Slashdot Mirror
Review of Discovery Institute's Evolution Textbook
Darwinned writes "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school. Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning. 'The book doesn't only promote stupidity, it demands it. In every way except its use of the actual term, this is a creationist book, but its authors are expecting that legislators and the courts will be too stupid to notice that, or to remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion.'"
"
remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion
"
Can someone post a reference. I suspect any actual rulings will be somewhat more nuanced than that broad statement.
1 - In The Beginning...
2 - The Great Flood (Where are all the Unicorns?)
3 - Jesus, Dinosaur Wrangler
4 - Darwin, What a Jerk.
5 - The Scientific Method - Hooey or Baloney?
In the US, its not fashionable to know math or science. It's not fashionable to work hard. 'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).
Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else. God forbid we ask these delicate flowers to do more than the minimum.
Prosperity is being taken as a birthright. I half wonder if the outcry against illegal aliens is due to the fact that these people work hard. The complainers may one day be expected to. Can't have that!
Mainly because they don't only want to teach their children this stuff but they want to force public schools to teach every child this stuff. It is a slippery slope. Once they teach "the controversy" what else will they want to tech?
http://www.popularculturegaming.com -- my blog about the culture of videogame players
Please RTFA and understand what this textbook contains. If you really think the word stupidity (or lack of intelligence) doesn't match the description, then science and technology really isn't your thing. Hand in your geek card, Coward.
What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.
As I understand science, it's a cycle: observe, explain, hypothesize, test; and repeat. Evolution as a theory, holds to this cycle. But Intelligent Design is just: observe and explain- the explanation being essentially "God did it." There's not much reason to keep examining things when you feel you've reached that stage, is it? It's an intellectual dead end.
If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like. When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).
are you suggestion that there is any occasion where it is proper to diss the volcano god?
What the hell is wrong with you- do you want to be responsible for the entire town burning down?
don't you care about your neighbors or family at all?
dang- move far away from everyone before you say anything like that again please.
every day http://en.wikipedia.org/wiki/Special:Random
Let the wingnuts in Kansas and other red states teach creationism or any other loony idea they want and let those of us who are in the blue states teach real science and math and critical thinking skills and let's see which population is more successful in our knowledge based economy 10 - 20 years down the road. Let the free market decide, as they say, with one condition. Let's do away with welfare and let the religious nut jobs who aren't interested in teaching science, math and critical thinking reap what they sew.
Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)
Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
(YEC for short)
There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.
Why are we fighting this? It's futile. Let them believe what they will believe, let them teach what they want
If that's the case, why are you posting your own opinion on slashdot? Let the slashdot readers believe what they will believe and let the submitters submit what they want.
You fail to understand that if they do WHATEVER IT TAKES to convince other people of their truth, those converted people will do WHATEVER IT TAKES to convince EVERYONE of their truth. If we don't do anything to stop them, soon it will be 1984 all over the country. And I'd say we're on the edge of seeing that happening.
Sadly in places people defend your ignorant view. As if there's a middle road here. "Teach both", or "there's room for more then one theory".
Evolution is one of the cornerstones for modern biology. You don't want it taught even though it has withstood over 100 years of scrutiny and is incredibly accepted by the scientific community? Why? Because you don't understand it most likely.
I saw a t-shirt the other day that said:
SCIENCE
It Works, Bitches!
I thought it was funny...
"I might have made a tactical error in not going to a physician for 20 years." -- Warren Zevon
In your first paragraph, you are making an a priori assumption that schools which teach ID also teach critical thought. I find that very unlikely, since acceptiong ID requires limited critical thinking abilities.
As per the bias of the reviewer, well that's pretty obvious. I think part of the reason impartial dialog is becoming increasingly scare among evolution proponents is due to the techniques ID proponents have employed. While I agree the entire debate needs to be had at a lower grade level, so that everyone can partake, I don't think the maturity should sink to the same grade level. And I'm certain this last statement appears biased to a pro ID reader.
The main thing that bothers me is the cultural framework this creates of closing science into dogma.
What was that about strawmen? /grin
https://www.accountkiller.com/removal-requested
Darwin's Black Box was shown to be wrong in the Dover trial. Behe's central premise that things are irreducibly complex was proven wrong both with hard scientific data (about the flagella being irreduceably complex, but the bacterial Type III secretory system has a subset of the parts, though they serve a different function) and logically (Behe says a mousetrap is irreducibly complex, but it is useful as a tie clip if you remove two key parts).
The judge in the Dover trial summed it up by saying:
WTF are you talking about? ... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory?
Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism?
For heliocentrism, we have probes and satellites taking nice pictures.
For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA
Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect?
What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection?
And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?
The Slashdot blurb implies that the review shows the book to be "chock full of bad science", yet I didn't get that impression from the review.
The first section of the review dealt with politics, not science.
The second section claimed that the "scientific community" overwhelmingly accepts evolution.
Finally on the second page of the review, the implication is made that it's unscientific to be precise about definitions ("neodarwinianism") since the rest of the community prefers the term "evolution" (which is a VERY plastic term that can mean almost anything depending on who you talk to and what part of the sentence just came out of their mouth).
The next "unscientific" claim the review "refutes" is the idea of common descent. Well, duh! That IS the issue, isn't it? "You don't accept my science therefore your claim is unscientific." Pfft.
Then the review objects to the book's criticizing the views of scientists with whom the reviewer doesn't agree anyway. The reviewer claims that the book is using these examples of molehills to build mountains. Maybe, but is it a "chock-full" of "bad science" to criticize faulty viewpoints?
