Re:What could possibly go wrong? by philspear · · Score: 1

      I don't know about lives at stake. It's not like your surgeon is doing on-the-fly sequencing, looking up what genes you have, and making snap decisions based on that.

      Any medical treatment relating to genetics should be based on more than a wiki article or even a single peer-reviewed article in a respected journal. If your doctor is giving you treatment based off of something he read in "Genes and Development" last month, he doesn't have any kind of medical license and he hasn't gotten proper approval to be doing human experiments. Remember that even primary research in peer-reviewed journals is often wrong, you need multiple sources.

      If he's basing his treatment off of anything resembling this service, he really should be in jail.

      Even researchers applying for funds base fundamental points off of more than one article, so vandalism isn't likely to even significantly affect research removed from medicine.

    15. Re:What could possibly go wrong? by SirGarlon · · Score: 1

      Any medical treatment relating to genetics should be based on more than a wiki article or even a single peer-reviewed article in a respected journal.

      Now you're really putting a lot of faith in the biotech industry. ;-) You're definitely right: it should be.

      --
      [Sir Garlon] is the marvellest knight that is now living, for he destroyeth many good knights, for he goeth invisible.
  6. on a more serious note..... by redalertbulb · · Score: 1
    The "long tail" principle doesn't seem to fit this idea, since there are only a small number of experts in any gene, rather than the large number that the authors of the PLOS article seem to think. I also believe curated gene annotation has been tried before with the Genome DataBase (GDB), which has recently folded.

    Nice try guys, but I think this is doomed to fail due to the time pressures that most experts who would be able to contribute to this wiki operate under.

  7. Editing the Human Genome by D+Ninja · · Score: 5, Funny

    Heh. The type of graffiti that will be put on these sites should be good. I can see it now...

    Title: Bill Gates Genome
    ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG

    Title: Linus Torvalds Genome
    ATTATATACGYAYOPENSOURCETAGCCGCGATCG

    Title: Cowboy Neal Genome
    ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT

    1. Re:Editing the Human Genome by Anonymous Coward · · Score: 0

      Of course these aren't legal sequences. But I was surprised that a quick grep through /usr/share/dict/words showed only 7 words having just the letters A,C,T,G: act Acta at cat gag tact tag. Bummer; that limits the possibilities for good jokes in legal DNA sequences. (That was Debian Woody. Maybe a more current one has a better vocabulary?)

    2. Re:Editing the Human Genome by voltel · · Score: 0

      Of course these aren't legal sequences. But I was surprised that a quick grep through /usr/share/dict/words showed only 7 words having just the letters A,C,T,G: act Acta at cat gag tact tag. Bummer; that limits the possibilities for good jokes in legal DNA sequences. (That was Debian Woody. Maybe a more current one has a better vocabulary?)

      Who cares? He made a funny!

    3. Re:Editing the Human Genome by Linker3000 · · Score: 1

      Title: The "Indian Car Company Makes 'All Terrain Armored Transport' Vehicles for Star Wars Fans" genome?

      TATATATAATATATATTATATATAATATATAT

      --
      AT&ROFLMAO
  8. Whose? by pzs · · Score: 1

    Whenever they talk about these human genome projects (including the guys who can sequence it in a matter of weeks) I always wonder whose genome they're talking about. How long before this become a privacy issue?

    1. Re:Whose? by RDW · · Score: 1

      The original public genome project (the 'reference genome you'll find on sites like UCSC's, NCBI's and EnsEMBL) used a mixed pool of DNA from several anonymous individuals for sequencing. The private (Celera) project was also a pool (of 5), though we now know most came from the project leader, Craig Venter. Since then, Venter's 'pure' genome has been published, as has that of (DNA structure co-discoverer) James Watson. There'll be many more genomes in the near future, generated using various 'next generation' sequencing technologies like the one you mention (one group is aiming eventually to do a complete genome 'in minutes for pennies'), and yes, there'll be major privacy issues. Random example - even a very small amount of genetic information derived from the Y-chromosome in a male DNA sample can allow you to make a reasonable guess about the donor's surname if you have a sufficiently large database:

      http://news.bbc.co.uk/1/hi/sci/tech/4736984.stm

      so how private can even an 'anonymous' genome really be? In the longer term, personal privately-sequenced genomes intended for medical or even recreational purposes (genealogy, etc.) rather than publication are likely to become commonplace. Since even an uncompressed diploid genome will easily fit on an 8Gb USB stick or iPod Nano, it can only be a matter of time before someone leaves their entire genetic blueprint lying around on a train...

  9. A similar wiki already exists by swid27 · · Score: 1

    SNPedia has been around since August 2006. It's just for SNPs, not entire genes, and focuses on SNPs used in commercial testing, but the layout of SNPedia and the proposed wiki in the paper are fairly similar.