Then the review seems to find fault with the book for calling attention to real controversies in biology, as if that's playing unfairly.
The review even seems to claim that although we still, after 150 years, have limitations in our fossil record, it's a "bait and switch" to mention therefore that some scientists doubt that the fossil record supports common descent.
The review seems to take offense for the book's claim that Darwin's "Tree of Life" has in recent years come to look more like an orchard of bushes. As I understand the state of the fossil record, the book is more correct on this point than is the reviewer. The review also seems to claim that cladistic trees match molecular trees, which I am quite confident is not the case (read an article on that just the other day - sorry, don't recall the citation).
The review downplays the significance of the Cambrian Explosion, claiming that to look at it the way the book does is faulty. And one of the reviewer's arguments is that the sudden appearance of the bat is offset by the sudden appearance of an earlier bat. What?!
The review takes offense at Behe's "irreducible complexity", claiming that at least three scientific papers have refuted Behe. I'm a little familiar with those claims; those claims don't convince me (particularly since they've not been demonstrated, but merely are "just so" stories that "might" be how it happened).
Don't get me wrong; I'm not saying the book is good, or bad; I don't know; I haven't seen it myself. But I definitely get the impression that this review is more an emotionally-charged response to a challenge to a religiously-held belief system. The battle-cry of "bad science" is just a banner under which the faithful will be expected to gather.
I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum. There are lame attempts and arguments that go along the line of we want to be "balanced", but, frankly, creationism is not accepted science (it doesn't even come close to science). It's great to debate these things (it broadens our minds), but schools should teach fact; not conjecture.
Evolution is not "fact" either (although the accumulated data supports the theory). If another theory comes along that explains the data better, then Darwin's theory will be superseded. This is how science works. Teaching crackpot "theories" in schools doesn't end up making people more objective. I would suggest that it teaches them to be more stupid. Teach critical thinking. Don't teach things that are not falsifiable. It's easy.
It's not a debate it's arguing absurdity.
The Riddle of Epicurus
~~~~~~~~~~~~~
If God is willing to prevent evil, but is not able to
Then He is not omnipotent.
If He is able, but not willing
Then He is malevolent.
If He is both able and willing
Then whence cometh evil?
If He is neither able nor willing
Then why call Him God?
~~~~~~~~~~~~~~
Back on topic, the Discovery institute is dedicated solely to enriching its members, any other claim is nonsense.
A learning experience is one of those things that say, 'You know that thing you just did? Don't do that.' - D. Adams
(pun intended)
i don't think you are going to find much support for this textbook on slashdot
however, what you will find is a lot "hear, hear" and then... nothing. or worse, cynicism
there's a lot of issues in this world where all you can do is whine and bitch and moan, and are otherwise helpless to effect change. this is not one of those issues
ALL of these creationist initiatives are happening on state and local levels. you CAN do something about it if you live in one of these areas
if you do live in an area creationists are making headway, do something about it, please. if for nothing than else than simple civic pride, that the residents of your {state/ town} are not all ignorant buffoons, that some of you actually understand the value of a critical mind, and even more importantly, understand the value of an involved electorate and citizens active for causes they believe in
how is it possible that such idiots can get creationism in our schools? because THEY GET INVOLVED
there are too many voices here on slashdot that will speak loudly about right and wrong, and never actually get involved to make sure their government stands up for that
please, do not feed me the standard psychological lines of learned helplessness that convinces you you can effect no change on this issue or that issue. on creationism, on a state and local level, you CAN do something about this. you SHOULD do something about this. DO IT
if not you, who?
intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
This story from the Seattle-area satire paper The Naked Loon seems relevant: Discovery Institute Takes on Gravity Myth
Do not read this sig.
Ah, but the beauty of YEC is that it really can't be disproven. Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.
This is fundamentally why YEC should not be taught in a science classroom. It is not disprovable and thus not science.
If you mod me Overrated, you are admitting that you have no penis.
I subscribe to the Creation theory.
No, you do not. You subscribe to an unsupported and unsupportable myth, and see nothing wrong with your personal mythology being taught to children as established fact. That makes you not only ignorant, but dangerous. Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.
We'll see how your faith holds up when the lights go out for good. Civilization is fragile. Believe it.
The higher the technology, the sharper that two-edged sword.
Years ago when Georgia was going through the ID vs Evolution in school issue I saw the national media on site at a high school ask a local student his thoughts. He responded that he wanted ID taught because he knew evolution was full of holes and he could disprove it himself.
Well step up young man and claim your Nobel prize that's waiting you.
Where did he get his (mis)information from? It's not the local drug dealers. It's not the science classes. It's not video games.
It's the churches.
There are many churches that deal in lies to peddle their agenda of pushing evolution out of the classroom. It's not a conspiracy theory it's a fact of life in this country.
If man came from monkeys why are there still monkeys? People ask that because they've been told that. They've been told that is a hole in evolutionary theory so they parrot it. They aren't told that at the drive through line at McDonalds. They are only told that type of information in religious circles.
I used to argue with Answers in Genesis for years. It was like pulling teeth trying to get them to remove content that was completely non-factual or completely taken out of context. Letter after letter would be sent with references to the correct information, but it would take months or years (or sometimes never) to get them to correct their website. Even though they updated their site regularly. There was no incentive for them to provide correct information because incorrect information is the only way they could build their case against evolution.
The fact that some Christians can't reconcile their religion with a very well grounded theory that has withstood the rigors of science for over 100 years isn't my problem.
Regardless of those two examples, the entire concept of irreducible complexity is complete bullshit.
Evolution does not simply add parts. It also removes them. And indeed there is a great incentive for this to happen, as every unnecessary part is an added metabolic cost to the organism which contains it.
So let's say for a moment that some structure was discovered that were irreducibly complex. Does that disprove evolution? Absolutely not! It just means that the structure evolved from something more complex, not less.
If you mod me Overrated, you are admitting that you have no penis.
That would be very convenient for the creationists, because YEC is disappearing these days. The creationists have learned that if they make definite scientific statements (e.g, that the Earth is 6000 years old), they risk being proved wrong by scientific evidence. Instead, they've learned to say vague, fuzzy things about intelligent design, while avoiding making testable statements about facts.
Right, and those people aren't creationists. The wikipedia article gives a good definition of creationism: "Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities, whose existence is presupposed.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution.[2]" In other words, the commonly accepted definition of creationism is that it's in contradistinction to evolution, so the people you're describing, who accept evolution, aren't creationists. "Creationism" is just one of those words that doesn't mean exactly what you'd think it meant based on its etymology. For comparison, "communism" doesn't mean belief that people should live in communes, and a "Republican" in the US isn't defined as someone who's happy that our form of government is a republic.
Find free books.
When I'm a decade or two older, the young people who will be affected by these decisions today will just be entering the workforce, bringing their bright new ideas into focus, and beginning to drive the next round of scientific and technological advances.
I do not want these people to believe that one of the most successful, important, and useful scientific theories in history is a lie. I do not want these people to believe that "God did it" is any kind of reasonable scientific answer. I don't want the doctors and medical researchers who determine the length and quality of my old age to be spouting off about "irreducible complexity" and other such nonsense.
You're wrong about losing the battle. Here we are conversing on a globe-spanning information network using unimaginably powerful computing machines. We've always won, and we'll keep on winning, because in the end we're right and they're wrong. But it won't be thanks to people like you.
If you mod me Overrated, you are admitting that you have no penis.
Your ideas are intriguing to me and I wish to subscribe to your newsletter.
You can imply that there is bias all you want, but there is one very big difference between the two. The biologist has studied biology, the scientific process involved in researching the subject and is able to make an evidenced based critique of an ID argument.
Rebuttals from the ID camp contain no such expertise or references, and are usually based on long refuted arguments against evolution, but little or nothing that truly supports ID.
This isn't a case where he-said she-said attempts to discredit both sides will work. One side clearly has evidence on their side, and the other does not.
Shop Smart, Shop S-mart!
Since you seem like a friendly fellow I'll save you a little money. Every issue of the newsletter just contains the same two words, in large type on the front page, and nothing else.
If you mod me Overrated, you are admitting that you have no penis.
In my opinion, schools need to have a separate course on Culture. It should teach about different races and religious beliefs. Intelligent design should certainly be taught there, so that people understand and respect one another's beliefs. Currently, for every idiot who opposes evolution, there's another idiot who is unaccepting of religious beliefs. There are a lot of people who believe in a combination of evolution and intelligent design (myself included), and while the intelligent design aspect is in no way science, it is education.
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.
But by that definition, facts are rare. Damned rare. More like nonexistent.
There's lots of stuff we call evidence. But that is subject to experimental error, lack of precision, unintentional (or intentional) bias and numerous other effects. Once sufficient evidence has been collected, and is found to be reasonably reliable, it either supports or refutes hypotheses. Those that it supports become theories.
But someone out there is always building a larger accelerator, capable of collecting ever more difficult to observe evidence. Some of that evidence may result in the modification, or in extreme cases, the refutation of existing theories. But I can't think of anything that science has stated, "This is a fact. Nothing more to see here. Move along now."
Have gnu, will travel.
"... as evidenced by recent legislation mandating that it be taught in school. ..."
And I said "WHAT?"
So I clicked on the link... and it says "The US state of Louisiana has passed the 'Science Education Act,' a piece of legislation that could allow Intelligent design to be taught in schools."
And this is why we will never get anywhere trying to intelligently discuss anything; either about education, politics, any contentious issue... because I honestly believe that this is how "ScuttleMonkey" sees it; when people disagree with something, they paint it as the most extreme, worst exaggeration... it's not that I agree with it, this book, or ID, it's that people become blinded when they get "religious" about a topic (no pun intended).
Stupid sexy Flanders.
And while we're at it, can we stop giving:
^ These idiots a veneer of respect by treating them as if they're rational? They AREN'T. They are functional (but nevertheless, crazy as a shithouse rat) religious zealots who do not respect science unless it serves their beliefs (see also: nuclear power, IC engine, medicine, etc.).
Evolution in the broadest sense means change, it doesn't imply directionality in biology and it doesn't in a more general use of the word. Saying something is evolving backwards is like saying something is "changing backwards."
If a parent species of birds were to give rise to a new species of birds that were dumber, smaller, uglier, and/or shorter-lived, that wouldn't be de-evolution or evolving backwards, that would still be evolution.
Use your terms properly! What you mean is that you don't think you like what america is "evolving" into.
From the summary:
It's only a hot topic here in the United States. In the rest of the civilized world, ID is dismissed as the nonsense it is.
This ain't rocket surgery.
I'm not sure how best to explain it so I'll try with a simple example.
Let's say the structure you're trying to evolve can be represented as ABC. The letters are different parts. Together, ABC performs some useful function. Maybe it senses light, or moves the organism, or converts energy. Doesn't matter.