  10. I am going to build a "Wiki-stein" by peter303 · · Score: 1

    A totally artificial human from the pieces I steal from Gene Wiki. It will be able to tap dance and sing too.

    1. Re:I am going to build a "Wiki-stein" by Anonymous Coward · · Score: 0

      MUDDINONDERIIIII!!!

  11. Oh, no you don't! by Illbay · · Score: 3, Funny

    I just KNOW that every time I post my genetic information up there, some wise-a** leftist is gonna "correct" it to give me more "compassion," "understanding," and "desire to eat foreign cuisine."

    I'll be sitting there in my recliner watching The History Channel's week-long series on "Hitler's Secret Weapons" when I'm seized with an overwhelming desire to change the channel to "Oprah."

    The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!

    --
    Any technology distinguishable from magic is insufficiently advanced.
    1. Re:Oh, no you don't! by dyefade · · Score: 1

      The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!
      Or even want to.

  12. Have Faith by Iamthecheese · · Score: 1

    I, for one, have faith that in the true spirit of wiki, it will be worked, reworked, improved pon, and cross-referenced until it is as good as any reference work.

    I think this project will end up giving more credibility to the wiki way.

    --
    If video games influenced behavior the Pac Man generation would be eating pills and running away from their problems.
  13. What do you want to bet... by dvoecks · · Score: 1

    That when the genome's posted on Wikipedia it'll be pretty easy to find out exactly which gene contains the gene for Wolverine's super healing mutation.

    1. Re:What do you want to bet... by yoinkityboinkity · · Score: 1

      But will you want to deal with the side effects?

      (Kind of like Olean, only better...)

  14. Shouldn't this be on Google? by nutrock69 · · Score: 1

    Am I the only one who thinks this "map" should be on Google maps instead of Wikipedia?

    I for one would love to see a "You Are Here" Google pin in the gene pool...

  15. Link by yoinkityboinkity · · Score: 1

    Link

    In case anybody wanted to look at it on Wikipedia.

  16. Re:first po5t by yoinkityboinkity · · Score: 1

    Hello Markov bot. Would you like to add some coherence please?

  17. wouldn't a semantic database like freebase.com .. by abstrakts · · Score: 0

    be more appropriate? its structured and you can perform programmatic queries against it using MQL via http.

  18. Marked for deletion: Not notable. by Seumas · · Score: 1

    This won't last long. On wikipedia, a very notable personality or topic can be removed with little justification other than "not notable" while every single minor pokemon character gets a full ten page writeup.

    Mark the human genome for deletion due to lack of notability!

  19. And I shall call it... by Taibhsear · · Score: 1

    And I shall call this flexible, organic archive of human genetic information a "cell."

  20. I think this is a good idea by Nomadic_Z · · Score: 1

    This is a good idea on many fronts. One if this is open and collaborative it cannot be instantly monetized. It can perhaps in the way linux can, but still it has the spirit of the open-source community behind it. Two, information sharing is a good thing. If there are twenty separate universities working on this project independently, think of how much productivity loss happens. Instead, when they collaborate and share information in a formal manner, everyone wins. Third, if there is open information sharing, it is a lot more simple to establish guidelines for using and monetizing this information. This is interesting and I think should be followed closely.

  21. Some context by fnielsen · · Score: 1

    The science article where the approach is described in detail is this one: "A Gene Wiki for Community Annotation of Gene Function", http://dx.doi.org/10.1371/journal.pbio.0060175 It has just come out in PLoS Biology, - an open access journal. The researchers/wikipedians have constructed a script called "Protein box bot" that runs on (the real) Wikipedia. It creates images and writes text, for example links to NCBI. The bot can do this both for existing articles, such as this one: http://en.wikipedia.org/wiki/HTR2A, or it can create new articles with a the box, a small summary and references. The "gene wiki" is making an impact on the science part of Wikipedia. I counted the number of outbound scientific citations from Wikipedia, and the new ones that the bot has created are now the majority. The details of this count are here: http://www2.imm.dtu.dk/pubdb/views/publication_details.php?id=5666

  22. Wikipedia? by Anonymous Coward · · Score: 0

    Are Wikipedia really that trustworthy? I don't think so. We'll probably go to retrieve something, only to find that gene wasn't "notable enough", and has had the genes of a Jewish admin edited in...

  23. Wikipedia already has a gene repository... by HeadlessNotAHorseman · · Score: 1

    Wikipedia already hosts a comprehensive gene repository:

    Please ignore this portion of the comment, I am trying to get around the "too few characters per line" filter. Your comment has too few characters per line. Your comment has too few characters per line. Your comment has too few characters per line. Your comment has too few characters per line. Your comment has too few characters per line.

    --
    I like my coffee the way I like my women - roasted and ground up into little tiny pieces.
  24. Is this automated? by MessedRocker · · Score: 1

    If these articles are being automatically posted, they may run in contravention with bot editing rules; see "Wikipedia:Bots".