Now imagine that AB and BC are both useless constructs. The stance of the IDers is that ABC would have to evolve from constituent parts, by starting with one letter and adding more until ABC is achieved. But, they claim, since both AB and BC are useless, they would never evolve, and so ABC could never come to be. Therefore, the existence of ABC in an organism is, essentially, proof that God Did It.
However, imagine if C is some sort of useful construct all by itself. The actual function of C could be completely different from the function of ABC, it just has to be useful in some fashion. Then we add D, another part which is not part of ABC, to form CD. Imagine that CD is also useful in some manner, potentially related to C, potentially not. Then B is added which gives it more of a useful function, so organisms have the useful construct BCD. Then A is added to give the final functionality in the more complex form of ABCD. Then D, being redundant, is eventually dropped from the organism. Therefore you have evolved the useful and "irreducibly complex" construct ABC from parts.
If you mod me Overrated, you are admitting that you have no penis.
Horse shit. Evolution is a provable scientific theory. Show me one other religion that meets that standard, please.
This ain't rocket surgery.
We evolved in a world where it took about 20 hours/week to get everything we needed. People that bent their head down over a big leaf scratching symbols for very long got eaten by lions.
Pretty much, we're evolved to be beach bums, and all this 60 hour weeks doing the same thing in the same place all day long is a mental illness we only lapsed into in the last 10,000 years, a bare millesecond in evolutionary time.
I blame it on the women, myself - she kept complaining about the skin hut falling down until finally he got p'o'd and went figured out how to build with wood and stone just to get some peace.
But then he couldn't move the hut anymore, and he had to start planting grasses and tubers around the hut for food. Then his buddy's wife made him build a stone hut next door, then her friends got on their men, and pretty soon you had a town, and that was the end of the good old days...its been little pink houses ever since.
When the country falls into chaos, politicians talk about 'patriotism'. Lao-Tzu
They are functional (but nevertheless, crazy as a shithouse rat) religious zealots
I think it's worth pointing out - particularly to people in the US - that the Muslim countries of the Middle East led the world in science and technology, once. Why do you think so many stars have Arabic names? Why do so many words in science have Arabic roots? Think carefully...
Now think about what happened when they let the conservative religious crazies take control.
Just sayin'
Serbs with their hateful xtian idealogy
You're wrong here, it was Catholic Croats collaborating with NAZIs who persecuted Orthodox Serbians. More recently the Albanians, especially the KLA, Kosovo Liberation Army, were persecuting Serbians and others. And the KLA deals in opium with an idea of a Greater Albania.
It's not just Serbians who are instigating violence.
Falcon
Should there be a Law?
Parent is the most insightful comment in a long time.
That's *exactly* what happens now.
But never forget that psychology defines religion as a kind of (mild or bad) schizophrenia. And indeed, if you compare them both, it fits nicely. :\
So the country needs a therapy. As a whole. Unfortunately psychological therapies are still not very effective.
But I learned, that a raise in intelligence often helps people to solve their problems themselves. So my money's on education. (And I'm not talking about the outdated way you know from school. I'm talking about modern methods and more social and emotional education in addition to logic an motor skills.)
Any sufficiently advanced intelligence is indistinguishable from stupidity.
The reason they don't teach what you say is because it is false. It simply isn't true that evolution is "a broken, flailing ship being tossed from its course every five years" or that evolution is popular because it appeals to atheists. You have to know something about evolutionary biology to understand why the former is false, but to see that the latter is false you need only realize that there are far fewer atheists than people who accept evolution and that many non-atheists, including most Jews, Catholics, and mainline Protestants, accept evolution.
Incidentally, it is quite possible to believe in god without believing in the literal truth of Genesis. Numerous people outside the Judaeo-Christian tradition do. And on the other hand, evolution is hardly necessary to discredit literal belief in Genesis. Genesis isn't even internally consistent.
Or that, chemically and mathematically, life on Earth only has a 1:1,200,000,000,000,000,000 chance of happening the way evolutionists predict?
Wow!!!
There are probably more than that number of planetary systems in the universe, so there's better than a 1:1 chance of life existing by biochemical and mathematical chance.
I think your number is exagerated, or you pulled it out of your ass, but if it's accurate, you just proved that it's LIKELY that life would evolve from nothing somewhere in the universe.
Thanks for doing the hard part... :-)
Umm, the linked article says nothing about ID being mandated, it talks about legislation that would allow schools to teach it, not require them to do so. It's dumb legislation, but attacking intellectual dishonesty with more intellectual dishonesty doesn't really help your case.
Don't blame me; I'm never given mod points.
All the YEC apologists I've encountered believe in a deity who is incapable of deception. Their deity didn't make the world appear old even though it was young, they believe the earth IS young and all the science we rely upon is flawed.
The Pastafarians are the ones who claim the earth is young, but the FSM made it appear old.
Learn something new.
So: consider the arch bridge.
An arch bridge is held up by internal pressure. Remove any part of the arch bridge and the whole thing falls into the river. An arch bridge is irreducibly complex, by the creationists' definition. It works as a whole, or not at all; take any part away and it collapses.
Does that mean, then, that all the arch bridges in the world were assembled all at once? Shipped pre-fab to the site and installed as a whole?
Not at all! When we build such things, we use scaffolding. We first build a huge, clumsy, inefficient structure, a grid of poles and joints. This structure is flimsy, it cannot bear very great weight, nor carry much traffic - but it does span the river, it is indeed a bridge. And it can be built up piece by piece - it will stand up even if the span is not complete. Then we work on the arch bridge itself. We build up stone alongside our scaffolding. The scaffolding holds up the stone and the stone braces the scaffolding. Each new stone added strengthens the whole structure.
And there comes a day when the arch bridge is completed. Now we find that the whole scaffolding structure is redundant - it can be done away with. That leaves only the arch. The irreducibly complex arch.
The same could easily go for living things. Evolution can take away as well as add, and if some older structure has been made redundant by a newer development that grew from it, then that structure can surely be done away with. Behe's notion of irreducible complexity would only be a problem if evolutionary theory only allowed for organisms to become more complex over time - but if an organism is already complex, and it happens to benefit that species to become simpler, then it will do so. And it might well arrive at an 'irreducibly complex' structure from above.
It's all a hangover of the old idea of a 'great chain of being'. It's a common misconception: men are more advanced than apes, which are more advanced than dogs, which are more advanced than... you get the picture. This is the kind of thinking where the X-Men are the 'next stage' of evolution. Evolution doesn't work that way. There's no great plan, no distant goal, no inevitable increase of sophistication. Evolution does whatever works, and if that means eliminating redundancies, refactoring, and going ahead with a simpler design, then so be it.
Real Daleks don't climb stairs - they level the building.
I've met many creationists who, for example, thought that fossils were put there because of the flood and they just happen to line up in what appears to be a historical record because God is testing their faith.
If you mod me Overrated, you are admitting that you have no penis.
Um, yes it does. There is no detectible difference between the Earth being created billions of years ago out of the coalescing gas cloud surrounding the young Sun, and the Earth being created six thousand years ago in the exact state it would have been if it had been created billions of years ago out of the coalescing gas cloud surrounding the young Sun.
If you mod me Overrated, you are admitting that you have no penis.
I want someone to hit the nail on the head with creationisms, but no one seems to ever do that online so I'll give it my best shot.
/. of armchair intellectuals decrying the ignorance of the bible belt hicks, while smugly reassuring each other that they have the "best" ideology. It is through an understanding of their actions and why they do them and coming to terms with them. Calling their text book stupid isn't going to get them to stop. I don't know what the solution is, but I know what it isn't.
Evolution in no way denounces god. Even the Catholic church says the view science has on the universe and evolution are compatible with their faith: http://rellavent.blogspot.com/2008/09/catholic-church-acknowledges-evolution.html And it's pretty easy to reconcile the two: universe created in a big explosion that created light, land and heaven coalescing into stellar bodies, water and land separating as it cools, life slowly taking to the land, and man ultimately being removed from the bliss of the primordial garden by eating the fruit of knowledge. It's god, if evolution happened without his help at all, he set up the universe knowing full well what it would do. ID in the 6k year old vein makes no sense and actually is insulting to the power of god.
This brings up the problem of the creationists. Science as it is written, is not in that strong of a conflict with the bible as it is written, so why do they continue to push it?
we know the symptoms: text books, politicians, online spaming, but what causes the disease? Or to frame it in a more humanistic perspective: what do they gain by perusing their agenda? This should be the prime argument in creationism, not the symptomatic treatment that has been prevalent.
My theory is that creationism is viewed as being linked to a value system that creationists view as being under attack from secular radicals, and evolution is taken as a battle field to fight against this because Evolution is pretty removed from their day to day lives, if they chose to believe fantasy on it they wont hurt them selves like they would if they choose to believe fantasy about refrigeration. Basically they are picking ID as the place to make their stand to defend their way of life.
That brings up the other point, why do they feel their way of life is in danger? It could be politicians playing it up for votes, it could be changing social economics beyond anyones control, it could be pure paranoia, and it could be that people in the cities and scientific community actually attack them. I think its a combination of all those factors, but i also think one of the largest factors is the fact that Secular atheists do actively attack the religious beliefs of others.
I know this from having been to several meetings. The atheist community is one of the most bitter and spiteful I have ever seen and actively wish to see all "non-rational" belief systems torn down and replaced with their "belief" system on a level that matches any religion. Pure tribalism at its best, two sets of group-think throwing stones at each other. the Atheists attack christen beliefs and they attack the atheists through ID.
The solution to the problem is not the one shown on
> Now think about what happened when they let the conservative religious crazies take control.
Methinks history betrays you.
The Wahabbi extremists (Islamic versions of the US fundamentalist extremists) came to power with ibn Saud, in the 18th century.
Economic power (and scientific luminance) seeped away from the Caliphates and kingdoms of the Levant when the sea routes were broken open, most notably and astoundingly at Lepanto.
There followed a long decline. Wars, on and off, with the crusaders of Europe raiding into the Middle East. Various rulers of Arabic and Persian and Turkish dynasties competing for domination of the Islamic world. A gradual eclipse as the nations of Europe set about building their empires. And finally irrelevance, a culture respected only insofar as it provides crude oil to its betters. Small wonder that a civilisation brought so low from such a glorious past turns to its god for answers, and finds dark counsels.
Real Daleks don't climb stairs - they level the building.
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.
If something cannot be questioned, then it does not belong in a science laboratory, it belongs in pulpit in a church. The concept of QUESTIONING is what gives science its bad ass record.
The luminiferous ether was widely regarded as the only way for light to behave the way it did. Light was a wave, and that explained the double slit experiment.
Then a few jerks were just messing around and bang, the ether is GONE. The discovery was so important, it got one of those jerks a Nobel Prize. When somebody says they have an idea that's totally irrefutable, their idea isn't science. Even various aspects of evolution are able to be falsified, for example, if a fossilized cat were found in the Jurassic period, then that would throw common decent right out the window. It's doubtful for that to happen, considering the mountains of evidence that support common decent, but it's never going to be an unquestioned fact. An absolute fact would require absolute proof, and the only tool that provides absolute proof is mathematics.
Learn something new.
For those of you that missed it and still might think that Behe has some semblance of a reasonable argument, let me tell you what just happened in Free The Coward's post: We saw that a ten line post on Slashdot, likely written off the cuff without any planning, is all it takes to rigorously and quite comprehensibly debunk the evolutionary fallacy that Behe's entire argument against evolution hinges on.
I'll at least give Behe credit for filling his book with a lot of irrelevant detail that makes it seem like he's proving something.
In fact, of course, the bridge is the remainder of a larger, still more complex system of bridge plus scaffolding, most of which has been removed as being redundant.
The same goes for the supposed 'irreducibly complex' structures put about by creationists. They argue that the removal of any part of such structures would cause the whole to fail completely. Perhaps they're even right. But the discussion of the arch bridge shows that it's possible to arrive at such a structure by subtraction, rather than by addition: the 'irreducible' structure exists as a relic of a more complex, less efficient system, hacked together ad hoc, which did the job poorly but nonetheless did it - and which was then gradually optimised until it achieves the engineer's perfection, when there is nothing left to take away.
Real Daleks don't climb stairs - they level the building.
Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.
Whoa there !
We don't "know" anything of the sort. That is why we call it "The Dark Ages". It may disappoint you to learn that if it wasn't for the church, there would be no written records of most of our history before that. And by "our" I mean, in the west. I don't think they had a "Dark Ages" in India or China, so there goes your "human race" argument too. Where do you think all that knowledge of the past came from ?
And religion wasn't responsible for the breakdown of society either. It just so happened that the Romans went home. No-one else invaded for a while, so we all just did our thing. The Romans were the ones with all the inventions and organisation. No one else really saw the need. If you really look with open eyes, you'll find that religion has been the number 1 educator for almost all human history. They were the geeks of their time. If you needed an answer you went to the monastery and they gave you what knowledge they had. Of course it was religious, they're monks ! But they kept written accounts, learned mathematics, studied the skies. It's only in the last maybe 200 years that the masses were deemed worthy of reading and writing, and it's only really the last 100 years that anybody actually had the right to go to school.
No, I'm not religious. But science is about facts, not FUD.
"Oh yeah? Not even the theory of gravity?"
Nope it was tossed out once already. Newtons "laws" of gravity failed to predict the orbit of Mercury.
"Or the theory of heliocentrism?"
Not a theory. Been proven by observation. BTW you know that that first version had the Sun at the center of the Universe.
"And quantum theory? Way wacky, as theories goes/"
Why do you think we have places like CERN? Yes Quantum theory is very useful but there is a good chance it will go the way of Newtonian physics as well. It fails to work for gravity much like Newtons laws failed for the Orbit of Mercury.
But just as Newtons laws are good enough for many things so is quantum physics. But it is an incomplete theory but it is the best framework that we have. It isn't a fact because it is still being refined.
People need to stop worshiping science "and patting themselves on the back for doing so" and actually learn it.
See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
Although, as you say, such beliefs are not "disprovable", they do open up the realm for an infinite possibility of counter-beliefs, none of which are disprovable, and certainly unchallengeable should the ID/YEC believer insist his initial assumption be considered or believed.
For instance, I could say back to him, "Erm, no, actually *my* god created the Earth just last week. All your memories are false, and I have here a book which declares, above all, that you're a fucking idiot, and you can't disprove me because any evidence you might think you have found to the contrary has been put there in order to make this existence seem real."
Et cetera.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
"Therefore, the seeker after the truth is not one who studies the writings of the ancients and, following his natural disposition, puts his trust in them, but rather the one who suspects his faith in them and questions what he gathers from them, the one who submits to argument and demonstration, and not to the sayings of a human being whose nature is fraught with all kinds of imperfection and deficiency. Thus the duty of the man who investigates the writings of scientists, if learning the truth is his goal, is to make himself an enemy of all that he reads, and, applying his mind to the core and margins of its content, attack it from every side. He should also suspect himself as he performs his critical examination of it, so that he may avoid falling into either prejudice or leniency."--Ibn al-Haytham
http://en.wikipedia.org/wiki/Ibn_al-haytham
This is what too few human beings do, they always trust in what they have been taught... when much of what they know is fraught with error. I am weary of anything I say as well as anything any other man says, that cannot be demonstrated. Therefore, I only defend what can be demonstrated.
The majority of people do not take the above view, they are overconfident in what they think they know when they hardly know anything at all.
Science as it is written, is not in that strong of a conflict with the bible as it is written
Perhaps not if you don't take the bible literally. But many do. And science is, and let's not mince words here, absolutely and completely at odds with the bible as it is written, should it be interpreted as literal text.
Now, I've never understood anybody who said they believed in the bible but didn't take it literally. What. The. Fuck.
OK, how about: "I believe in The Complete Works Of Shakespeare, but I don't take it as a literal historical document." Say what now? What does "believe in" *mean* then?!
Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.
And just to be clear, attributing unknown or unexplained things to god is *never* a reasonable theory because that logic requires the concept of god in the first place, which (if you spend any amount of time thinking about it) you should know is circular reasoning and therefore crap. One of the fundamentals of the scientific method is never to search only for facts to fit a theory, but rather to constantly revise the theory to fit the facts. This precludes the possibility of the concept of "god" to ever factor in to any scientific theory because there was never any direct evidence to cause the scientist to develop the concept and theory of a god.
Personally, I find religion deeply offensive, in the same way I find littering, racism, homeopathy, and liars offensive. If anybody is going to be doing any of that on my lawn, I'm going to yell at them.
Now, I know exactly the tribal mentality you mention, but that is human nature and humanity will always have a Complete Dick contingent. However, I certianly do not need smug reassurance from anybody else whose beliefs line up with mine. My smug reassurance comes from ascribing to verifiable truth, which stands on a mountain of evidence, and holds its own.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
is that they readily embrace other conclusions of science. Fundamentalist Christian's happily drive SUV's, talk on cell phones and take prescription medicine. They have no problem with the technologies and science that provide refined oil, vulcanized rubber, plastics, satellite communications, data encoding in radio waves, etc. They also implicitly agree with theories on blood-born pathogens, vaccines and antibiotics. But, when science turns its gaze to the age of the earth, the fossil record or the origins of the human genome, they suddenly have problems with the method or its conclusions. Except for possible exceptions like the Amish, it smacks of hypocrisy. Physics and chemistry are OK while genetics, astronomy and geology (oil good, dinosaurs bad) are suspect? If you want to live by revealed as opposed to discovered truth (remember Galileo?), perhaps rejecting more of the fruits of science is your spiritual path, are they not, after all, tools of the devil? I have no problem with spiritual beliefs, but 4000 year-old myths on the origin of the world really needn't be taken literally.
slashdot now has over one and a quarter million subscribers, probably 5-10 times that many readers.
Do you honestly think only geeks frequent this site anymore?
Do you honestly think this site is not a major target for astroturfers?
Over the past half decade, I've noticed a MUCH heavier proportion of blatant MAFIAA propaganda and utterly fallacious reaganomic sophistry modded to +5. I don't believe those posts, or the modding, traces back to legitimately individual users, and certainly not geeks.
VLC FOR MAC IS DYING! IF YOU DEVELOP, PLEASE SAVE IT!!
It is falsifiable, which is to say that if it were false then it could be shown to be false. Since it's not false then it can't be shown false, but that doesn't change the fact that it's falsifiable. If light moved at a different speed then a simple experiment to show that different speed would falsify it.
Contrast this to creationism. No matter what test you conduct and what results you receive, "God did it" is always a working refutation. Thus it's not falsifiable.
If you mod me Overrated, you are admitting that you have no penis.
Evolution vs Intelligent Design
Darwin vs Darfail, basically, yeah?
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
if people really want to be so dense that they make up bullshit like that i say we just have fun with them....
If you mod me down, I will become more powerful than you can imagine....
Under attack?
Pro-choice people don't force abortions on other people who are against abortions.
Pro-alcohol people don't force muslims and mormons to drink the stuff.
Pro-stem cell research people don't require you to have your DNA fixed.
Would-be parents with a serious inheritable disease don't force other people to have their embryo/egg tested.
Pro sex toy people don't want to force the use of the toys on other people who think sex is sin.
Gay people don't want to force you to have sex with a same sex person.
Nobody is trying to force christians to have premarital sex.
Nobody is trying to force catholics to use birth control.
Atheists are not trying to bully other peoples' children into saying out loud brainwashing slogans such as "one nation, god is imaginary" five times a week. (You are free to do your brainwashing at home.)
Atheists are not trying to get their "ten reasons" plaques displayed in courtrooms.
Now, who is under attack and what bad things were atheists doing? Calling theists who wreck other peoples lives something you don't want to hear? How does that compare to the above list?
Xtians are skilled at turning the oppressing majority into the underdog. If theists only had confidence in their deity that it is indeed almighty, then people could be free. The theists would be confident that their deity would get back at the "sinners" later.
Bert
Freedom means free to do something without harming someone else. Now, in view of the above, try to explain "home of the free" to me.
You just quoted Wikipedia to make your point.
GP did qualify his citation with the phrase "The wikipedia article gives a good definition of creationism," not "The wikipedia article backs me up, therefore I'm right." No implication was made that the source was otherwise reliable. (Heck, you could quote Conservapedia if it gave a good definition ... though it doesn't.)
Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.
If Christianity promotes a belief that is at odds with provable fact, then you're right, but the argument of young-earth Creationists is that macro-evolution and a billions-of-years-old universe is NOT provable fact. This is where you have a conflict, not in the logical conclusions that follow.
I believe your view of the scientific method to be flawed. The existence of God clearly falls completely outside the realm of empirical science. This doesn't make God false, it makes God untestable. Science only deals with the natural, which doesn't mean that the supernatural cannot exist. The scientific method does not require that you begin with a disbelief in God; indeed, many well-known scientists including Kepler, Galileo, Pasteur and Newton put God at the center of their scientific work. These men endeavored to better know the Creator through the better understanding of His Creation. Would you call their work unscientific?
Personally, I find religion deeply offensive, in the same way I find littering, racism, homeopathy, and liars offensive. If anybody is going to be doing any of that on my lawn, I'm going to yell at them.
I find that most people who are offended by religion in general (as opposed to being offended by some specific aspect of a particular religion) completely misunderstand what religion is.
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
An interesting theory I read is that part of the decline was due to economics. In the Middle Ages, Europe ran on feudalism, which granted individuals permanent rule over an area, which they could also pass on to their descendants. In the Arab world instead terms of power were granted, such as for three or five years.
This meant that European nobles had at least some incentive to invest in long-term projects in their territories, while in the Middle East the incentive was skewed towards short-term profit. Therefore, while the Middle East had a head start while Europe was busy clawing itself from barbarism, over time the situation reversed, and by the time of the Renaissance the Middle East was stagnating.
" There is a rational explanation for everything. There is also an irrational one. "
As an ex-christian I'll help interpret for you. Since I understand both sides of the fence.
1) Your belief system is comforting. The more conservative I was the more certain I was and the more certain I was the happier and more comforted I felt.
2) Denying God is real means it's all in your head and you shouldn't actually be confident in what you 'know'.
3) If you can't be confident in what you know then you can't be certain and if you can't be certain then you aren't comforted. Your amazingly incredibly blissfully wonderfully happy land grows dark and is replaced with the cold uncaring uncertainty of doubt.
4) So when you attack a christian's faith what you're actually doing is robbing them of that beautiful all enveloping right-hemisphere of the brain oneness with God. Which is incredibly painful.
It's like stealing a junkie's needle. It's going to be very traumatic. Much more traumatic than if you for instance told them that ketchup sucks and it's silly that they like it. Unless they get some sort of bizzare high from ketchup.
I don't believe in any god. But its the opposite to the "not believing is a sin" the "believing is ignorant" that I was trying to get at as causing the uping of the ID stuff. I went to some atheist meetings and all they talked about was how ignorant christens were. which is different then what I thought they would talk about, maybe humanism and how you don't need divinity to have a moral society, you know MTOB, not worrying what the christens were doing.
Atheists have meetings? Great. I already have to go to meetings for all the drugs I don't do anymore, now I have to go to meetings for all the things I don't believe in anymore.
Now, I'm an atheist - but I think you need to look up the word 'metaphor'.
'The government is forcing Christian pharmacists to dispense drugs that are abortifacient, thus forcing them to be morally complicit in the termination of an unborn life. Christian doctors who wish to practice obstetrics are forced to learn how to perform abortions.'
Perhaps your government is more to blame for providing insufficient information before these people started their studies. I'm very sorry to hear that they cannot find another job.
'Schools are teaching birth control in such a way as to all but force it upon teenagers -- at least in my school, we were taught that everyone should use birth control and that natural methods were not methods at all.'
Generally society bears the brunt if horny teenagers, some of whom may not have learned that it is OK to say no, get pregnant. I believe there is no law in Germany that forbids parents to tell their kids a thing or two.
'For that matter, the Nazis (sorry for the Godwin's Law thing) didn't force non-military personnell to murder Jews, so I suppose that was alright.'
As an example of a non-sequitur perhaps? I don't get it. My basic point is that religions (or more generally anyone) should leave other people (including those of other religions) free to do what they want, as long as they don't harm someone. Killing Jews should not be a pass-time.
'Remember that most Christians believe that abortion is the murder of an innocent human being.'
Don't worry. Yagolah must positively hate those pre-born human beings. Next time you visit the ladies room and see the trash can for sanitary towels, put some flowers next to it and pray. If it is there for a while and the ladies room is visited fairly frequently, there is a large likelihood that at some point in time it contained your beloved 46 chromosome entity. A very large portion of fertilized eggs never make it to the full 9 month development period. Abortions barely increase the number. Of the 3 women I have data for: One with 3 kids and 1 miscarriage (I know of). One with 3 kids and 3 miscarriages (just a hormone thing. When the doctor gave her suppositories against the violent morning sickness causing the rejection the kids kept coming. Apparently yagolah liked the doctor's action. Or allowed the doctor to compensate for the birth control pills he had prescribed in his carrier. And the last woman I know of has 2 kids and one miscarriage. Oh the humanity! And I couldn't count the times they just missed a period, because I'm not privy to that.
'If embryonic testing is used to promote abortion ("I'm sorry Ms. Smith, your child has Down Syndrome. When can we schedule the abortion?"), then this also comes here.'
The doctor would be an asshole and probably face the medical profession's court. The nice thing about abortion is that every child being born is a wanted child, warts and all. Parents' decision. No interference from third parties, whether they are doctors or theists.
'Against gay marriage, yes, there is a movement, but you didn't mention that one in your litany above.'
Thanks for bringing it up. Another one for my "litany" then. Nobody is forcing churches that gay people can marry in front of their god, in their religious building or according to their religious rules. There is a difference between a marriage before the law and for the church. There is no reason why gay people cannot have the first one. It is an arrangement that gives security (and some obligations) to the marital partners, e.g. in case of pensions, in case of the custody in case there is off-spring involved, and if one of the partners dies. There is no reason why these regulations cannot be open for gay people. But in most countries theists have still hijacked the whole concept of marriage, conveniently ignoring the difference between a marriage before the law and before the church, even though that goes in their country as well.
Bert
Not forcing -- oh really?
You probably haven't seen this news article -- but we all knew it was coming!
The proponents of the progressive agenda are finally showing their hand... Be afraid! Be very afraid!
I believe your comment was a longwinded way of saying "it's all metaphor".
So, if the bible is all metaphor, what does god stand for?
Let me push this a bit further.
If you told me, "I just counted about 68 dogs and at least 93 cats raining out of the sky over the course of sixty seconds", I would know you're not just using a figure of speech, and I would probably be able to disprove it. The same is true for the bible, which states many, many, many things as factual. And even if you ignored ALL of that, simply accepting certain concepts presented in the bible, metaphor or not, would place you quite squarely in the realm of falseness.
It is simply illogical to state that you believe in the bible, because it is utterly impossible. You can say you enjoy the bible, or you learn from the bible, or any of those things, but stating belief in it is as ridiculous as stating belief in any other provably incorrect account of a set of events, or any other work of fiction.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson