Slashdot Mirror


Review of Discovery Institute's Evolution Textbook

Darwinned writes "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school. Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning. 'The book doesn't only promote stupidity, it demands it. In every way except its use of the actual term, this is a creationist book, but its authors are expecting that legislators and the courts will be too stupid to notice that, or to remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion.'"

621 of 756 comments (clear)

  1. SCOTUS reference anybody? by jdogalt · · Score: 3, Insightful

    "
      remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion
    "

    Can someone post a reference. I suspect any actual rulings will be somewhat more nuanced than that broad statement.

    1. Re:SCOTUS reference anybody? by jandrese · · Score: 5, Informative

      The grandparent was probably referring to Edwards v. Aguillard.

      --

      I read the internet for the articles.
    2. Re:SCOTUS reference anybody? by Anonymous Coward · · Score: 1, Insightful

      No scotus reference will support this broad claim. As a practical matter, though, most cases indicate that teaching creationism in science classes in public k-12 schools may be an unconstitutional endorsement of religion.

    3. Re:SCOTUS reference anybody? by jarom · · Score: 1

      As far as I read it, the Supreme Court declared that you can't pass a law forcing people to teach creationism.
      That is different from declaring it is unconstitutional to teach creationism, which is what the great-grandparent says.

      --
      This signature is far too complex to have been created by chance.
    4. Re:SCOTUS reference anybody? by commodoresloat · · Score: 4, Informative

      What's unconstitutional is putting it into the science curriculum at public schools (violating the establishment clause of the first amendment). As far as "forcing people to teach ____," all public school curriculum is "forced" on teachers in the sense that it is established at the state and local government level.

    5. Re:SCOTUS reference anybody? by jdogalt · · Score: 2, Insightful

      If that is correct, then my skepticism was correct as well. From your link-

      "
      [This is the text of the 1987 United States Supreme Court decision striking down a Louisiana law that required if evolution is taught in public schools then creationism must also be taught.
      "

      Which is entirely different than what the top post said-

      "
      remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion.
      "

      I understand that many of my fellow democrats suffer from *severe* dogmatism on this issue, but if you can just look at those two quotes and realize that the former has zilch to do with any particular teacher deciding to teach creationism in any random classroom on any random day of the schoolyear. Which is precisely what the latter quote suggested that SCOTUS outlawed.

    6. Re:SCOTUS reference anybody? by vought · · Score: 4, Informative

      Piyush Jinda, Governor of Louisiana (George Bush with a funny name, if you ask me) is trying to sneak this shit right back in.

      Louisiana: Last on the good lists, first on the bad lists, and determined to keep it that way.

      I can say that because I'm a rare escapee from that temple to ignorance. Still, it's a lot of fun to visit the Bayou State.

    7. Re:SCOTUS reference anybody? by Secret+Rabbit · · Score: 2, Informative

      There's also:

      http://en.wikipedia.org/wiki/Kitzmiller_v._Dover_Area_School_District

      ID is creationism and creationism being taught in schools is a clear violation of the separation of church and state. That, so called, broad statement is law in many a county including the US.

    8. Re:SCOTUS reference anybody? by chromeshadow · · Score: 2, Insightful

      How so? Define your terms: how is atheism an irrational/non-rational belief in the supernatural?

    9. Re:SCOTUS reference anybody? by Anonymous Coward · · Score: 3, Insightful

      Evolution != atheism. There are plenty of religious people who have no problem reconciling evolution (and all other scientific theories) with their own particular faith.

      I mean, if I really believed, as a fundamental aspect of my religion, that our memories were implanted yesterday by aliens, would it be valid to say that history classes teach atheism because they don't fit with my particular religious beliefs?

    10. Re:SCOTUS reference anybody? by 99BottlesOfBeerInMyF · · Score: 1

      Evolution != atheism. There are plenty of religious people who have no problem reconciling evolution (and all other scientific theories) with their own particular faith.

      Indeed. Most organized christian faiths accept evolution as not in conflict with their beliefs, more so by percentages of the population than their adherents. If most of the people in the US who answer surveys saying they don't believe in evolution asked their religious leaders, they would find themselves in conflict. Even the pope of the Catholic church explicitly stated that evolution did not conflict with their doctrine.

    11. Re:SCOTUS reference anybody? by Pantero+Blanco · · Score: 1

      What's unconstitutional is putting it into the science curriculum at public schools (violating the establishment clause of the first amendment).

      RTFFA.

      Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the press; or the right of the people peaceably to assemble, and to petition the Government for a redress of grievances.

      "Unconstitutional" isn't just a long word that means "bad idea". Many terrible ideas don't conflict with the Constitution at all.

    12. Re:SCOTUS reference anybody? by grub · · Score: 5, Insightful


      Atheism is a religion.

      Atheism is a religion like not collecting stamps is a hobby.

      --
      Trolling is a art,
    13. Re:SCOTUS reference anybody? by KDR_11k · · Score: 1

      The Supreme Court has ruled that the First Amendment affects all levels of the government, not just Congress. Otherwise a state could ban free speech.

      --
      Justice is the sheep getting arrested while an impartial judge declares the vote void.
    14. Re:SCOTUS reference anybody? by malkavian · · Score: 2, Informative

      I'd love to know your statistical source of information on that, as most of the people I know who have studied evolution are either religious, or agnostic (with a few atheists in there for luck).
      In the Europe, where evolution is taught as science, and creationism/ID fits squarely in Religious Education lessons, there is a high percentage of the population that are religious. Which squarely debunks your argument that teaching evolution promotes atheism.

      Now, atheism is not strictly speaking a religion, as it has no firm set of beliefs, or common practices. It is just the belief that there is no deity. And before you start ranting away that science just promotes this, that is entirely incorrect.
      The most scientifically correct approach would be agnosticism, where you're not sure if there is a god or not.
      Atheism is a belief, in the same sense that a religion is a belief. There is no evidence for it, and it can neither be proved nor disproved. In other words, it is just plain NOT science.
      Agnosticism covers the inability to know if there is a god. It is the absence of belief in either direction.

      So, I'm not against creationism, or ID. I'm just entirely against them being treated as science. I firmly think that if people keep trying to get ID put in science classes (where it really does NOT belong, as it really is NOT science), then legally, religious studies classes and churches must be obligated to put the belief of the 'creation event' to scientific scrutiny, and widely spread the word.
      In other words, the process that has allowed us to progress, and build a society that spans the globe, has enabled us to leap into space, and look farther away into the universe would be turned on a belief, and would give the answer "There is no evidence for this". And with science, you can choose to ignore the conclusions (ignoring it is just willful ignorance), or attempt to disprove it (if you can absolutely prove something with evidence based on experimentation, then you win, and get to amend the theories so that they take this evidence into account. Congratulations, your view is science!). Belief is not science. Science does not care what anyone believes, it only considers what can be shown to occur time after time, observably and reliably.
      Evolution meets these criteria, ID and creationism don't.

    15. Re:SCOTUS reference anybody? by commodoresloat · · Score: 1

      RTFFA.

      OK, I read it. Now you read the fucking Supreme Court's interpretation of it. Sorry, but putting creationism in the science curriculum in US public schools is a violation of the establishment clause of the first amendment. You quoted it, so you are probably already aware of this. Thanks for playing.

    16. Re:SCOTUS reference anybody? by Wonko+the+Sane · · Score: 1

      The Supreme Court has ruled that the First Amendment affects all levels of the government, not just Congress. Otherwise a state could ban free speech.

      The Supreme Court didn't just pull that ruling out of thin air. That requirement is (now) written into the constitution itself.

      All persons born or naturalized in the United States, and subject to the jurisdiction thereof, are citizens of the United States and of the State wherein they reside. No State shall make or enforce any law which shall abridge the privileges or immunities of citizens of the United States; nor shall any State deprive any person of life, liberty, or property, without due process of law; nor deny to any person within its jurisdiction the equal protection of the laws.

    17. Re:SCOTUS reference anybody? by hey! · · Score: 1

      Well, not burning gasoline isn't a hobby either -- unless you're a hypermiler.

      One of the definitions of "religion" is "A cause, principle, or activity pursued with zeal or conscientious devotion." Some people may be atheists in that they just don't believe. They're like people who telecommute; telecommuters don't use gas because they're doing other things.

      Others espouse atheism, and have a mania for correcting the metaphysical errors of others that is quite comparable in zeal to any other sort of evangelical. They are proselytizers for the Null God. Those atheists are like the hypermilers, who have more in common with people who like to drive fast on the track than people who prefer not to drive at all. It's all about different kinds of performance.

      --
      Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
    18. Re:SCOTUS reference anybody? by Disfnord · · Score: 1

      "When I use a word, it means just what I choose it to mean - neither more nor less."

    19. Re:SCOTUS reference anybody? by Wicked+Zen · · Score: 1

      Atheism is a religion like not collecting stamps is a hobby.

      Whoa there, buddy. No need to go dragging us nonphilatelists into your argument. I've been not collecting stamps for decades, now, and I'm damn proud of it!

    20. Re:SCOTUS reference anybody? by turkeyfish · · Score: 1

      The name is Jindal, but thats not all that important.

      Louisiana education is very poorly funded, but if they insist on pushing this book onto students they stand a good chance of getting funding from the Russians and Chinese, who would likely be more than happy to see US children get a poor science education so that they can take the lead in biotechnology.

    21. Re:SCOTUS reference anybody? by Stephan+Schulz · · Score: 1

      Teaching evolution promotes atheism which is a violation of church and state.

      Of course, atheism is not a religion, and much less a church. But your whole premise is morally bankrupt ("let's not teach the truth because I don't like the consequences") and almost entirely unfounded. You might want to talk to the Pope, or to the Archbishop of Canterbury, or to any of the 11000+ signatories of the Clergy Letter Project. Thousands of scientists and millions and millions of Christians have no trouble reconciling evolution and the other sciences with their religion.

      --

      Stephan

    22. Re:SCOTUS reference anybody? by Pantero+Blanco · · Score: 1

      I reread the Fourteenth Amendment before I made the post you replied to, and I expected someone to bring it up.

      Diet creationism being taught alongside evolution, despite being unscientific, doesn't abridge any privileges or immunities of citizens, though it may annoy or misguide them. If we were talking about a state law that attempted to restrict or impose religion, then yes, the Fourteenth would apply.

    23. Re:SCOTUS reference anybody? by Wonko+the+Sane · · Score: 1

      Teaching a particular religious doctrine as fact in a public school does not count as "imposing religion"?

    24. Re:SCOTUS reference anybody? by mdwh2 · · Score: 1

      One of the definitions of "religion" is "A cause, principle, or activity pursued with zeal or conscientious devotion."

      So, atheism can be a "religion" just like collecting stamps can be a "religion".

      Not that this definition has anything to do with the meaning of religion being discussed here. Just because a word has more than one definition doesn't mean those two definitions are the same thing.

    25. Re:SCOTUS reference anybody? by johanatan · · Score: 1

      Actually, it's secular humanism which is the religious form of atheism.

    26. Re:SCOTUS reference anybody? by Golddess · · Score: 1

      Religion
      4: a cause, principle, or system of beliefs held to with ardor and faith.

      I'd say Atheism could potentially fit in with that fourth definition.

      One thing I've wondered though, the people who keep repeating what you said, do you say it to simply differentiate those who believe in a God from those who do not, or are you trying to say that the First Amendment to the Constitution does not apply to Atheists? IE, the old "freedom of religion, not freedom from religion" argument.

      --
      "I'm not sure I like the fugnutish tone you used in your post!" -RogL (608926)-
    27. Re:SCOTUS reference anybody? by mfnickster · · Score: 1

      > Actually, it's secular humanism which is the religious form of atheism.

      No, you're thinking of religious humanism - possibly Unitarianism?

      "Secular" means "not religious."

      I'd probably be a humanist, except that I have no faith in people! :)

      --
      "Slow down, Cowboy! It has been 3 years, 7 months and 26 days since you last successfully posted a comment."
    28. Re:SCOTUS reference anybody? by collinstocks · · Score: 1

      The most scientifically correct approach would be agnosticism, where you're not sure if there is a god or not.

      I'm agnostic about god in the same way in which I am agnostic about flying pigs in my back-garden (that become invisible whenever I might see them) that everybody knows about except me, and will not tell me about them because I am so cute when I argue that they don't exist.

      That said, neither should be treated as a science, nor should they be construed as having any validity whatsoever.

    29. Re:SCOTUS reference anybody? by johanatan · · Score: 1

      It sure looks like a religion to me. It has a basic set of tenets (or doctrine). And, there have been U.S. courts who agree.

      See the 'Legal mentions...' section of this: http://en.wikipedia.org/wiki/Secular_humanism

    30. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ... you can't pass a law forcing people to teach creationism....

      Why should evolution-ism, creation-ism or any other kind "ism" taught as science? Why not just teach the facts of science and let the student choose from the various interpretations?

      For example, it is a fact that astronomers measure what has been called a "red-shift" in the starlight they see in their telescopes. That is really the only fact we have. It is measured cut and dried. Everything else concerning this red shift is pure interpretation and speculation. There are several interpretations which could equally apply to the data we have.

      An unbiased textbook writer should first state this fact and then briefly outline the various interpretations and on what assumptions they are based.

      A measured fact is that certain elements are what we have labeled in science as radioactive. What the rate of this activity is, how fast it proceeds today and what particles are produced can be accurately measured in the laboratory. A science textbook should concentrate on communicating the actual information we really do know. However, when radioactivity is promoted as a means of measuring the age of rocks and other objects, there are some underlying interpretive assumptions made. The word assumption is a scientific codeword for "educated guess". It is assumed that for dating purposes for example, the rate at which this radioactive decay proceeds for each element, commonly termed "half-life" has always been what we measure it to be today. That may be a valid guess, but it is not something that we really do know. Therefore, such a guess or assumption should not be presented as a known fact.

      It is a well-established fact, that there is hardly any place on the surface of this earth, where we do not find fossils. All fossils show imprints of living creatures. It is also a well-established fact that these fossils are only found in sedimentary rocks, that is rocks formed by water action. A good, dogmatism neutral textbook would first present these and other observed facts about fossils. After that, it could give the various interpretations of when and how these fossils might have come into existence and what else they might tell us.

      In short than a good neutral textbook with no dogmatic axe to grind would present the scientific facts we do observe and measure. Only after the facts are presented should ALL the interpretations and assumptions, clearly labeled as such we presented. Of course, realistically that will never happen.

      --
      All theory is gray
    31. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...Teaching a particular religious doctrine as fact...

      Teaching the doctrines of the religion of secular humanism in public schools appears to be perfectly OK as long as it is labeled science.

      --
      All theory is gray
    32. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...how is atheism an irrational/non-rational belief in the supernatural..

      So it now should be a matter of law whether a belief is rational or irrational? Atheism is a belief and as such it doesn't make any difference whether such a belief is termed rational or irrational. A belief defined in terms of what you don't believe is still a belief after all.

      --
      All theory is gray
    33. Re:SCOTUS reference anybody? by Wonko+the+Sane · · Score: 1

      Just because you call something a religion doesn't make it true..

    34. Re:SCOTUS reference anybody? by Wonko+the+Sane · · Score: 1

      For example, it is a fact that astronomers measure what has been called a "red-shift" in the starlight they see in their telescopes.

      True

      There are several interpretations which could equally apply to the data we have.

      False (note 34)

      It is assumed that for dating purposes for example, the rate at which this radioactive decay proceeds for each element, commonly termed "half-life" has always been what we measure it to be today. That may be a valid guess, but it is not something that we really do know.

      Bullshit

      In short than a good neutral textbook with no dogmatic axe to grind would present the scientific facts we do observe and measure. Only after the facts are presented should ALL the interpretations and assumptions, clearly labeled as such we presented. Of course, realistically that will never happen.

      What you're leaving out is that you want your interpretation presented as equally plausible as any other interpretation when in fact it is not. They only "neutral" text you would accept is one that omits substantial information in order to present the illusion that YEC is not thoroughly debunked

    35. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...Evolution != atheism. There are plenty of religious people who have no problem reconciling evolution...

      How would anyone who claims to believe the Bible, in other words a true Christian, reconcile the opening statement of the Bible with evolution?

      Genesis 1:1 In the beginning God created the heaven and the earth.

      Either God really did create the earth and everything in it or it came into existence in some other way. How can anyone who truly believes this very first foundational sentence of the Bible, have any difficulty in believing everything else that follows it?

      If there truly is a God capable of creating everything that exists out of absolutely nothing, including all life, then everything else we read in the Bible that we commonly attach the term "supernatural" to, should be believable as well.

      --
      All theory is gray
    36. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...They only "neutral" text you would accept is one that omits substantial information...

      No a truly "neutral" text would clearly separate observed, experimental facts from assumptions and interpretations.

      from the link:
      (... and Halton Arp, while investigating the mystery of the nature of quasars, tried to develop alternative redshift mechanisms, and very few of their fellow scientists acknowledged let alone accepted their work....)

      A neutral textbook would first include that there ARE alternate interpretations in the first place and then summarize several of them. A neutral textbook could even state that certain assumptions (beliefs) are not held be the majority of today's scientists. Of course, just because a certain view is held by a majority, doesn't mean that view is correct. The history of science has plenty of examples, where the majority opinion was shown later to be wrong.

      again from the link:
      (...These predictions hold for supernova SN1987A, which is 169,000 light-years away...)

      The 169,000 light year distance is NOT a measured value. We have NO technology to measure such distances. That stated distance, presented as if it were a measured fact, is based on the above mentioned red-shift being interpreted as distance. It is further based on the ASSUMPTION that the speed of light has always been what it is today. We can only measure the speed of light what it happens to be now. Whether it has always been of this value can only be assumed (guessed). Because there is NO way of measuring what it was in the past we have to make assumptions. Most of the time, these assumptions are stated as if they were measured, observed facts. That sort of thing has no place in science, but is OK for religion.

      So then, the reference in para. 34 of the reference is based on TWO assumptions, NOT sure measured facts. These assumptions should be clearly stated in any text book. All the present dogmatic evolution textbooks state these assumptions as facts, when they clearly are not. ALL assumptions (beliefs, educated guesses) may or may not be correct, but they will ALWAYS be assumptions until someone actually measures or observes otherwise.

      --
      All theory is gray
    37. Re:SCOTUS reference anybody? by allaunjsilverfox2 · · Score: 1

      I mean, if I really believed, as a fundamental aspect of my religion, that our memories were implanted yesterday by aliens, would it be valid to say that history classes teach atheism because they don't fit with my particular religious beliefs?

      Yes, And they'd sue your for revealing the great secret. You must pay several hundred thousand dollars and bully people. Xenu is among us!

      --
      Restore the madness of youth's lechery
    38. Re:SCOTUS reference anybody? by ninderthana · · Score: 1

      I am a scientist who uses the scientific method to study the world around me on a daily basis. There is no part of the scientific method which states that I must exclude certain conclusions because they are not "popular" or because they do not fit in with the current "world view" of biology. If I were to adopt this belief, I would be self-censoring myself and biasing my research in a way that is the antithesis of the scientific method. I believe that there is sufficient evidence available, at the bio-chemical level, to raise serve doubts about a pure evolutionary explanation for the diversity of life. As far as I am concerned, there are clear signals, at the biochemical level, that strongly support the idea of design. The scientific evidence that is available does not indicate the source of this design and so it does not support the idea of a "god". All it says is that at some point in the development of life there has been an intervention by an "intelligence" that has influenced the eventual outcome that we see today. Claims that design plays a role in the development of life do not necessarily rule out evolutionary biology (both at the macro and micro level of change). A good analogy is to consider a car race. Inbuilt design in the development of racing cars may provide five or ten different basic car designs that can participate in a car race. However, it is the car race itself which actually weeds out the cars that are entered in the race and which produces the eventual (evolutionary) winner. Design comes into play in limiting the race entrants, in such a way as to ensure that cars that participate in the race have a fighting chance of completing the race. I believe that the scientific evidence strongly supports the position that without the initial level of "thought" and "design" at the bio-chemical level, the race of life may have not have got off the ground.

    39. Re:SCOTUS reference anybody? by Mr.+Slippery · · Score: 1

      Diet creationism being taught alongside evolution, despite being unscientific, doesn't abridge any privileges or immunities of citizens, though it may annoy or misguide them. If we were talking about a state law that attempted to restrict or impose religion, then yes, the Fourteenth would apply.

      Teaching creationism in a school is an attempt to impose religion. School cirricula are set by state law. Ergo, what we have here is exactly "a state law that attempted to restrict or impose religion".

      --
      Tom Swiss | the infamous tms | my blog
      You cannot wash away blood with blood
    40. Re:SCOTUS reference anybody? by Mr.+Slippery · · Score: 1

      the religion of secular humanism

      The religion of non-religious humanism?

      And science is hardly limited to secular humanists. If your religious dogmas contradict scientific findings, your religion is broken and you need to trade up to one based less on metaphysical dogma and more on personal religious experience.

      --
      Tom Swiss | the infamous tms | my blog
      You cannot wash away blood with blood
    41. Re:SCOTUS reference anybody? by Mr.+Slippery · · Score: 1

      How would anyone who claims to believe the Bible, in other words a true Christian

      Who gets to define a "true Christian" as one who believes in the literal truth of the Bible?

      The religion is called "Christianity", not "Bible-anity".

      --
      Tom Swiss | the infamous tms | my blog
      You cannot wash away blood with blood
    42. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...If your religious dogmas contradict scientific findings...

      That may be, but the FACTS of science and what is actually written in the Bible never contradict. It is the interpretation of the facts of science by people and the interpretation of what is actually written in the Bible by other people, that the contradictions arise.

      --
      All theory is gray
    43. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      Atheism is more like denouncing the existence of stamps, and as such it isn't really neutral to the question of the "great stamp in the sky". In that respect, state atheism would be a violation of church and state just as state <insert religion of choice here> would be.

      Then again, I don't agree with glitch's assertion that evolution promotes atheism and by extension I don't agree with his assertion that teaching evolution is school is a violation of the 1st. amdmt.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    44. Re:SCOTUS reference anybody? by mfnickster · · Score: 1

      state atheism would be a violation of church and state just as state <insert religion of choice here> would be.

      Exactly. If the state were promoting or requiring atheism, would we see the huge number of churches we have in the U.S.? Religion is flourishing, not leastwise because the government stays out of it and guarantees freedom of exercise.

      Secularism in government is not atheism (or secular humanism). It's just attending to the facets of public life which don't involve religion. It's "rendering unto Caesar what is Caesar's," if you like.

      --
      "Slow down, Cowboy! It has been 3 years, 7 months and 26 days since you last successfully posted a comment."
    45. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      Teaching evolution promotes atheism

      How?

      Evolution is mute on the question of abiogenesis / "the origin of life". It is also mute with regards to what happened before, like what caused the big bang. As such, it is not in conflict with the view that some sort of intelligent agent set the wheels in motion some time in the distant past.

      In the more general sense, science tries to find the answer to "how" while religion is concerned with "why".

      The theory of evolution only "promotes atheism" if you happen to be in the YEC / genesis literalism camp. In that case, it isn't really evolution that "promotes atheism" but rather that the world around us does not behave as described in a particular book ("the world has an evolution bias!"). Then again, if you would rather believe in a literal interpretation of an old book rather than to trust what we can see around us I would suggest that you get some professional help.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    46. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      Either God really did create the earth and everything in it or it came into existence in some other way.

      You are arguing from the point of biblical literalism. Far from all Christian share that view. There are also passages in the Bible that can be read to mean that the earth is the centre of our solar system ("the world is firmly established, it cannot be moved"), and there is no shortage of similar examples. However, there are very few Christians that take that passage literally and they don't consider teaching school children that the earth revolves around the sun as promotion of atheism. ;-)

      The idea that the Bible is open to interpretation is very old.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    47. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      Diet creationism being taught alongside evolution, despite being unscientific, doesn't abridge any privileges or immunities of citizens, though it may annoy or misguide them.

      Check the history of creationism and ID. The ID movement is little more than a search/replace of "God" to "some intelligent designer".

      This happened after the 1987 Edwards case, which ruled that teaching creationism in school was unconstitutional, because [it] was specifically intended to advance a particular religion. While ID doesn't name the "intelligent designer", it is quite obvious what the ID proponents' motive for getting ID taught in science class is.

      Not to mention that what is taught in science class should be science. If the standard is lowered enough to allow ID access, then why shouldn't the pastafarianism creation story be told too?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    48. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      Teaching the doctrines of the religion of secular humanism in public schools appears to be perfectly OK as long as it is labeled science.

      Huh? That makes absolutely no sense to me. How is science the same as secular humanism?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    49. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      ALL assumptions (beliefs, educated guesses) may or may not be correct, but they will ALWAYS be assumptions until someone actually measures or observes otherwise.

      That is really a subject for a textbook on philosophy, not for basic level science.

      To some level or another, everything we "know" (or rather think to know) is built on assumptions. Taken to the extreme, how do we know we're not plugged into the Matrix? The question then is where to draw the line.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    50. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...The religion is called "Christianity",...

      which is named after Jesus the Christ. He believed in the written word available at that time. He indicated the story of Jonah and the fish to be a historical event. He quoted his Bible, the Old Testament of our present Bible many times, taking it quite literally.

      --
      All theory is gray
    51. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      It is the interpretation of the facts of science by people and the interpretation of what is actually written in the Bible by other people, that the contradictions arise.

      So your argument is, as far as I can tell, that the contradiction happens in the head of people that read the texts - sort of like a bible/science analogy of the schrÃdinger's cat experiment? That is, no contradiction exists until someone "interprets" the bible/science?

      It is an interesting example of sophistry, but no more convincing as an argument than Clinton arguing about what the meaning of "is" is.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    52. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...the world is firmly established, it cannot be moved...

      How does that statement say that the earth is at the center of the solar system? Maybe some people interpret it that way but that is not what it says.

      One of the rules of interpreting not only the Bible, but any written text, is to pay attention to the context. The quote you gave is from Psalm 96:10. The readers thereof are encouraged and inspired to appreciate and worship the one true God who made the heavens and earth. Taking a few words or phrases out of context from the Bible is a favorite activity of cults and unbelievers. The former then fashion these words into their doctrines and the latter use the out of context phrases to ridicule and debunk.

      Are you not glad that the Earth is rather "rock solid"? Are you not glad that humans are incapable of making or controlling the weather? Should we be allowed to vote to decide whether it rains tomorrow for the benefit of the farmers or that the sun shines for the benefit of a baseball game? I am very glad that the basic mechanics and operations of our planet are well beyond the shenanigans and whims of mankind.

      --
      All theory is gray
    53. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      *rolleyes*

      You are really good at missing the point, arent't you?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    54. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...How is science the same as secular humanism...

      Science itself isn't, but some of the interpretations of scientific facts are foundational doctrines or beliefs of secular humanism. All interpretations of scientific facts should be clearly labeled as such interpretations. Also, any qualified scientist, such as any one with a degree from a well-known university, should be allowed to express their opinion and interpretation, even if and especially if it is materially different from or contradicts the interpretations of the majority.

      Experimentally established and observed facts of science could be clearly separated from the interpretation of such facts.

      --
      All theory is gray
    55. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      ...How is science the same as secular humanism...

      Science itself isn't, but some of the interpretations of scientific facts are foundational doctrines or beliefs of secular humanism.

      Could you give a few examples of these, specifically examples of these being taught in science class?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    56. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...How about the Star of Bethlehem?...

      According to the written account, what was the purpose of the star? If you search out and answer that question, then the properties and orbits of stars as we know them today becomes irrelevant.

      The purpose of the star is clearly given to us. Some cosmic phenomena caused these astronomers of the East to travel at least 500 miles in order to worship and give homage to this person they labeled the newborn King of the Jews. We are not told how they connected whatever it was they saw in the heavens with the birth of his child. Whatever this "star" may have been, as defined by our modern astronomy is irrelevant because its purpose was to guide them to the very place where they could worship the one they were seeking.

      --
      All theory is gray
    57. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      "and behold, the star which they had seen in the East went before them, till it came and stood over where the young Child was."

      "Stood over". Unlike genesis, this is not intended to be taken literally then?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    58. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...That is, no contradiction exists until someone "interprets" the bible/science....

      No, the contradiction comes in because people interpret both the facts of science and the text of Bible according to their worldview.

      A person with an atheistic worldview throws the Bible away entirely and interprets all scientific facts and observations through his lens of " their is no God". Everything that exists, according to this worldview, came into existence by some means that specifically excludes any kind of intelligence or God.

      A person with a Christian worldview believes that the Bible is God's communication to mankind and tries to figure out what this communication is truly all about. Such a Christian person will look at the facts and observations of science and interpret them through the lens of Genesis 1:1 where God, Time, Space, matter, and energy are all mentioned together.

      --
      All theory is gray
    59. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ....That is really a subject for a textbook on philosophy, not for basic level science...

      This is exactly right, but these philosophies are written into the present textbooks as "science" and then taught as a scientific truth. If any particular philosophy is incorporated into a science textbook, then in a sense it is no longer a science textbook but a book of philosophy.

      If a book that purports to be a science textbook contains interpretations of the facts and observations of science, these interpretations will _always_ involve the philosophy of the interpreter. Therefore, any neutral science textbook should ALSO contain ALL plausible interpretations of the facts put forth by educated, degreed scientists. This would include scientists that graduated with honors from reputable mainstream colleges who DO believe in God and his communication to man, the Bible.

      This, unfortunately is not the case in textbooks today. These only contain the philosophic interpretations seen through the lens of confident "there is no God" atheism. Any mention of God is officially and legally outlawed. The Supreme Court has misinterpreted the founders edict on freedom OF religion into a interpretation of freedom FROM religion.

      --
      All theory is gray
    60. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...Could you give a few examples of these, specifically examples of these being taught in science class...

      Secular humanism is a philosophy and belief that man is the measure of all things and that nothing and no power outside the understanding of the human mind exists. This philosophy is reflected in the explanations and interpretations of scientific observations and experiments written into today's textbooks. Any interpretations of the facts of science where God, Intelligence or the supernatural is mentioned, is officially and legally disallowed. Secular humanism is the only official state promoted religion of the United States.

      --
      All theory is gray
    61. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      Ah. So you you are not arguing god-of-the-gaps after all, you are arguing "teach the controversy".

      What are these facts that has "god did it" as a plausible interpretation? Please be as specific as you can.

      Also remember that if you open for Christian interpretations in science text books you also open for all interpretations.

      Besides, where do you have "This would include scientists [..] DO believe in God" from? Is it your assertion that scientists that have a personal belief in religion is for some reason banned from writing science textbooks? If so, I would have to ask for supporting evidence.

      The Supreme Court has misinterpreted the founders edict on freedom OF religion into a interpretation of freedom FROM religion.

      Opinions differ on that matter. From what I can tell, the majority opinion seems to be that the establishment clause means the separation of church and state.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    62. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      Huh? The supernatural is orthogonal to science. It is not part of science, never has been, never should be.

      Secular humanism is certainly not taught in science class either. I certainly don't remember a single instance of being taught ethical philosophy in science class when I went to school. Secular humanism might have science and the scientific method as part or their core beliefs, but that does not make teaching science the same as teaching secular humanism. If you disagree, please provide *specific* examples.

      Any interpretations of the facts of science where God, Intelligence or the supernatural is mentioned, is officially and legally disallowed.

      As it should be. What part of church and state is so difficult to grasp? If you want to enumerate scientific facts and then proclaim religious interpretations of those facts, isn't the church a large enough soap box to preach it from?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    63. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...the establishment clause means the separation of church and state...

      Indeed is does and rightfully so. The state must not endorse or prefer any particular religion or philosophy over any other. This sadly not the case in practice. The tenets of secular humanism have become the officially recognized religion in public schools and life. That happens to be a religion that believes that the mind of man and his rational understanding is the be all and end all of everything that exists. There is no room for the possibility of anything beyond what can be understood, because that would be supernatural. Any mention of the supernatural or of God is specifically disallowed by this humanistic religion and it has become the law. Like I said before, freedom OF religion is not the same as freedom FROM religion. The establishment clause was intended to give freedom of religion and it has failed in that in today's practice, because the religion of secular humanism is officially allowed to be taught in schools and other public forums. The humanistic sanctioned doctrine of evolution is taught under the guise of science and other views such as those of the founding fathers and other dissenters of the humanistic world view are forbidden by law to enter public life.

      --
      All theory is gray
    64. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...If you disagree, please provide *specific* examples...

      OK, here is one. The facts of science are that there is hardly any spot on this Earth where we DON'T find fossils. It is also a FACT that all fossils, without a single exception are found in sedimentary rocks. These are rocks formed by the action of water.

      Evolutionists INTERPRET these facts by stating that bodies of water covered and receded these fossil beds over millions of years. The now fossilized creatures lived and died millions of years ago and were slowly buried and then over much more time became fossilized.

      The same FACT that there are fossils only in sedimentary layers is interpreted by God believing creation scientists to be caused by a world wide, sudden universal flood catastrophe. The scientists who believe this are not some wild-eyed religious nuts, but are academically equally well qualified.

      The Biblical account specifically states that the water covered the highest mountains. Even today, if the earth were flat and smooth, the whole planet would be a water world covered by over a mile of water. However, this equally valid scientific interpretation is NOT allowed to be even mentioned in American Schools by LAW.

      --
      All theory is gray
    65. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      It is also a FACT that all fossils, without a single exception are found in sedimentary rocks.

      Not really surprising, considering that the other forms of rock (igneous and metamorphic) are formed in a way that would destroy any fossils contained therein.

      These are rocks formed by the action of water.

      Not strictly. It is caused by particles carried in suspension (which would in most instances mean water in some form, be it from rain, in rivers, ice sheets melting, etc) and then deposited over time. It does not mean that sedimentary rocks are only formed when below the sea level.

      The same FACT that there are fossils only in sedimentary layers is interpreted by God believing creation scientists to be caused by a world wide, sudden universal flood catastrophe.

      How would this "interpretation" account for fossils found in different sedimentary layers? If fossils were trapped all at once by a single universal flood, you would expect to only find fossils in a single layer.

      Besides, how long did this global flood last? Sedimentary rock does take some time to form. Besides, if these sediments were deposited on land and the water then retracted, this sedimentary layer would be on the surface of the earth and would likely just erode away by the action of wind and rain.

      However, this equally valid scientific interpretation is NOT allowed to be even mentioned in American Schools by LAW.

      That could perhaps have something to do with even a simple layman like me being able to find problems with this "interpretation" by no more than a cursory glance and 10 minutes with Google?

      Seriously, you want this taught as valid interpretations in science class in schools? If you were successful in getting this into the curriculum, I think it would do more damage to the credibility of Christianity than it would gain you new converts.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    66. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      Could you please answer my very basic questions instead of using every opportunity to ignore them and instead go on another rant about the unfairness of religion not being allowed in science class?

      Again:

      What are these facts that has "god did it" as a plausible interpretation? Please be as specific as you can.

      Where do you have "This would include scientists [..] DO believe in God" from? Is it your assertion that scientists that have a personal belief in religion is for some reason banned from writing science textbooks? If so, I would have to ask for supporting evidence.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    67. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ....If fossils were trapped all at once by a single universal flood, you would expect to only find fossils in a single layer....

      If you want to find out how this can happen in a single sudden event, go study the floodplain and miniature of the Grand Canyon carved by the Toutle river below Mount Saint Helens. While there, you can also learn that petrification of wood can and does take place very quickly. All you need do is examine the bottom of Spirit Lake at the foot of the mountain.

      There are two sources for the water given in the flood account. One of them is rain from the atmosphere, but most of the water came from deep within the earth, specifically the mantle. There is a seismic evidence even today that the quantities of water stored in the mantle could far exceed that in all of the world's oceans put together. A quick look at a diagram of the various sections of the earth, the crust, the outer mantle, the inner mantle and the core shows the relative volumes of these.

      Not only would the volume of this water from the inside of the earth been huge, but it would also have been expelled rather violently. We are also told in the flood account of the Bible, that it was only after this event, that seasons as we have today, spring, summer, winter and fall began. The reason we have seasons in the first place is because the axis of the earth is now tilted at about 23 degrees in relation to the plane of the Earth's orbit. There is no way to know exactly what immense forces were at work to cause the axis of the earth to be realigned this way. Perhaps, a planet sized object came close. This would put tremendous pressure from gravitational forces on the entire Earth, squeezing it like a sponge, thus releasing immense quantities of stored water. Furthermore, this water would have been boiling hot.

      Nobody has ever made a fossil and we do not observe fossils being formed today. When a living creature dies, its body decays by the action of microbes. The boiling hot waters would have killed these and the enormous raging flows of water sweeping across the surface of the earth, carried mud, rocks and boulders as large as apartment houses and buried the bodies of living creatures under thousands of feet of mud. With no exposure to microbes and oxygen, the impressions of the bodies of these animals, even the delicate parts at times, where preserved as the mud turned into rock.

      The biblical record tells us that all of this took place in about a year. One look at the moon and Mars tells us that the solar system had a violent history. The gradualism spread by environmentalists is a huge lie. There is plenty of evidence that the earth itself also had a very violent history.

      There is no way to explain how a fossil can be made gradually over time. Fossils were made in a sudden unimaginable water catastrophe. That is why we do not see fossil formation today, especially on a global scale.

      None of this is allowed to be put into a textbook used in public schools. Only the gradualist interpretations of evolution are permitted, in spite of all the evidence of violent sudden catastrophe.

      --
      All theory is gray
    68. Re:SCOTUS reference anybody? by kalirion · · Score: 1

      How would anyone who claims to believe the Bible, in other words a true Christian, reconcile the opening statement of the Bible with evolution?

      Genesis 1:1 In the beginning God created the heaven and the earth.

      Either God really did create the earth and everything in it or it came into existence in some other way. How can anyone who truly believes this very first foundational sentence of the Bible, have any difficulty in believing everything else that follows it?

      If there truly is a God capable of creating everything that exists out of absolutely nothing, including all life, then everything else we read in the Bible that we commonly attach the term "supernatural" to, should be believable as well.

      That "opening statement" has absolutely nothing to do with evolution. Few people claim that the Earth evolved. What comes later.... yes, that causes problems.

    69. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ....What comes later.... yes, that causes problems.....

      And exactly why should it? If Genesis 1:1 is true, then why doubt the other statements that tells us just a little of how God he did it and in what time frame.

      In the context of the giving if the Ten Commandments the reason for keeping of the sabbath was given. It says there that on the seventh day the people are to rest for the reason that:

      Exo 20:11 For in six days the LORD made heaven and earth, the sea, and all that in them is, and rested the seventh day: wherefore the LORD blessed the sabbath day, and hallowed it.

      The Hebrew word translated "day" is the same in all places there. A person who can believe Genesis 1:1 should have no problem believing that the same Creator God could have done it exactly has He tells He did and in the time He said He did it.

      --
      All theory is gray
    70. Re:SCOTUS reference anybody? by kalirion · · Score: 1

      A person who can believe Genesis 1:1 should have no problem believing that the same Creator God could have done it exactly has He tells He did and in the time He said He did it.

      There's a difference between believing that a Creator God could do something, and believing that a Creator God did something.

    71. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      We are also told in the flood account of the Bible, that it was only after this event, that seasons as we have today, spring, summer, winter and fall began. The reason we have seasons in the first place is because the axis of the earth is now tilted at about 23 degrees in relation to the plane of the Earth's orbit. There is no way to know exactly what immense forces were at work to cause the axis of the earth to be realigned this way. Perhaps, a planet sized object came close. This would put tremendous pressure from gravitational forces on the entire Earth, squeezing it like a sponge, thus releasing immense quantities of stored water. Furthermore, this water would have been boiling hot.

      Do you have any idea of the force required to move the axis of the earth like that? The current best supported theory is that the earth's tilt was changed by a giant object that collided with the earth and created the moon. We are talking close to shattering the earth into pieces scale energies here. If this happened in fairly recent time, it would be ludicrous not to expect to find geological evidence of this all over the earth. It would be ludicrous to even think that our ancestors would be able to survive such an event.

      Not to mention, where is the geological evidence for the flood? If a global flood occurred, we would expect to observe a uniform, worldwide blanket of randomly sorted boulders, cobbles, sand, and silt overlain by a layer of clay. This blanket would overlie any pre-existing geologic record. Since the Flood allegedly took place within a mere 4,000 years ago, this evidence should still remain with very little erosion. But this worldwide blanket does not exist.

      There is plenty of evidence that the earth itself also had a very violent history.

      Some of that was extremely long ago (e.g., the event that created the moon). In more recent history, the only thing that comes even within shooting distance of the force required for a global flood (let alone something big enough to alter the earth's tilt) would be the K-T event at an estimated 65mill years ago. Such an event within biblical time would be sure to leave physical evidence behind.

      Fossils were made in a sudden unimaginable water catastrophe.

      Yeah. Sure it is. Lack of supporting evidence. Lack of even having an inkling of understanding the forces that would be required.

      One more - How would you explain that fossils of creature A only show up in strata A while fossils of creature B only show up in strata B if all fossils were created in a single event?

      None of this is allowed to be put into a textbook used in public schools.

      And you should thank your maker it isn't in there. The US educational system would be a laughing stock for decades.

      Only the gradualist interpretations of evolution are permitted, in spite of all the evidence of violent sudden catastrophe.

      WHAT EVIDENCE?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    72. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ..There's a difference between believing that a Creator God could do something, and believing that a Creator God did something..

      Well in the scripture I cited, he DID tell us that he did it and how long he took to do it.

      --
      All theory is gray
    73. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...we would expect to observe a uniform...

      That is a big problem that evolution has to grapple with. There is plenty of evidence that things in nature don't happen slowly gradually and uniformly at all, but suddenly and catastrophically. The fact is, that the flood was very violent event and the surface of the earth bears the hallmarks of the violence and still today. How long ago that violence occurred can only be assumed. You always keep citing millions of years ago as if it were fact and not theory based on assumptions of constancy. Why should there be any nice uniform layers, unless the flood were nothing more than a gentle spring rain slightly amplified.

      (...The current best supported theory is that the earth's tilt was changed by a giant object ...)

      To tilt axis of the earth does not require a direct collision. A close pass by of a massive object could do that. We are told that the flood was a very violent event. We are told two additional things as well. The first one is that the fountains of the deep broke open. Enormous quantities of boiling hot water came out of the mantle of the earth as the earth was being gravitationally squeezed like a giant sponge. Second, after the flood the rainbow is specifically mentioned as a new thing which signified God's promise to Noah to never flood the earth again like that. If Noah had been familiar with rain and rainbows, or in fact have ever seen either one before, that would be a nonsensical statement.

      (...One more - How would you explain that fossils of creature A only show up in strata A while fossils of creature B only show up in strata B if all fossils were created in a single event?...)

      Again, you assume that this flood was like what we experience today when a river rises over its banks. We have seismic evidence that there are quantities of water stored in the mantle of the earth, many times greater than all the water of the world's oceans put together. These waters raged across the surface of the earth at hundreds of miles per hour as the Earth's axis shifted. Living things, killed by the boiling, mud laden water, which also killed all microbes, where washed helter-skelter all over the planet in wave after wave. When the flowing waters finally slowed down, they dropped everything in thousands of feet deep mud flows.

      Nobody has ever made a fossil or explained how they were made. No fossils are being made today because living things decay after they die. The fact that there are fossils almost everywhere is the biggest piece of evidence for a universal, violent, boiling hot, water flood.

      In your next post, please explain to me how to make a fossil. Please be sure to explain how you propose to prevent decay.

      --
      All theory is gray
    74. Re:SCOTUS reference anybody? by kalirion · · Score: 1

      Well in the scripture I cited, he DID tell us that he did it and how long he took to do it.

      And creating the Earth and the Heavens in a single day would not contradict evolution in any way shape or form. Populating it with the birds and the fishes and all that does contradict evolution, and that's one of the "later" parts I referred to in my first post.

    75. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      In your next post, please explain to me how to make a fossil. Please be sure to explain how you propose to prevent decay.

      Mind if I quote instead of writing it out myself?

      Fossilization is an exceptionally rare occurrence, because most components of formerly-living things tend to decompose relatively quickly following death. In order for an organism to be fossilized, the remains normally need to be covered by sediment as soon as possible. However there are exceptions to this, such as if an organism becomes frozen, desiccated, or comes to rest in an anoxic (oxygen-free) environment. There are several different types of fossils and fossilization processes.

      Due to the combined effect of taphonomic processes and simple mathematical chance, fossilization tends to favor organisms with hard body parts, those that were widespread, and those that lived for a long time. On the other hand, it is very unusual to find fossils of small, soft bodied, geographically restricted and geologically ephemeral organisms, because of their relative rarity and low likelihood of preservation.

      Larger specimens (macrofossils) are more often observed, dug up and displayed, although microscopic remains (microfossils) are actually far more common in the fossil record.

      Types of preservation

      [edit] Permineralization
      A permineralized trilobite, Asaphus kowalewskii
      A permineralized trilobite, Asaphus kowalewskii

      Permineralization occurs after burial, as the empty spaces within an organism (spaces filled with liquid or gas during life) become filled with mineral-rich groundwater and the minerals precipitate from the groundwater, thus occupying the empty spaces. This process can occur in very small spaces, such as within the cell wall of a plant cell. Small scale permineralization can produce very detailed fossils. For permineralization to occur, the organism must become covered by sediment soon after death or soon after the initial decaying process. The degree to which the remains are decayed when covered determines the later details of the fossil. Some fossils consist only of skeletal remains or teeth; other fossils contain traces of skin, feathers or even soft tissues. This is a form of diagenesis.
      External mold of a bivalve from the Logan Formation, Lower Carboniferous, Ohio.
      External mold of a bivalve from the Logan Formation, Lower Carboniferous, Ohio.

      [edit] Casts and molds

      In some cases the original remains of the organism have been completely dissolved or otherwise destroyed. When all that is left is an organism-shaped hole in the rock, it is called an external mold. If this hole is later filled with other minerals, it is a cast. An internal mold is formed when sediments or minerals fill the internal cavity of an organism, such as the inside of a bivalve or snail.

      [edit] Replacement and recrystallization

      Replacement occurs when the shell, bone or other tissue is replaced with another mineral. In some cases mineral replacement of the original shell occurs so gradually and at such fine scales that microstructural features are preserved despite the total loss of original material. A shell is said to be recrystallized when the original skeletal minerals are still present but in a different crystal form, as from aragonite to calcite.

      [edit] Compression fossils

      Compression fossils, such as those of fossil ferns, are the result of chemical reduction of the complex organic molecules composing the organism's tissues. In this case the fossil consists of original material, albeit in a geochemically altered state. Often what remains is a carbonaceous film. This chemical change is an expression of diagenesis.

      [edit] Bioimmuration
      The star-shaped holes (Catellocaula vallata) in this Upper Ordovician bryozoan represent a soft-bodied organism preserved by bioimmuration in the bryozoan skeleton.
      The star-shaped holes (Catellocaula vallata) in this Upper Ordovician bryozoan represent a

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    76. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      To tilt axis of the earth does not require a direct collision. A close pass by of a massive object could do that.

      Did you ever play with one of those toy gyroscopes as a child? The forces required are immense. If you think otherwise, show me the math please.

      We are told that the flood was a very violent event.

      We are also told that it was survivable by some folks and animals in a boat, so that puts an upper limit on the forces that could have been at play here.

      Second, after the flood the rainbow is specifically mentioned as a new thing which signified God's promise to Noah to never flood the earth again like that. If Noah had been familiar with rain and rainbows, or in fact have ever seen either one before, that would be a nonsensical statement.

      Rainbows can also be seen in water mist (say for example by a waterfall or by spray mist as waves hit the beach). If he had never seen rainbows before he (1) either lived inland and had never seen rain before and/or (2) the Creator somehow altered the laws of physics to change the properties of reflection/refraction when light hits water droplets.

      One obvious problem with (1) is that it would have been horribly dry, how would anything be able to live if there was no rain.

      (2) I find so silly it is hard to know where to start. Anyway, if you believe that people in a boat can survive the forces (roughly the force of an object 1/1000 the mass of earth hitting it with a speed of 170,000 mph) required to alter the tilt of the earth from 0deg to 23.4deg then I suppose the idea of God changing physics like that at the flick of his hand doesn't seem so outlandish either.

      (...One more - How would you explain that fossils of creature A only show up in strata A while fossils of creature B only show up in strata B if all fossils were created in a single event?...)

      Again, you assume that this flood was like what we experience today when a river rises over its banks.

      No, I assume that it was quite a cataclysmic event, especially if it was also the same event that changed the tilt of earth's axis.

      When the flowing waters finally slowed down, they dropped everything in thousands of feet deep mud flows.

      Did you misunderstand my question? The event you describe would lead to fossils of all different creatures being mixed up in a single layer. My question was why we see *separate layers* with *no mixing of creatures of different types between the layers*. That is, in the fossil record we find "spotted pertussis" only in layer 1 and at the same time find "coffee-stained keyboardog" only in layer 2. If this all happened in a single event, we would expect to find the s.pertussis and c-s.keyb. in all layers.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    77. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...Populating it with the birds and the fishes and all that does contradict evolution...

      In the end, it comes down what you are going to BELIEVE. Evolution masquerades as science, but it has many assumptions (beliefs). One fundamental evolutionary belief is in the uniformity of natural processes throughout vast ages of time. Actual evidence shows that very few things in nature are uniform. One look at the cratered moon and mars, as well as plenty of evidence on earth shows anything BUT a smooth gentle history.

      Another belief is that huge quantities of time can accomplish what nobody has ever done in the lab or observed happening today. For example, nobody has ever made a fossil nor observed one being made today. Scientists have experimented with innumerable generations of creatures, such as the Drosophila fruit flies. However they have never succeeded making anything other than more fruit flies. People have bred dogs for centuries, but all they have ever produced is more dogs.

      The biblical statement that living things were made to reproduce "after their own kind" has NEVER been contradicted by any scientific fact. The theory of evolution, is an INTERPRETATION of facts based on assumptions (beliefs). The real time TODAY evidence is against that interpretation in many points.

      When push comes to shove, if people truly believe in a Creator God, then the question of responsibility and accountability arises. Evolution gives a way out for people to deceive themselves about the possibility of having to face this God.

      --
      All theory is gray
    78. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ....Fossilization is an exceptionally rare occurrence....

      If it is rare, then how is it that there is virtually no place on earth that does NOT have fossils? It is rare or non existent today for fossils to be made.

      (...the remains normally need to be covered by sediment as soon as possible...)

      Even the evolutionists will admit that fossilization has to be rapid, not over thousands or even millions of years. Even so, today, just covering up a dead body with sediment will NOT make a fossil. There is the vital ingredient of killing ALL, not just most microbes. Decay sets in in days nowadays. Microorganisms would still destroy the dead bodies long before permineralization could be completed. When we preserve food today, boiling is a common method to kill such spoilage organisms. There are also microbes that thrive in anaerobic, oxygen free environments. The boiling hot water violently erupting out of the depths at the time of the great flood over the whole Earth would certainly preserve organic remains as surely as our canneries preserve food today.

      From the article: (..On the other hand, it is very unusual to find fossils of small, soft bodied, geographically restricted and geologically ephemeral organisms..)

      That is simply not true. Very delicate fossilized life forms are actually quite wide spread, all over the planet. Almost every sedimentary rock formation has evidence of fossils, some of which are very delicate and finely detailed. Whole trees, including the leaves are found, as well as delicate sea creatures. These are not just in single isolated spots, but in widely separated parts of earth.

      (...For permineralization to occur, the organism must become covered by sediment soon after death or soon after the initial decaying process....)

      Right, exactly how soon and by what means? Is soon a day, a month, a year or what? How does the "initial decay process" get stopped at some point, rather than going to completion? Something HAS to kill the decay causing microbes fairly quickly. If that doesn't happen, the decay will obliterate all details.

      The bottom line of all this is, that by some means, delicate organic matter has to be preserved in shape and form. That is crucial and cannot be gotten around. Only after that preservation has taken place, can all the various processes mentioned happen. Even there, it has to be fairly rapid, not the huge amount of time generally given in evolutionary texts and literature.

      --
      All theory is gray
    79. Re:SCOTUS reference anybody? by kalirion · · Score: 1

      Evolution masquerades as science, but it has many assumptions (beliefs).

      All science has many assumptions. Without assumptions you're not going to get any further then "I am aware therefore I am" (since someone else could conceivably be doing the actual thinking).

      When push comes to shove, if people truly believe in a Creator God, then the question of responsibility and accountability arises.

      Yes, God's responsibility and accountability. Because if God knows what humans are going to do before creating them, then God, and only God, is responsible for all that they do, and there's no such thing as free will no matter what the Bible claims. But this is getting way off topic.

    80. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      One fundamental evolutionary belief is in the uniformity of natural processes throughout vast ages of time.

      Is there any evidence to the contrary?

      If you believe that radioactive decay, c, Planck's constant etc varied over time then do some SCIENCE. That is, the article you linked to shows some statistical likelihood of c-Decay. A proper scientific approach to this ASSUMPTION/THEORY of C-decay would require developing this theory further - what effects could we expect to see of this change? WHAT WOULD BE DIFFERENT compared to a C-constant universe? Would it be possible to OBSERVE ANY OF THESE DIFFERENCES today?

      If you want c-decay to be part of textbooks, you need to do that research. You have to look at all the angles of this ASSUMPTION and come up with as many ways as possible to TEST this assumption.

      One look at the cratered moon and mars, as well as plenty of evidence on earth shows anything BUT a smooth gentle history.

      Asteroid impacts is one thing. Claiming that the basic laws of physics has changed over time is not even on the same scale.

      Another belief is that huge quantities of time can accomplish what nobody has ever done in the lab or observed happening today.

      Same would apply for the Grand Canyon.

      I've covered fossils elsewhere, *snip*.

      Scientists have experimented with innumerable generations of creatures, such as the Drosophila fruit flies. However they have never succeeded making anything other than more fruit flies. People have bred dogs for centuries, but all they have ever produced is more dogs.

      Bacteria have evolved resistance to antibiotica. Wolves have become dogs. Do you disagree that this shows that "microevolution" works?

      "Macroevolution" is just "microevolution" over a longer time span, there is nothing special required. The time required makes it nigh impossible to recreate the Grand Canyon in the lab, but the processes required to make a canyon like that are understood and we can see and test this on the small scale.

      The same goes for turning a bear into something else. It would take lots of time, but the process of evolution is understood and we can see and test this on the small scale.

      The biblical statement that living things were made to reproduce "after their own kind" has NEVER been contradicted by any scientific fact. The theory of evolution, is an INTERPRETATION of facts based on assumptions (beliefs).

      The pastafarian statement that water was commanded to "never dig deep" has NEVER been contradicted by any scientific fact. The theory of river canyons, is an INTERPRETATION of facts based on assumptions / beliefs.

      Evolution gives a way out for people to deceive themselves about the possibility of having to face this God.

      Rrrrright.. Because accepting evolution does for some reason automagically mean atheism which means nihilism which leads to... [insert litany of all the horrible things man would do if they did not have the Damocles Sword of Eternal Damnation hanging over their heads or the Carrot of Paradise to keep them on the narrow path].

      Do you really believe that man is not capable of being good and moral without a longbeard in the sky watching them? That is a horrible thing to think of your fellow human beings!

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    81. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ....Claiming that the basic laws of physics...

      Since when is the speed of light a LAW? It just happens to be parameter no different than the mass of the earth or any other number. There is no LAW of physics that demands ALL such numbers should remain absolutely constant throughout all time. It has been firmly established that the speed of light is a variable, not a constant. It can be slowed down and sped up in the laboratory at will. The speed of light clearly depends on the medium through which travels. As the universe expanded, the medium of space through which to light travels changed dramatically. Therefore, the speed of light _cannot_ remain constant throughout all time.

      (...Wolves have become dogs...)

        Yes, they can be thought of as a "kind" of dog, but they have never become cats or rabbits or anything else.

      (...The time required makes it nigh impossible to recreate the Grand Canyon in the lab...)

      If it cannot be tested in the lab were observed in nature, it is not science, but history. The element of time, the magic of evolution, is always the final retreat of evolutionists. Whenever evolutionists do not have a here and now explanation, or the here and now observed evidence contradicts their theory, the invoke the magic of time, millions or billions of years.

      We do have indeed a recent example of a canyon made on a small scale, not over millions of years, but over days. It can be found at the foot of Mount Saint Helens. The river that runs through it is named the Toutle river.

      (...Do you really believe that man is not capable of being good and moral ...)

      I think that if you study history or read your local newspaper you can answer that one. Yes, I believe that humans are capable of loving and doing the right thing. Just having the capability and actually doing it are two very different things.

      Most likely, you know that it is wrong to lie and steal. If you have done so, even once, that makes you a liar and a thief. You do not have to murder a dozen people to be a murderer. Just once is enough. There is a law that demands death for such activities, therefore anyone who does any of the above could be executed. We are all sitting on death row right now.

      Nobody will ever go to hell for being a thief, a liar, a murderer an adulterer and such. People are going to go to hell for calling God a liar. You don't like to be labeled a liar, so why should God. If you tell someone something and they tell you that they do not believe you, that is what you are really doing, calling them a liar.

      God offers every death row inmate on this planet a free pardon. The conditions of this pardon are to believe God and then decide to WANT to no longer break God's laws. You can begin to find out what God wants and how he wants you to live by first reading the Gospel of John in your Bible.

      --
      All theory is gray
    82. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      There is no LAW of physics that demands ALL such numbers should remain absolutely constant throughout all time.

      If you CHANGE those numbers, you CHANGE a lot of things. Ranging from chemical and nuclear reactions to gravity. The EFFECT of those numbers being DIFFERENT in the past would be OBSERVABLE today.

      It can be slowed down and sped up in the laboratory at will. The speed of light clearly depends on the medium through which travels.

      Yes. I have no problem with that. It is the change of c in vacuum that I have a problem with.

      Anyway. Let's say it was true. That would explain the red-shift, but a secondary effect is that we would see stars and galaxies orbiting slower than we would expect. Do we see that?

      People are going to go to hell for calling God a liar. You don't like to be labeled a liar, so why should God. If you tell someone something and they tell you that they do not believe you, that is what you are really doing, calling them a liar.

      Sorry, I find it incredibly hard to believe in a deceitful god.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    83. Re:SCOTUS reference anybody? by LarsG · · Score: 1

      If it is rare, then how is it that there is virtually no place on earth that does NOT have fossils?

      Time? Oh, I forgot. "Time" is a dirty word, and any attempts at measuring age is assumptions.

      Whole trees, including the leaves are found

      Polystrate fossil

      I'll get back to you on the rest, don't have time now.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    84. Re:SCOTUS reference anybody? by arminw · · Score: 1

      ...If you CHANGE those numbers, you CHANGE a lot of things...

      Not so. For example, take the famous equation e=mc^2.

      Atomic rest masses "m" are proportional to 1/(c^2). Thus when c was higher, rest masses were lower. If the rest mass does down as c goes up then energy will be conserved.

      (...It is the change of c in vacuum that I have a problem with...)

      What makes you think the medium you call vacuum has not changed? Space and the vacuum are not an empty nothing, but have definite electromagnetic properties. Antenna designers have to deal with these. As space expanded, its properties changed.

      (.. but a secondary effect is that we would see stars and galaxies orbiting slower than we would expect...)

      Orbits of any sort have nothing to do with red-shifts. Orbits are controlled by he force of gravity. The red-shift is of atomic origin, controlled by the electric force.

      In hat way do you believe God is deceitful?

      --
      All theory is gray
  2. Table Of Contents by darth_MALL · · Score: 5, Funny

    1 - In The Beginning...

    2 - The Great Flood (Where are all the Unicorns?)

    3 - Jesus, Dinosaur Wrangler

    4 - Darwin, What a Jerk.

    5 - The Scientific Method - Hooey or Baloney?

    1. Re:Table Of Contents by mattack2 · · Score: 1

      You forgot..

      6 - PROFIT.

      Oh wait, this is a book about creationism...

      6 - LOSE OUR SHIRTS PRINTING THIS BOOK THAT NOBODY IN SCIENCE WANTS

      (yeah I know that doesn't really fit a table of contents..)

  3. Yeah by nawcom · · Score: 1, Funny

    "The book doesn't only promote stupidity, it demands it."

    What were people expecting? A book made by stupid people to promote intelligence?

    1. Re:Yeah by philspear · · Score: 1, Insightful

      What were people expecting? That goes both ways.

      "A biologist reviews an evolution textbook from the ID camp"

      The conclusion: it's crap.

      OMFG!!!

      Next up: the writer of the inteligent design textbook reacts to the review. Don't want to spoil the ending, but he MAY not be convinced!

    2. Re:Yeah by nawcom · · Score: 2, Insightful

      Please RTFA and understand what this textbook contains. If you really think the word stupidity (or lack of intelligence) doesn't match the description, then science and technology really isn't your thing. Hand in your geek card, Coward.

    3. Re:Yeah by ScrewMaster · · Score: 1

      What happened to the traditional Christianity that preached "love thy neighbor"?

      That means "have sex with the neighbor girl" nowadays. I want to know what happened to the Christianity that taught that lying was wrong.

      --
      The higher the technology, the sharper that two-edged sword.
    4. Re:Yeah by MojoRilla · · Score: 4, Informative

      Darwin's Black Box anybody. Whether or not you agree w/ his conclusions or not he does not make a stupid argument.

      Darwin's Black Box was shown to be wrong in the Dover trial. Behe's central premise that things are irreducibly complex was proven wrong both with hard scientific data (about the flagella being irreduceably complex, but the bacterial Type III secretory system has a subset of the parts, though they serve a different function) and logically (Behe says a mousetrap is irreducibly complex, but it is useful as a tie clip if you remove two key parts).

      The judge in the Dover trial summed it up by saying:

      We therefore find that Professor Behe's claim for irreducible complexity has been refuted in peer-reviewed research papers and has been rejected by the scientific community at large.

    5. Re:Yeah by Free+the+Cowards · · Score: 4, Insightful

      Regardless of those two examples, the entire concept of irreducible complexity is complete bullshit.

      Evolution does not simply add parts. It also removes them. And indeed there is a great incentive for this to happen, as every unnecessary part is an added metabolic cost to the organism which contains it.

      So let's say for a moment that some structure was discovered that were irreducibly complex. Does that disprove evolution? Absolutely not! It just means that the structure evolved from something more complex, not less.

      --
      If you mod me Overrated, you are admitting that you have no penis.
    6. Re:Yeah by JetJaguar · · Score: 5, Insightful

      You can imply that there is bias all you want, but there is one very big difference between the two. The biologist has studied biology, the scientific process involved in researching the subject and is able to make an evidenced based critique of an ID argument.

      Rebuttals from the ID camp contain no such expertise or references, and are usually based on long refuted arguments against evolution, but little or nothing that truly supports ID.

      This isn't a case where he-said she-said attempts to discredit both sides will work. One side clearly has evidence on their side, and the other does not.

      --

      Shop Smart, Shop S-mart!

    7. Re:Yeah by JetJaguar · · Score: 1

      What happened to the traditional Christianity that preached "love thy neighbor"?

      Where have you been? That part of Christianity pretty much disappeared within days of Christ's crucifixion (assuming it even happened in the first place).

      --

      Shop Smart, Shop S-mart!

    8. Re:Yeah by LordLucless · · Score: 1

      Er, but how did that original complexity that this feature devolved from come about? Wouldn't it have had to evolve too? Yeah, when you're talking about an already-existing complex organism, evolution can involve removing or simplifying existing structures. But if you're talking about how complex organisms came to be in the first place, then it's always a progression from simple to complex - unless you're positing that complex structures just suddenly appeared (i.e. creationism).

      --
      Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
    9. Re:Yeah by methuselah · · Score: 1

      wow a salient thought! I bow in your general direction.

    10. Re:Yeah by Free+the+Cowards · · Score: 4, Informative

      I'm not sure how best to explain it so I'll try with a simple example.

      Let's say the structure you're trying to evolve can be represented as ABC. The letters are different parts. Together, ABC performs some useful function. Maybe it senses light, or moves the organism, or converts energy. Doesn't matter.

      Now imagine that AB and BC are both useless constructs. The stance of the IDers is that ABC would have to evolve from constituent parts, by starting with one letter and adding more until ABC is achieved. But, they claim, since both AB and BC are useless, they would never evolve, and so ABC could never come to be. Therefore, the existence of ABC in an organism is, essentially, proof that God Did It.

      However, imagine if C is some sort of useful construct all by itself. The actual function of C could be completely different from the function of ABC, it just has to be useful in some fashion. Then we add D, another part which is not part of ABC, to form CD. Imagine that CD is also useful in some manner, potentially related to C, potentially not. Then B is added which gives it more of a useful function, so organisms have the useful construct BCD. Then A is added to give the final functionality in the more complex form of ABCD. Then D, being redundant, is eventually dropped from the organism. Therefore you have evolved the useful and "irreducibly complex" construct ABC from parts.

      --
      If you mod me Overrated, you are admitting that you have no penis.
    11. Re:Yeah by meringuoid · · Score: 4, Insightful
      When discussing the idea of 'irreducible complexity', it's probably best to consider a simple everyday system which fits the bill.

      So: consider the arch bridge.

      An arch bridge is held up by internal pressure. Remove any part of the arch bridge and the whole thing falls into the river. An arch bridge is irreducibly complex, by the creationists' definition. It works as a whole, or not at all; take any part away and it collapses.

      Does that mean, then, that all the arch bridges in the world were assembled all at once? Shipped pre-fab to the site and installed as a whole?

      Not at all! When we build such things, we use scaffolding. We first build a huge, clumsy, inefficient structure, a grid of poles and joints. This structure is flimsy, it cannot bear very great weight, nor carry much traffic - but it does span the river, it is indeed a bridge. And it can be built up piece by piece - it will stand up even if the span is not complete. Then we work on the arch bridge itself. We build up stone alongside our scaffolding. The scaffolding holds up the stone and the stone braces the scaffolding. Each new stone added strengthens the whole structure.

      And there comes a day when the arch bridge is completed. Now we find that the whole scaffolding structure is redundant - it can be done away with. That leaves only the arch. The irreducibly complex arch.

      The same could easily go for living things. Evolution can take away as well as add, and if some older structure has been made redundant by a newer development that grew from it, then that structure can surely be done away with. Behe's notion of irreducible complexity would only be a problem if evolutionary theory only allowed for organisms to become more complex over time - but if an organism is already complex, and it happens to benefit that species to become simpler, then it will do so. And it might well arrive at an 'irreducibly complex' structure from above.

      It's all a hangover of the old idea of a 'great chain of being'. It's a common misconception: men are more advanced than apes, which are more advanced than dogs, which are more advanced than... you get the picture. This is the kind of thinking where the X-Men are the 'next stage' of evolution. Evolution doesn't work that way. There's no great plan, no distant goal, no inevitable increase of sophistication. Evolution does whatever works, and if that means eliminating redundancies, refactoring, and going ahead with a simpler design, then so be it.

      --
      Real Daleks don't climb stairs - they level the building.
    12. Re:Yeah by LordLucless · · Score: 1

      The second half of your post argues against the first. We build scaffolding when we're making bridges because we have a final goal in mind - a bridge. We want a bridge, so we create the scaffolding (which is useless), and build a bridge on top of it.

      Evolution is blind - it doesn't plan. It picks out the most favourable adaptation, and runs with that. Some outliers may emerge - features that once were useful, but are now no longer due to environmental change, or that aren't useful, but aren't detrimental enough to have been selected out yet - but in general, evolution only selects things that are immediately useful.

      Now, if you're saying that the scaffolding itself acts as a bridge, then you're not providing an accurate analogy of an allegedly "irreducibly complex" structure. The whole argument of irreducible complexity is that in order to get to the complex structure, it would require the selection of structures that confer no advantage. The "scaffolding" in your analogy confers an advantage - it acts as a bridge. Therefore, a structure which was created through the use of such scaffolding is not an example of irreducible complexity.

      Note that I'm not arguing that irreducible complexity is true - it may be that there are no structures which meet it's definitions. It may be that for each structure put forward as irreducibly complex, you can put forward a series of steps in which every step is useful that would end up with the given structure. But your bridge example is just a way in which a structure is not irreducibly complex, not a way in which a truly irreducibly complex structure could have evolved (which is what needs to be demonstrated to invalidate irreducible complexity as a concept, rather than just invalidating possible examples of it on a case-by-case basis).

      --
      Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
    13. Re:Yeah by ClassMyAss · · Score: 2, Insightful

      For those of you that missed it and still might think that Behe has some semblance of a reasonable argument, let me tell you what just happened in Free The Coward's post: We saw that a ten line post on Slashdot, likely written off the cuff without any planning, is all it takes to rigorously and quite comprehensibly debunk the evolutionary fallacy that Behe's entire argument against evolution hinges on.

      I'll at least give Behe credit for filling his book with a lot of irrelevant detail that makes it seem like he's proving something.

    14. Re:Yeah by meringuoid · · Score: 3, Insightful
      The point is that if we were to arrive late on the scene and find an arch bridge, with the scaffolding long gone, we might examine the bridge, realise that if any part were removed then the whole must fall, and conclude that we were looking at an irreducibly complex system.

      In fact, of course, the bridge is the remainder of a larger, still more complex system of bridge plus scaffolding, most of which has been removed as being redundant.

      The same goes for the supposed 'irreducibly complex' structures put about by creationists. They argue that the removal of any part of such structures would cause the whole to fail completely. Perhaps they're even right. But the discussion of the arch bridge shows that it's possible to arrive at such a structure by subtraction, rather than by addition: the 'irreducible' structure exists as a relic of a more complex, less efficient system, hacked together ad hoc, which did the job poorly but nonetheless did it - and which was then gradually optimised until it achieves the engineer's perfection, when there is nothing left to take away.

      --
      Real Daleks don't climb stairs - they level the building.
    15. Re:Yeah by skeeto · · Score: 1

      Just like you don't need to consult a fairyologist to find out the size and shape of fairy wings.

    16. Re:Yeah by Free+the+Cowards · · Score: 1

      While I realize that your reply is much more based on bashing Behe than praising me (as it should be), it's still the nicest thing anyone has said to me all day. Thanks!

      --
      If you mod me Overrated, you are admitting that you have no penis.
    17. Re:Yeah by djspiegel3 · · Score: 1

      Rebuttals from the ID camp contain no such expertise or references, and are usually based on long refuted arguments against evolution, but little or nothing that truly supports ID.

      Actually, you know, I have heard a well-based defense of ID, based on "irreducible complexity," which with all the latest in technology, and knowledge of DNA, and genome projects, actually, hasn't been refuted, but is even more strongly supported.

      And in regard to expertise and references, I believe that the biologists who worked on the human genome project are probably among the most qualified of all. Funny thing, though... by the time they finally finished mapping the human genome, every last one of them believed in Intelligent Design, thinking it impossible for such a mass of intricate complexity to have evolved spontaneously.

    18. Re:Yeah by ClassMyAss · · Score: 1

      While I realize that your reply is much more based on bashing Behe than praising me (as it should be), it's still the nicest thing anyone has said to me all day. Thanks!

      No problem - and don't underestimate how much of the praise is directed at you, your explanation was extremely clear, concise, and correct, I was very happy to see someone get this right. The Behe-bashing was mainly for good measure. :)

    19. Re:Yeah by JetJaguar · · Score: 1

      This is garbage. Go read the transcript from the Dover trial. Irreducible complexity was thoroughly refuted long before the Dover trial, and during the trial it was shown exactly how.

      As for the human genome project, I think you need to check your references. Francis Collins is not an ID supporter. He is a Christian but he does not support ID.

      --

      Shop Smart, Shop S-mart!

    20. Re:Yeah by JetJaguar · · Score: 1

      In order for a fairyologist to even exist, presupposes that fairies do exist. If such things existed, such a person would know more about them than either you or I.

      --

      Shop Smart, Shop S-mart!

    21. Re:Yeah by falconwolf · · Score: 1

      I believe that the biologists who worked on the human genome project are probably among the most qualified of all. Funny thing, though... by the time they finally finished mapping the human genome, every last one of them believed in Intelligent Design

      Citation needed.

      Falcon

    22. Re:Yeah by LibertarianWackJob · · Score: 1

      Goin` home, late last night suddenly I got a fright
      Yeah I looked through the window and surprised what I saw
      Fairy boots were dancin` with a dwarf, all right now!
      Fairies wear boots and you gotta believe me
      yeah I saw it, I saw it, I tell you no lies
      Yeah Fairies wear boots and you gotta believe me
      I saw it, I saw it with my own two eyes, well all right now!

      --
      What? ®
    23. Re:Yeah by aaron+alderman · · Score: 1
      Here is another analogy.

      Imagine a stone arch. Remove any stone and it collapses (irreducible complexity).

      To build it using evolution one could use scaffolding (blocks on top of blocks) and finish by removing those blocks which aren't part of the arch.

    24. Re:Yeah by 1u3hr · · Score: 1
      , I believe that the biologists who worked on the human genome project are probably among the most qualified of all. Funny thing, though... by the time they finally finished mapping the human genome, every last one of them believed in Intelligent Design,

      Please document this incredible claim. Because, really, it is COMPLETE BULLSHIT AND LIES.

      Sorry, emails asking you to "forward this to all your Christian friends" don't count as "proof".

    25. Re:Yeah by 1u3hr · · Score: 1
      I suppose this ridiculous assertion is based on Dr. Francis Collins, director of the National Human Genome Research Institute. He is an avowed Christian. However, not a Creationist.

      It's only ONE person, and he DOES NOT believe in Intelligent Design.

      http://articles.latimes.com/2007/dec/15/science/sci-collins15

      "Unfortunately, the intelligent-design argument is scientifically flawed. My premise, which is shared by virtually all scientists who are believers and thats about 40% of scientists is that evolution is true, and it was Gods method of creation."

    26. Re:Yeah by Rocketship+Underpant · · Score: 1

      Irreducible complexity aside, there is an important challenge Behe sets before evolutionary scientists that they seem to prefer to ignore in their denunciations of Behe.

      The short version is that evolution at the molecular biological level isn't even a theory yet. It's a black-box hypothesis. You can say this spot evolved into that eye, or this fin evolved into that arm, but you might as well say that crowbars evolved into hammers if you're not going to specify at the molecular level how these immensely complicated biological systems managed to change from one state to the other and which specific alterations allowed the new traits to be passed on.

      Abiogenesis has it even worse.

      Like it or not, a fair amount of what is accepted as gospel with regards to evolution isn't really science yet, because there are no falsifiable theories. Science is hard.

      --
      He who lights his taper at mine, receives light without darkening me.
    27. Re:Yeah by DrJay · · Score: 1

      You know, you might want to consider reading the review that this story's based on, since it came up there:

      "An entire section of the book is devoted to Discovery Fellow Michael Behe's contention that complex, multiprotein systems cannot evolve, a concept called "irreducible complexity." Again, PubMed reveals no significant presence of this concept in the scientific literature. There are 18 papers, only three of which address it directly; all of them conclude that "irreducibly complex" systems can evolve. Indeed, scientists have proposed at least three mechanisms by which irreducibly complex systems can evolve, any one of which would invalidate Behe's contention that they can't. EE mentions only one of these, and again concludes that nobody really knows what's going on."

      I realize that asking someone to read the linked piece is a bit much, especially given that it's more than a page long, but it might be a good idea to do so before you stick your foot in your mouth. Reading Behe's cross examination at Dover would also be useful.

      --
      ______ This mind intentionally left blank.
    28. Re:Yeah by skeeto · · Score: 1

      Theologists exist without a god existing. ;-) There is no reason a theologist should know any more about the supernatural than, say, a gardener.

    29. Re:Yeah by Fred_A · · Score: 1

      What infuriates me is the hypocrite naming. "Discovery Institute" (what on Earth are they discovering? Or was the name chosen to make people fall for the similarity between that and the Discovery Channel?), "evolution textbook", "intelligent design" that make their idiocy sound intelligent (just as "patriot act" and similar initiatives). And they use deception so blatantly to promote their "truth"?

      They *did* consider "Christian Institute for Deceit, Propaganda and Lies" but apparently one of the founding members had a cousin in marketing who convinced them it wouldn't work for some obscure reason.

      --

      May contain traces of nut.
      Made from the freshest electrons.
    30. Re:Yeah by philspear · · Score: 1

      You can imply that there is bias all you want...

      I didn't mean to imply that, I am a biologist too, I wouldn't have given the book any time so he's much less biased than me. Just saying, there's a certain predictable dynamic here.

  4. revenge on the nerds by Phantom+of+the+Opera · · Score: 5, Insightful

    In the US, its not fashionable to know math or science. It's not fashionable to work hard. 'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).

    Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else. God forbid we ask these delicate flowers to do more than the minimum.

    Prosperity is being taken as a birthright. I half wonder if the outcry against illegal aliens is due to the fact that these people work hard. The complainers may one day be expected to. Can't have that!

    1. Re:revenge on the nerds by wrf3 · · Score: 1

      In the US, its not fashionable to know math or science. It's not fashionable to work hard.

      And why is this? What has changed about out culture that these things are no longer valued? The secularists among us might argue that "religion" has affected math and science, but I think this a false argument. Speaking to what I know from personal experience, Christians are opposed to naturalism, but not math or science. My middle child, for example, is pursing advanced studies in MEMS. And, certainly, there used to be something called the Protestant work ethic.

      'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).

      So what caused the shift from an emphasis on inward appearance to outward? Why force as a tool of leadership, instead of love?

      Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else.

      Hmmm... +5 Insigtful if I had mod points.

    2. Re:revenge on the nerds by Kamineko · · Score: 1

      Back in my day, the after school special would say both 'Believe in yourself.' and 'Stay in school.'... Sonic Sez!

    3. Re:revenge on the nerds by Phantom+of+the+Opera · · Score: 2, Insightful

      In the US, its not fashionable to know math or science. It's not fashionable to work hard.

      And why is this? What has changed about out culture that these things are no longer valued?

      I wish I knew. When is the last time we as a people have been asked to sacrifice or had to sacrifice? That's not necessarily a bad thing, but my grandparents' generation lived through WWII and the great depression.

      The secularists among us might argue that "religion" has affected math and science, but I think this a false argument.

      I agree with you. Religion is not opposed to philosophy, science or thought. I think it is a culture that has. This culture tends (IMHO) to be a rabid form of the Christian right with a tribal 'we are better than you' attitude.

      Speaking to what I know from personal experience, Christians are opposed to naturalism, but not math or science. My middle child, for example, is pursing advanced studies in MEMS. And, certainly, there used to be something called the Protestant work ethic.

      The textbook in question stems from a lack of sophisticated thought. I would rate it more tribal and political than religious. I'd doubt it would hold up to real religious scrutiny.

      'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).

      So what caused the shift from an emphasis on inward appearance to outward? Why force as a tool of leadership, instead of love?

      Force is faster. This is a society of convenience. The timing of TV's changed our perceptions. Love might take weeks, but blowing something up - that's seen to resolve in the alloted 1/2 hour or hour.

      I blame TV a lot, probably too much.

    4. Re:revenge on the nerds by dpilot · · Score: 1

      > Prosperity is being taken as a birthright. I half wonder if the outcry against illegal
      > aliens is due to the fact that these people work hard.

      I'm caught between agreeing with you on this, and thinking that you just sound like a spoiled brat CxO who doesn't want to share any of "his hard-earned money" with his employees who did most of the real work. Speaking of "Prosperity is being taken as a birthright," certainly our CxO crew has taken that one to new heights - 270X (on average) higher than the people that they insist complain too much and want too much for too little work. Not to mention that as they took home 270X the average worker's pay, they managed to completely screw the US industrial/development base, and the economy itself, to boot. I'd say we got much better service back when that number was only 40X.

      --
      The living have better things to do than to continue hating the dead.
    5. Re:revenge on the nerds by TheModelEskimo · · Score: 1

      This point of view (not fashionable to know math or work hard) has been manufactured in part by advertising groups. Do a Google search for a combination of the terms "mook" and "midriff" and you'll find out why, and how this happened.

      Basically, they present Mooks and Midriffs in the media to make people buy in to their products. Mooks and Midriffs are the type of people who make big corporations rich.

    6. Re:revenge on the nerds by Rinikusu · · Score: 1

      Huh? Name a time in history where this wasn't true? The best and brightest have been getting dumped on since time immemoriam (sp?).

      --
      If you were me, you'd be good lookin'. - six string samurai
    7. Re:revenge on the nerds by linzeal · · Score: 2, Insightful

      Too many parents worldwide use religion as a way to discipline this blurs the line between normative and natural laws. Some middle eastern and african societies have taken this and established broad regimes of terror based on their "holy" religions. Countries based on other ideologies such as humanism, socialism and even capitalism typically do not act in such wanton ways. These other sorts of countries may instigate violence and many times the violence they have instigated has been horrific but it has never been so shown to be so pervasively inhuman in modern times unless religion was involved. Serbs with their hateful xtian idealogy, Sudan and their arabs vs everyone, and the Sino Emperor Worship cult.

    8. Re:revenge on the nerds by laddiebuck · · Score: 1

      Consumerism.

    9. Re:revenge on the nerds by Phantom+of+the+Opera · · Score: 1

      I'm caught between agreeing with you on this, and thinking that you just sound like a spoiled brat CxO who doesn't want to share any of "his hard-earned money" with his employees who did most of the real work.

      Heh, if only! No, my parents are teachers and I'm just a coder. As to those top earnings, my opinions are expressed here : http://slashdot.org/comments.pl?sid=965813&cid=25028569

    10. Re:revenge on the nerds by Quiet_Desperation · · Score: 1

      Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else.

      Yeah! It's that evil Spongebob! Corrupting our youth and tainting their precious bodily fluids! Grrr! Damn his yellow, porous absorbency!

    11. Re:revenge on the nerds by BraksDad · · Score: 1

      Amen!

      --
      Slowly waving my hand - "This is not the sig you are looking for."
    12. Re:revenge on the nerds by mattack2 · · Score: 2, Informative

      I wish I knew. When is the last time we as a people have been asked to sacrifice or had to sacrifice?

      Possibly Carter's "Crisis of Confidence" speech? http://www.pbs.org/wgbh/amex/carter/filmmore/ps_crisis.html

      This is the one that people continue to mock by saying that Carter "told people to wear a sweater" (but he didn't specifically say that at all).

      Sigh...

      Moreover, I will soon submit legislation to Congress calling for the creation of this nation's first solar bank, which will help us achieve the crucial goal of 20 percent of our energy coming from solar power by the year 2000.

    13. Re:revenge on the nerds by StrategicIrony · · Score: 1

      It comes from seemingly limitless prosperity and saftey.

      When people regard themselves as totally safe and perpetually prosperous, they stop thinking they have to try, and begin to EXPECT that they are OWED.

    14. Re:revenge on the nerds by Phantom+of+the+Opera · · Score: 4, Interesting

      Good point. Instead, we got good looking genius boy.

      "Trees cause more pollution than automobiles do." -- Ronald Reagan, 1981

      "I have flown twice over Mt St. Helens out on our west coast. I'm not a scientist and I don't know the figures, but I have a suspicion that that one little mountain has probably released more sulfur dioxide into the atmosphere of the world than has been released in the last ten years of automobile driving or things of that kind that people are so concerned about." -- Ronald Reagan, 1980. (Actually, Mount St. Helens, at its peak activity, emitted about 2,000 tons of sulfur dioxide per day, compared with 81,000 tons per day by cars.)

      "The American Petroleum Institute filed suit against the EPA [and] charged that the agency was suppressing a scientific study for fear it might be misinterpreted... The suppressed study reveals that 80 percent of air pollution comes not from chimneys and auto exhaust pipes, but from plants and trees." Presidential candidate Ronald Reagan, in 1979. (There is no scientific data to support this assertion.)

    15. Re:revenge on the nerds by Hao+Wu · · Score: 1
      • It is not fashionable to work hard in EUROPE. Only in the US and Japan do people work crazy overtime.
      • Look at the internet. All you have to do is be angry and medicated.

      Looking pretty and being force wielding leaders are very good options compared to what geeks are offering. Maybe more geeks would have girlfriends if they understood that looking pretty is not unimportant or shameful. They certainly wouldn't have the persecution complexes that lead them to dark thoughts and school shootings, if only they desired to be leaders at something other than Warcraft.

      --
      I suggest you read Slashdot
    16. Re:revenge on the nerds by dpilot · · Score: 1

      Comment on your opinion: Obviously the staff hasn't been working hard enough for the past few years.

      Reality distortion field, prick of a boss, and all, I have a level of respect for Steve Jobs because he's one of the few CEOs who knows how to do anything to improve the bottom line besides cut costs and shed employees.

      --
      The living have better things to do than to continue hating the dead.
    17. Re:revenge on the nerds by cheesygrapes · · Score: 1

      In the US, its not fashionable to know math or science.

      In most of the world through most of history (with definite exceptions) knowledge of math and science were not fashionable. Just look what happened to Galileo.

      It's not fashionable to work hard.

      This is how it's been for most of history. (except for the wacky puritans who thought they'd go to hell if they didn't work) If work was fun, they wouldn't have to pay you for it.

      'Being liked' is in. Girls are encouraged to look pretty

      As opposed to the good old days when 'being hated' was in and girls were encouraged to be ugly? 'Being liked' is always in and outside of fundamentalist religious groups, girls have always been encouraged to look pretty.

      and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).

      People have always wanted to have power. The only difference is that now we have a slight amount of class mobility and so normal people who dream of becoming powerful leaders might actually be able to.

      Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself.

      I think more often, the message stressed is obedience. For example, look at Finding Nemo (number 1 grossing G rated movie). It's about a Fish who get's screwed over because he doesn't listen to his dad.

      Prosperity is being taken as a birthright.

      Damn, let's go back to when it actually was a birthright.

      I half wonder if the outcry against illegal aliens is due to the fact that these people work hard.

      This one might be right, but I think there's also a pretty strong race factor.

      And from your other post:

      So what caused the shift from an emphasis on inward appearance to outward? Why force as a tool of leadership, instead of love?

      When did leaders ever rule out of love? The more you go back in time, the more brutal leaders tend to get.

      It really bugs me that people are always trying to get back to the "good old days" when these "good old days" that they yearn for never actually existed.


      And that is my review of Phantom of the Opera's revenge of the nerds post.

    18. Re:revenge on the nerds by sunwukong · · Score: 1

      ohhhhhh ...
      who lives in a pineapple under the sea
      *spongebob squarepants*
      yellow and porous and self-confident is he!
      *spongebob squarepants*
      if high self-estimat'n is something you wish
      *spongebob squarepants*
      then grab yer ankles and blub like a fish!

      It's late ...

    19. Re:revenge on the nerds by gtall · · Score: 1

      My own view was that WWII and the Depression helped spawn the current "Look, I'm stupid so I'm cool" attitude in the U.S. After WWII, the nation had just come out of unimaginable horror (not nearly as traumatic as the Europeans or the Chinese or others went through) and the Depression. WWII built up U.S. industry. After the war, that industry had to do something and there was a recession after the war since all that industry producing had no market. The U.S. moved toward consumerism which could lap up all that capacity and the G.I. Bill put a lot of service men in College and so created an educated work force.

      That work force wanted the best for their kids. That gave the U.S. the pampered Me generations of the 1960's and 1970's. These generations weren't willing to work hard because they never had to. Science grew on trees for them. But worse, Science was seen as anathema to the Peace, Love, and Pass the LSD. And so was spawned Education schools in which method over substance was promoted. Johnny and Mary couldn't learn because Johnny and Mary needed a shot of self-esteem in the rear first.

      Now we have Johnny and Mary, who were never given a sense for the thrill of science, procreating Johnny and Mary Version 2.0. These Versions are even further lost to Science. And the Me generations with no true feeling for science are teaching John and Mary Version 2.0. The poor kneebiters are sunk.

      Gerry

    20. Re:revenge on the nerds by yakiimo · · Score: 1

      I kind of agree with you, but intelligence ("the best and the brightest" is hard to pin down meaningfully besides saying we all have variations of patterns in our nervous systems that result in different behaviors.

      Who is smarter? The guy who understands everything but can't influence the world around him very effectively, or the guy who doesn't really understand why things are the way they are but can shape the world around him? An argument can be made either way and many other ways as well.

      That is to say that being good at math and science as the GP said is not necessarily synonymous with being intelligent. It seems natural to me that people who are smart about influencing other people have been able to more or less control ("dump on") people good at other things.

    21. Re:revenge on the nerds by renoX · · Score: 1

      OK, Reagan or Bush are dumb or (just to pull a Godwin) that Hitler is a violent sadist, but you know what?
      All of them were elected!
      So what to think of the people who elected them?

    22. Re:revenge on the nerds by Blakey+Rat · · Score: 1

      Dude, that was 27 years ago. You really need to get over it, ok? Move on to how Bush stole the 2000 election from Gore, that's pretty timely. :)

    23. Re:revenge on the nerds by Phantom+of+the+Opera · · Score: 1

      Easily impressed?

    24. Re:revenge on the nerds by Phantom+of+the+Opera · · Score: 1

      Sure, but he's creeping into the debate. Republicans are tying to cast themselves as new Ronnies.

      Here is what Reagan did for America: He restored a sense of pride in the country. He made many people feel good and he listened. He was a very important President.

      He also instilled in the patriotic that America could do no wrong, no matter what she may do. Free markets will always strengthen if you don't regulate them and that wealth 'trickles down'. God gave America these natural resources and it would be a sin not to use them up as rapidly as possible. He made is fashionable to blame the destitute and mentally ill for their condition. He was the first king of deficit spending.

      It's said he brought down the 'Evil Empire'. He may have contributed, but what really hurt the world's largest oil producer was the price of oil plummeting in the 80s.

    25. Re:revenge on the nerds by Phantom+of+the+Opera · · Score: 1

      I do like to make a distinction between those who have started the business (or with the business) and those who hire into it later, just smelling success. Steve Jobs has a passion for the products Apple makes. Maybe passion is what separates out the hacks from the greats in this case. I don't mean a passion for money here.

    26. Re:revenge on the nerds by Quiet_Desperation · · Score: 1

      It's late ...

      I understand. :)

  5. So let them. by ivandavidoff · · Score: 1, Interesting

    Why are we fighting this? It's futile. Let them believe what they will believe, let them teach what they want. We've been fighting this battle since the first caveman got brained by his devout brethren for dissing the volcano god. We'll never win. Might as well leverage the ignorance of the masses somehow, like Elmer Gantry.

    1. Re:So let them. by bigbigbison · · Score: 4, Insightful

      Mainly because they don't only want to teach their children this stuff but they want to force public schools to teach every child this stuff. It is a slippery slope. Once they teach "the controversy" what else will they want to tech?

      --
      http://www.popularculturegaming.com -- my blog about the culture of videogame players
    2. Re:So let them. by Spy+der+Mann · · Score: 4, Insightful

      Why are we fighting this? It's futile. Let them believe what they will believe, let them teach what they want

      If that's the case, why are you posting your own opinion on slashdot? Let the slashdot readers believe what they will believe and let the submitters submit what they want.

      You fail to understand that if they do WHATEVER IT TAKES to convince other people of their truth, those converted people will do WHATEVER IT TAKES to convince EVERYONE of their truth. If we don't do anything to stop them, soon it will be 1984 all over the country. And I'd say we're on the edge of seeing that happening.

    3. Re:So let them. by compro01 · · Score: 1

      You forgot something important. In this reality, those proles vote.

      --
      upon the advice of my lawyer, i have no sig at this time
    4. Re:So let them. by Free+the+Cowards · · Score: 5, Insightful

      When I'm a decade or two older, the young people who will be affected by these decisions today will just be entering the workforce, bringing their bright new ideas into focus, and beginning to drive the next round of scientific and technological advances.

      I do not want these people to believe that one of the most successful, important, and useful scientific theories in history is a lie. I do not want these people to believe that "God did it" is any kind of reasonable scientific answer. I don't want the doctors and medical researchers who determine the length and quality of my old age to be spouting off about "irreducible complexity" and other such nonsense.

      You're wrong about losing the battle. Here we are conversing on a globe-spanning information network using unimaginably powerful computing machines. We've always won, and we'll keep on winning, because in the end we're right and they're wrong. But it won't be thanks to people like you.

      --
      If you mod me Overrated, you are admitting that you have no penis.
    5. Re:So let them. by methuselah · · Score: 1

      what are you retarded? you have read 1984 have you? bah.

    6. Re:So let them. by Wonko+the+Sane · · Score: 1

      tech? So are we talking about Scientology now?

    7. Re:So let them. by CorporateSuit · · Score: 1, Insightful

      Mainly because they don't only want to teach their children this stuff but they want to force public schools to teach every child this stuff. It is a slippery slope. Once they teach "the controversy" what else will they want to tech?

      Maybe they'll even teach something like "Evolution is mostly popular because many atheists think it can discount the first two pages of the bible, thereby disproving god forever"

      Or that, chemically and mathematically, life on Earth only has a 1:1,200,000,000,000,000,000 chance of happening the way evolutionists predict? That it's six trillion times more likely that life started with an asteroid colliding with earth containing life, than the Atheist non-god shooting lightning bolts at wet rocks to develop, program, and animate DNA, that it might begin compiling itself as the most intense lines of code ever written in an attempt to blindly, unknowingly, coincidentally construct the most powerful, intelligent, coherent machines in the universe, run by compact, concise, reasoning processors and dangle the illusion of sentience in front of these animated batches of inanimate chemicals like a carrot on a string -- in order to keep them recompiling itself (DNA) at sustainable rates? You realize how stupid that actually sounds?

      Is that what they'll want to teach? That science doesn't have all the answers yet, and it's current "best theory" is a broken, flailing ship being tossed from its course every five years -- that every kid in that classroom has a chance of figuring out a more likely scenario, scientifically, than evolution's claim of how the genesis of life on our planet happened.

      They start teaching that, the truth, instead of seperate theories and stories AS truth, and kids might actually be interested in science again.

      But I doubt that's what they want to teach. A man can sometimes only dream...

      --
      I am the richest astronaut ever to win the superbowl.
    8. Re:So let them. by penix1 · · Score: 1

      Believe? Sure. Whatever people like. And I'll defend their right. But, no, I won't stand by and let people teach any old nonsense as science. If they want to teach this other stuff, do it in a comparative religion course or philosophy.

      First off, when was the last time you saw a "religion course or philosophy" taught in K-12 public schools? It isn't because to do so would be immediately challenged in court as violating the 1st amendment. Public school boards across the country are under the gun to educate while having their hands tied in what they can offer in education. College is usually the first place a person is exposed to either of those courses which I contend is too late.

      Second, just read the comments in this topic. Read your comment again in the light of offering a religious class in public school. You would be screaming up and down about that too especially if they skip a religion or make it a mandatory class.

      --
      This is a sig. This is only a sig. Had this been an actual sig you would have been informed where to tune for more sigs.
    9. Re:So let them. by abigor · · Score: 1, Troll

      The awesome thing about stories like this is it reveals who the religious kooks are, and so discredits any assertions they ever make about anything, past or present.

    10. Re:So let them. by belmolis · · Score: 3, Insightful

      The reason they don't teach what you say is because it is false. It simply isn't true that evolution is "a broken, flailing ship being tossed from its course every five years" or that evolution is popular because it appeals to atheists. You have to know something about evolutionary biology to understand why the former is false, but to see that the latter is false you need only realize that there are far fewer atheists than people who accept evolution and that many non-atheists, including most Jews, Catholics, and mainline Protestants, accept evolution.

      Incidentally, it is quite possible to believe in god without believing in the literal truth of Genesis. Numerous people outside the Judaeo-Christian tradition do. And on the other hand, evolution is hardly necessary to discredit literal belief in Genesis. Genesis isn't even internally consistent.

    11. Re:So let them. by StrategicIrony · · Score: 2, Funny

      Or that, chemically and mathematically, life on Earth only has a 1:1,200,000,000,000,000,000 chance of happening the way evolutionists predict?

      Wow!!!

      There are probably more than that number of planetary systems in the universe, so there's better than a 1:1 chance of life existing by biochemical and mathematical chance.

      I think your number is exagerated, or you pulled it out of your ass, but if it's accurate, you just proved that it's LIKELY that life would evolve from nothing somewhere in the universe.

      Thanks for doing the hard part... :-)

    12. Re:So let them. by Just+Some+Guy · · Score: 1

      Maybe they'll even teach something like "Evolution is mostly popular because many atheists think it can discount the first two pages of the bible, thereby disproving god forever"

      Yes, I'm sure that some knuckle-dragging anti-knowledge jackass will say exactly that. The sad part is that their students will someday be expected to differentiate between fairy tale and reality but will have no experience with doing so.

      I'm a conservative Christian, by the way. I just don't believe that God hates us and delights in playing cruel hoaxes on his beloved.

      --
      Dewey, what part of this looks like authorities should be involved?
    13. Re:So let them. by mog007 · · Score: 1, Informative

      Oh goodie! A fundie!

      "Evolution is mostly popular because many atheists think it can discount the first two pages of the bible, thereby disproving god forever"

      First, we'll start with that... um... mess. Evolution isn't popular because it furthers an agenda for atheists. Atheists are a minority. The majority of people, who believe evolution describes the diversity of life, and who live in the United States are... drumroll... Christians. That's right, you crazy Christians are the majority of proponents of evolution. Also, atheism existed long before Charles Darwin wrote about evolution. The word "atheism" comes from an ancient Greek word meaning "without god".

      Or that, chemically and mathematically, life on Earth only has a 1:1,200,000,000,000,000,000 chance of happening the way evolutionists predict?

      I'm assuming you're calculating that based on the number of atoms in every molecule in a protein or amino acid or something. Chemistry is not bound by probability. It's governed by the electromagnetic force. There's no chance involved. When you pour vinegar into a bowl filled with baking soda, there's no probability that there's going to be a reaction, the reaction is inevitable.

      Is that what they'll want to teach? That science doesn't have all the answers yet ...

      The day science has all the answers is the day science is no longer done. When you know EVERYTHING about EVERYTHING, you've got no reason to ask any questions about anything you see, because you already have the answer. Scientists do NOT have the answers. Back when science was used to discover the earth was NOT the center of the universe, the scientists had no preconceived notions about whether or not it would actually be in the center of the universe, they just had to check. When the first scientists discovered the earth was much older than their holy texts told them it was, they were amazed. You think the first person who used science to determine that the earth wasn't made a few thousand years ago had an agenda? He was trying to confirm his faith through science, but the reality of the situation was: his faith was wrong. Sure, it's possible he had an agenda to deconvert everybody into a bunch of raving heathens, but the key with science is evidence, not belief. You're free to believe what you want, but if you want to convince a scientist of your belief, you need EVIDENCE, and a single book written about 1800 years ago is NOT compelling evidence. Science also provides verifiable predictions. It's almost like seeing into the future, with astounding accuracy, because they've already done all the hard work and can calculate how something will be, if their idea has merit.

    14. Re:So let them. by robot_love · · Score: 1

      You're on a roll today, Free the Cowards! :)

      --
      .there is enough of everything for everyone.
    15. Re:So let them. by bigbigbison · · Score: 1

      Maybe they'll also teach that monkeys fly. The Roman Catholic church doesn't have any issues with evolution and they aren't exactly atheists...

      --
      http://www.popularculturegaming.com -- my blog about the culture of videogame players
    16. Re:So let them. by ChromaticDragon · · Score: 1

      Philosophy in High School may be a stretch. But I would imagine that any number of public High Schools likely have humanities courses that teach the world's major religions.

      I had such a course in my Freshman year. It served as a combination English and Social Studies class. I cannot recall the exact title. It was part of a Humanities magnet program, however.

      In any case, we did indeed do fairly in depth study of the basic tenets and practices of the world's major religions. Hilariously though, the teachers (team taught) informed us that we would perform the worst on our own religion (whatever it was). This proved to be the case. The cause seemed to be that everyone found it interesting to learn about other faiths, but nobody wanted to do much deep investigation on their own.

      Though a bit more to topic, I don't think there'd be any justification or need to stress ID or even teach it in such a course. Again I said major religions. As many have already stated, the majority of what most would consider some flavor or another of Christianity would not necessarily have any issue with theories of Common Descent.

      Ironically, I do think ID should be taught in a science course. It should be part of whenever you teach what the Scientific Method is and what it is not. The goal wouldn't be so much to pillory religion, per se. The goal should simply be to help folk understand issues of hypotheses, falsifiability, Scientific Theories, etc. ID stands as an EXCELLENT counter example.

    17. Re:So let them. by LarsG · · Score: 1

      Maybe they'll even teach something like "Evolution is mostly popular because many atheists think it can discount the first two pages of the bible, thereby disproving god forever"

      Oh my, we've been found out! Yes the theory of evolution is obviously an ebil conspiracy by the crazed atheists that have nothing better to do with their short time on this planet than to rob you of your faith in god.

      Or that, chemically and mathematically, life on Earth only has a 1:1,200,000,000,000,000,000 chance

      Cute big number. Mind sharing how you came up with it?

      happening the way evolutionists predict?

      The theory of evolution makes many testable predictions. Please mention at least one lab experiment or anything in the fossil record that is incompatible with the predictions of evolution. (Adaptation, Genetic drift, Gene flow, Mutation, Natural selection, Speciation).

      That it's six trillion times more likely that life started with an asteroid colliding with earth containing life.

      You seem to confuse evolution and abiogenesis. Evolution only deals with how life evolves, it is not a theory of how life started.

      Is that what they'll want to teach? That science doesn't have all the answers yet

      Yes, that's exactly what we should teach. Science is the effort to discover, and increase human understanding of how the physical world works. We should teach our current best understanding ("theories"), be it gravity or evolution, and also teach the scientific method so that they have the tools needed to test the current theories and come up with better ones if the tests show that our current theories are deficient.

      They start teaching that, the truth, instead of separate theories and stories AS truth, and kids might actually be interested in science again.

      Is gravity true or not? It certainly is close to what we would call a fact, and at least in lower grades children are taught Newton's law of gravity as a fairly good approximation.

      What would you rather that we should teach about gravity? That it is a plot by atheists trying to hide the fact that the sun revolves around the earth?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    18. Re:So let them. by Phroggy · · Score: 1

      The funny thing about the Drake equation is that most of the numbers you have to plug into it, we have no data on, so everybody just makes stuff up, and then they come up with a number that they can say must be accurate because the math all checks out.

      --
      $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
      $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
    19. Re:So let them. by JavaRob · · Score: 1

      Illustration.

      Yup... sometimes I think it's just as well, since the world might be a better place if America loses some of their power (happening already, I guess).

      But there are ways for that to happen that require less suffering from all of the citizens involved....

    20. Re:So let them. by CorporateSuit · · Score: 1

      The reason they don't teach what you say is because it is false. It simply isn't true that evolution is "a broken, flailing ship being tossed from its course every five years" or that evolution is popular because it appeals to atheists. You have to know something about evolutionary biology to understand why the former is false

      Go ahead and ask five evolutionsts to describe how life began on this planet, and you'll hear two or three different stories (most popular, of course, is lightning bolt striking primordial soup). It's constantly changing. It should change, of course, as data is presented to get a more accurate picture, but it shouldn't be heralded as the answer (or even scientific) when they can't claim any basis of observation as to what actually happened. Until then, it's a ship caught in a storm without a rudder.

      As for your "evolution is not popular because of atheists" I ask you to go through any evolution topic and NOT run into the straw man "in a bathrobe." As Dawkins suggested, evolutionism eventually leads to athism. Atheism eventually leads to nihilism. If you're not there yet, you haven't thought it through enough. The religions that have embraced evolution will either have to divorce themselves from it in the coming years, or will be exposed as the farces they are for pronouncing something that, in turn, devours them.

      Ridiculously enough, "evolutionism" is rated as a more important scientific discovery than genetics, cellular biology, DNA, quantum mechanics, relativity, atomic science, electronics and computer science, and any other scientific discovery or invention of our time. It's rated number one. Yes, that's like saying that having a painted car is more important than having a car with an engine. It's like saying it's more important to have an airplane with blue seats than an airplane with wings. There is no way that evolution even benefits mankind in any way, shape, or form (genetics, cellular biology, and study of DNA certainly do, but they're not EVOLUTION anymore than biology is phrenology.) yet, "scientists" around the globe say it's so important. Why?

      The concept that evolution is the most important scientific discovery in recent times is so unbelievably stupid, hardheaded, and obtusely-blind that it calls into question the ability to reason among all the atheists who fly it as their banner. That's right, kids, Scooby Doo pulled the mask off of the big, smart scientist costume, and there was an idiot inside who needed something to vindicate his hatred of others' beliefs. Sadly enough, if there weren't enough idiots in that costume that this applies to, it wouldn't have been rated number one... Disagree with me? Re-read the paragraph above this one again, and answer the question yourself -- but certainly take your time to answer it. I suggest at least taking a walk, making a sandwich, cleaning your house, or actually researching evolution before you decide on your response. The question deserves the time it takes to come up with a reasonable answer, not based on any knee-jerk reaction or momentary emotional explosion. It's nothing personal, it's just an observation. ;)

      --
      I am the richest astronaut ever to win the superbowl.
    21. Re:So let them. by JohnFluxx · · Score: 1

      You state the odds are 1 in:

      1,200,000,000,000,000,000

      In the visible universe there are approx:

      1,000,000,000,000,000,000,000 stars.

      So even using the number that you pulled from your arse, that's a pretty good chance that life will evolve in the universe.

    22. Re:So let them. by JohnFluxx · · Score: 1

      I can shoot down your entire point with a simple equation. I hope you can think long and hard about what this means:

      evolution != abiogenesis

    23. Re:So let them. by CorporateSuit · · Score: 1

      I can shoot down your entire point with a simple equation. I hope you can think long and hard about what this means: evolution != abiogenesis

      evolution != mutation
      evolution != adaptation
      evolution != survival of the fittest
      evolution != selective breeding

      The theory is made up by the sum of its parts. If you want to try moving the target and saying "Evolutionists don't believe in abiogenesis" then I suggest you CONSULT with some evolutionists. Maybe you're comfortable with discarding the single greatest irreconcilable difference between evolutionism and intelligent design, but I'm not so sure your proported cohorts are.

      Besides, this just goes back to what I said earlier: You ask 5 evolutionists how life began on the planet, and you'll get 2-3 answers. You didn't give your answer, but you do seem to claim it's different from the mainstream. If not, then we have nothing to discuss here.

      --
      I am the richest astronaut ever to win the superbowl.
    24. Re:So let them. by JohnFluxx · · Score: 1

      Wow, you managed to take away from my statement that evolutionists don't believe in abogenesis?

      I'll just copy-pasta from talk origins since this has been answered hundreds of times before:

      Response:

            1. The theory of evolution applies as long as life exists. How that life came to exist is not relevant to evolution. Claiming that evolution does not apply without a theory of abiogenesis makes as much sense as saying that umbrellas do not work without a theory of meteorology.

            2. Abiogenesis is a fact. Regardless of how you imagine it happened (note that creation is a theory of abiogenesis), it is a fact that there once was no life on earth and that now there is. Thus, even if evolution needs abiogenesis, it has it.

    25. Re:So let them. by LarsG · · Score: 1

      Go ahead and ask five evolutionsts to describe how life began on this planet, and you'll hear two or three different stories (most popular, of course, is lightning bolt striking primordial soup). It's constantly changing. It should change, of course, as data is presented to get a more accurate picture, but it shouldn't be heralded as the answer (or even scientific) when they can't claim any basis of observation as to what actually happened. Until then, it's a ship caught in a storm without a rudder.

      You might have missed the fact that the Theory of Evolution does not contain an explanation of abiogenesis. ToE is a theory of how life evolves once life exists.

      If you ask "evolutionists" (whatever that is) about how life started, you are obviously going to get a lot of different answers. And that is simply because there is no coherent tested theory of that yet, so what you get from them are thought experiments and their current best guesses.

      That abiogenesis is still in the dark does however not mean that ToE itself is "caught in a storm without a rudder".

      The origin of life is a necessary precursor for biological evolution, but understanding that evolution occurred once organisms appeared and investigating how this happens does not depend on understanding exactly how life began. The current scientific consensus is that the complex biochemistry that makes up life came from simpler chemical reactions, but it is unclear how this occurred. Not much is certain about the earliest developments in life, the structure of the first living things, or the identity and nature of any last universal common ancestor or ancestral gene pool. Consequently, there is no scientific consensus on how life began, but proposals include self-replicating molecules such as RNA, and the assembly of simple cells.

      Atheism eventually leads to nihilism.

      Oh, that old argument again. "In the absence of faith, man will just revert to this lawless beast that only thinks of himself and has no regard for others."

      Those that believe that must have such a horribly sad view of humanity. It is a puzzle to me why they have so little faith in humanity that they believe that we need a constant Damocles Sword of Eternal Damnation hanging over our heads in order to keep us on the narrow path and Paradise as a carrot to keep us from depression and suicide.

      There must be something utterly broken in the minds of those that have so little faith in their fellow humans.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  6. Intelligent Design, Stupid Tactics by cliffiecee · · Score: 4, Insightful

    What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.

    As I understand science, it's a cycle: observe, explain, hypothesize, test; and repeat. Evolution as a theory, holds to this cycle. But Intelligent Design is just: observe and explain- the explanation being essentially "God did it." There's not much reason to keep examining things when you feel you've reached that stage, is it? It's an intellectual dead end.

    If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like. When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).

    1. Re:Intelligent Design, Stupid Tactics by Torontoman · · Score: 5, Insightful

      ID is about as legit as Scientology.

    2. Re:Intelligent Design, Stupid Tactics by 99BottlesOfBeerInMyF · · Score: 4, Insightful

      What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.

      That's because you and the religious fundamentalist leaders have different goals.

      If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like.

      ID isn't about finding science that is sufficiently speculative and trying to insert "God". It's about finding science that is sufficiently confusing to the average person so that some will be able to be convinced while others will not. If there isn't strong controversy, then people don't get emotional and angry and feel they need to fight and give exploiters money to help with the fight.

      If they weren't laughed at so hard, they'd be arguing that the sun revolves around the earth, because that is in conflict with absurdly literal interpretations of the bible. In fact, in some poorly educated communities, they are making that argument. It's just too absurd for the mainstream US (who can understand enough astronomy or at least see the pictures, to understand otherwise). So they pick the most outrageous untruth possible that they can talk a significant number of ignorant saps into believing. That way there are two "sides" and the religious can feel they are being attacked and need to strike back, by sending their money in and casting their votes to fight for their religion... even though mainstream christianity moved on and has accepted evolution (and heliocentrism) for a long time.

      Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).

      And that is where you fail. They aren't interested in logic or reason, but in emotionally charged attacks and intentionally spread confusion as a way of manipulating the sheep. Seriously, how many of these so called scientists and preachers do you think have any interest in really promoting christianity instead of making a buck or getting elected? If they were really christians they'd be focusing on the core message of Jesus, which is still not well understood; things like reacting to violence with nonviolence and treating people you disagree with peacefully and respectfully in spite of said disagreement.

    3. Re:Intelligent Design, Stupid Tactics by eball · · Score: 1

      Because young people, the easiest to indoctrinate, don't know about the creation of the cosmos yet. But even an 8 year old can say "Wait, if the earth is only 6000 years old, when did this T. Rex on my T-shirt live?" In other words, you have to defend your idea on the grounds by which it is most easily disproved. If someone says "There is evidence in the layers of the earth that there was no flood, and that you are an idiot," you can't just say "Well, string theory doesn't explain that either." You have to defend yourself, no matter how bad of a job you do at it, on the grounds on which you are being challenged.

    4. Re:Intelligent Design, Stupid Tactics by Concerned+Onlooker · · Score: 1

      "When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. "

      No. That's exactly what ID does today. Whenever science doesn't have a quick and ready answer for something then the creationists automatically attribute it to "god." When we can't explain why something is the way it is it simply means there is not enough data or technique to discover the answer. It does not mean that some mythical being created the thing in question.

      You had it right at first. To be legit ID will have to complete the cycle of observe, hypothesize and test until they've gathered enough data to form a--you guessed it--theory.

      --
      http://www.rootstrikers.org/
    5. Re:Intelligent Design, Stupid Tactics by Anonymous Coward · · Score: 1, Insightful

      Not this again.

      A theory is just a falsifiable statement of how things work. Theories can either be supported by evidence (e.g., evolution) or not.

      Evolution is both a theory and a fact. Microevolution has been SEEN. It's not up for debate. It's a fact. Macroevolution is so well supported by evidence that only the ignorant doubt it. About the only thing that is questionable in all of evolution is abiogenesis, but oddly the I.D. kooks rarely go after it preferring to focus on how "we're not evolved from monkeys."

      Intelligent Design is not a scientific theory. It's not falsifiable because it relies on an intelligent designer which, by definition, cannot be proven not to exist.

      So there is really only one "side" to this debate as far as science is concerned. Now, if you want I.D. taught in schools, might I suggest dropping the designer part to make it falsifiable and then busting your ass for the next 200 years to get even a shred of the evidence that evolution has already acquired in support of itself.

    6. Re:Intelligent Design, Stupid Tactics by Wonko+the+Sane · · Score: 4, Informative

      Evolution is a theory. That's all it ever has been and all it ever will be.

      Just like gravity

      We'll never be able to actually go out and test evolution.

      False

      But the same reasoning applies to intelligent design, which has made great advances in understanding life at the biochemical level.

      Citation needed

    7. Re:Intelligent Design, Stupid Tactics by Vellmont · · Score: 1


      When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s

      That hasn't worked well historically speaking

      --
      AccountKiller
    8. Re:Intelligent Design, Stupid Tactics by Free+the+Cowards · · Score: 2, Insightful

      I'm sorry, gravity is a fact? Show it to me. I say that things fall down because they like the Earth and want to be happy.

      Atomic interactions are fact? Have you ever seen an atom? Show one to me, then maybe I'll believe it's a fact.

      Optics? Binoculars work because God shows you a clearer, larger image. Telescopes show lies about the Universe because they are the Devil's devices.

      Plate tectonics are obviously not facts. The Earth was created only 6000 years ago, don't you know. Plate tectonics would have no time to function over such a short period.

      Go on, tell me why I should take all of those as "fact" but evolution is "just a theory". I can't wait.

      --
      If you mod me Overrated, you are admitting that you have no penis.
    9. Re:Intelligent Design, Stupid Tactics by methuselah · · Score: 1

      well if you read a little bit of history to go along with all the science of yours you might find there is a pattern of plausible divine intervention. however i am sure your answer would be the ufo's did it. its not an either or. if god did create us then he does understand us however, it does not hold that we can understand him. deny the existence of something that you have never actually looked for does not mean it isn't there.

    10. Re:Intelligent Design, Stupid Tactics by StrategicIrony · · Score: 1

      Evolution as a theory

      Science should be about teaching students SOLID, known facts, not "theories". They should learn about gravity and atomic interaction and optics and the kinds of rocks and plate techtonics.

      Hahaha! You mean the Theory of gravity and Atomic Theory?

      You do realize, of course, that these are accepted as having "reasonable evidence of being factual" but are actually theories, just like everything else in biology and chemistry. A theory is something that someone has postulated using the scientific method. Generally, theories will be studied and refined by scientists until it is disproven scientifically. So far, gravity and atomic theory as they stand have been distilled from dozens of theories on the topic and are generally accepted as accurate (if somewhat incomplete).

      Evolutionary theory is exactly the same in this regard. It is generally accepted, though recognized as incomplete, but has never been scientifically disproven. There may be questions about it, but there are NO reputable scientists who deny evolution on any scale. There are a few (somewhere on the order of a tenth of a percent) who question whether this can expand to a larger scale), but nobody has ever put forth a reputable biological, chemical, genetic or morphological reason other than "wow, that blows my mind" to postulate what exactly would cause this "macro-evolution" barrier. Without scientific disproof and WITH massive amounts of evidence to support it, it is considered a very strong theory.

      They should not be taught some bizarre dream that some guy hobbled together based on a few coincidental pieces of evidence.

      If by "some guy", you mean somewhere on the order of a quarter of a million top scientists, and by "a few coincidental pieces of evidence", you mean somewhere on the order of three quarters of a million fossils, over 110,000 scientific papers spanning 400 years.... uhm.... sure.... whatever you say dude.

      That's just not what science is.

      Uhm, read my previous paragraph. That is exactly what science is. It is the epitome of modern science and the application of the scientific method, to be honest.

      Evolution is a theory. That's all it ever has been and all it ever will be. We'll never be able to actually go out and test evolution.

      It's a theory in as much as "the sun probably has a heavy metal core, undergoing massive fusion" is a theory.

      We will never test it directly, but we have pretty damn good evidence from observation, that it's true, at least until we have some better explanation that follows scientific reason. It IS ENTIRELY POSSIBLE that there is a giant iguana breathing fire at the core of the sun, and we will never know. It's simply not scientific to teach that, even if someone might hold that theory.

      All we really have is faith, and that's exactly why it's important to teach students about alternate belief systems.

      Yes, faith! This is why it belongs in theology or philosophy, not science.

      I still think evolution should be taught in science class because obviously you have to be on the up and up about what's going on.

      Young-earth creationism has about as much evidence going for it as the old Hindu "earth was created during a cataclysmic fight between Brahma and Vishnu sometime before time existed"... which isn't science either, even if I still respect Hindu beliefs about spirituality and faith, just like Christianity.

      But the same reasoning applies to intelligent design, which has made great advances in understanding life at the biochemical level.

      PLEASE enlighten me. What advance has intelligent design contri

    11. Re:Intelligent Design, Stupid Tactics by The_Wilschon · · Score: 1, Informative

      It's not falsifiable because it relies on an intelligent designer which, by definition, cannot be proven not to exist.

      You've almost got this right, but your argument doesn't work as it stands. Observe:

      Quantum mechanics is not falsifiable because it relies on the number 1, which cannot be proven not to exist.

      See the problem? There are plenty of reasons why ID is not science, but this is not one of them. Another example:

      My theory involves invisible pink elephants, undetectable elves, and other universes which do not interact even indirectly with ours. It unequivocally predicts that the sky is green and not blue.

      This theory is science because it makes a falsifiable prediction. It relies on unfalsifiable constructs, but it is still itself falsifiable and therefore science.

      --
      SIGSEGV caught, terminating

      wait... not that kind of sig.
    12. Re:Intelligent Design, Stupid Tactics by 99BottlesOfBeerInMyF · · Score: 1

      wow your cynicism and bigotry are profound.

      I'm certainly a cynic, most of us become so with age. As for bigotry, I have no problem at all with people holding different beliefs than I do, but that doesn't mean I blind myself to the most likely motivations of those presenting any given information.

      i would like to point out that all the crap you are spouting was shoved into your head by people with agendas also.

      Really, who do you suppose it was that shoved those ideas into my head? What motivations do you think they had? Please be specific.

      if you weren't a narrow minded brainwashed non thinking minion of the leftist pseudo intelligentsia and were capable of independent thought...

      Leftist intelligencia? I don't think anyone who knows me would describe me as leftist since I'm a strong advocate of so many beliefs and policies left wing politicians object to.

      ...and apologize for being an idiot, jerk, and hypocrite. oh and your belief system sucks too.

      I'm rubber and you're glue? I really hope you're twelve years old. Your favorite OS sucks.

      P.S. your shift key is broken.

    13. Re:Intelligent Design, Stupid Tactics by Concerned+Onlooker · · Score: 1

      "well if you read a little bit of history to go along with all the science of yours you might find there is a pattern of plausible divine intervention."

      Please, please, please tell me you are joking. History is creative writing. And you want me to put that up against the scientific method?

      --
      http://www.rootstrikers.org/
    14. Re:Intelligent Design, Stupid Tactics by vitamine73 · · Score: 1

      *THAT's* when you can trot out the "God did it"s

      that does not solve their problem because it doesn't explain anything and leads to an infinite loop if you then try to "explain" the existence of god in the same way: "who/what made god?" ... "who/what made the who/what that made god?" and so on. moreover...

      Intelligent Design is just: observe and explain

      actually, it's more like: find an explanation, then try to come up with "evidence" supporting it. They also love quote-mining.

    15. Re:Intelligent Design, Stupid Tactics by methuselah · · Score: 1

      yes i do
      i know lets just elect you arbiter of everything and declare that what you "believe" to the truth is fact. If you have never seen the color blue then blue does not exist!
      wow what an intellect you have.

    16. Re:Intelligent Design, Stupid Tactics by methuselah · · Score: 1

      I'm certainly a cynic, most of us become so with age. As for bigotry, I have no problem at all with people holding different beliefs than I do, but that doesn't mean I blind myself to the most likely motivations of those presenting any given information.

      so you know the motivations of everyone in every situation?

      Really, who do you suppose it was that shoved those ideas into my head? What motivations do you think they had? Please be specific.

      they are obviously not the product of any kind of rational thought processes.

      Leftist intelligencia? I don't think anyone who knows me would describe me as leftist since I'm a strong advocate of so many beliefs and policies left wing politicians object to.

      i was referring to your obvious atheistic and humanistic leanings not your politics. you know there are generally multiple meaning to some words and then you have to view them in this think called context. I would think that someone who is obviously as brilliant as you would know that without having to have is actually spelled out for you.

      I'm rubber and you're glue? I really hope you're twelve years old. Your favorite OS sucks.

      good comeback its right there at your apparent intellectual level

      P.S. your shift key is broken.

      no its not it just hasn't evolved one yet...

    17. Re:Intelligent Design, Stupid Tactics by Concerned+Onlooker · · Score: 1

      No, that is exactly the point. I am NOT the arbiter. Repeatable results are. It's not what I believe, it's what I can prove. That is the beauty of science, it doesn't ask people to believe "just because" but rather it shows results. Repeatable results.

      --
      http://www.rootstrikers.org/
    18. Re:Intelligent Design, Stupid Tactics by eball · · Score: 1

      I'm not sure how stupid you think kids are, but whether or not they understand HOW large something is, they understand that a world that is 6000 years old couldn't have harbored animals 65 million years ago. It's just a matter of knowing one number is bigger than the other.
      Also, feel free to grab a dictionary, and check out subtle differences between "argument" and "example." "Troll" might be a good one too (perhaps webopedia might be more helpful for that one...).

    19. Re:Intelligent Design, Stupid Tactics by meringuoid · · Score: 1
      If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like. When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).

      You ought to apply for a job at the Vatican. That's what they do. Scientists say the Universe began in a hot, dense fireball of intense radiation? Fine. 'And God said, let there be light. And there was light.'

      The problem for fundamentalists is this. If the modern view of human origins is correct, then the Genesis story is not true. If the Genesis story is not true then there was no Fall. If there was no Fall then there is no Original Sin. If there is no Original Sin then there is no need for salvation. If there is no need for salvation then there is no need for Christ. If there is no need for Christ then there is no need for Christianity. If there is no need for Christianity then there is no need for fundamentalists. If there is no need for fundamentalists, then they have to go and get a proper job.

      Hence, Creationism.

      --
      Real Daleks don't climb stairs - they level the building.
    20. Re:Intelligent Design, Stupid Tactics by GaryPatterson · · Score: 2, Insightful

      Quantum mechanics is not falsifiable because it relies on the number 1, which cannot be proven not to exist.

      Mathematics relies on axioms, which do not require proof. If you can define new axioms and still produce theories that fit observable data, there's probably a Nobel Prize waiting for you.

      Quantum Mechanics is a set of theories that fit observable data, and are definitely falsifiable.

      My theory involves invisible pink elephants, undetectable elves, and other universes which do not interact even indirectly with ours. It unequivocally predicts that the sky is green and not blue.

      This theory is science because it makes a falsifiable prediction. It relies on unfalsifiable constructs, but it is still itself falsifiable and therefore science.

      You are completely correct here - your theory is science. Where you go wrong is assuming that it has any value. The outcome is empirically wrong, so the theory must be incorrect. Back to the drawing board to look for a theory (which can say whatever you like) that fits the observable data.

      That's actually quite a good example of science in action. A bad theory is easily disproven.

    21. Re:Intelligent Design, Stupid Tactics by GaryPatterson · · Score: 1

      ...all the science of yours...

      You don't seem to mind using the products of science - transistors, electricity, plastics, metals - when it suits you. Maybe it's just some areas in science that are objectionable to you. It's a shame that the same rigourous process applies in all areas of science, but perhaps we'll just sweep that under the rug, eh? ...pattern of plausible divine intervention...

      No, there is no pattern. Just like staring at a cloud, you'll see patterns that aren't really there. Stare at the static on a TV screen. Stare at a fire. Stare at the ocean. Stare at any random visual element long enough, and you'll notice your brain's remarkable ability to pick patterns out of chaos. (As an aside, that'd be a handy survival trait for a hunter/gatherer living in grasslands - spotting hidden predators and all that.) The patterns you perceive in history are not automatically perceived by others.

      You're correct to say that absence of evidence does not imply evidence of absence (well, it seemed you were trying to say that) but if religious groups insist on putting up theories of their own that conflict with tried and tested theories, they have a burden of proof - they must demonstrate that their theories fit the observable data better than the current ones. It'd also be nice if their theories were falsifiable (ie actual "theory" instead of "made up stuff").

    22. Re:Intelligent Design, Stupid Tactics by methuselah · · Score: 1

      good point. doesn't make mine invalid though

    23. Re:Intelligent Design, Stupid Tactics by Jeremy+Erwin · · Score: 1

      Um, those are experimental tests for stuff like, "does the Jizz whale have the same nucleotide sequence in location X as a goat". Remind me what that has to do with evolution? That's biochemistry.

      You like your little compartments don't you? All nice and neat with no overlap: Animals in one box, plants in another, and humans in yet a third. I think that's why biochemistry appeals to people like Behe-- all the proteins can be though of little gears, sprockets and girders that can be used by some intelligent designer to assemble an organism-- with no extra parts, no half assed solutions, no Rube Goldberg devices. I have some advice for you: read a biochemistry journal or textbook sometime-- they aren't evolution free zones.

      And if you want to actually work on sequence analysis, an understanding of the statistical ramifications of evolution is invaluable.

    24. Re:Intelligent Design, Stupid Tactics by methuselah · · Score: 1

      when it comes to someone's personal beliefs I don't really think that there is any burden of proof. please keep in mind i really don't see intelligent design as a theory. i also see an awful lot of what i would call faith in what is being called science particularly when in come to the question of where did it all come from. scientists see to have this propensity to extrapolate obvious facts through what they call logic out to some pretty absurd conclusions and still insist its science. consensus is not science. a lot of the theory of evolution is conjecture. if anyone was truly honest about it they would admit that. i'm not going to get into the common sense validity of it but, perspective does play a role in conjecture. i just don't think that anyone is truly objective once they take a stand on this topic.

    25. Re:Intelligent Design, Stupid Tactics by Secret+Rabbit · · Score: 1

      You still wouldn't have a leg to stand on comparing ID to any Big Bang nor String "Theory."

      You see, the Big Bang theories are being tested against every year as we get more powerful Colliders, and the theories are developed further (i.e. more testable predictions produced). So, with each passing year, any given Big Bang is either thrown out or more evidence is found in its favour. They cycle holds.

      When it comes to String "Theory," it's in *really* big trouble. The only reason why anyone outside the labs know anything about it is the *massive* PR campaigns put on by its participants. When it comes to the scientific community thoughts on it... well, it's a *very* different story than what's coming from the Proles. In fact, the only things that String "Theory" has been good for, is developing some interesting techniques (Mathematical) and ideas that have benefited *real* Physics research.

      In other words, String "Theory" is fine as a toy. But, the whole String Theory notion spun wildly out of control. Thankfully, and this is where your argument falls on its face:

      It is currently being corrected.

      If you don't believe me, just check out the distribution of funding in the last couple years. String "Theory's" piece of the pie is getting smaller and smaller and smaller.

      I'll also point out that many a Theory has started like "String Theory." So, entertaining such notions ARE part of the scientific process. It looked interesting in the beginning, like it might lead somewhere. Now that the likeliness of that is waning, Administration's perception has caught up with reality and its funding is being dramatically cut. The cycle holds.

      To give you another example, I just need to point to the variable speed of light guys. It most certainly solves a number of problems, but they've yet to produce a cohesive theory. They're working on it, and I for one and quite interested in what is produced. But, it'll take a while. Patience. Sometimes these things need a few decades (or more actually) to see that it's not going to work out.

    26. Re:Intelligent Design, Stupid Tactics by robot_love · · Score: 3, Informative

      If memory serves me correct, Behe's books were completely and utterly shredded in the recent Kansas court case.

      I doubt you will, but you can start your reading here:

      http://www.talkorigins.org/faqs/behe.html

      --
      .there is enough of everything for everyone.
    27. Re:Intelligent Design, Stupid Tactics by methuselah · · Score: 1

      I agree with you totally. there are things that there are only one of and came into existence over a span that we can not fathom. There is no right answer that we can come up with that explains how it all came into existence and ordered itself. my problem with evolution is not that i think it is wrong. i find it all makes pretty good sense actually. I also find it perfectly plausible that it was all winked into existence. its great fun to sit around and speculate on what happened. my rub is when your convoluted perception of how it all happened is somehow fact and any other convoluted perception is wrong and therefore must be crushed. zealotry is zealotry just because you think you are on the right side of an issue doesn't justify it.

    28. Re:Intelligent Design, Stupid Tactics by mqduck · · Score: 1

      New theory: God is tiny vibrating strings!

      --
      Property is theft.
    29. Re:Intelligent Design, Stupid Tactics by djspiegel3 · · Score: 1

      Actually, ID is supported by the Big Bang, and the Laws of Thermodynamics, and General Relativity. In fact all of these point to a definite beginning of the universe as we know it, including, but not limited to, time, space, and matter. Therefore, for the universe to exist, something which/whose existence is outside of the universe is necessary. Hence, being outside of time, it must be eternal, being outside of space, it must be infinite, being outside of matter, it must be immaterial. Not only do these scientifically proven facts (Big Bang, 2Law, and GR) point to these qualifications, but they also require that this eternal, infinite, and immaterial whatever be intelligent, and personal. Something, or whatever, is not capable of causing the existence of a universe that is so fine-tuned to the very existence of life without being intelligent. And by necessity, it must also be personal, because an impersonal whatever/something does not have the capability of making any choice, much less the choice to cause the existence of a fine-tuned universe. So, if even the the most high, profoundly, and widely accepted, and broadly proven scientific fact (2nd Law of Thermodynamics) points to a creation of the universe, not accepting and teaching Intelligent Design "demands stupidity," to quote the reviewer. As for evolution, now that's a whole other can of worms. Yes, it has been researched; no, it has not been tested. No scientist has ever observed a spontaneous appearance of a new species from another. The rationale behind the theory of evolution is actually very interesting, it shows a great deal of keen insight. It was, however, based upon a limited knowledge of science from over a century ago. If evolution were in fact true, we would expect to see intermediate specimins, between species. We would also expect to see different life forms show up chronologically in the fossil records, whereas, we actually see all varieties of viruses, monera, protista, fungi, plants, invertibrates and vertebrates show up in the fossil record all at the same time, at the beginning of the Pre-Cambrian era. If anything, I would say that Evolution is not based on scientific fact, whereas Intelligent Design is, as noted above.

    30. Re:Intelligent Design, Stupid Tactics by djspiegel3 · · Score: 1

      Macroevolution is so well supported by evidence that only the ignorant doubt it.

      The only evidence that can possibly support macroevolution, is the exact same evidence that points to creationism. The only thing that changes is how the evidence is interpreted. Now, in my previous diatribe, I assumed an unbiased point of view, in which the most proven scientific facts, point to a theistic worldview. Evolution, on the other hand, to arrive at an interpretation that supports evolution, can only get there by starting with a bias: namely, a non-theistic worldview. Bias is unscientific in that it causes a self-serving basis to reach its own conclusion, at the exclusion of any other possibility. What I did above was the exact opposite, I let the evidence of the Big Bang, the Laws of Thermodynamics, and General Relativity, to speak for themselves, the the conclusion is noted above. THAT is scientific analysis of the evidence.

    31. Re:Intelligent Design, Stupid Tactics by LSD-OBS · · Score: 1

      *THAT's* when you can trot out the "God did it"

      Like hell you can. The scientific method requires that your theory fits as "tightly" around the facts and experiments as possible (see Occam's Razor). It logically follows that you can't start making up theories like "somebody created us" when you can find no direct evidence of the existence of the "somebody" in the first place.

      Also, just because you can't explain something doesn't automatically make someone else's baseless theory more correct - that's a terrible logical fallacy.

      --
      Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
    32. Re:Intelligent Design, Stupid Tactics by SiriusRegalis · · Score: 2, Informative

      I know this is off topic, but it is a personal pet peeve. Just for the sake of accuracy, Persians (Iranians preferred name) Teach Evolution heavily. The purely religious institutions don't, but they also don't teach against it. Except the "hillbillies" of the country, a very small percentage of the population. Basically, the areas comparable to the back woods of Arkansas with no electricity.

      They think that Evolution is fact.

      In fact, I cannot tell you how many times the evolution debate in this country has made a Persians ask me about it, assuming I, being American, must be creationist. When they find out I am not, they ask me why Americans are so stupid. My Wife (A Beautiful Persian woman) laughs and makes fun of my Uncle, a fundamentalist Christian. Though they are careful to try to avoid me hearing so as to not give offense, they actually make fun of the US over these things. This came up as a topic of conversation each and every time I was over there. They actually wanted to know if it was true, or just more propaganda from their government to make us look bad.

      This idea that Iran is backwards, just because their president is divisive and they are on some "Axis of Evil" list created primarily for political "Us vs. Them" games is really frustrating. Remember, they have a ruling class that uses the uneducated violent minority to enforce its lust for power. But it is a minority, less than 10%. We have a larger ultra-religious group of zealots in this country. Their president makes those crazy statements because it appeals to the minority powerbase, and it gets attention on a world stage.

      I have never met a Persian who did not believe that the holocaust happened and was terrible. Oh, they don't like Isreal's POLITICS, but they have no problem with jews. They equally don't like Palestinian Politics. (though are less likely to like Palestinians)

      Iran is actually quite "western". Our allies (Saudi Arabia, Kuwait, Etc...) in the middle east are actually much closer to the stereotypes that are applied to Iran. Iran was fighting the Taliban before most Americans even know Afghanistan continued to exist after the russian left. They were demonstrating and providing support for Afghan women before we knew there was a problem. A woman with out a college degree in Iran is looked at with disdain, "why didn't she go to college and make herself better and educated?" The same applies to men by the way.

    33. Re:Intelligent Design, Stupid Tactics by bidule · · Score: 1

      ChuckSchwab here, karma limits me from using my name again for some reason.

      Just like gravity

      Uh, sorry dude, gravity isn't a "theory". Gravity is a FACT, and I'm appalled that in this day an age there are still people like you who dismiss it as just another theory.

      Erm, sorry dude. Gravity is a theory. Mercury's precession is a FACT. And that fact is not supported by the theory.

      --
      ID: the nose did not occur naturally, how would we wear glasses otherwise? (apologies to Voltaire)
    34. Re:Intelligent Design, Stupid Tactics by localman · · Score: 1

      Evolution is a theory.

      You know what's a riot about the conflict between evolution and intelligent design? If you got to the creationism museum sometime, and have the intestinal fortitude to actually read through their description of the past 6000 years, you'll come across a very interesting bit.

      Since it is quite obvious that all the diversity of life could not have fit on Noah's Ark, they are required to explain the upwards of 2 million different species we see around us. Their explanation? Speciation through natural selection. I'm serious. They don't call it evolution and they hand wave some of the details, but they basically say that evolution took place after Noah's Ark (in only a few thousand years!!!) to explain the contradiction between the size of the ark and the diversity of life on earth.

      It's insanity, I tell you. Insanity.

      Yep, it's a theory. A very good one that explains a whole lot. Just as solid a theory as anything else you mentioned. And we've observed evolution: just check out antibiotic resistant bacteria. No evolutionary biologist was surprised at what happened there, though everyone else was. Evolution predicted exactly that outcome. Why do you think?

      Cheers.

    35. Re:Intelligent Design, Stupid Tactics by LSD-OBS · · Score: 1

      when it comes to someone's personal beliefs I don't really think that there is any burden of proof

      It's fairly obvious beliefs which aren't based on proof or logic are, at best, dreams, and at worst, lies. I only ask for the permission to describe them as such, because that's exactly what they are.

      consensus is not science

      Consensus *is* science. That's exactly what it is: when many scientists and people who are experts in a field agree on an interpretation of verifiable facts.

      Furthermore, have you ever heard of a chap called Einstein? This whole theory of relativity thing of his sounds like *complete* nonsense. It sure did sound completely absurd when I first heard it. And do you know how he came up with it? By extrapolating obvious facts -- a little thing he called a "thought experiment."

      Thing is, his logic was sound. It turns out that thousands upon thousands of experiments in the last century have proved many, many aspects of relativity.

      Funny what you can achieve with logical extrapolation. Perhaps you could try it sometime?

      --
      Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
    36. Re:Intelligent Design, Stupid Tactics by Greyfox · · Score: 1
      Last I checked physicists didn't have an explanation as to why when you get a bunch of matter together it attracts stuff. Since they can't explain it, they can't tell you with 100% certainty that it'll work tomorrow. Perhaps God did it and if you have enough Faith in Him, gravity will not apply to you.

      Currently seeking individuals to test this hypothesis from the top of a tall building.

      --

      I'm trying to teach myself to set people on fire with my mind... Is it hot in here?

    37. Re:Intelligent Design, Stupid Tactics by LarsG · · Score: 1

      Something, or whatever, is not capable of causing the existence of a universe that is so fine-tuned to the very existence of life without being intelligent.

      I were with you up until this point. The above makes no sense to me, I see no requirement for intelligence in the conditions that caused the big bang. Your argument is equivalent to "The position of the earth is so fine-tuned to the very existence of life, so it must have been placed at this exact point in the solar system by some intelligence".

      With all the solar systems in the universe, isn't random chance a sufficient explanation and that our particular planet got lucky? The same with the big bang, how do we know that this universe is the only universe? We might just happen to be a winner in the great lottery of the multiverse, no intelligent creator required.

      No scientist has ever observed a spontaneous appearance of a new species from another.

      Sure we haven't. Well, it depends a bit on what one defines as separate species but it has certainly been observed and also created in labs for at least some definitions of the word.

      whereas, we actually see all varieties of viruses, monera, protista, fungi, plants, invertebrates and vertebrates show up in the fossil record all at the same time, at the beginning of the Pre-Cambrian era.

      If by "same time" you mean 70-80 million years.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    38. Re:Intelligent Design, Stupid Tactics by Concerned+Onlooker · · Score: 1

      Just nevermind.

      --
      http://www.rootstrikers.org/
    39. Re:Intelligent Design, Stupid Tactics by wildsurf · · Score: 1

      My theory involves invisible pink elephants, undetectable elves, and other universes which do not interact even indirectly with ours. It unequivocally predicts that the sky is green and not blue.

      You are completely correct here - your theory is science. Where you go wrong is assuming that it has any value. The outcome is empirically wrong, so the theory must be incorrect.

      The incorrectness of the prediction is beside the point. Note that this "theory" would be just as useless if it predicts that the sky were blue.

      The reason is that a useful theory predicts or accounts for a wide range of observations, relative to the theory's complexity. Since there already exists a much more elegant theory that perfectly accounts for the sky's blueness (the solar spectrum, combined with light-scattering properties of the atmosphere), while incidentally providing deep insight into the nature of light and electromagnetism, the pink-elephant theory becomes doubly useless.

      Note that ID doesn't actually even predict anything: it just states "things are the way they are, because god diddit." That isn't science: it's a cop-out. If ID predicted the existence of a particular species living on the ocean floor, and next year we discover exactly that species, then that would be something to talk about. But it doesn't. So it isn't.

      --
      Weeks of coding saves hours of planning.
    40. Re:Intelligent Design, Stupid Tactics by ionix5891 · · Score: 1

      the voice from the closet is violently disagreeing with you

    41. Re:Intelligent Design, Stupid Tactics by 91degrees · · Score: 1

      THAT's* when you can trot out the "God did it"s.

      Yes and no...

      If you believe that some supernatural force started off the Big Bang, then there's nothing I can say to argue against it.

      On the other hand there's no real reason for believing that. So ultimately it's just a matter of faith.

      No problem with that. It's just important to understand that it's highly speculative and that there's a difference between science and religion.

    42. Re:Intelligent Design, Stupid Tactics by RealGrouchy · · Score: 1

      See also the PBS Nova documentary Judgment Day: Intelligent Design On Trial (Nov 2007).

      (Don't forget to support PBS for providing this stuff available free online!)

      - RG>

      --
      Hey pal, this isn't a pleasantforest, so don't waste my time with pleasantries!
    43. Re:Intelligent Design, Stupid Tactics by DrJay · · Score: 1

      Wow, way to get a bunch of stuff wrong. I was especially struck by this:
      "we actually see all varieties of viruses, monera, protista, fungi, plants, invertibrates and vertebrates show up in the fossil record all at the same time"

      Could you explain how to find a fossil of a virus?

      And, incidentally, none of those things appeared in the fossil record at the same time. I see that getting your facts straight is optional.

      --
      ______ This mind intentionally left blank.
    44. Re:Intelligent Design, Stupid Tactics by LarsG · · Score: 1

      I think you just proved his point.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    45. Re:Intelligent Design, Stupid Tactics by Beezlebub33 · · Score: 1

      I read it. Regardless of the correctness or incorrectness of it's conclusions, it does not support the contention that:

      But the same reasoning applies to intelligent design, which has made great advances in understanding life at the biochemical level.

      What are the great advances? Name one? That we don't understand the origins of the bacterial flagella (though we have some ideas, nothing conclusive yet). Well, we knew that. What is the advance to this knowledge that Behe provides? Nothing. He draws a conclusion based on our lack of knowledge of the origins, but offers nothing in terms of additional information about it's origins. I've got my copy right here. Please point to a page where he provides a explanation for the origins of the bacterial flagellum. When, for example, was it designed? What was designed?

      The response by ID'ers about such requests for information consists of the following: "We don't provide explanations." No, really, they claim that they don't have to, because their pet theory wins because evolution fails. And evolution (in their opinion) fails because it cannot provide a step by step explanation, along with probabilities of new mutations, their selelctive advantages, and the names of the individuals involved. And so, ID'ers don't feel the need to do any research on their ideas, because they think they win by default while they keep their fingers in their ears claming 'That's not enough, I win!'

      Intelligent design has not provided anything of scientific value. Please, please provide something if there is anything. It is a wholly negative philosophical stance.

      --
      The more people I meet, the better I like my dog.
    46. Re:Intelligent Design, Stupid Tactics by sydneyfong · · Score: 1

      Just like gravity

      Whenever somebody jumps off a building, the devil pushes him to the ground so that he could have another new recruit in hell.

      --
      Don't quote me on this.
    47. Re:Intelligent Design, Stupid Tactics by sydneyfong · · Score: 1

      Go on, tell me why I should take all of those as "fact" but evolution is "just a theory". I can't wait.

      Because God told me so.

      --
      Don't quote me on this.
    48. Re:Intelligent Design, Stupid Tactics by VJ42 · · Score: 1

      Evolution, on the other hand, to arrive at an interpretation that supports evolution, can only get there by starting with a bias: namely, a non-theistic worldview.

      Here you are wrong, I have holy scripture that can beinterprited to support evolution. It just so happens that it's a different religion that yours. The Wikipedia article is a good place to start if you want a broader view on how Hinduism sits with evolution.

      --
      If I have nothing to hide, you have no reason to search me
    49. Re:Intelligent Design, Stupid Tactics by TrekkieGod · · Score: 1

      even though evolution is still basically just a theory at this point

      You have a serious problem with the use of the word theory in science. It does not mean the same as the word theory when used in casual english.

      Take the theory of gravity for example. It's pretty well tested, but it's a scientific theory. It's never going to graduate from that, because a scientific theory, by definition, is a well-tested hypothesis that has not been disproven.

      Allow me to demonstrate and explain the difference. FACT: Things fall. Theory: Objects with mass attract one another with a force equal to F=G*m1*m2/(r^2). Prediction: Based on the theory, all objects fall at the same rate, regardless of their mass. Test: drop objects of different mass in a vacuum, observe them fall at the same rate. Prediction: acceleration due to gravity on the moon will be 1.6 m/s^2. Test: Drop things on moon, measure their fall rate. Anytime one of these tests give results that do not fit prediction, we say that our theory is incorrect and revise it to fit the new observations.

      There are also hypotheses, which are weaker than theories, and more like speculations. Example: "gravity does not behave at F=G*m1*m2/(r^2) at very large scales, and this accounts for the "missing mass" that we observe in the universe instead of 'dark matter'. There's no way we can test that yet, so it's not as strong as a theory (theory is the strongest statement you can make in science). It is falsifiable in that it does make predictions and it is therefore still scientific (and it has, in fact, been falsified as it is not sufficient to explain away all the effects attributed to dark matter).

      So...evolution. Theory: A combination of mutation, gene exchange, and environmental pressures results in adaptation of living organisms. Prediction: addition of antibiotics to a bacterial population may cause the bacteria to develop a resistance. Test: Superbugs exist. Prediction: Breeding of foxes by selecting those that are tamer toward humans will cause them to develop dog-like traits, in the same way the domestication of wolves led to the different breeds dogs we have today. Test: Tame Silver Foxes. There are many other predictions made. Once evolution fails a prediction, that particular theory will be revised, and replaced by a better one.

      Now here's why ID isn't a scientific theory. Prediction: "Evolution from one species to another cannot occur without intelligent guidance". Test: ???. When you observe the evolution into a new species how can you prove that an intelligent ultra-powerful being wasn't involved? It gives no testable predictions that differ from standard evolution and its other claims are unfalsifiable. That doesn't mean ID is wrong, it could be right, but unfalsifiable=not science.

      In short, evolution is the only theory that can be taught in a science classroom. When your kid gets home, or when he's in sunday school, you can feel free to supplement that teaching with "the evolution you studied was guided by this higher being." However, that's a personal unscientific belief. It could be right, it could be wrong, but it's most definitely unscientific.

      --

      Warning: Opinions known to be heavily biased.

    50. Re:Intelligent Design, Stupid Tactics by Chuichupachichi · · Score: 1

      What they are really saying is that after the flood, "micro-evolution" took place. Thus, it was not necessary for Noah to take a Black bear, a brown one and a Polar bear also. But rather, just one type of bear. Same went for the other animals of which there are many variations of the species. Take only relatively recently born animals since they take less space and will be needed to reproduce later. Of course, fish wouldn't need a boat ride. So you can subtract them and the variations from your count. Variation, "micro-evo", later took care of causing the different types of bears seen today. Millions of years are not required. This is known, since you can take a pair of dogs and within your own lifetime, you can change the lines physical form and coloration considerably. Its funny how you get things all backwards. You attribute macro-evolution to the occurrence of micro-evo. Claiming that Macro-evo is what falsifies the claims. Then you once again attribute the incorrect Macro-evolution to variegated, antibiotic resistant bacteria. Only this time, you claim that the same reversal is what proves your view. Macro-evo has never had proof of its existence. Which is exactly why you have to resort to extrapolating the mere variation of bacteria as if it were proof of it.

    51. Re:Intelligent Design, Stupid Tactics by Chuichupachichi · · Score: 1

      First of all, the ID scientists don't engage in referring to any "designer" with their scientific work. Therefor, there they don't present a theory regarding a "designer", which requires the attribution of being "falsifiable". Since they've never developed such a theory. They simply demonstrate that the world and universe contain much evidence of the presence of "design". Thats where the facts lead to. The rest is not their business, or line of work, regarding who or what, people may credit the designing to. I have "observed" your defective explanation. ("See the problem? There are plenty of reasons why ID is not science") The problem is that you and most evoists believe that the attribution of ID is itself, claimed to be the actual science. Or usually, its spoken of by evoists as if somebody has claimed that its the theory developed to explain the workings or characteristics of a subject of inquiry. ID scientists conduct research, applying the processes of science. Sometimes working from, or testing a theory, which sometimes leads to the discovery of factual data. The data itself, often strongly suggests, or leaves no other reasonable explanation other than that the subject of their inquiry was designed. Your pink elephants and elves "theory", is no such thing. At least it would never be a theory of science. Since a true scientific theory is developed by being based on known facts. When at first its a hypothesis, its heavily scrutinized in light of known facts. To determine whether or not its even plausible. If plausible, then it may be considered a theory. No existing data of "pink" elephants or "elves"!

    52. Re:Intelligent Design, Stupid Tactics by Chuichupachichi · · Score: 1

      Your over simplifying the matter. Life on earth is dependent on many, many more fine tunings, than just the position of the earth within our solar system. Also, our sun is a very particular type of star. Only its particular type, is capable of being the kind of energy source, star. Which is required for having a planetary system in which life can exist. Those many other solar systems which you speak about that are throughout the universe. The vast majority of them don't have the correct type of star. With all of the lacking of the correct for life, type of solar systems. Added to the incredible multitude of factors, both in outer space and within our atmosphere. Which are finely tuned and their detuning would make life impossible. Makes non intelligent processes of "random chance" the already mathematically calculated, to be an implausible hypothesis. DNA contains so much ordered, sequenced information, that the probability of the spontaneous generation of life has been "conservatively" calculated. To have the odds of X:1, X being a number so large that its more than the amount of particles that scientists have calculated to exist in the universe. "Particles"! Those are sub-atomic.

    53. Re:Intelligent Design, Stupid Tactics by LarsG · · Score: 1

      Makes non intelligent processes of "random chance" the already mathematically calculated, to be an implausible hypothesis.

      Are you speaking of the Drake equation? Depending on what estimates you use, the value ranges from something like 500 to close to zero concurrent extraterrestrial civilizations in our galaxy.

      If you are not thinking of Drake, mind sharing what "already mathematically calculated" thing you are referring to? And besides, such a calculation would probably only come up with the chance for our particular form of life. Even on earth, there are organisms that thrive in conditions that we would consider completely unsuitable for life - like around hydrothermal vents on the sea floor. There is also nothing that says that DNA is the only option, so an attempt to "mathematically calculate" to any kind of certainty the chance of life being out there is rather futile due to the huge uncertainties in the values you would plug into this equation.

      DNA contains so much ordered, sequenced information, that the probability of the spontaneous generation of life has been "conservatively" calculated.

      The DNA in modern organisms is not a product of chance alone; it is under selective pressure. To calculate the chance of a human spontaneously self-assembling from dead matter would be silly.

      If you are talking about the assembly of the very first self-reproducing molecule/molecules or cells I would be very interested to know exactly which molecules you are speaking of. Self-replicating ribozymes, perhaps?

      To have the odds of X:1, X being a number so large that its more than the amount of particles that scientists have calculated to exist in the universe. "Particles"! Those are sub-atomic.

      Citation needed. Mind sharing what magic equation these scientists used?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    54. Re:Intelligent Design, Stupid Tactics by LarsG · · Score: 1

      What they are really saying is that after the flood, "micro-evolution" took place. Thus, it was not necessary for Noah to take a Black bear, a brown one and a Polar bear also. But rather, just one type of bear.

      How long ago was this supposed flood?

      You do know that we are now capable of sequencing DNA? That makes it possible to compare the DNA of different organisms and estimate how long ago their common ancestor walked the earth.

      There is also the issue of the fossil record. If this flood happened fairly recently, it should be fairly easy to check this theory of yours.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    55. Re:Intelligent Design, Stupid Tactics by LarsG · · Score: 1

      They simply demonstrate that the world and universe contain much evidence of the presence of "design".

      Mind sharing with us what this evidence is?

      And please don't bring up that old Behe flagellum unless you want to bring some facts to the table.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    56. Re:Intelligent Design, Stupid Tactics by localman · · Score: 1

      I know it's fun to cling to beliefs, and in fact people generally get pleasurable stimulation from rejecting ideas that contradict their beliefs, but you owe it to yourself to take a more inquisitive stance. You might like to turn that back around on me, but in fact I used to deny evolution as you do, and I took the time to research it with an open mind and eventually got it. How often do you update your beliefs based on new information? Unless it happens regularly you can pretty well be assured you're wrong about a lot of things, since nobody is always right from the get go.

      I have heard the micro-vs-macro distinction before, and it's a crock. The journey of a thousand miles begins with a single step. Once you accept micro-evolution and understand the age of the earth, it all falls into place and makes a lot more sense than any other explanation. In fact, your belief that the world's species could have differentiated from a large boat in just the past 4300 years or so puts far more power in the hands of natural selection than even I would be willing to give it. You may want to do some comparisons on the the number of distinct genera in the world, their locations, and how much space would be required to house them.

      And to be clear: the existence of macro-evolution has absolutely nothing to do with faith in God. You can believe in God and macro-evolution. Most people I know do.

      Christ, my wife's heritage (Korean history) goes back further than the the flood. It's just ridiculous the level of factual denial one must go through to take an absolute interpretation of the bible.

      Keep your faith, and like many of the first scientists, let observation, data, and experiment inform your knowledge of "the mind of God". That is what the exploration of science is all about.

      Cheers.

    57. Re:Intelligent Design, Stupid Tactics by Chuichupachichi · · Score: 1

      The way my comment was written, was a bit confusing. Since my reply was to a comment regarding the probability of other life. But the writer of the comment, concluded by saying that earth may have hit the lotto and got lucky to have life occur by random chance. He said its probability would be quite likely. Therefor, my comment mentioned the rarity of other stars of the type like ours(alludes to prob. of other life). But everything else was regarding the finely tuned, highly ordered conditions enabling life on earth. My having spoken of the math probability, I was referring to spontaneous generation of a living organism. You said, calculations which only consider our particular type of life. Science knows not of any other composition of life, but earth life. Therefor, to have a view of that the possibility of other, merely speculated, unknown life. Somehow trumps, or should displace any subscription to the validity of mathematically calculated to be an improbable occurrence of the spontaneous generation of the only type of life which science does know. Is not sound reasoning. I'm not saying that speculating of that life may exist elsewhere, is not sound. But that since its merely speculation, therefor lays outside of anything produced by the processes of science. To attribute a higher value to that, then to the existence of things known and their calculated probabilities, is unsound. By doing that, you'd be doing exactly what evolutionists claim of that Creationists do. That the unscientifically supported view is being valued greater than that which science can be applied to. Your words - ("Even on earth, there are organisms that thrive in conditions that we would consider completely unsuitable for life") - I dont know of anyone that considers "Earth" as unsuitable for life. Certainly, there are places with extreme conditions. But those are generally regarded as unsuitable for higher life forms. When speaking of microbial organisms, I dont think anyone is much surprised when they're discovered in places of extreme conditions. They've even been found in tar pits. Feeding on the tar, they can feed on the asphalt in the streets.

    58. Re:Intelligent Design, Stupid Tactics by Slur · · Score: 1

      Uh, sorry dude, gravity isn't a "theory". Gravity is a FACT

      Well, if you're using formal scientific terms (which you should be in this discussion) the word "gravity" is a label for the theoretical force and/or bending of space and the mathematics that embody it. It's a theory because it is free to be revised as new experimental data becomes available.

      When you describe the pen falling experiment, that's the way you gather the facts that inform the theory - how fast the pen fell and so forth.

      So, I'm just picking on your semantics. When scientists speak in popular media they will sometimes use the word "fact" in the conventional sense, to be understood by ordinary folks. For example in one of the Cosmos segments Carl Sagan emphatically states: "Evolution is a fact, not a theory. It really happened." We can be as certain of the process of evolution as we are that it rained last Thursday, because the data unambiguously supports it.

      Okay. Behe, Michael. Darwin's Black Box. Look it up, smartass.

      This is no Isaac Newton you're talking about. If he had good science, his ideas would be accepted. He simply points out holes in our understanding and tries to fill them in with "and then a miracle occurs."

      Look, either the whole of existence is a miracle or none of it is. Actually, let me restate that. The whole of existence is a miracle and none of it is. If you know exactly what I mean, kudos to you! The gist of what I'm saying is that the universe is quite wonderful and it works just perfectly, without any conspicuous intervention. In theistic terms, any obvious evidence of divine intervention would imply that God is capricious or erred in the initial creation.

      Frankly, the universe makes much more sense if you stop separating "god" and "creation" into separate entities. I think a close reading of the New Testament shows clearly that the Christ - like the Buddha - was doing his level best to get people to stop cherishing their stupid gray matter pinhole map of the universe and their silly laws of conduct, and realize the unity of the mundane and the divine through the practice of self-transcendence (through meditating and following precepts).

      But, as I always say... the Bible confuses far more than it helps in this regard. Buddhism is a far more thorough accounting of the Dharma, and far better appeals to the modern rational mind. The way is the way is the way, after all...

      --
      -- thinkyhead software and media
    59. Re:Intelligent Design, Stupid Tactics by The_Wilschon · · Score: 1

      Quantum mechanics is not falsifiable because it relies on the number 1, which cannot be proven not to exist.

      Quantum Mechanics is a set of theories that fit observable data, and are definitely falsifiable.

      Yes. That was rather the point. The AC I originally replied to claimed that ID is not science for an incorrect reason (to wit, that it relies on an unfalsifiable construct). I gave a counterexample (two in fact), a theory that relied on an unfalsifiable construct but that was still science (valuable or not).

      It would probably be good if you would read both your parent and your grandparent comment before replying in the future. This might help you avoid this sort of confusion in the future.

      --
      SIGSEGV caught, terminating

      wait... not that kind of sig.
  7. I'm sorry by way2trivial · · Score: 3, Funny

    are you suggestion that there is any occasion where it is proper to diss the volcano god?

    What the hell is wrong with you- do you want to be responsible for the entire town burning down?

    don't you care about your neighbors or family at all?

    dang- move far away from everyone before you say anything like that again please.

    --
    every day http://en.wikipedia.org/wiki/Special:Random
  8. Let the idiots be idiots by Luscious868 · · Score: 2, Insightful

    Let the wingnuts in Kansas and other red states teach creationism or any other loony idea they want and let those of us who are in the blue states teach real science and math and critical thinking skills and let's see which population is more successful in our knowledge based economy 10 - 20 years down the road. Let the free market decide, as they say, with one condition. Let's do away with welfare and let the religious nut jobs who aren't interested in teaching science, math and critical thinking reap what they sew.

    1. Re:Let the idiots be idiots by spazdor · · Score: 1

      This would be perfect reasoning if not for the fact that kids don't get to choose their parents.

      Your plan is to punish an entire generation of kids for the poor reasoning skills of their parents.

      --
      DRM: Terminator crops for your mind!
    2. Re:Let the idiots be idiots by jeevesbond · · Score: 1

      Let the wingnuts in Kansas and other red states teach creationism or any other loony idea they want and let those of us who are in the blue states teach real science and math and critical thinking skills and let's see which population is more successful in our knowledge based economy 10 - 20 years down the road.

      I'm a Brit, and used to think like this too. What does it matter if a bunch of them crazy Yanks believe the world was created 6,000 years ago? Unfortunately for us critical thinkers, daft ideas spread . And now we have the Internet, stupid ideas can travel like wildfire.

      One thing we need to learn: no state, province, county or country has a monopoly on stupidity. Being an idiot really is a game the whole family can play! :)

      --
      I'm going to transform myself into a mighty hawk. Either that or I'll just go and work at Dixons, haven't decided yet.
    3. Re:Let the idiots be idiots by couchslug · · Score: 1

      That's not a bad idea. I favor a parental opt-out for science and biology classes because both sides MUST like the outcome.

      The Christian Taliban can avoid polluting their young with evil ideas, and we can avoid polluting scientific fields with Superstitionists. Christians must like this choice because it cannot have a bad outcome for them.

      This is a war where neither side will be convinced of anything different, so non-Superstitionists should leverage superstition to maneuver Superstitionists out of the way.

      As learning science and technology becomes more demanding, the barrier to entry will be higher. Self-imposed barriers to entry by people we don't need there in the first place can usefully backfire. Religionists in the US are Fundamentally enemies of science (the tiny number on Slashdot don't matter) so the thing to do is exactly what their leaders do. Provide choices they will want to accept because of their beliefs. We have every right and social duty to manipulate these people in this manner.

      --
      "This post is an artistic work of fiction and falsehood. Only a fool would take anything posted here as fact."
    4. Re:Let the idiots be idiots by jcr · · Score: 1

      stupid ideas can travel like wildfire.

      So can refutations of said stupid ideas.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    5. Re:Let the idiots be idiots by jeevesbond · · Score: 1

      So can refutations of said stupid ideas.

      The problem with that is, people don't believe the refutations! :)

      Perhaps I should have said that stupid ideologies can travel like wildfire.

      --
      I'm going to transform myself into a mighty hawk. Either that or I'll just go and work at Dixons, haven't decided yet.
    6. Re:Let the idiots be idiots by GaryPatterson · · Score: 1

      There was a great line in one of the Terry Pratchett books:

      "A lie can run around the world before the truth has put its boots on."

      Refutations are never as widespread as the lies. Just look to an politics for more examples.

      I'm pretty sure that if this were not so, the world would be a far better place.

    7. Re:Let the idiots be idiots by falconwolf · · Score: 1

      Let the wingnuts in Kansas and other red states teach creationism or any other loony idea

      Think of the children. You really want to be sadistic don't you? ;-)

      Falcon

    8. Re:Let the idiots be idiots by mechsoph · · Score: 1

      Yes! Go "States Rights!"

    9. Re:Let the idiots be idiots by Fred_A · · Score: 1

      And apparently creationism silliness is also getting fairly popular in several former eastern bloc countries such as Poland. I presume the UK is targeted because there is no language barrier for the US groups.
      They're also starting in Africa it seems... :(

      --

      May contain traces of nut.
      Made from the freshest electrons.
  9. No, it doesn't. by Empiric · · Score: 1, Troll

    Simple fact is, an extensive elaboration on, say, the Copenhagen Interpretation versus the Everett Interpretation, -even were one demonstrated false-, would not "promote stupidity", much less "demand" it. Simply having to follow the arguments to critically evaluate the question at hand, -even if 100% of the students thus rejected ID-, would do nothing but increase the students familiarity with the biological questions at hand, and challenge them to be able to analytically utilize them.

    However, this last statement does strike me as fully representative of the overall politicalization of the question the reviewer engages in throughout (at least he explicitly states he's doing so, justifying it by saying it's "where ID started", even though that's false in ID's case, it started with Behe publishing a book on biochem and its implications on evolutionary theory), and the overall tinge of a kind of deep defensive bias the piece reeks of.

    Particularly funny was the part where he chides the book for not anticipating evidence that he presumes of-course will be found, which is basically tantamount to concluding a particular sub-issue on the basis on -no present evidence-, something he'd never let ID get away with.

    Standard straw-man of representing ID as simply the most easily-dismissed notion of "Creationism" of anyone on the planet, standard ignoring of the fact that "evolution happens" is not actually debated by anyone advocating ID, and his particular meaning equivocating it to "only evolution happens" is fully scientifically untestable, and will never change from being untestable, and that desire to conclude such causal exclusivity for the -actual- motivation at hand is simply a non-sequitur, even were it testable.

    The main thing that bothers me is the cultural framework this creates of closing science into dogma. Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.

    Anyway, I'm heading out for the weekend, so I doubt I'll be able to follow up to any replies right away. Since Natural Selection will inevitably take care of my response for me, though, I won't worry about it too much. Later.

    --
    ~ Whence do you come, slayer of men, or where are you going, conqueror of space?
    1. Re:No, it doesn't. by Sebastopol · · Score: 3, Insightful

      In your first paragraph, you are making an a priori assumption that schools which teach ID also teach critical thought. I find that very unlikely, since acceptiong ID requires limited critical thinking abilities.

      As per the bias of the reviewer, well that's pretty obvious. I think part of the reason impartial dialog is becoming increasingly scare among evolution proponents is due to the techniques ID proponents have employed. While I agree the entire debate needs to be had at a lower grade level, so that everyone can partake, I don't think the maturity should sink to the same grade level. And I'm certain this last statement appears biased to a pro ID reader.

      The main thing that bothers me is the cultural framework this creates of closing science into dogma.

      What was that about strawmen? /grin

      --
      https://www.accountkiller.com/removal-requested
    2. Re:No, it doesn't. by spazdor · · Score: 1

      "evolution happens" is not actually debated by anyone advocating ID

      [citation needed]

      --
      DRM: Terminator crops for your mind!
    3. Re:No, it doesn't. by PCM2 · · Score: 1

      I know you're a troll, but...

      The main thing that bothers me is the cultural framework this creates of closing science into dogma. Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.

      That's just silly. Of course you can propose it. Who's stopping you? For the sake of argument, let's assume you have proposed the idea that aliens from a nearby planet came to Earth and genetically modified early organisms to turn them into people. Now what? What form of "investigation" do you propose?

      Scientists are actively searching for nearby planets that are capable of supporting life, and if they find any they will actively investigate whether any life exists on them, intelligent or not. So in a way, that part of your hypothesis is already being tested. The problem is, so far we have found absolutely no evidence of life anywhere else in the universe.

      You could propose the theory that mermen from beneath the sea created humans, and suggest that if we searched the vast expanse of the oceans for long enough we might actually encounter evidence of these mermen -- fine. It's plausible enough; the oceans certainly are huge and there's a lot in them that we don't know about. But this is really two theories in one. So far, there is no evidence to support your first premise -- mermen created humans -- because we have never seen evidence of any mermen. And in fact, insofar as we have undersea craft roaming the Earth at all times, we are constantly conducting experiments to locate mermen (much in the same way that the LHC will search for the Higgs boson) -- and, unfortunately, we have not found any. No mermen, no mermen creating humans. Simple as that.

      Just because scientists choose not to pursue certain experiments doesn't mean they are closed-minded or involved in some conspiracy. Suppose I have a piece of paper in my hand. I tell you that if I let go of this piece of paper, it will descend to the ground at exactly the same rate of speed every time. That's my theory. To prove this theory to you, I drop the piece of paper. Then I repeat the experiment. In total, I drop the piece of paper 1,134 times. Upon examining the data, I find that the paper hit the ground after roughly the same interval, repeatedly, 1,133 times. But one time, the paper flew out of my hand and landed on the other side of my room. Is this evidence that my theory about gravity is unsound? By strict scientific method, yes is is -- but which is the more likely explanation? That the action of gravity has changed, or that the front door blew open when I was conducting that one trial? Which "investigation" into those results will be more fruitful?

      Scientists are expected to conduct their research with rigor and detachment, and not bias their research based on ideology. But nothing in the handbook says they have to act as if they're stupid.

      --
      Breakfast served all day!
    4. Re:No, it doesn't. by Adrian+Lopez · · Score: 1

      "Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop."

      If life on Earth had indeed been created by intelligent beings from outer space and evidence of that fact were provided, I am sure no honest scientist would oppose the teaching of such a theory.

      Of course, there is absolutely no evidence for such a claim, so at the moment it's nothing more than pure speculation and therefore does not belong in science class. Speculation is not synonymous with theory, and It's not "academic crimestop" to prevent the teaching of nonsense in our public schools. In fact, preventing its teaching it's the only responsible thing to do.

      --
      "In prison you just have to shut your eyes and take it. Here you have to shut your eyes and give it."
    5. Re:No, it doesn't. by mog007 · · Score: 1

      I wouldn't say everybody at the Discovery Institute supports evolution. Michael Behe supports Intelligent Design, but he also accepts the validity of common ancestry, because that damned second chromosome is really hard for a creationist to ignore.

    6. Re:No, it doesn't. by ClassMyAss · · Score: 1

      The main thing that bothers me is the cultural framework this creates of closing science into dogma. Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.

      No, no, no, no. NO! PLEASE propose it - at least propose something! The problem with ID is not that it claims evolution is wrong, it's that it fails to offer a solid alternative. "Something did it, we're not exactly sure what, but it's something!" is not even close to an alternative. It's a bunch of unhelpful words on a page.

      Of course, the alternative could only be one of two things: 1) God (of some sort), or 2) aliens. And God knows that the people running the ID campaign don't want people thinking they're talking about aliens! This is why people assume ID is merely Creationism-lite: the people talking about it refuse to bring it into the non-supernatural realm by saying straight up that they are talking about aliens instead of gods. Which must be the case if ID is to be considered science, otherwise this is not a scientific debate, it is religion.

      But you don't seriously think the people "researching" this stuff are thinking about aliens, do you? Because unless you do, you're deluding yourself when you say that the creationism tie-in is a strawman.

      Seriously, though, I'd be very happy if someone actually proposed a theory to look into rather than merely talking about how the other theory is wrong. For this to work, you'd actually need some evidence for the particular theory, but hey - if you believe in it so strongly, you've certainly got some evidence for that belief. Otherwise you'd have little reason to suspect that the prevailing view, which does have lots of evidence, is wrong (as difficult as that evidence may be to wade through).

      Right?

  10. 2 - The Great Flood (Where are all the Unicorns?) by rossdee · · Score: 4, Insightful

    Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)

    Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
    (YEC for short)

    There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.

  11. Re:Personally by Liquidrage · · Score: 3, Insightful

    Sadly in places people defend your ignorant view. As if there's a middle road here. "Teach both", or "there's room for more then one theory".

    Evolution is one of the cornerstones for modern biology. You don't want it taught even though it has withstood over 100 years of scrutiny and is incredibly accepted by the scientific community? Why? Because you don't understand it most likely.

  12. Re:2 - The Great Flood (Where are all the Unicorns by gardyloo · · Score: 1, Interesting

    Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
    (YEC for short)

    Perhaps. At least the YECers have the balls to believe in something which is not only demonstrably inane, but has been disproven many times. Those OECers simply relegate their creator to misty Planck times. I call that moving the goalposts to a spot where they do no one any good whatsoever.

  13. Science...It Works.... by RiffRafff · · Score: 5, Funny

    I saw a t-shirt the other day that said:

    SCIENCE
    It Works, Bitches!

    I thought it was funny...

    --
    "I might have made a tactical error in not going to a physician for 20 years." -- Warren Zevon
    1. Re:Science...It Works.... by eball · · Score: 1

      It's xkcd!

    2. Re:Science...It Works.... by Shaitan+Apistos · · Score: 2, Informative
      xkcd store

      About halfway down the page fyi.

    3. Re:Science...It Works.... by Bogtha · · Score: 1

      If you are looking for science t-shirts, these ones are pretty cool. They have a teach the controversy section that's pretty relevant to this discussion too.

      --
      Bogtha Bogtha Bogtha
    4. Re:Science...It Works.... by robot_love · · Score: 1

      I've been looking for a t-shirt that says, "Thank God for science!"

      I thought it would be funny.

      --
      .there is enough of everything for everyone.
    5. Re:Science...It Works.... by werdnapk · · Score: 1

      I've been looking for a t-shirt that says, "Thank God for science!"

      I thought it would be funny.

      I want that shirt now too!

    6. Re:Science...It Works.... by FrankDrebin · · Score: 1

      If this came in T-shirt form, I would probably buy it: http://www.youtube.com/watch?v=Tc5JXbyw1C0

      --
      Anybody want a peanut?
  14. "No one can prove Evolution"??? by Nicolas+MONNET · · Score: 3, Informative

    WTF are you talking about?
    Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism?
    For heliocentrism, we have probes and satellites taking nice pictures.
    For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA ... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory?
    Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect?
    What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection?
    And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?

    1. Re:"No one can prove Evolution"??? by mog007 · · Score: 1

      Very well done. I hate Biology, it's terribly boring, but I'd be a fool if I believed there were any other scientific theory which has more support than evolution. Not even gravity has been scrutinized as much. If these ID proponents were really scientists, they should try poking holes in an easier theory, like gravity or the atomic model, or something.

    2. Re:"No one can prove Evolution"??? by halcyon1234 · · Score: 1

      Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA ... ?

      Maybe he was dictating?

    3. Re:"No one can prove Evolution"??? by timmarhy · · Score: 1

      i think it's funny they don't try to disprove their own theory of creationism. after all, thats' what real science does.

      --
      If you mod me down, I will become more powerful than you can imagine....
    4. Re:"No one can prove Evolution"??? by JavaRob · · Score: 1

      Logic failure - how did evolution come into being? Who or what created it? It obviously did not evolve from evolution -- circular logic. So someone or something must have created it.

      Evolution is a process, not a thing that "comes into being". Evolution happens as long as there is life reproducing and undergoing natural selection.

      Are you trying to ask how the first life came into being?

    5. Re:"No one can prove Evolution"??? by Nicolas+MONNET · · Score: 1

      That "carbon dating" thingie is not, contrary to the flawed slashdot headline, what is usually meant by "carbon dating." Specifically it doesn't involve radioactive decay, unlike C14 dating.
      Funny thing, that radioactive decay. It's completeley random, yet incredibly accurate.

      If more scientists where researching ALL possible leads to how the earth was created instead of spending all their time proving evolution correct,

      The origin of the earth is studied by geologists, physicists and astronomers. Evolution is the subject of biologists. I'm not sure how much that would help anything if biologists dropped their microscopes all of a sudden and took up astronomy.

    6. Re:"No one can prove Evolution"??? by mog007 · · Score: 1

      And that's exactly why ID is NOT science. It's not even BAD science like Astrology, because Astrology can be tested false or not. ID can't be falsified at all.

    7. Re:"No one can prove Evolution"??? by Alsee · · Score: 1

      Logic failure - how did evolution come into being? Who or what created it? It obviously did not evolve from evolution -- circular logic. So someone or something must have created it.

      Logic failure - how did rain come into being? Who or what created it? It obviously did not come from rain -- circular logic. So someone or something must have created it.

      You don't quite directly say it, but you seem to have the impression that evolution = atheism. Chemistry does not equal atheism. quantum mechanics does not equal atheism. Evolution does not equal atheism. The theory of relativity does not equal atheism. They all describe how the physical world operates. None of them say anything about God. None of them say God does or does not exist. If there is a God, then the science optics explains God's chosen mechanism for creating rainbows. If there is a God, then the science of evolution explains God's chosen mechanism for creating the diversity of life on earth. If there is a God, then the heliocentric solar system explains God's chosen mechanism for creating day and night and the seasons of the earth.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  15. "Chock full of bad science"? by Anonymous Coward · · Score: 2, Interesting

    The Slashdot blurb implies that the review shows the book to be "chock full of bad science", yet I didn't get that impression from the review.

    The first section of the review dealt with politics, not science.

    The second section claimed that the "scientific community" overwhelmingly accepts evolution.

    Finally on the second page of the review, the implication is made that it's unscientific to be precise about definitions ("neodarwinianism") since the rest of the community prefers the term "evolution" (which is a VERY plastic term that can mean almost anything depending on who you talk to and what part of the sentence just came out of their mouth).

    The next "unscientific" claim the review "refutes" is the idea of common descent. Well, duh! That IS the issue, isn't it? "You don't accept my science therefore your claim is unscientific." Pfft.

    Then the review objects to the book's criticizing the views of scientists with whom the reviewer doesn't agree anyway. The reviewer claims that the book is using these examples of molehills to build mountains. Maybe, but is it a "chock-full" of "bad science" to criticize faulty viewpoints?

    Then the review seems to find fault with the book for calling attention to real controversies in biology, as if that's playing unfairly.

    The review even seems to claim that although we still, after 150 years, have limitations in our fossil record, it's a "bait and switch" to mention therefore that some scientists doubt that the fossil record supports common descent.

    The review seems to take offense for the book's claim that Darwin's "Tree of Life" has in recent years come to look more like an orchard of bushes. As I understand the state of the fossil record, the book is more correct on this point than is the reviewer. The review also seems to claim that cladistic trees match molecular trees, which I am quite confident is not the case (read an article on that just the other day - sorry, don't recall the citation).

    The review downplays the significance of the Cambrian Explosion, claiming that to look at it the way the book does is faulty. And one of the reviewer's arguments is that the sudden appearance of the bat is offset by the sudden appearance of an earlier bat. What?!

    The review takes offense at Behe's "irreducible complexity", claiming that at least three scientific papers have refuted Behe. I'm a little familiar with those claims; those claims don't convince me (particularly since they've not been demonstrated, but merely are "just so" stories that "might" be how it happened).

    Don't get me wrong; I'm not saying the book is good, or bad; I don't know; I haven't seen it myself. But I definitely get the impression that this review is more an emotionally-charged response to a challenge to a religiously-held belief system. The battle-cry of "bad science" is just a banner under which the faithful will be expected to gather.

  16. NO. by J_Omega · · Score: 1

    You should desire to really inform those who are getting taught his crap. Realize that the ID/Creationism movement is from the adults - they just force the (idiotic) ideas on the children who have no say in the matter, and are confused enough as is. Hey, if an adult tells them that's how the world works, the'll believe it. Better that the kids are taught the real-deal so that this stuff isn't propagated to their children's children's children.

    If "red state" values dominate, who gets elected? who runs this place? who tells YOU how to live your own life?

    Think of the children?

  17. Why? by Psychotria · · Score: 3, Insightful

    I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum. There are lame attempts and arguments that go along the line of we want to be "balanced", but, frankly, creationism is not accepted science (it doesn't even come close to science). It's great to debate these things (it broadens our minds), but schools should teach fact; not conjecture.

    Evolution is not "fact" either (although the accumulated data supports the theory). If another theory comes along that explains the data better, then Darwin's theory will be superseded. This is how science works. Teaching crackpot "theories" in schools doesn't end up making people more objective. I would suggest that it teaches them to be more stupid. Teach critical thinking. Don't teach things that are not falsifiable. It's easy.

    It's not a debate it's arguing absurdity.

    1. Re:Why? by Fastolfe · · Score: 1

      So this is a bit of nitpicking, but since you made your anti-fact claim so strongly, I thought I might respond: Evolution actually has two senses, both fact and theory, and neither should be confused with abiogenesis, which is what creationists frequently mean (attack) when they say evolution. The observed facts of evolution aren't going to be "superseded" by anything, but the theory behind it could be (just like any other scientific theory). Evolution is happening, and if a person doesn't believe that, then no amount of debate or logic is going to convince them otherwise, because they can't even see the data. This goes beyond not being a "science type" and suggests some form of mental impairment, IMO.

    2. Re:Why? by 99BottlesOfBeerInMyF · · Score: 2, Informative

      I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum.

      Money.

      Seriously, televangelists have made bucketloads of cash by making people feel like they are persecuted or like "those people" are trying to force them to change. Politicians get elected using the same. They use that money to market misinformation and undermine education. It's just a way to make money and gain power.

      In most countries there is not a lot of profit in misinforming citizens in that way, so no one does it and said misinformation is less intentional. Marketing works if it is well funded which is why the US is slightly less educated than Latvia on the topic of evolution. The same phenomenon can be seen in both the US and (to a lesser extent) the UK on the topic of global warming. There isn't a lot of serious scientific debate on the fundamentals of either issue, but due to huge marketing expenditures, there's a lot of debate and disagreement among the average people, who don't read scientific journals or critically assess facts, but who do watch TV and believe some of what they see.

    3. Re:Why? by Psychotria · · Score: 1

      You're saying the same thing that I attempted and, obviously, failed to present. Thank-you for doing what I could not.

    4. Re:Why? by ScrewMaster · · Score: 1

      Hey, you did okay. A lot better than any Creationist.

      --
      The higher the technology, the sharper that two-edged sword.
    5. Re:Why? by Free+the+Cowards · · Score: 1

      Two reasons.

      1) The US has a lot of crazy religious fundamentalists who think that their religion should govern all aspects of their (and everyone else's) lives. They are not content to teach their children about it and go to church on Sunday. They want all aspects of society to aid them in religiously indoctrinating their children, especially school. Evolution runs contrary to their beliefs and rather than put their children into a different school, they wish to change the school that everyone goes to.

      2) The US has weak voter turnout and a nearly 50/50 split between the two big parties. This gives small but vocal and politically active groups such as this a disproportionately large influence on government, as it's considerably more difficult to win any sort of office without their support.

      --
      If you mod me Overrated, you are admitting that you have no penis.
    6. Re:Why? by jbeach · · Score: 1
      I think because there's a much higher proportion of religious conservatives in the US than in othe first-world nations - and our religious conservatives really can't stand to admit they even might be wrong.

      George Lakoff attributes this underlying tendency to an overall patriarch-based family model, where the Dad sets the tone and family safety relies on not contradicting him even if he's wrong or crazy. I think there's something to that. But whatever the pychosocial roots, they have enough money and numbers to continue gumming up teaching.

      So yes, it logically falls on it's face - but the struggle isn't really over logic. It fails on basic fairness, too - I can suggest to them: Do you want evolution taught in your church? No. Then why should we teach your religion in school? But that doesn't get anywhere, because it's not about fairness either.

      It's about them wanting control over what's said, whether or not is has value to anyone else or not.

      --
      The Invisible Hand of the Free Market is what punches workers in the nuts.
    7. Re:Why? by jjohnson · · Score: 1

      Others have observed that there are a large number of christian fundamentalists in the U.S. for whom creationism is obviously true, and evolution obviously false. But more than that, they tend to be concentrated in the southern U.S., where they are the dominant culture in many towns, counties and states, and see no reason why the schools shouldn't teach what everyone (around them) already believes.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    8. Re:Why? by RiffRafff · · Score: 1

      [I] see no reason why the schools shouldn't teach what everyone (around them) already believes.

      How about because it's fantasy? How about because it's religious fundamentalism masquerading as science? How about because it puts all those students that are subjected to this behind the eight-ball when it comes to getting jobs in the real world? What if "everyone around them" believed in leprechauns? Does that make it "fact?"

      Teach "creationism" in a philosophy course, if you must, but not as science, and not with any semblance or reference to it being "the truth," or as fact as we know it. Otherwise, these kids will never work in any technical field, and their mantra will be, "you want fries with that?"

      *Shakes head* I fear for our future generations, and our future in general.

      Luckily, I'm old enough that I'll likely be dead before the meltdown occurs, and won't have to experience it. Gee, what a silver lining that is. Meh.

      --
      "I might have made a tactical error in not going to a physician for 20 years." -- Warren Zevon
    9. Re:Why? by falconwolf · · Score: 1

      My real question is why the subject is even being considered being added to the US school curriculum.

      Because fundies want their beliefs taught in school as fact.

      Falcon

    10. Re:Why? by ispeters · · Score: 1

      [I] see no reason why the schools shouldn't teach what everyone (around them) already believes.

      I think the "[I]" is an unfair edit to jjohnson's post. The original comment, as written, claims that the zealously religious residents of the South are the ones who "see no reason why the schools shouldn't teach what everyone (around them) already believes".

      Ian

    11. Re:Why? by jjohnson · · Score: 1

      ispeter's comment below is correct. I don't believe in creationism, I was pointing out that, where ID keeps getting slipped into the school system, evangelical Christianity is often the dominant culture. When the dominant culture believes something, it's not obviously crazy to want that thing to be taught directly in class. Many people in those areas simply don't understand why one wouldn't want creationism taught in school, if that's what everyone there believes. And when the court rules that it infringes the first amendment, it looks like uppity northerners imposing their "faith" on the locals.

      That's why, in the U.S., creationism has a far longer leash on life than it does elsewhere--that geographic concentration of believers keep it alive.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    12. Re:Why? by wallet5 · · Score: 1

      We teach Aristotle. And, for that matter, Socrates.

    13. Re:Why? by Alsee · · Score: 1

      I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum.

      There have been many other good replies, but I would like to add two critical points to the mix.

      (1) One flaw in the Constitutional design of our election system is that it mathematically locks in on a winner-takes-all two party elections. One of our two parties caters-to / exploits the religious evangelicals. Evangelicals make up around 20% of the overall population. They also tend to be fanatically dedicated and motivated, and can be rallied to vote at a higher rate than the general public. So that 20% of the population is almost exclusively concentrated in the Republican Party - meaning they are maybe 40% of the Republican party. And then with increased voter turnout they represent more than 50% of the Republican vote. That turns into winner-take-all control of the presidency by the Republicans (when they win), and the evangelicals are responsible for more than 50% of the power in selecting and electing that candidate. So this minority group can wield power WAY out of proportion to their numbers. They are distributed in a number of regionally concentrations, in some areas approaching 100%, meaning they completely elect and completely make up the local and state government. They can pull all sorts of religious-fundie stunts in schools and local government and in state legislatures, and it only gets smacked down when it gets dragged up to the US Supreme Court.

      (2) The United States is really big. It's HUUUUUUGE. It sounds like a silly point, but those square miles really matter - a lot. I think it was last weak I ran some of the math. There was a threat talking about Denmark and comparisons with conservatism. The US average population density worked out some 13.7 or 14.7 times lower than that of Denmark. Compared to any other First World country, the US is pretty well made up of remote frontier villages in the middle of nowhereland. The US has vast extremely rural areas, vast segments of our population are extremely isolated, hundreds and hundreds of miles from even the slightest urbanism. People literally a thousand kilometers from any coastline or international border. The US political divide is almost complete determined by population density. Rural areas vote Red in even the Bluest of states, and urban/suburban areas vote Blue even in the Reddest of states. There are essentially none of these religious evangelicals in any of our urban or suburban areas. This religious evangelical culture is in isolated rural areas. Areas where everyone you know goes to the same one church in the middle of town, where that church powerfully defines the community, where that church is the authority defining what is socially acceptable or not. Where they have never met anyone of another religion. Where they have the illusion that everyone follows the one-and-only unquestionable religion, that anyone who doesn't follow their religion are freak aliens on some other planet. Where they have never met anyone from another country. Areas where everyone is deeply saturated in conforming to the one and only acceptable social and cultural norm. Where someone of asian or other ethnic decent is some strange alien they have never seen in person. Where an open homosexual is a freakish alien, defying church authority and defying the one-and-only acceptable social norm. Where people and different ideas do not flow easily.

      Isolated social conformity and intolerance. Isolated deep religious faith unchallenged by the fact that they do not possess some Magical Unquestionable One Truth. They are generally blissfully clueless just how badly their One True Understanding of the Bible conflicts with the One True Teaching in many of their fellow evangelical churches. They have absolute unchallenged faith in their Inerrant Universal religious Truth. No experience and no idea that even other "Good Christians" reject much of their Inerrant Universal religious Truth, not to mention no experience facing and reasonably dealing with people of other major religions.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  18. Epicurus said it best by thermian · · Score: 5, Informative

    The Riddle of Epicurus
    ~~~~~~~~~~~~~

    If God is willing to prevent evil, but is not able to
    Then He is not omnipotent.

    If He is able, but not willing
    Then He is malevolent.

    If He is both able and willing
    Then whence cometh evil?

    If He is neither able nor willing
    Then why call Him God?

    ~~~~~~~~~~~~~~

    Back on topic, the Discovery institute is dedicated solely to enriching its members, any other claim is nonsense.

    --
    A learning experience is one of those things that say, 'You know that thing you just did? Don't do that.' - D. Adams
    1. Re:Epicurus said it best by LordLucless · · Score: 1

      Correction:

      If He is able, but not willing
      Then He is merciful.


      God's standard is perfection - and nobody's perfect. If you're demanding God wipe out all evil, chances are He'll start with you. I much rather it God's way - offering humanity a chance at forgiveness and transformation, tolerating evil until it can be redeemed.

      --
      Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
    2. Re:Epicurus said it best by FooAtWFU · · Score: 1

      If He is able, but not willing Then He is malevolent.

      Most refutations of the "problem of evil" in religion would aim for this one, arguing that, in fact, allowing the presence of evil effectively achieves a greater level of that desirable stuff (the promotion of which would be considered "benevolent") than preventing all evil would. Consider, in particular, the value of Free Will and people making their own decisions. Under this system, people making good decisions of their own and striving to overcome the evil in the world around them, is part of that "benevolent stuff", whereas people who are forced into doing all 'good' things all the time (because they are mindless puppets and their actions are not their own) would be a hollow imitation of what is "good" (except in the most extreme forms of fundamentalism).

      It does depend on what people consider "good" and "evil", though. Those with a sufficiently self-centered or hedonistic approach might, for instance, consider any impediment to their personal ideas of what they want (money, power, pleasure, etc) to be an exhibit of "evil", even if this deprivation serves some absolute moral good (in a system of moral goodness -- God's -- that they do not recognize). If that is the case, then God will probably always seem malevolent to them.

      --
      The World Wide Web is dying. Soon, we shall have only the Internet.
    3. Re:Epicurus said it best by jjohnson · · Score: 1

      How is it merciful for God to allow a sexual predator to abuse and murder a small child?

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    4. Re:Epicurus said it best by RiffRafff · · Score: 1

      That would be "God's Will."

      What? Isn't that what they always say when confronted with logic and truth?

      I ask them, "Shouldn't you be out spreading religiosity to all the fuzzy-wuzzies everywhere?"

      (With apologies to Joss Whedon's Malcolm Reynolds character)

      BTW, my invisible friend can beat up your invisible friend.

      --
      "I might have made a tactical error in not going to a physician for 20 years." -- Warren Zevon
    5. Re:Epicurus said it best by LordLucless · · Score: 1

      So what you're saying is "my threshold for evil is sexual predation - God should punish those I think are evil enough, but leave the ordinary liars or hypocrites alone". If you want justice, then what you're wanting is that God annihilate the world - because really, while we've got people running around here, there's not going to be justice, or peace, or goodness.

      --
      Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
    6. Re:Epicurus said it best by LordLucless · · Score: 1

      Firstly, if you're going to quote, get the quote right: "shouldnt you be off spreading religiosity to the fuzzy wuzzys or some such".

      Secondly, if you're going to claim superiority to religion by virtue of reason, you should probably show a little in your posts, instead of resorting to name-calling and insults.

      --
      Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
    7. Re:Epicurus said it best by GaryPatterson · · Score: 1

      What about a lightning strike that starts a wildfire, burning animals and people to death?

      Or a tornado that sweeps through a town, killing a few and destroying everything?

      Or an earthquake that kills hundreds?

      Can we blame God for those things? After all, if people thank God when good stuff happens, shouldn't they blame Him for the bad stuff?

      (As an aside, I always love the athletes who credit God for their win. I'd like, just once, to hear the second placed athlete say "I ran better than ever, but God was against me on this one. His divine might stopped me winning, and thanks for nothing Jesus.")

    8. Re:Epicurus said it best by Anonymous Coward · · Score: 2, Interesting

      So. Let's see here.

      The first few chapters of Genesis can be quite simply stated as: God gets bored. God creates some toys to play with, which he calls people. God creates the potential for vast, limitless pain, suffering and EVIL into these "toys". God lets them do their thing and watches for millennia as the pain and suffering unfold.

      Yep, I can't see *anything* malevolent there.

      No amount of "free will" touting can cancel this -- it's "free will" which allowed the events to play out that way in the first place! Were god NOT malevolent he would have removed the potential for suffering, one of the (many) ramifications of which would be the removal of free will.

      It's quite easy to show that a "loving god" would never have allowed free will in the first place, by never having created the potential for suffering in the first place. The logical conclusion to this chain of thought is that a "loving god" would never have created us in the first place in ANY form!

    9. Re:Epicurus said it best by jjohnson · · Score: 1

      No, that's not what I'm saying. I'm testing the grandparent's assertion that being able to prevent evil, but unwilling to do so, is merciful. God is able to strike down the predator, or perhaps just distract him, and prevent the evil from occurring, but he doesn't do so. That doesn't seem very merciful to me.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    10. Re:Epicurus said it best by jjohnson · · Score: 2, Insightful

      Not at all. God could strike down the sexual predator after he makes his freely willed decision to molest the child. Perhaps a simple aneurysm. Perhaps simply distracting the child at the playground so she doesn't go over to the nice man with candy. An infinite number of interventions are possible that don't impinge on the free will of the actors in the scenario.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    11. Re:Epicurus said it best by jjohnson · · Score: 1

      Okay. So God could have prevented the tsunami that killed, what, 200,000 people? I'd call that evil. God's omnipotent, so he could have prevented it. But he didn't, so he's unwilling. Not seeing how that's merciful, letting 200,000 people die like that.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    12. Re:Epicurus said it best by LordLucless · · Score: 1

      So, what should God do? Prevent the molestor from attacking the child? Why is molestation a special case? Why not stop the mugging happening near by? Stop the boyfriend from bashing his girl? Stop the wife cheating on the husband she swore to be loyal to? Force the son to visit his sick Mum in hospital? Prevent people from spreading malicious gossip? Make every human dance like a puppet on a string because they shouldn't be able to make their own choices? Or destroy us all because whatever we do, we'll still cause evil, somewhere, sooner or later?

      Where does it start, and where does it end? God's mercy lies in his not acting, because if he were to act, and act consistenly, act against all evil, it'd mean the end of all us. That's how Judgement Day is described in the Bible - when God's patience runs out, when mercy takes a backseat to justice. When everybody gets what they deserve. God's stalling, giving as many people as possible a chance to accept the amnesty Jesus offered, before we're all made accountable. That's mercy.

      --
      Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
    13. Re:Epicurus said it best by jjohnson · · Score: 2, Insightful

      First, molestation isn't a special case, it's merely an example. But I see your point: If God stops people from doing any and all bad things, we live in something like an MMO full of invisible walls--you can try to go certain places, you just can't.

      Now, by your argument, allowing a little girl to be molested and murdered is merciful because refraining from acting to prevent it allows many, many other people the chance to choose Jesus as their savior. Correct?

      So God creates all, including both humans and the possibility of doing evil. Then he allows people to choose good or evil, and those who choose evil are damned, and those who choose good are saved, even if it requires suffering on earth. After all, isn't an eternal paradise worth it?

      Okay, but God still created the suffering of the good, and the circumstances under which evil could be done, when he could have simply created us in paradise in the first place (or put us into that invisible-walled MMO). In one alternative, you have no evil, and no suffering, just eternal paradise. In the other, you have everything in the first one, plus evil and suffering and possibly, depending upon how you choose, eternal damnation. God could have created X, but he created X+Y.

      Not seeing how the latter alternative can be considered merciful. Not seeing how the addition of Y is, in any sense, merciful.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    14. Re:Epicurus said it best by n+dot+l · · Score: 1

      If God stops people from doing any and all bad things, we live in something like an MMO full of invisible walls--you can try to go certain places, you just can't.

      Sounds horrible, doesn't it. Which is probably why hell is supposed to be full of such ridiculous amounts of suffering - it has to be worse than the hideous boredom of the eternal MMO, else who would want to go to heaven?

    15. Re:Epicurus said it best by jjohnson · · Score: 1

      That's another deep philosophical problem for the faithful. I don't see how they can be reconciled.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    16. Re:Epicurus said it best by hierofalcon · · Score: 1

      Um. Actually, according to the Bible God did initially create a paradise and put man in it. Man chose disobedience after explicit warnings. Don't blame God for man's choice.

    17. Re:Epicurus said it best by jjohnson · · Score: 1

      Didn't God create the possibility of that choice? The circumstances under which it could be exercised for good or evil? Doesn't ultimate responsibility for how that choice is used then lie with God?

      To put it another way: God could have created a paradise in which we weren't free to choose, in which case we'd simply have paradise. Instead, he created the choice, and added suffering and evil and possibly eternal damnation to the universe for us to experience. Still doesn't sound 'merciful'.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    18. Re:Epicurus said it best by hierofalcon · · Score: 1

      No. The ultimate responsibility rests with the one making the informed choice.

      Do you have children? Would you be happier as a parent with a child who had no choice but to do what they were told to do like a robot with no chance of any self programming or would you be happier if your creation instead chose to do right instead of wrong out of love for you? Hopefully, the second choice would be the choice you want. If you don't have kids yet, are you happier as a young adult having choices instead of living a totally pre-programmed existence? Are you a better person who is more productive today because you are doing some of the things you want to do rather than knowing for example at the time of birth that you were going to be a garbage collector in the second ward - get married at 18 - have six kids - et cetera? As a father, I can assure you life would be easier if our creation came with an instruction book that we could follow till they're on their own with answers to every question and with every day planned out. It would also be boring. If I can say that as a father of just a few, how can you sit there and criticize God for not wanting a bunch of robots as His creation?

      I'm not saying that is merciful. I don't think that that enters into the discussion at all. But you really don't have much basis for criticizing the way God did things. He came to fellowship with Adam and Eve routinely. They were created to keep Him company. But the bright shiny things of life looked too good to them to just go about the boring old walks in the garden - so they picked bright and shiny and paid the price. They discovered that God really did mean what He said. The same day that the sin was discovered, however, God shed the blood of animals to make them clothing and uttered the prophecy that in due time (a few thousand years as it turns out) He would send a redeemer to restore a right relationship between all mankind who would accept the means of justification and God and to restore that communion with Him that originally existed. He was still being merciful to them and their descendents even when He had just been wronged. Sounds pretty good to me.

      Remember that God is merciful, but He is also just and many other things. You have to make the same choice that Adam and Eve did, in essence. Choose the pleasures of sin for a season and eternal loss, or choose His way of salvation. The choice is yours. But now that He has sent His son to be a sacrifice for sin, there are no other ways of reconciliation that are available. You've heard about Christ and salvation and you must choose. Take the advice of the knight of the Round Table on the Indiana Jones movie and choose wisely.

      Getting back to the original thread - yes God could protect everyone from crime, disease, and all bad things. That was His original intent. Mankind left, so God picked plan B. He's carrying it out day by day, prophecy by prophecy. There's basically just a few chapters to go. Choose wisely before you have to live through God's wrath being poured out on those who didn't choose wisely.

    19. Re:Epicurus said it best by jjohnson · · Score: 1

      I'm not saying that is merciful. I don't think that that enters into the discussion at all.

      It enters the discussion because that was the point I replied to in the first place: someone's "correction" of Epicurus's dictum that a God who is able to prevent evil but unwilling to do so was merciful, rather than malicious.

      Yours is an articulate argument (thank you for making it) but it starts from a basis of believing that God exists and that he made the universe a certain way that suited him. Within those assumptions, your explanation makes tremendous sense. What I've been quibbling with, though (as Epicurus did) is the concept of God and what sort of sense it makes.

      If we back up to the attributes of a supposed omnipotent God, then Epicurus is basically identifying what's classically been called "the problem of evil". My point has always been that, rather than create free will and allow evil into the world, God could have simply not done it, and saved countless numbers of souls the suffering of Earthly existence and the possibility of eternal damnation.

      You countered that an existence without free will would be boring, and that a freely willed choice to love God is much more satisfying to him than the chorus of angels who sing his praises because that is their nature. From our perspective, yes, that does seem true, but if we were created as constrained beings who simply existed happily in paradise, we wouldn't know what we're missing--we'd just be enjoying paradise. The introduction of free will and evil, then, is for God's pleasure, at the cost of our (perhaps eternal) suffering. Beyond "merciful", that doesn't seem benevolent at all. It seems heartless, if not malicious.

      --
      Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
    20. Re:Epicurus said it best by hierofalcon · · Score: 1

      Actually, Lucifer (one of the chief angels) demonstrated that even the angels have free will and he showed his exercise of it by rebelling against God along with many others. They lost, but they do have free will just like we do.

      Yes, of course my argument is based on the fact that God exists. In my time, I have seen the gifts of the Holy Spirit as described and used by Christ and the New Testament church alive and well in today's church. I wish I saw as much fruit of the Spirit as gifts, but that is a subject for another time. These workings, including words of knowledge (people saying things they would have no knowledge of on their own but that are 100% accurate), messages in tongues and interpretation that are independently verified as being given and translated correctly when the person(s) involved don't know the human language being used but some visitor happened to, and healings have happened many times over the course of my life. I can't say I've seen a miracle unless you count people delivered from long term habits like smoking or something as a miracle instead of a healing. Some of them have happened on a weekly or monthly basis. God does these things for many reasons, but one of the reasons is to eliminate doubt in the minds of man that He is.

      Many of these are debated at length by people who don't believe in God. For example, when someone gives a word of prophecy and says that something will happen in the future and it does, there is always the criticism that having heard the prophecy people move in that direction and it becomes self fulfilling. There is some truth to that. For messages in tongues and interpretation there is also the lingering suspicion that the persons involved really knew the languages but weren't telling anyone. When you don't know the people but are just looking from the outside that is easy to say. But words of knowledge where something is said by someone about something you've done that you know only you and God knew about is a lot harder to dismiss.

      People who are outside the church always dismiss reports of healings. They call them staged because they know nothing about the people involved and it is easier to claim that it's all a show than accept that the supernatural really exists. The healings I'm talking about are those of people that I personally know, who had been verified as having a disease by doctors, who are prayed for, and who get a clean bill of health after. This has included people who had gone to the doctor with coughs, had X-Rays that showed cancer starting on the lungs, were prayed for and went back for the next appointment with a healing message that the doctor didn't believe and then proved with a new set of clear X-Rays. This includes a church member who was in a wheel chair for 8 years, was prayed for, and got up out of his wheel chair and walked out of the service. It includes more than one person with a leg that was physically deformed in the past by an accident or by birth to the point where they used braces to walk or walked with a limp being prayed for and walking out of the services without a limp or without the need for braces. God cares about some little things too. His healings have included instances in my own family where my kids started feeling sick during the service and were prayed for at the end and had their stomachs stop hurting (two instances) and my wife who had also seen a doctor for an issue and had been directed to a specialist who was prayed for and received immediate relief. It is easy to scoff when you aren't involved with the church and know the people and their character.

      Everyone isn't healed. I know that faith comes into that and not necessarily the faith of the person being prayed for. All God wants is some faith from someone there. Sometimes there may be sin issues. And sometimes, He knows that something worse will happen if they are healed so He chooses not to. I don't pretend to be able to answer why He does some things for some and doesn't intervene in other situations. But I don't doubt for a second that

    21. Re:Epicurus said it best by ChaosDiscord · · Score: 1

      Do you think that would-be child molesters might eventually catch on that no matter how hard they try, some coincidence interferes? How much freedom do you have if your evil actions never pan out? I'm guessing somewhere in childhood people would stop trying to be evil, since it never pans out.

      Science in such a universe might be interesting. You could run experiments where you repeatedly try to steal toys from children and observe the increasingly improbable coincidences that stop you.

  19. Re:Personally by ScrewMaster · · Score: 1

    Because you don't understand it most likely.

    That's most likely true ... he understands only what those "religious leaders" with an agenda want him to understand (nothing, in other words) and he doesn't want to question their authority and learn more on his own. I mean, how many people of faith do you know that are convinced that the Theory of Evolution teaches how life was created and thus detracts from the glory of God? Darwin's Theory says nothing about the origins of life, it only predicts how life changes over time. Yet that single misunderstanding is at the center of much of the hate and discontent.

    Then, of course, there are the even more ignorant types that just can't stand the thought that humans are nothing but slightly-more-evolved monkeys.

    --
    The higher the technology, the sharper that two-edged sword.
  20. preaching to the choir by circletimessquare · · Score: 4, Insightful

    (pun intended)

    i don't think you are going to find much support for this textbook on slashdot

    however, what you will find is a lot "hear, hear" and then... nothing. or worse, cynicism

    there's a lot of issues in this world where all you can do is whine and bitch and moan, and are otherwise helpless to effect change. this is not one of those issues

    ALL of these creationist initiatives are happening on state and local levels. you CAN do something about it if you live in one of these areas

    if you do live in an area creationists are making headway, do something about it, please. if for nothing than else than simple civic pride, that the residents of your {state/ town} are not all ignorant buffoons, that some of you actually understand the value of a critical mind, and even more importantly, understand the value of an involved electorate and citizens active for causes they believe in

    how is it possible that such idiots can get creationism in our schools? because THEY GET INVOLVED

    there are too many voices here on slashdot that will speak loudly about right and wrong, and never actually get involved to make sure their government stands up for that

    please, do not feed me the standard psychological lines of learned helplessness that convinces you you can effect no change on this issue or that issue. on creationism, on a state and local level, you CAN do something about this. you SHOULD do something about this. DO IT

    if not you, who?

    --
    intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
    1. Re:preaching to the choir by Free+the+Cowards · · Score: 1

      i don't think you are going to find much support for this textbook on slashdot

      however, what you will find is a lot "hear, hear" and then... nothing. or worse, cynicism

      It is amusing how your comment is posted below a metric crapload of comments talking about how mainstream science is wrong, how ID should be taught in schools, how the reviewer is biased, etc. Yes, the stupid people are here too!

      --
      If you mod me Overrated, you are admitting that you have no penis.
    2. Re:preaching to the choir by Jangchub · · Score: 1
  21. Re:Personally by Fastolfe · · Score: 1

    Except evolution can be proven: scientists regularly evolve new lines of insects, bacteria, and other rapidly reproducing forms of life. Applying the same concepts to life all over the world is just taking a sufficiently large step back so that you can see the bigger picture. Examining the world and coming up with natural explanations that can be experimentally tested is the very essence of the scientific method, which makes it perfectly appropriate to teach in a science classroom. I would support discussing creationism in a science classroom too, but only to teach children why it's not a scientific theory.

    Don't confuse evolution with abiogenesis, and take a read through Evolution as theory and fact.

  22. There's more science in "Doc Smith". by argent · · Score: 1

    This isn't like comparing the Copenhagen Interpretation and the Everett-Wheeler-Graham model, this is like comparing the Copenhagen Interpretation and Scientology. Not only does ID make claims about edge cases that, with further investigation, are found to support the standard model of natural selection, but ID doesn't even serve its original purpose. It isn't even Biblically supported: ID contradicts the fundamentalist reading of Genesis just as systematically as the standard models.

    Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.

    Not only can you propose that, but there is active research into the existence of complex extraterrestrial life on Earth (by looking for evidence of life in the interior of meteorite fragments), in the solar system (pretty much every probe sent to Mars and quite a few other places has included experiments looking for evidence of life), and beyond (not just project SETI, but things like research into the possibility of the intelligent origin of pulsars... before we figured out what they were).

  23. Dear Students by baggins2001 · · Score: 1

    The lesson for this semester, will be an extraordianary example of how people can be full of shit. Notice how there arguments don't fit together and that when you boil it all down and examine it, basically they are saying " Poof and it was there". Basically they are saying David Blaine is god and created the Universe.

    Let's compare this with a book by Charles Darwin called "Origin of Species"....................

    --
    He who said 1,000,000 monkeys on 1,000,000 typewriters would eventually type the great novel, never saw an AOL chat room
  24. Re:Personally by Reality+Master+101 · · Score: 1

    No one can prove Evolution nor can anyone prove Creation.

    Er, considering evolution has been observed (yes, including new species creation), I don't know how much more proof you need. Of course, creation as described in the Bible has zero observable evidence.

    Unless you mean human evolution, and yes, barring a time machine, we can't directly observe pre-humans changing into humans. We can only look at the mountain of fossil evidence showing clear pre-human bones that bear no resemblance to anything else except humans. But I suspect that no amount of evidence is good enough for you.

    --
    Sometimes it's best to just let stupid people be stupid.
  25. Discovery Institute Takes on Gravity Myth by H0NGK0NGPH00EY · · Score: 2, Funny

    This story from the Seattle-area satire paper The Naked Loon seems relevant: Discovery Institute Takes on Gravity Myth

    Hot on the heels of a recent Louisiana victory in the fight against evolution, the Seattle-based think tank Discovery Institute held a press conference Thursday to announce their latest initiative: defeating the myth of gravity.

    Robert Crowther, Discoveryâ(TM)s director of communications was visibly excited as he detailed the Instituteâ(TM)s plan for attacking what he refers to as the sloppy, inaccurate, and overtly biased portrayal of the theory of gravity.

    --
    Do not read this sig.
    1. Re:Discovery Institute Takes on Gravity Myth by aaron+alderman · · Score: 1

      I can imagine the new catch phrase for the IF (intelligent falling) crowd. "If gravity is true how come my Helium balloon floats?"

  26. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 5, Insightful

    Ah, but the beauty of YEC is that it really can't be disproven. Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.

    This is fundamentally why YEC should not be taught in a science classroom. It is not disprovable and thus not science.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  27. Re:Personally by ScrewMaster · · Score: 3, Insightful

    I subscribe to the Creation theory.

    No, you do not. You subscribe to an unsupported and unsupportable myth, and see nothing wrong with your personal mythology being taught to children as established fact. That makes you not only ignorant, but dangerous. Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.

    We'll see how your faith holds up when the lights go out for good. Civilization is fragile. Believe it.

    --
    The higher the technology, the sharper that two-edged sword.
  28. Bad Science all around. by LWATCDR · · Score: 1, Insightful

    Before the mindless pro science zelots go off on their little snits.
    I will state the simple truth. There is no creditable evidence for creationism and it can not be taught in school as a theory of equal standing with Evolution.

    But this little bit from the story makes my blood run cold as well.
    "The scientific community has very valid reasons for accepting evolution as an accurate description of the history and current development of life on earth,"
    Yes this is right.
    " reasons that are so so compelling that aspects of the theory can be safely treated as fact."
    NO! NO! NO! NO!
    No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.

    In science every theory is disposable. Newtons theory of gravity worked for a long time but we had to toss it when it started to fail. It wasn't the truth. It was the nearest that we could get to the truth at that time.
    Evolution right now is the closest we can get to the truth at this time. We are refining it all the time and hopefully getting closer and closer to the truth.
    And please quite calling the people that believe in it stupid. Frankly most of the people that will post how stupid they are have just about the same depth of knowledge as the people that believe in creationism. They just have happened to have guess right in this subject.
     

    --
    See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    1. Re:Bad Science all around. by ScrewMaster · · Score: 1

      " reasons that are so so compelling that aspects of the theory can be safely treated as fact."

      Yes, the observational portions of the Theory of Evolution can, indeed, be treated as fact because, well, they are.

      --
      The higher the technology, the sharper that two-edged sword.
    2. Re:Bad Science all around. by JetJaguar · · Score: 1

      You're confusing facts and theories a bit which is kind of understandable. Let me put it this way. Gravity is both a theory and a fact. Regardless of what theory of gravity that you might use, there is no dispute over the fact that two bodies possessing mass will be attracted to each other. This is an observed fact.

      We have a similar situation for evolution. Even if evolution (the theory) is wrong, there is more than enough evidence to show that evolution does indeed happen even if our description of how it works may be wrong.

      --

      Shop Smart, Shop S-mart!

    3. Re:Bad Science all around. by PPH · · Score: 2, Insightful

      No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.

      But by that definition, facts are rare. Damned rare. More like nonexistent.

      There's lots of stuff we call evidence. But that is subject to experimental error, lack of precision, unintentional (or intentional) bias and numerous other effects. Once sufficient evidence has been collected, and is found to be reasonably reliable, it either supports or refutes hypotheses. Those that it supports become theories.

      But someone out there is always building a larger accelerator, capable of collecting ever more difficult to observe evidence. Some of that evidence may result in the modification, or in extreme cases, the refutation of existing theories. But I can't think of anything that science has stated, "This is a fact. Nothing more to see here. Move along now."

      --
      Have gnu, will travel.
    4. Re:Bad Science all around. by LWATCDR · · Score: 1

      "Yes, the observational portions of the Theory of Evolution can, indeed, be treated as fact because, well, they are."
      No the obervations maybe treated as fact. That they are evidence in support of the Theory of Evolution is also a fact.
      The Theory of Evolution is currently the best supported theory of how life developed and changes on Earth.

      But it is never "safe" to treat any theory as fact.
      Oh I will state that evolution is fact since it has been observed. Things like bacteria becoming resistant to drugs is a great case of observed evolution. But that Theory of Evolution going back to the beginning of the Earth is still a Scientific theory. Just the best supported theory that really does fit well with the data we have.
      What the creationists are trying to teach is a theory that has very little data. Actually I have seen none that is creditable so frankly the only way that it can be taught in a science class is simply this.
      "Creationism or if you like Intelligent Design is a theory of the origin of life on Earth. It currently has no creditable evidence." So yes I am all for teaching it in a science class. And that is the science I am sorry to say.

      --
      See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    5. Re:Bad Science all around. by LWATCDR · · Score: 1

      No.
      You are confusing the Theory of Evolution with evolution.
      We know that life can evolve as a fact. As I have posted elsewhere drug resistant bacteria are a great example of evolution.
      The Theory of Evolution is how life can go from simple compounds to every form of life that is currently on the Earth.
      That is the Theory of Evolution. And it is theory that has a lot of evidence. It has a HUGE amount of evidence when you compare it to IE.
      But it can not be safely treated as a fact and still be called science.

      --
      See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    6. Re:Bad Science all around. by LWATCDR · · Score: 1

      Yes I agree. They are not nonexistent they are just limited to that which can be observed.
      If you combine a solution of HCL and NaOH you will have an endothermic reaction and solution of NaCL.
      At least within the realm of quantum uncertainty. "Yes I will ignore that level of quantum effects"
      So that is a fact.
      But to say that the Theory of Evolution can safely be treated as a fact isn't science.
      As Big Al said.
      " A million people can not prove me right. On person cam prove me wrong."
      That is science.

      --
      See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    7. Re:Bad Science all around. by JetJaguar · · Score: 1

      Uh, you're repeating essentially what I just said. In your previous post, it sounded like you were not making a distinction between the theory and the fact. Perhaps I didn't make that clear, but that is what I was getting at.

      --

      Shop Smart, Shop S-mart!

    8. Re:Bad Science all around. by mog007 · · Score: 3, Insightful

      No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.

      If something cannot be questioned, then it does not belong in a science laboratory, it belongs in pulpit in a church. The concept of QUESTIONING is what gives science its bad ass record.

      The luminiferous ether was widely regarded as the only way for light to behave the way it did. Light was a wave, and that explained the double slit experiment.

      Then a few jerks were just messing around and bang, the ether is GONE. The discovery was so important, it got one of those jerks a Nobel Prize. When somebody says they have an idea that's totally irrefutable, their idea isn't science. Even various aspects of evolution are able to be falsified, for example, if a fossilized cat were found in the Jurassic period, then that would throw common decent right out the window. It's doubtful for that to happen, considering the mountains of evidence that support common decent, but it's never going to be an unquestioned fact. An absolute fact would require absolute proof, and the only tool that provides absolute proof is mathematics.

    9. Re:Bad Science all around. by GaryPatterson · · Score: 1

      Don't get too worked up - the story included that line, but few scientists will consider any theory a rock-solid fact. There's always going to be modifications and special cases to be handled, and there's the off-chance of a Nobel Prize to a scientist who can extend an existing theory, or replace it with a better one.

    10. Re:Bad Science all around. by Nicolas+MONNET · · Score: 1

      Your nitpicking is as useless as it's wrong.

    11. Re:Bad Science all around. by LWATCDR · · Score: 1

      No I didn't talk about the fact at all. The article wasn't talking about observed evolution at all.
      It was talking about the Theory of Evolution and how it could be taken as fact. I was only addressing what was in the article.

      --
      See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    12. Re:Bad Science all around. by LWATCDR · · Score: 1

      Well you can question anything but there are some facts. Observational data can provide facts. Things like the Earth is roughly spherical is a good example.
      Or sunlight is reaching the Earth is also a fact. Will if it daytime where you are at.
      You can make observations and those can be facts.
      But when real scientists add theory to it. Then they are making a statement that it is a theory.
      The problem are the two groups of none scientists.
      The ones that think that theory means guess. And that one theory is as good as another.
      Then the other group. The ones that think that theory means fact. What makes me so angery is those tend to fill Slashdot and have no doubt that they understand science.

      --
      See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    13. Re:Bad Science all around. by 99BottlesOfBeerInMyF · · Score: 1

      Then the other group. The ones that think that theory means fact.

      I don't believe in this group. Who here or elsewhere has ever claimed that "theory means fact"? Theories can be well supported enough so that reasonable people accept them as facts for all practical purposes, but other theories can be almost completely unsupported. I've never heard anyone argue that theories are inherently facts.

    14. Re:Bad Science all around. by Alpha830RulZ · · Score: 1

      Newtons theory of gravity worked for a long time but we had to toss it when it started to fail.

      You know, every time these discussions come up, stuff like this gets said, and it obscures an important subtlety in the debate. Newton's equations still work perfectly well for most things we care about. Very few people need to use anything but Newtonian approaches for real world calculations. When we estimate the trajectory of a bullet, baseball, or space shuttle, we use Newton, despite knowing that more accurate approaches exist. Newton's laws and their attendant equations work perfectly well to explain most of what is around us. It may not be "Truth" but it's a very useful approximation. Predictions made with it generally "just work" (tm). [/smirk]

      As does the theory of evolution.

      --
      I was taught to respect my elders. The trouble is, it's getting harder and harder to find some.
  29. Re:Personally by Liquidrage · · Score: 4, Insightful

    Years ago when Georgia was going through the ID vs Evolution in school issue I saw the national media on site at a high school ask a local student his thoughts. He responded that he wanted ID taught because he knew evolution was full of holes and he could disprove it himself.

    Well step up young man and claim your Nobel prize that's waiting you.

    Where did he get his (mis)information from? It's not the local drug dealers. It's not the science classes. It's not video games.
    It's the churches.

    There are many churches that deal in lies to peddle their agenda of pushing evolution out of the classroom. It's not a conspiracy theory it's a fact of life in this country.
    If man came from monkeys why are there still monkeys? People ask that because they've been told that. They've been told that is a hole in evolutionary theory so they parrot it. They aren't told that at the drive through line at McDonalds. They are only told that type of information in religious circles.

    I used to argue with Answers in Genesis for years. It was like pulling teeth trying to get them to remove content that was completely non-factual or completely taken out of context. Letter after letter would be sent with references to the correct information, but it would take months or years (or sometimes never) to get them to correct their website. Even though they updated their site regularly. There was no incentive for them to provide correct information because incorrect information is the only way they could build their case against evolution.

    The fact that some Christians can't reconcile their religion with a very well grounded theory that has withstood the rigors of science for over 100 years isn't my problem.

  30. Mod parent up by zerkshop · · Score: 1

    Mod parent up!!!

    Its hard to be believe how ignorant people's arguments can be like the GP's. Or should I say, contradictory?

    If evolution isn't provable, thats like saying any science shouldn't be taught because it's not provable.

    "Creation theory subscribers" should just stop getting vaccines, using modern technology, etc etc :)

  31. Re:2 - The Great Flood (Where are all the Unicorns by bcrowell · · Score: 4, Insightful

    Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism" (YEC for short)

    That would be very convenient for the creationists, because YEC is disappearing these days. The creationists have learned that if they make definite scientific statements (e.g, that the Earth is 6000 years old), they risk being proved wrong by scientific evidence. Instead, they've learned to say vague, fuzzy things about intelligent design, while avoiding making testable statements about facts.

    There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.

    Right, and those people aren't creationists. The wikipedia article gives a good definition of creationism: "Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities, whose existence is presupposed.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution.[2]" In other words, the commonly accepted definition of creationism is that it's in contradistinction to evolution, so the people you're describing, who accept evolution, aren't creationists. "Creationism" is just one of those words that doesn't mean exactly what you'd think it meant based on its etymology. For comparison, "communism" doesn't mean belief that people should live in communes, and a "Republican" in the US isn't defined as someone who's happy that our form of government is a republic.

  32. Re:2 - The Great Flood (Where are all the Unicorns by Wonko+the+Sane · · Score: 5, Funny

    --
    Fuck y'all.

    Your ideas are intriguing to me and I wish to subscribe to your newsletter.

  33. Re:2 - The Great Flood (Where are all the Unicorns by d34thm0nk3y · · Score: 1

    Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism" (YEC for short)

    Slashdotters, everyone else on the planet, and dictionary writers you mean...

    Creationism Defined:

    Some excerpts:

    the doctrine that matter and all things were created, substantially as they now exist, by an omnipotent Creator, and not gradually evolved or developed.

    Belief in the literal interpretation of the account of the creation of the universe and of all living things related in the Bible.

    the literal belief in the account of Creation given in the Book of Genesis; "creationism denies the theory of evolution of species"

  34. pardon? by Phantom+of+the+Opera · · Score: 1

    Huh? Name a time in history where this wasn't true? The best and brightest have been getting dumped on since time immemoriam (sp?).

    I don't think this was true for most of history. I don't even think it was true for the early part of the 20th century. Doctors and scientists and engineers were admired or at least respected. In the 19th century, 'The Origin of Species' was a popular read. Don't forget the enlightenment, Confucius, the renaissance, the philosophers of Greece and Germany. In India and China, people work extremely hard to get into universities. It's the utmost honour to be the one from your villiage to get to go.

  35. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 5, Funny

    Since you seem like a friendly fellow I'll save you a little money. Every issue of the newsletter just contains the same two words, in large type on the front page, and nothing else.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  36. My opinion by Anonymous Coward · · Score: 2, Interesting

    In my opinion, schools need to have a separate course on Culture. It should teach about different races and religious beliefs. Intelligent design should certainly be taught there, so that people understand and respect one another's beliefs. Currently, for every idiot who opposes evolution, there's another idiot who is unaccepting of religious beliefs. There are a lot of people who believe in a combination of evolution and intelligent design (myself included), and while the intelligent design aspect is in no way science, it is education.

  37. Why I knew I could never be a high school teacher by smchris · · Score: 1

    "chock full of bad science and questionable reasoning"

    Just the book I'd enjoy adding to a class so we could learn something about science and reasoning by tearing it apart together.

  38. Re:2 - The Great Flood (Where are all the Unicorns by jcr · · Score: 1

    The Irish Rovers song doesn't count

    That was a Shel Silverstein song, BTW.

    -jcr

    --
    The only title of honor that a tyrant can grant is "Enemy of the State."
  39. Ok, so I'm reading this... by gfxguy · · Score: 2, Informative

    "... as evidenced by recent legislation mandating that it be taught in school. ..."

    And I said "WHAT?"

    So I clicked on the link... and it says "The US state of Louisiana has passed the 'Science Education Act,' a piece of legislation that could allow Intelligent design to be taught in schools."

    And this is why we will never get anywhere trying to intelligently discuss anything; either about education, politics, any contentious issue... because I honestly believe that this is how "ScuttleMonkey" sees it; when people disagree with something, they paint it as the most extreme, worst exaggeration... it's not that I agree with it, this book, or ID, it's that people become blinded when they get "religious" about a topic (no pun intended).

    --
    Stupid sexy Flanders.
  40. Ad-based economy by oldhack · · Score: 1

    Ad- and marketing-driven economy is a big part of the problem, I think. It makes us lie to ourselves things are "free". Ain't nothing free, like all the wisemen and assholes alike say. one of the prices we pay is slow erosion in the culture.

    --
    Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
  41. Re:Evolution textbook!? by vought · · Score: 4, Insightful

    And while we're at it, can we stop giving:

    Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning

    ^ These idiots a veneer of respect by treating them as if they're rational? They AREN'T. They are functional (but nevertheless, crazy as a shithouse rat) religious zealots who do not respect science unless it serves their beliefs (see also: nuclear power, IC engine, medicine, etc.).

  42. Re:America is evolving backwards by philspear · · Score: 2, Insightful

    Evolution in the broadest sense means change, it doesn't imply directionality in biology and it doesn't in a more general use of the word. Saying something is evolving backwards is like saying something is "changing backwards."

    If a parent species of birds were to give rise to a new species of birds that were dumber, smaller, uglier, and/or shorter-lived, that wouldn't be de-evolution or evolving backwards, that would still be evolution.

    Use your terms properly! What you mean is that you don't think you like what america is "evolving" into.

  43. Hot Topic? by gyrogeerloose · · Score: 3, Informative

    From the summary:

    "Intelligent Design is still a hot topic

    It's only a hot topic here in the United States. In the rest of the civilized world, ID is dismissed as the nonsense it is.

    --
    This ain't rocket surgery.
    1. Re:Hot Topic? by jandrese · · Score: 1

      Actually, it's not even a hot topic in the US, just the handful of nuts that want to make a big deal of it know how to get on TV.

      --

      I read the internet for the articles.
  44. Re:Reasons that are so so compelling... by gyrogeerloose · · Score: 2, Insightful

    Evolution is as much a religion as anything else.

    Horse shit. Evolution is a provable scientific theory. Show me one other religion that meets that standard, please.

    --
    This ain't rocket surgery.
  45. Re:Personally by Arcane_Rhino · · Score: 1
    "evolution has been observed, including new species creation"

    Aside from the amusing (and, I suspect, unintentional) contradiction between "observable evolution" and "species creation", this is incredible news of which I was unaware. What new species was observed emerging? When did it happen? This event really should resolve the question for creationists entirely.

  46. Well, you remember how it all started? by Freedom451 · · Score: 2, Funny

    We evolved in a world where it took about 20 hours/week to get everything we needed. People that bent their head down over a big leaf scratching symbols for very long got eaten by lions.

    Pretty much, we're evolved to be beach bums, and all this 60 hour weeks doing the same thing in the same place all day long is a mental illness we only lapsed into in the last 10,000 years, a bare millesecond in evolutionary time.

    I blame it on the women, myself - she kept complaining about the skin hut falling down until finally he got p'o'd and went figured out how to build with wood and stone just to get some peace.

    But then he couldn't move the hut anymore, and he had to start planting grasses and tubers around the hut for food. Then his buddy's wife made him build a stone hut next door, then her friends got on their men, and pretty soon you had a town, and that was the end of the good old days...its been little pink houses ever since.

    --
    When the country falls into chaos, politicians talk about 'patriotism'. Lao-Tzu
  47. Re:Reasons that are so so compelling... by jjohnson · · Score: 1

    Nonsense. Religion has, at its roots, beliefs that are accepted by faith--that God exists, that salvation is possible, etc. You can reason about derived doctrines, but in the end you are religious because you accept the basic premises on faith. That's the whole point of faith.

    What the article says is that there are demonstrable reasons that are compelling, so compelling that they may be treated as fact. As compelling as the sky being blue. I don't believe that the sky is blue on faith; I believe it because the demonstration of looking up and seeing blue is so compelling that I call "the sky is blue" a fact, despite sometimes difficult philosophical arguments about skepticism and solipsism.

    Evolution as a topic on /. depresses me so much because I see so many geeks, so many people who are theoretically well grounded in engineering and empiricism, make moronic equivalencies between religion and well established scientific theories.

    --
    Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
  48. Re:Evolution textbook!? by Gordonjcp · · Score: 5, Insightful

    They are functional (but nevertheless, crazy as a shithouse rat) religious zealots

    I think it's worth pointing out - particularly to people in the US - that the Muslim countries of the Middle East led the world in science and technology, once. Why do you think so many stars have Arabic names? Why do so many words in science have Arabic roots? Think carefully...

    Now think about what happened when they let the conservative religious crazies take control.

    Just sayin'

  49. yes, thank you by Phantom+of+the+Opera · · Score: 1

    Add to that philosophy

  50. Re:Personally by methuselah · · Score: 1

    the point of education is to inform and to teach reasoning skill. many many people believe in creationism in some form. evolution even fits into some peoples view that do fundamentally believe that something started all of this. what I find astounding is that we can't even broach the concept of god in our schools but, we must teach faggotry to the 5 year old children of christians. So beat your chests about how inappropriate it is to teach the philosophy of god in public schools. After all anyone that has read any of the history of this country knows we were founded by a bunch of hedonistic pagans that sat around performing acts of debauchery. I for one have never said evolution should not be taught but don't you even for a second demand i accept it as the universal truth. you want to cram your truth down my throat while decrying mine. your rationalization for shouting me out of the room is that I want to shove my beliefs down your throat? isn't the next logical step violence? it just kills me how humanist bullshit clings to "its" facts making it "correct" therefore anything that doesn't conform to it bullshit and can't be tolerated. bullshit is bullshit you want me to respect yours then you respect mine. the hysterical part of this whole discussion is if I don't buy your bullshit hook line and sinker you accuse me of be "intolerant".

  51. Re:Personally by jjohnson · · Score: 1

    Nonsense. Evolution has been "proven" to the satisfaction of the science community, just as much as heliocentrism or the theory of gravity--which is to say that falsifiable theories have been constructed that explain more data than previous theories, and will likely be refined or replaced with better theories in the future. In purely scientific terms, evolution is one of the safest bets around.

    When (virtually) all the scientists studying evolution consider its basic premises to be proven, on what grounds can you possibly say they're wrong?

    --
    Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
  52. Serbes by falconwolf · · Score: 2, Informative

    Serbs with their hateful xtian idealogy

    You're wrong here, it was Catholic Croats collaborating with NAZIs who persecuted Orthodox Serbians. More recently the Albanians, especially the KLA, Kosovo Liberation Army, were persecuting Serbians and others. And the KLA deals in opium with an idea of a Greater Albania.

    It's not just Serbians who are instigating violence.

    Falcon

  53. Re:Evolution textbook!? by Hurricane78 · · Score: 2, Interesting

    Parent is the most insightful comment in a long time.

    That's *exactly* what happens now.

    But never forget that psychology defines religion as a kind of (mild or bad) schizophrenia. And indeed, if you compare them both, it fits nicely.
    So the country needs a therapy. As a whole. Unfortunately psychological therapies are still not very effective. :\

    But I learned, that a raise in intelligence often helps people to solve their problems themselves. So my money's on education. (And I'm not talking about the outdated way you know from school. I'm talking about modern methods and more social and emotional education in addition to logic an motor skills.)

    --
    Any sufficiently advanced intelligence is indistinguishable from stupidity.
  54. mandated by geoffspear · · Score: 3, Insightful
    "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school."

    Umm, the linked article says nothing about ID being mandated, it talks about legislation that would allow schools to teach it, not require them to do so. It's dumb legislation, but attacking intellectual dishonesty with more intellectual dishonesty doesn't really help your case.

    --
    Don't blame me; I'm never given mod points.
  55. Re:2 - The Great Flood (Where are all the Unicorns by mog007 · · Score: 3, Informative

    All the YEC apologists I've encountered believe in a deity who is incapable of deception. Their deity didn't make the world appear old even though it was young, they believe the earth IS young and all the science we rely upon is flawed.

    The Pastafarians are the ones who claim the earth is young, but the FSM made it appear old.

  56. Re:2 - The Great Flood (Where are all the Unicorns by GaryPatterson · · Score: 1

    So the YECs are guilty of blasphemy then?

    Believing that evidence is put in place by their God with the intent to deceive others is pretty much a slight against their God.

    Nice! Now, what do they think should be done to blasphemers?

  57. Re:2 - The Great Flood (Where are all the Unicorns by timmarhy · · Score: 1
    "It is not disprovable and thus not science"

    yes it is. geology 101 blows them out of the water. "looking old" has nothing to do with it.

    --
    If you mod me down, I will become more powerful than you can imagine....
  58. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 4, Funny

    I've met many creationists who, for example, thought that fossils were put there because of the flood and they just happen to line up in what appears to be a historical record because God is testing their faith.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  59. Re:Evolution textbook!? by Jeremy+Erwin · · Score: 1

    From the article:

    EE appears to be part of a strategy to change that. In June, Louisiana became the first state to enact a law specifically enabling the use of supplemental materials for the critical evaluation of evolution; similar legislation has been introduced in several other states. EE appears to have been intelligently designed to be the sort of supplemental text that's appropriate under the Louisiana legislation, and so it's likely to be making an appearance in classrooms there. But EE may appear in other states, as the approval process for supplementary material is often far less strict than that governing textbooks.

    There's nothing wrong with using a couple of texts per class, provided that costs don't spiral out of control.In literature classes, for instance, the use of supplementary texts allows the class to read unabridged novels and epic poems.

  60. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 2, Insightful

    Um, yes it does. There is no detectible difference between the Earth being created billions of years ago out of the coalescing gas cloud surrounding the young Sun, and the Earth being created six thousand years ago in the exact state it would have been if it had been created billions of years ago out of the coalescing gas cloud surrounding the young Sun.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  61. Re:2 - The Great Flood (Where are all the Unicorns by gregbot9000 · · Score: 4, Insightful

    I want someone to hit the nail on the head with creationisms, but no one seems to ever do that online so I'll give it my best shot.

    Evolution in no way denounces god. Even the Catholic church says the view science has on the universe and evolution are compatible with their faith: http://rellavent.blogspot.com/2008/09/catholic-church-acknowledges-evolution.html And it's pretty easy to reconcile the two: universe created in a big explosion that created light, land and heaven coalescing into stellar bodies, water and land separating as it cools, life slowly taking to the land, and man ultimately being removed from the bliss of the primordial garden by eating the fruit of knowledge. It's god, if evolution happened without his help at all, he set up the universe knowing full well what it would do. ID in the 6k year old vein makes no sense and actually is insulting to the power of god.

    This brings up the problem of the creationists. Science as it is written, is not in that strong of a conflict with the bible as it is written, so why do they continue to push it?

    we know the symptoms: text books, politicians, online spaming, but what causes the disease? Or to frame it in a more humanistic perspective: what do they gain by perusing their agenda? This should be the prime argument in creationism, not the symptomatic treatment that has been prevalent.

    My theory is that creationism is viewed as being linked to a value system that creationists view as being under attack from secular radicals, and evolution is taken as a battle field to fight against this because Evolution is pretty removed from their day to day lives, if they chose to believe fantasy on it they wont hurt them selves like they would if they choose to believe fantasy about refrigeration. Basically they are picking ID as the place to make their stand to defend their way of life.

    That brings up the other point, why do they feel their way of life is in danger? It could be politicians playing it up for votes, it could be changing social economics beyond anyones control, it could be pure paranoia, and it could be that people in the cities and scientific community actually attack them. I think its a combination of all those factors, but i also think one of the largest factors is the fact that Secular atheists do actively attack the religious beliefs of others.

    I know this from having been to several meetings. The atheist community is one of the most bitter and spiteful I have ever seen and actively wish to see all "non-rational" belief systems torn down and replaced with their "belief" system on a level that matches any religion. Pure tribalism at its best, two sets of group-think throwing stones at each other. the Atheists attack christen beliefs and they attack the atheists through ID.

    The solution to the problem is not the one shown on /. of armchair intellectuals decrying the ignorance of the bible belt hicks, while smugly reassuring each other that they have the "best" ideology. It is through an understanding of their actions and why they do them and coming to terms with them. Calling their text book stupid isn't going to get them to stop. I don't know what the solution is, but I know what it isn't.

  62. Re:Personally by Liquidrage · · Score: 1

    Your personal ignorance is your own right. But I will fight against your desire to spread your ignorance to the masses.

    And I really don't care for nor want your respect.

  63. Re:2 - The Great Flood (Where are all the Unicorns by BLAG-blast · · Score: 1

    Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism" (YEC for short)

    Eventually your belief (the one about your invisible friend creating everything) will be challenged. Then you must move your goal posts or do what the "YEC" sheep are doing, cling to fiction and trying to force everybody else to accept their fiction.

    But, until then, enjoy the comfort your beliefs bring to you.

    When they used the term "sheep" in the bible, do you think the people penning it chuckled as they wrote it...

    --
    M0571y H@rml355.
  64. Re:Personally by mog007 · · Score: 1

    Use. Fucking. Google.

  65. Re:Evolution textbook!? by Anonymous Coward · · Score: 4, Informative

    > Now think about what happened when they let the conservative religious crazies take control.

    Methinks history betrays you.

    The Wahabbi extremists (Islamic versions of the US fundamentalist extremists) came to power with ibn Saud, in the 18th century.

    Economic power (and scientific luminance) seeped away from the Caliphates and kingdoms of the Levant when the sea routes were broken open, most notably and astoundingly at Lepanto.

  66. Re:Evolution textbook!? by meringuoid · · Score: 5, Interesting
    The fall of the Islamic intellectual tradition wasn't entirely born of their own fundamentalism. It followed the sack of Baghdad by the Mongol horde. The centre of a civilisation stretching from India to Spain, full of the intellectual riches and history of all Eurasia, all burned. The loss of the Library at Alexandria was bad. This was worse.

    There followed a long decline. Wars, on and off, with the crusaders of Europe raiding into the Middle East. Various rulers of Arabic and Persian and Turkish dynasties competing for domination of the Islamic world. A gradual eclipse as the nations of Europe set about building their empires. And finally irrelevance, a culture respected only insofar as it provides crude oil to its betters. Small wonder that a civilisation brought so low from such a glorious past turns to its god for answers, and finds dark counsels.

    --
    Real Daleks don't climb stairs - they level the building.
  67. Re:Reasons that are so so compelling... by mog007 · · Score: 1

    Could you please define "religion". I've got two definitions from Princeton:

    "faith, religious belief (a strong belief in a supernatural power or powers that control human destiny) 'he lost his faith but not his morality'"

    and

    "organized religion (an institution to express belief in a divine power) 'he was raised in the Baptist religion'; 'a member of his own faith contradicted him'"

    I'm afraid the Theory of Evolution by Natural Selection doesn't fall into either of those definitions. Evolution is used to describe the natural world, so the first definition is out, because that deals with the "supernatural". And the second definition is out, because evolution is not a divine power. It's not a non-divine power, either. It's simply a mechanism that explains the natural world as we can observe it.

  68. I don't believe in Google by Nicolas+MONNET · · Score: 1

    It's obviously the work of the devil.

  69. proving yet again.... by Denihil · · Score: 1

    that intelligent design and intelligent thoughts are parallel and not perpendicular thoughts.

    --
    WÌÌfÍ--ÍSÌÒÍ...Í...ÌHÌÍfÍÍÍ--ÍÍÍ
    1. Re:proving yet again.... by Wonko+the+Sane · · Score: 1
  70. "No theory in science can be treated as fact" by Nicolas+MONNET · · Score: 1

    No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.

    Oh yeah? Not even the theory of gravity? Or the theory of heliocentrism? What about atomic theory? And quantum theory? Way wacky, as theories goes. Yet black body radiation wouldn't be possible if it weren't true. Don't know what that means? Okay, look at that box under your desk; that computer you used to post your nonsense, how well do you think it would work if quantum theory weren't fact?

    1. Re:"No theory in science can be treated as fact" by LWATCDR · · Score: 3, Insightful

      "Oh yeah? Not even the theory of gravity?"
      Nope it was tossed out once already. Newtons "laws" of gravity failed to predict the orbit of Mercury.
      "Or the theory of heliocentrism?"
      Not a theory. Been proven by observation. BTW you know that that first version had the Sun at the center of the Universe.
      "And quantum theory? Way wacky, as theories goes/"
      Why do you think we have places like CERN? Yes Quantum theory is very useful but there is a good chance it will go the way of Newtonian physics as well. It fails to work for gravity much like Newtons laws failed for the Orbit of Mercury.
      But just as Newtons laws are good enough for many things so is quantum physics. But it is an incomplete theory but it is the best framework that we have. It isn't a fact because it is still being refined.
      People need to stop worshiping science "and patting themselves on the back for doing so" and actually learn it.

      --
      See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    2. Re:"No theory in science can be treated as fact" by zkiwi34 · · Score: 1

      Happy days! Someone who gets it that science should not be worshiped.

  71. Re:Personally by methuselah · · Score: 1

    what brought up respect have nothing but contempt for stupidity and you have demonstrated yours rather effectively

  72. Re:Personally by smoker2 · · Score: 3, Insightful

    Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.

    Whoa there !
    We don't "know" anything of the sort. That is why we call it "The Dark Ages". It may disappoint you to learn that if it wasn't for the church, there would be no written records of most of our history before that. And by "our" I mean, in the west. I don't think they had a "Dark Ages" in India or China, so there goes your "human race" argument too. Where do you think all that knowledge of the past came from ?
    And religion wasn't responsible for the breakdown of society either. It just so happened that the Romans went home. No-one else invaded for a while, so we all just did our thing. The Romans were the ones with all the inventions and organisation. No one else really saw the need. If you really look with open eyes, you'll find that religion has been the number 1 educator for almost all human history. They were the geeks of their time. If you needed an answer you went to the monastery and they gave you what knowledge they had. Of course it was religious, they're monks ! But they kept written accounts, learned mathematics, studied the skies. It's only in the last maybe 200 years that the masses were deemed worthy of reading and writing, and it's only really the last 100 years that anybody actually had the right to go to school.
    No, I'm not religious. But science is about facts, not FUD.

  73. This isn't the only bad textbook. by jd · · Score: 1

    There are now textbooks which solely and specifically go through all the errors and flaws in other textbooks. It makes for a superb recursive market, but not for a very coherent picture.

    Personally, I would like to see a law in the US requiring that textbooks permissable as school texts (including private schools, but excluding specifically and explicitly religious texts) be peer-reviewed to the same standard as scientific papers, and that such reviews shall expire either after a fixed period of time (with the option of being re-validated) OR expired when there is general consensus within the field that a major theory has failed a critical test and been falsified within the range of conditions that would be addressed by the target school audience.

    (I would not consider falsifying Hooke's Law outside the limits of elasticity or at levels of precision beyond the means of Junior High to measure to be significant. We know it's an approximation, we know why, and we know the scope over which the approximation is good enough to be useful. Put the caveats in as a footnote if you like, but you don't need to reject a useful approximation to such students simply because it isn't a useful approximation to others.)

    Either that, OR require that all examinations in all schools (public and private) be peer-reviewed at that level of accuracy with zero allowance made for what the school chooses to teach. It comes to the same thing - the only way to pass is to exclude all teaching material that isn't as valid or better than the examination material.

    (If examinations were changed, I'd also add in that the syllabus be made intentionally less specific. Tests should not be about how well children do at tests. They should be measures of how well the children understand the subject. Teaching to the test is the worst possible form of education. Well, second-worst. Teaching to the religion is the worst.)

    --
    It's a small world and it smells funny; I'd buy another if it wasn't for the money; Take back what I paid (SoM)
  74. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 2, Insightful

    Although, as you say, such beliefs are not "disprovable", they do open up the realm for an infinite possibility of counter-beliefs, none of which are disprovable, and certainly unchallengeable should the ID/YEC believer insist his initial assumption be considered or believed.

    For instance, I could say back to him, "Erm, no, actually *my* god created the Earth just last week. All your memories are false, and I have here a book which declares, above all, that you're a fucking idiot, and you can't disprove me because any evidence you might think you have found to the contrary has been put there in order to make this existence seem real."

    Et cetera.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  75. Re:2 - The Great Flood (Where are all the Unicorns by Beardo+the+Bearded · · Score: 1

    You'd get a response like this:

    "The rocks aren't really that old. They are made to look old by all humanly methods, including carbon dating. God is perfect and infallible, and has foreseen not only carbon dating, but any other future inventions that can check ages. By all human measurements, the rocks will appear to be hundreds of thousands of years old, although they are obviously not more than 4000 years old. You cannot disprove The Holy Bible by a mere technological invention."

    The quotes are to clarify any problems with Poe's Law.

    --

    ---
    ECHELON is a government program to find words like bomb, jihad, plutonium, assassinate, and anarchy.
  76. Re:Evolution textbook!? by dwarg · · Score: 1

    These idiots a veneer of respect by treating them as if they're rational? They AREN'T. They are functional (but nevertheless, crazy as a shithouse rat) religious zealots who do not respect science unless it serves their beliefs

    I just want to point out that while most of what you say is true, calling them crazy is far too dismissive a term. They are extremely intelligent in their ability to manipulate the system and draw people to their cause. They are capable of framing the debate in ways that make them look credible and they have the resources to broadcast and rebroadcast their message which further bolsters their credibility. They have been very methodical in probing the system for weak point (superstitious school boards) and advancing toward their goals slowly.

    I have no doubt many of the drivers of their movement are zealots, but I also believe that some of them want to use religion as a means of controlling the populous--as Leo Strauss, the father of the Neoconservative movement taught. When leaders extol the virtues of religion to a receptive audience (I.D. is designed to make people more receptive to religion instead of science and facts) it blurs the separation between divine powers and the leader's power and makes people less likely to question authority.

    If economic pressures continue to erode the middle class and push more people into poverty, more people will turn to religion for comfort. With ID being taught in schools children can be further indoctrinated into those beliefs and our slide back into the dark ages will begin.

    --
    I'm a glass half full kind of guy.

  77. evolution by falconwolf · · Score: 1

    Evolution is happening, and if a person doesn't believe that,

    Oh but at least some IDers admit evolution does happen, microevolution. But mcaroevolution doesn't. Still other IDers say evolution is directed by a superior intelligence. Or something like that.

    Falcon

    1. Re:evolution by Fastolfe · · Score: 1

      The point I was trying to make is that disbelief in the the facts of evolution require a different kind of person than one that disbelieves the reigning Theory of Evolution.

  78. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    Sorry, the correct term is "falsifiable". It means that an assertion has the logical possibility of being show false. In other words, if the assertion is wrong, can you show it to be wrong?

    Creationism isn't falsifiable, because any piece of evidence can be explained with "God did it". Evolution is, for example if the Intelligent Designer suddenly showed up and announced himself.

    "Testable" isn't really it, because that implies that it can not only be disproven but also proven. Generally scientific theories can't be proven, only fail to be disproven after many different rigorous tests.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  79. Re:2 - The Great Flood (Where are all the Unicorns by jstott · · Score: 1

    Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)

    While unicorns aren't mentioned in any modern English-language translation of the bible, they are mentioned in the King James Version (a widely-read translation from around 1610). According to Wikipedia, unicorns are mentioned in the following places: Job 39:9-12, Ps 22:21, 29:6, Num 23:22, 24:8, and Deut 33:17. Noah and the flood are in Genesis, so all of these would be post-flood references. The translation of re'em as unicorn, however, would seem to be specific to the KJV.

    -JS

    --
    Vanity of vanities, all is vanity...
  80. Re:Evolution textbook!? by blahplusplus · · Score: 5, Interesting

    "Therefore, the seeker after the truth is not one who studies the writings of the ancients and, following his natural disposition, puts his trust in them, but rather the one who suspects his faith in them and questions what he gathers from them, the one who submits to argument and demonstration, and not to the sayings of a human being whose nature is fraught with all kinds of imperfection and deficiency. Thus the duty of the man who investigates the writings of scientists, if learning the truth is his goal, is to make himself an enemy of all that he reads, and, applying his mind to the core and margins of its content, attack it from every side. He should also suspect himself as he performs his critical examination of it, so that he may avoid falling into either prejudice or leniency."--Ibn al-Haytham

    http://en.wikipedia.org/wiki/Ibn_al-haytham

    This is what too few human beings do, they always trust in what they have been taught... when much of what they know is fraught with error. I am weary of anything I say as well as anything any other man says, that cannot be demonstrated. Therefore, I only defend what can be demonstrated.

    The majority of people do not take the above view, they are overconfident in what they think they know when they hardly know anything at all.

  81. Re:Evolution textbook!? by Jangchub · · Score: 1

    That was quite a beatific swirl of information. I didn't cry but the thought of a tear arose in my mind.

  82. Re:2 - The Great Flood (Where are all the Unicorns by Anonymous Coward · · Score: 1, Interesting

    So by extension of your logic, any knowledgable person who contributes accurate information to wikipedia immediately becomes wrong retrospectively until the point at which that knowledge was first gained. Right?

  83. Rebuttal by johanatan · · Score: 1, Insightful
    Instead of taking my usual approach of replying to the extremist comments here on slashdot that inevitably rise to the top of the moderation system, I thought this time I would offer direct responses to TFA.

    Evolution has been singled out for special ire by Discovery, as it provides an explanation for the origin of humanity based solely on natural processes.

    There's two claims here-- 1. Evolution is singled out. 2. It is singled out because it offers an explanation for the origin of humanity based solely on natural processes.

    On the first:
    William Paley predated Darwin. And, certainly Creationists have not in the interim ceased 'preaching' the same message which has gone forth since before either of them.

    And, the second:
    Does evolution really offer an explanation for the origin of humanity based solely on natural processes? If you really believe that, then ask yourself two questions. 1 - Where did the original matter making up the primordial soup (or the infinitesimally small mass before the big bang) come from? and 2 - What about these natural laws that seem to govern the universe which make natural processes possible?

    And, even if evolution did offer this explanation, it is solely a conjecture that rebuffing evolution is ID theorists' sole motive in advancing their theory.

    Why should I continue any further? I typically stop reading articles after the first few errant statements, but in this case, two are enough. Why should I waste any more time on this?

    1. Re:Rebuttal by LSD-OBS · · Score: 1

      THERE ARE EXACTLY 2^52 (4503599627370496) POSSIBILITIES OF THAT EXACT COMBINATION OCCURING!

      That should read something "1:2^52 odds against that exact combination occuring", whoops :)

      --
      Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
    2. Re:Rebuttal by johanatan · · Score: 1

      Your 'origin' is but my intermediary stomping ground. I do not consider that an 'origin' in any sense of the word. If you want to talk about origins, then do so. If not, then please choose another word (and please inform the rest of your community including the author of TFA that origin is rather an 'endpoint' instead of an intermediary).

      And about the anthropic principle that you seem to find so contemptible-- yes, the combination of factors we observe is unique and quite improbably, but the key to the anthropic principle which you seem to miss is that 'we observe it', i.e., sentience.

      Why, in your view, is there a difference between plants and animals? Or is there? And, if there isn't, why is there anything such as morality of any sort governing the way we 'animals' treat each other? Why would a moral code evolve for animals, but not for plants?

    3. Re:Rebuttal by johanatan · · Score: 1

      P.S. Since you seem to be a fan of logic, let's go through a few inferences here starting with these numbered axioms.

      1. TFA said that ID theorists single out evolution because it 'explains the origin of the human species in terms of natural processes.

      2. ID Theorists are by most all accounts Creationists and religious followers of Christ (and to a lesser extent other 'gods').

      3. People single things out because they consider them threats to their way of life or belief systems or pride or anything else 'selfish'.

      Ok, now, I hope I haven't lost you up to this point (and you, being the bright one you are, probably already see the inference I'm about to make).

      Conclusion: ID Theorists are attacking evolution because it is a threat to their belief system.

      Now, another axiom (thanks to your astute post):

      1. Evolution doesn't actually explain the 'origin' of anything, only its change over time.

      Wait!!! Hold on a second. Why would these Creationists feel so threatened by something that doesn't threaten their belief system?!? I'm confused.

    4. Re:Rebuttal by johanatan · · Score: 1

      Of course, I left one axiom out:

      4. The belief system of Creationists includes the existence of an all-powerful Creator who created the heavens and the earth and all living life. All things were created by Him, through Him and for Him.

      I hope that fills in any gap in the logic previously posted.

    5. Re:Rebuttal by johanatan · · Score: 1

      Actually, what the hell does base 2 have to do with it (is it just because we are on a geek site typing on computers which happen to have a binary numbering system)? I think the actual odds would be something more along the lines of:

      1: 52! (that's 52 factorial)

      Apparently, you should brush up on discrete math.

    6. Re:Rebuttal by johanatan · · Score: 1

      Oops, nevermind. I thought you were looking for a specific permutation (which would actually fit the anthropic principle better as an analogy than your illustration).

      Order (or sequence) is way more specific than a binary category and the anthropic principle includes *VERY* long odds for the tuning of the universe. So long in fact, that for all intents and purposes, it is by definition 'impossible' (according to a standard metric of statisticians).

    7. Re:Rebuttal by LSD-OBS · · Score: 1

      My reply was directly addressing your words, not those from the article. My logic still stands (as any sound logic should), and you still seem to want to lump various disciplines of scientific study together whereas what's in discussion is simply evolution versus ID.

      I'm not talking about who feels threatened by what. I'm talking about your completely erroneous assertions and assumptions.

      --
      Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
    8. Re:Rebuttal by johanatan · · Score: 1
      See previous reply. I think it was very clear where the statement:

      'Evolution offers an explanation for the origin of the human species based solely on natural processes'

      came from (hint: it wasn't me. IT was TFA and it was the same statement that I objected to).

      Also, please see previous post discussing the nature of the word 'origin'. Is there such a thing as an 'original origin'? Or, can you say that one origin is more original than another? I don't think so--origin is an ENDPOINT!

    9. Re:Rebuttal by LSD-OBS · · Score: 1

      By your complicitly I take it you are unable to refute my initial comment refuting your own logic. That's kinda still the point.

      --
      Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
    10. Re:Rebuttal by johanatan · · Score: 1

      No, you're absolutely right that evolution says nothing about origins (either of the universe or of man because even if you can trace man's origin back to the primordial soup, that soup must've come from somewhere). That was kind my point too. How can you speak of intermediate origins? Either something is an origin or it isn't and I don't think you can speak of the origin of the species independent of the origin of the universe. Anyone who is satisfied by science's explanation of the very distant past is simply either very easily satisfied, not very inquisitive or engaging in willful ignorance.

      I addressed your critique of anthropic principle in another post if that's the 'refutation' you're referring to. But, in short, sentience and ultimately intelligence are the keys to the anthropic principle (mere sentience is not enough unless it evolves into intelligence or hyper-intelligence). Consider a universe where everything else had turned out the same except that we humans and animals were not self-aware (so either a fully plant-like life existed in this hypothetical universe or none at all, just matter). In that universe, the anthropic principle would not apply. I wouldn't want to begin to speculate exactly how unique the sentience trait is (out of the 2^52 possibilities in your illustration), but I would bet that it is rather rare (not to mention that the existence of a soul really transcends the physical entirely). [And, obviously, I believe sentience is more than a rare trait, but even with your rationalist methodology, you ought to be able to agree that sentience affects the odds quite a bit].

      I suppose you could say at this point that sentience is merely an illusion, but it's pretty clear that in our current universe there's both sentient and non-sentient beings/collections of atoms. I think that if you chose to roll the die and come up with alternate universes, you'd at least have the possibility of coming up with one just like we have here--so both sentient and non-sentient life forms are possible in all alternate universes too [and maybe there's even hyper-sentience or meta-sentience ad infinitum].

    11. Re:Rebuttal by LarsG · · Score: 1

      Why would these Creationists feel so threatened by something that doesn't threaten their belief system?!? I'm confused.

      So am I. Why are the ID proponents so eager to push their stuff into our schools if evolution doesn't threaten their belief system? Might it have something to do with it conflicting with a literal reading of genesis?

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
    12. Re:Rebuttal by johanatan · · Score: 1

      Well, I think the real problem is that evolution is pushed into the science classroom, so that leaves no other option for the ID theorists and Creationists except to push for their material being presented as well. Evolution is more imagination than anything else (and no, I'm not ignoring the 'evidence' supporting it such as mutating viruses). Let's leave imagination to the liberal arts and not science, no?

  84. Re:America is evolving backwards by amRadioHed · · Score: 1

    And what's wrong with saying something is changing backwards? People used to believe in teaching creation in schools. Then for awhile we didn't. Now there are some that want to go back to teaching it. If we are reverting back to a previous state, isn't that changing backwards? It's a useful phrase that concisely expresses the idea that change is not always progress.

    --
    We hope your rules and wisdom choke you / Now we are one in everlasting peace
  85. Re:2 - The Great Flood (Where are all the Unicorns by amRadioHed · · Score: 1

    There are many creationists that profess to believe that the earth was created to look old to test our faith. Hell, in my immediate family alone I can name a few.

    --
    We hope your rules and wisdom choke you / Now we are one in everlasting peace
  86. Re:2 - The Great Flood (Where are all the Unicorns by amRadioHed · · Score: 1

    That would be very convenient for the creationists, because YEC is disappearing these days.

    You should probably clarify that by saying that these days YEC is disappearing from public. I'd be willing to bet that most people who claim to support ID deep inside are young earthers. They just see ID as a tool to get public opinion moving in the "right" direction.

    --
    We hope your rules and wisdom choke you / Now we are one in everlasting peace
  87. The Scientific Method (longer version) by Morgaine · · Score: 1

    The correct way to phrase it is as follows:

    Science consists of two halves which combine in the "scientific method":

    (i) A mathematical modelling half in which proofs are in the domain of logic and mathematics. The (entirely theoretical) models can be proven mathematically to be self-consistent or not, subject only to the constraints of Godel and the state of the art in mathematics; and

    (ii) An empirical half in which predictive hypotheses generated from the above mathematical models are tested against physical reality through observation and measurement. Under specific conditions related to error bounds and other statistical properties, these measurement can unambiguously declare a hypothesis to be unsupported by observation, and therefore its associated model to be declared invalid.

    When a model of Science has yielded a very large number of tested hypotheses but no observation has yet managed to invalidate it, it is then tentatively elevated to the exhalted heights of a Theory of science. But it can still fall at any time.

    So, speaking with more precision than we tend to get in these ID threads (:-) :

    1) YEC is not a model of mathematics nor logic and therefore cannot be demonstrated to be logically self-consistent;
    2) YEC is not a model of mathematics nor logic and therefore cannot yield a logically linked hypothesis for testing;
    3) Since YEC doesn't even have a hypothesis to test, it doesn't even reach the rank of a failed model, let alone a tentative one.

    I think the whole thing can be summarized as just "funny". Why is the human race even discussing this still in 2008?

    --
    "The question of whether machines can think is no more interesting than [] whether submarines can swim" - Dijkstra
    1. Re:The Scientific Method (longer version) by atraintocry · · Score: 1

      Seriously...YEC is almost as silly as sociology.

    2. Re:The Scientific Method (longer version) by arminw · · Score: 1

      ...A mathematical modelling half in which proofs...

      are only as good as the underlying assumptions that are made in the initial conditions and the algorithms of the models themselves. If those assumptions (beliefs) are wrong, the results will be, no matter how many super-computer are cranking out the answers. Assuming anything in nature to be constant over long periods of time is a very tenuous, iffy assumption.

      --
      All theory is gray
  88. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 4, Insightful

    Science as it is written, is not in that strong of a conflict with the bible as it is written

    Perhaps not if you don't take the bible literally. But many do. And science is, and let's not mince words here, absolutely and completely at odds with the bible as it is written, should it be interpreted as literal text.

    Now, I've never understood anybody who said they believed in the bible but didn't take it literally. What. The. Fuck.

    OK, how about: "I believe in The Complete Works Of Shakespeare, but I don't take it as a literal historical document." Say what now? What does "believe in" *mean* then?!

    Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.

    And just to be clear, attributing unknown or unexplained things to god is *never* a reasonable theory because that logic requires the concept of god in the first place, which (if you spend any amount of time thinking about it) you should know is circular reasoning and therefore crap. One of the fundamentals of the scientific method is never to search only for facts to fit a theory, but rather to constantly revise the theory to fit the facts. This precludes the possibility of the concept of "god" to ever factor in to any scientific theory because there was never any direct evidence to cause the scientist to develop the concept and theory of a god.

    Personally, I find religion deeply offensive, in the same way I find littering, racism, homeopathy, and liars offensive. If anybody is going to be doing any of that on my lawn, I'm going to yell at them.

    Now, I know exactly the tribal mentality you mention, but that is human nature and humanity will always have a Complete Dick contingent. However, I certianly do not need smug reassurance from anybody else whose beliefs line up with mine. My smug reassurance comes from ascribing to verifiable truth, which stands on a mountain of evidence, and holds its own.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  89. Re:2 - The Great Flood (Where are all the Unicorns by shadanan · · Score: 1

    Like a virtual machine save state. Either you install the OS from scratch, or you load the VM save state. Either looks identical to the running apps.

  90. My pet peeve about people who believe creationism by euclidprime · · Score: 3, Insightful

    is that they readily embrace other conclusions of science. Fundamentalist Christian's happily drive SUV's, talk on cell phones and take prescription medicine. They have no problem with the technologies and science that provide refined oil, vulcanized rubber, plastics, satellite communications, data encoding in radio waves, etc. They also implicitly agree with theories on blood-born pathogens, vaccines and antibiotics. But, when science turns its gaze to the age of the earth, the fossil record or the origins of the human genome, they suddenly have problems with the method or its conclusions. Except for possible exceptions like the Amish, it smacks of hypocrisy. Physics and chemistry are OK while genetics, astronomy and geology (oil good, dinosaurs bad) are suspect? If you want to live by revealed as opposed to discovered truth (remember Galileo?), perhaps rejecting more of the fruits of science is your spiritual path, are they not, after all, tools of the devil? I have no problem with spiritual beliefs, but 4000 year-old myths on the origin of the world really needn't be taken literally.

  91. Not "Mandated", merely "allowed" by plasmacutter · · Score: 1

    The law in question merely "allowed" it to occur.

    This merely stated explicitly what was implicit all the time:

    the schools dictate the curriculum.

    As disgusting as I find this campaign to destroy the foundations of science for the sake of irrational religious beliefs, This law did not "mandate" anything.

    --
    VLC FOR MAC IS DYING! IF YOU DEVELOP, PLEASE SAVE IT!!
  92. Re:2 - The Great Flood (Where are all the Unicorns by Anonymous Coward · · Score: 1, Interesting

    The reason creationists feel their way of life is under attack is that in a very real *psychological* aspect it is. A basic human need, is to feel significant, and beyond that to feel validated in the decisions you've made in life.

    As any child with siblings knows, one way to feel good about yourself is to try hard and achieve, the other is to find a way to feel better than your brother or sister by comparison ... possibly be insulting, hitting or tattling on them.

    Fundamentalism (actually all Zealotry) is in my opinion, simply an extension of this short-cut method of feeling better than everyone else by comparison.

    Linux-heads feel "under attack" by windows and os X.

    Creationists feel that they are "under attack" by science.

    Homophobes feel that they are "under attack" from gay people.

    Demoblicans feel that they are "under attack" by Republicrats.

    It's a moral short-circuit.

  93. Re:2 - The Great Flood (Where are all the Unicorns by LibertarianWackJob · · Score: 1

    I believe that light travels (roughly) 186000 miles per second.
    Can you disprove this?
    Since "it is not disprovable" is it "thus not science"?
    Think about it.

    --
    What? ®
  94. Evolution explained for creationists by timmarhy · · Score: 1

    Let me break it down to you this way: years and years along you were a monkey eating your own poop.

    --
    If you mod me down, I will become more powerful than you can imagine....
  95. Re:Reasons that are so so compelling... by plasmacutter · · Score: 3, Insightful

    slashdot now has over one and a quarter million subscribers, probably 5-10 times that many readers.

    Do you honestly think only geeks frequent this site anymore?

    Do you honestly think this site is not a major target for astroturfers?

    Over the past half decade, I've noticed a MUCH heavier proportion of blatant MAFIAA propaganda and utterly fallacious reaganomic sophistry modded to +5. I don't believe those posts, or the modding, traces back to legitimately individual users, and certainly not geeks.

    --
    VLC FOR MAC IS DYING! IF YOU DEVELOP, PLEASE SAVE IT!!
  96. teach the philosophy of god in public schools by falconwolf · · Score: 1

    I have no problem teacher religion in school, in a philosophy, humanities, or religion class but the only tyme in belongs in a science class is when explaining how religion repressed science. And if you're going to teach "God" in philosophy class be sure to also teach Buddhism, the Flying Spaghetti Monster, Hinduism, Jainism, and all the other religions. Fair play is fair play. If you're going to teach Genesis, also teach The Navajo Creation Story, Apache Creation Story, and other creation stories.

  97. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 3, Insightful

    It is falsifiable, which is to say that if it were false then it could be shown to be false. Since it's not false then it can't be shown false, but that doesn't change the fact that it's falsifiable. If light moved at a different speed then a simple experiment to show that different speed would falsify it.

    Contrast this to creationism. No matter what test you conduct and what results you receive, "God did it" is always a working refutation. Thus it's not falsifiable.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  98. Re:America is evolving backwards by LowlyWorm · · Score: 1

    Evolution does imply a direction though. "Survival of the fittest" has a specific meaning. Fit does not mean more intelligent, quicker, happier, or better. It is just the ability to successfully procreate. By that definition fruit files are fitter than humans.

    --
    Time flies like an arrow. Fruit flies like a banana.
  99. Re:2 - The Great Flood (Where are all the Unicorns by LibertarianWackJob · · Score: 1

    I concede 100%. "God did it" is not falsifiable. However, just because something can't be "disproved" doesn't mean it isn't science, maybe it's just true. Be careful to say what you really mean. Words mean things.

    --
    What? ®
  100. To coin a meme by LSD-OBS · · Score: 2, Funny

    Evolution vs Intelligent Design

    Darwin vs Darfail, basically, yeah?

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  101. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    Yes, I should have said falsifiable rather than "can't be disproven".

    --
    If you mod me Overrated, you are admitting that you have no penis.
  102. Re:2 - The Great Flood (Where are all the Unicorns by timmarhy · · Score: 4, Funny
    i would counter with "aliens came down and inserted a probe in your rectum, but before they could finish inserting the other 1/2 of your brain you started gyrating with enjoyment over the anal penetration and they had to pull out"

    if people really want to be so dense that they make up bullshit like that i say we just have fun with them....

    --
    If you mod me down, I will become more powerful than you can imagine....
  103. Re:2 - The Great Flood (Where are all the Unicorns by the_womble · · Score: 1

    Not only that, but time - St Augustine in particular. http://plato.stanford.edu/entries/evolution/#1 Evolution is more orthodox and traditional, and a better fit with Christian beliefs than "creationism". Have you noticed that the same people who advocate creationism have also abandoned a lot of other Christian ideas - such as the attitudes to power and wealth expressed by Jesus?

  104. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    No, but I think an omnipotent God (if one were available) could make it be already there when he created everything else.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  105. Re:evolution can't possibly be right, can it? by jjohnson · · Score: 1

    Do you realise that the same people who shout and scream about evolution being right, and that any form of design is wrong, would be the first to also instantly desert "evolution" in favour of any other future theory which seemed more paletable? - as quick as you could blink!!

    Yes, and that's science's virtue. When a better theory comes along, one that better explains the data, the scientific ideal is to switch to it easily as the obviously superior theory.

    Of course, sometimes scientists find it hard to abandon a pet theory, or the current orthodoxy, and that's a human failing. The perfect scientist would adopt the better theory without thinking twice about it.

    It's religion that decides it's got the one true TRUTH that is correct now, and for all time, no matter what happens, no matter what we learn, no matter what we mature into understanding as mistakes.

    As someone else said, when the facts change, I change my mind. What do you do?

    --
    Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
  106. Re:2 - The Great Flood (Where are all the Unicorns by Phroggy · · Score: 1

    Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)

    No.

    I wasn't aware that the Bible mentioned unicorns at all, but it turns out that the King James Version does mention unicorns in several places. The Hebrew word that the KJV renders as "unicorn" is translated as "wild ox" in the NIV; there's no way to know for sure exactly what was being referred to.

    The unicorn (or wild ox) is mentioned in Numbers 23:22 and 24:8, Job 39, Psalm 29:6, and Psalm 92:10.

    The book of Job also describes the "behemoth" (chapter 40) and the "leviathan" (chapter 41), the latter of which is also mentioned in Psalm 74:14 and 104:26 and Isaiah 27:1. I believe these to be dinosaurs of some sort, but it's impossible to say what they really were. Footnotes in the NIV suggest they could be a hippopotamus or elephant and crocodile respectively, but the (rather poetic) descriptions clearly don't fit anything like those animals.

    --
    $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
    $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
  107. Re:2 - The Great Flood (Where are all the Unicorns by kanweg · · Score: 4, Insightful

    Under attack?

    Pro-choice people don't force abortions on other people who are against abortions.
    Pro-alcohol people don't force muslims and mormons to drink the stuff.
    Pro-stem cell research people don't require you to have your DNA fixed.
    Would-be parents with a serious inheritable disease don't force other people to have their embryo/egg tested.
    Pro sex toy people don't want to force the use of the toys on other people who think sex is sin.
    Gay people don't want to force you to have sex with a same sex person.
    Nobody is trying to force christians to have premarital sex.
    Nobody is trying to force catholics to use birth control.
    Atheists are not trying to bully other peoples' children into saying out loud brainwashing slogans such as "one nation, god is imaginary" five times a week. (You are free to do your brainwashing at home.)
    Atheists are not trying to get their "ten reasons" plaques displayed in courtrooms.

    Now, who is under attack and what bad things were atheists doing? Calling theists who wreck other peoples lives something you don't want to hear? How does that compare to the above list?

    Xtians are skilled at turning the oppressing majority into the underdog. If theists only had confidence in their deity that it is indeed almighty, then people could be free. The theists would be confident that their deity would get back at the "sinners" later.

    Bert
    Freedom means free to do something without harming someone else. Now, in view of the above, try to explain "home of the free" to me.

  108. Re:2 - The Great Flood (Where are all the Unicorns by Random+BedHead+Ed · · Score: 2, Insightful

    You just quoted Wikipedia to make your point.

    GP did qualify his citation with the phrase "The wikipedia article gives a good definition of creationism," not "The wikipedia article backs me up, therefore I'm right." No implication was made that the source was otherwise reliable. (Heck, you could quote Conservapedia if it gave a good definition ... though it doesn't.)

  109. Re:Personally by timmarhy · · Score: 1

    and why do you think only monks and religious figures could read and write?? because anyone else was deemed a heretic and burned at the stake.

    --
    If you mod me down, I will become more powerful than you can imagine....
  110. Re:2 - The Great Flood (Where are all the Unicorns by Phroggy · · Score: 3, Insightful

    Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.

    If Christianity promotes a belief that is at odds with provable fact, then you're right, but the argument of young-earth Creationists is that macro-evolution and a billions-of-years-old universe is NOT provable fact. This is where you have a conflict, not in the logical conclusions that follow.

    I believe your view of the scientific method to be flawed. The existence of God clearly falls completely outside the realm of empirical science. This doesn't make God false, it makes God untestable. Science only deals with the natural, which doesn't mean that the supernatural cannot exist. The scientific method does not require that you begin with a disbelief in God; indeed, many well-known scientists including Kepler, Galileo, Pasteur and Newton put God at the center of their scientific work. These men endeavored to better know the Creator through the better understanding of His Creation. Would you call their work unscientific?

    Personally, I find religion deeply offensive, in the same way I find littering, racism, homeopathy, and liars offensive. If anybody is going to be doing any of that on my lawn, I'm going to yell at them.

    I find that most people who are offended by religion in general (as opposed to being offended by some specific aspect of a particular religion) completely misunderstand what religion is.

    --
    $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
    $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
  111. Re:Personally by aaron+alderman · · Score: 1

    The fact that some Christians can't reconcile their religion with a very well grounded theory that has withstood the rigors of science for over 100 years isn't my problem.

    It will be your problem eventually.

  112. Re:Evolution textbook!? by wiz_80 · · Score: 2, Interesting

    An interesting theory I read is that part of the decline was due to economics. In the Middle Ages, Europe ran on feudalism, which granted individuals permanent rule over an area, which they could also pass on to their descendants. In the Arab world instead terms of power were granted, such as for three or five years.

    This meant that European nobles had at least some incentive to invest in long-term projects in their territories, while in the Middle East the incentive was skewed towards short-term profit. Therefore, while the Middle East had a head start while Europe was busy clawing itself from barbarism, over time the situation reversed, and by the time of the Renaissance the Middle East was stagnating.

    --
    " There is a rational explanation for everything. There is also an irrational one. "
  113. Re:Reasons that are so so compelling... by aaron+alderman · · Score: 1

    It's called Projection

  114. Re:2 - The Great Flood (Where are all the Unicorns by im_thatoneguy · · Score: 3, Interesting

    As an ex-christian I'll help interpret for you. Since I understand both sides of the fence.

    1) Your belief system is comforting. The more conservative I was the more certain I was and the more certain I was the happier and more comforted I felt.
    2) Denying God is real means it's all in your head and you shouldn't actually be confident in what you 'know'.
    3) If you can't be confident in what you know then you can't be certain and if you can't be certain then you aren't comforted. Your amazingly incredibly blissfully wonderfully happy land grows dark and is replaced with the cold uncaring uncertainty of doubt.
    4) So when you attack a christian's faith what you're actually doing is robbing them of that beautiful all enveloping right-hemisphere of the brain oneness with God. Which is incredibly painful.

    It's like stealing a junkie's needle. It's going to be very traumatic. Much more traumatic than if you for instance told them that ketchup sucks and it's silly that they like it. Unless they get some sort of bizzare high from ketchup.

  115. Re:Why I knew I could never be a high school teach by aaron+alderman · · Score: 1

    Yeah but do you really think ALL teachers would do that?

  116. Re:2 - The Great Flood (Where are all the Unicorns by gregbot9000 · · Score: 2, Insightful

    I don't believe in any god. But its the opposite to the "not believing is a sin" the "believing is ignorant" that I was trying to get at as causing the uping of the ID stuff. I went to some atheist meetings and all they talked about was how ignorant christens were. which is different then what I thought they would talk about, maybe humanism and how you don't need divinity to have a moral society, you know MTOB, not worrying what the christens were doing.

  117. My latest discussion with a creationist... by Lodewijk · · Score: 1

    ...went something like this:

    [...]
    - So you support ID, therefore you assume the existence of God. How do you support that?
    - I see God in the perfect harmony of nature.
    - Then how do you maintain that the same God is responsible for miracles like healings, walking on water, splitting seas, etcetera?
    - There you have the the greatness of God! He can do what we, humans, with our restricted science cannot do or understand.
    - Okay, so God reveals himself though the laws of nature, AND by miracles, by definition a violation of those laws. If you can only prove the existence of something by a contradiction, you have proven the non-existence of it. Therefore, God doesn't exist.
    - [...]

  118. MOD PARENT INSIGHTFUL by marxmarv · · Score: 1

    Someone will raise the question of whether a job requiring a science degree then becomes a form of religious discrimination. Hilarity WILL ensue.

    --
    /. -- the Free Republic of technology.
    1. Re:MOD PARENT INSIGHTFUL by lenski · · Score: 1

      It's closer than you think. I thought I remembered a lawsuit relating to U.S. Berkely admission requirements that students have a demonstrable background in modern science. (No reference to that suit, maybe someone else can find it.)

      It seems that IDers were pissed off that Berkely wouldn't admit their students due to a lack of education in the principles of evolution.

      Here's a link to an article from the website Answers in Genesis discussing the issue. That particular article doesn't refer to a lawsuit, so my memory may be fuzzy on this.

      But your point is well taken, there are already people working that issue. And the real hilarity will ensue when our society fails to compete in the world marketplace due to a lack of depth in current scientific thought...

  119. Re:2 - The Great Flood (Where are all the Unicorns by fucket · · Score: 2, Funny

    Atheists have meetings? Great. I already have to go to meetings for all the drugs I don't do anymore, now I have to go to meetings for all the things I don't believe in anymore.

  120. Re:2 - The Great Flood (Where are all the Unicorns by KDR_11k · · Score: 1

    So Last Thursdayism it is, then?

    --
    Justice is the sheep getting arrested while an impartial judge declares the vote void.
  121. Re:2 - The Great Flood (Where are all the Unicorns by KDR_11k · · Score: 1

    Fish fossils on top of mountains, [..] really does kinda fit with the whole water theory.

    Or, you know, tectonic plate movement.

    --
    Justice is the sheep getting arrested while an impartial judge declares the vote void.
  122. Re:2 - The Great Flood (Where are all the Unicorns by Angostura · · Score: 2, Interesting

    Now, I've never understood anybody who said they believed in the bible but didn't take it literally.

    Now, I'm an atheist - but I think you need to look up the word 'metaphor'.

  123. Re:2 - The Great Flood (Where are all the Unicorns by Zumbs · · Score: 1

    Science only deals with the natural, which doesn't mean that the supernatural cannot exist.

    If the supernatural exists, it is a part of nature, and, thus, natural. This means that it can be measured and described. So, if the god(s) of some religion exists, it should be possible to test their existence. Many religions (inlcuding Christianity), however, has the rule that their god frowns upon any attempt at proving their existence. Pretty convinient, huh?

    I find that most people who are offended by religion in general (as opposed to being offended by some specific aspect of a particular religion) completely misunderstand what religion is.

    Most notably that religion is very, *very* much about feelings. Which is why many atheists end up being percieved like elephants moving around in a house of glass.

    --
    The truth may be out there, but lies are inside your head
  124. Re:2 - The Great Flood (Where are all the Unicorns by KDR_11k · · Score: 1

    We got two (actually more but let's limit it to these two) accounts of how the world came to be. One is a written text, accessible to anyone, conveniently explains all you'd want to know and was the predominant belief for centuries if not millenia with loads of people still holding onto it. The other is fossil, requires advanced scientific techniques to even notice, never mind interpret, has long and complicated trails needed to explain itself, still isn't known completely, is hard to grasp for the human understanding without a lot of education and hasn't even been found for the longest time. Now let's assume one of the two is a fake intended to trick people into going to hell. Additionally we have an omnipotent, omniscient, omnibenevolent deity and its antagonist (assuming the person seeking guidance is a Christian). A benevolent deity would not try to trick people into eternal torment (that is possibly the most evil act possible so an entity doing that would probably qualify more as omnimalevolent). However an antagonist would. Which is more inside the scope of the antagonist's abilities, writing a book or changing the physical structure of the entire fucking planet/universe?

    Then again the fundies seem to believe that God didn't give man reason so that man may use it but to trip man up...

    --
    Justice is the sheep getting arrested while an impartial judge declares the vote void.
  125. Mod Parent Up Please by yakiimo · · Score: 1

    [quote]Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.[/quote]

    Mod parent up please

  126. Re:2 - The Great Flood (Where are all the Unicorns by KDR_11k · · Score: 1

    The problem with claiming "macroevolution" isn't proven is that it's up to THEM to show what the hell "macroevolution" is supposed to be and why it cannot happen because the distinction does not exist per se. We know evolution can happen, unless they can show that "macroevolution" is somehow different it HAS been shown as possible. It's like asserting lightspeed differs at "macro distances" without showing that there is any difference between "micro" and "macro" distances and using that to claim that lightspeed is not absolute.

    --
    Justice is the sheep getting arrested while an impartial judge declares the vote void.
  127. Re:2 - The Great Flood (Where are all the Unicorns by KDR_11k · · Score: 1

    In its place they added the "rapture" to their doctrine. No idea why.

    --
    Justice is the sheep getting arrested while an impartial judge declares the vote void.
  128. Re:2 - The Great Flood (Where are all the Unicorns by KDR_11k · · Score: 1

    I prefer to think of it as a manic evil laugh.

    --
    Justice is the sheep getting arrested while an impartial judge declares the vote void.
  129. Re:2 - The Great Flood (Where are all the Unicorns by MPolo · · Score: 1

    The government is forcing Christian pharmacists to dispense drugs that are abortifacient, thus forcing them to be morally complicit in the termination of an unborn life. Christian doctors who wish to practice obstetrics are forced to learn how to perform abortions. Schools are teaching birth control in such a way as to all but force it upon teenagers -- at least in my school, we were taught that everyone should use birth control and that natural methods were not methods at all.

    For that matter, the Nazis (sorry for the Godwin's Law thing) didn't force non-military personnell to murder Jews, so I suppose that was alright. Remember that most Christians believe that abortion is the murder of an innocent human being, so of course they are going to fight it with all their strength. For that matter, a large number of so-called birth control methods are in fact abortifacient (read the package insert for most incarnations of "The Pill") so fall in the same category. Embryonic stem cell research also falls into this category. The cloned being, even if development is stopped at the blastula level, is still a human being (that is, it has 46 chromosomes, and if it were allowed to develop, could only result in a being that all persons, even atheists, would have to admit is a human being). Thus Christians consider it morally unacceptable, even for Atheists. If embryonic testing is used to promote abortion ("I'm sorry Ms. Smith, your child has Down Syndrome. When can we schedule the abortion?"), then this also comes here. In general though, I'd hold that such testing is neutral, morally speaking.

    I'm not against alchohol, so I will leave that one alone. I'm living in Germany, so I'll leave the Pledge of Allegiance alone. I don't really care about the Ten Commandments debate, and would tend to side with leaving them out of the courtroom because of commandments 1-3 (1-4 for Protestants reading this), which are problematic, because they only apply to a portion of society. Sex toys... I'd certainly not make this a huge issue. One can avoid them quite well.

    Premarital sex and gay sex... I don't think there is a lot of movement to actively ban this activity. (Against gay marriage, yes, there is a movement, but you didn't mention that one in your litany above.) There is a movement to actively promote this activity. So the activity seems to be more from the other direction...

  130. Re:2 - The Great Flood (Where are all the Unicorns by DeadDecoy · · Score: 1

    That brings up the other point, why do they feel their way of life is in danger? It could be politicians playing it up for votes, it could be changing social economics beyond anyones control, it could be pure paranoia, and it could be that people in the cities and scientific community actually attack them. I think its a combination of all those factors, but i also think one of the largest factors is the fact that Secular atheists do actively attack the religious beliefs of others.

    I'll probably state a few obvious things here, but please bear with me

    I believe that religion serves as a security blanket for one of the greatest fears of all: death. Most religions preach that life is not simply extinguished when the body fails but continues on in some form or another. Now, the concept of an afterlife is also coupled with a reward/punishment system that hinges on the faith that such-and-such dogma is true. Now, if something comes along and describes that does not fit into the faithful's existing framework it has the potential to alter their belief, which, as was just stated, is fundamental to their reward/continued existence. This is what prevents most believers from having a rational dialog, as even broaching the subject implies death (in the afterlife). In turn, this makes those who believe in different frameworks (other faiths, atheists, scientists, etc) frustrated, because there is no room for argument.

    Now, in terms of a solution, having armchair intellectuals decry people as stupid is about as far as we are going to get because everyone has or should have the right to believe what they will. As for setting up an academic curricula, I think the governing scholastic bodies should go back to the basics and reexamine the definition and purpose of academia. Is it meant to expand our viewpoints or teach us how things function. I think it's both and if creationism is taught from the perspective of the former and not the latter, I really don't have any qualms about it. The reason I don't have any qualms, and can hear many of you calling me stupid already, is that we should guard against intolerance and censorship of thought, lest we too fall into the state where others cannot have a two-way dialog with us.

  131. Re:Evolution textbook!? by gtall · · Score: 1

    The crusades where at the beginning of the second millenium. Islamic empires didn't start to atrophy until the 15th-16th centuries.

    Gerry

  132. Re:2 - The Great Flood (Where are all the Unicorns by malkavian · · Score: 1

    No, science is not at odds with religion, it is complementary.
    Science states that given a set of conditions, experimentation gives certain answers.
    What it does not do is say that given a set of conditions that we do not yet know about, certain things will occur.
    Science, at that point simply says "There is not enough information to draw a conclusion". Anything in that area is conjecture and belief.
    Humanity is still a scarily primitive race (barely off the planet, with so much barely understood, and so much yet to discover), that science cannot yet even begin to answer some questions.
    In the meantime, if science can't give the answer, why not let people gain comfort from a belief? Now, if they try and foist that belief on you as fact, but all means shred it apart if it doesn't fit your view, or beliefs about the things that are unknown.
    Me, I'm an agnostic. I know that I don't know, and can't either prove or disprove a deity, so I'll let the existence of it, or non-existence carry on happily as it has since the beginning of time. I'll just get on with having a life as happy as I can make it, and spread a little of the good cheer where I can. After all, if there is a god, isn't that what all the texts say to do anyway? If there isn't, at least I've had a good time while I've been breathing, and so have other people around me, if I can help it!

  133. Re:2 - The Great Flood (Where are all the Unicorns by Zontar+The+Mindless · · Score: 1
    --
    Il n'y a pas de Planet B.
  134. Re:2 - The Great Flood (Where are all the Unicorns by Cyberax · · Score: 1

    So? If you object to abortions - don't become a pharmacist!

    What next? Nurses objecting to intravenous injections because it conflicts with their faith?

  135. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    Ahem -- you're talking about the THEORY of plate tectonics, no?

    Don't forget now, that's just a theory. Just like the "water theory" that the GP mentions. Right?

    Heh heh heh....

  136. Re:2 - The Great Flood (Where are all the Unicorns by kanweg · · Score: 2, Insightful

    'The government is forcing Christian pharmacists to dispense drugs that are abortifacient, thus forcing them to be morally complicit in the termination of an unborn life. Christian doctors who wish to practice obstetrics are forced to learn how to perform abortions.'

    Perhaps your government is more to blame for providing insufficient information before these people started their studies. I'm very sorry to hear that they cannot find another job.

    'Schools are teaching birth control in such a way as to all but force it upon teenagers -- at least in my school, we were taught that everyone should use birth control and that natural methods were not methods at all.'

    Generally society bears the brunt if horny teenagers, some of whom may not have learned that it is OK to say no, get pregnant. I believe there is no law in Germany that forbids parents to tell their kids a thing or two.

    'For that matter, the Nazis (sorry for the Godwin's Law thing) didn't force non-military personnell to murder Jews, so I suppose that was alright.'

    As an example of a non-sequitur perhaps? I don't get it. My basic point is that religions (or more generally anyone) should leave other people (including those of other religions) free to do what they want, as long as they don't harm someone. Killing Jews should not be a pass-time.

    'Remember that most Christians believe that abortion is the murder of an innocent human being.'

    Don't worry. Yagolah must positively hate those pre-born human beings. Next time you visit the ladies room and see the trash can for sanitary towels, put some flowers next to it and pray. If it is there for a while and the ladies room is visited fairly frequently, there is a large likelihood that at some point in time it contained your beloved 46 chromosome entity. A very large portion of fertilized eggs never make it to the full 9 month development period. Abortions barely increase the number. Of the 3 women I have data for: One with 3 kids and 1 miscarriage (I know of). One with 3 kids and 3 miscarriages (just a hormone thing. When the doctor gave her suppositories against the violent morning sickness causing the rejection the kids kept coming. Apparently yagolah liked the doctor's action. Or allowed the doctor to compensate for the birth control pills he had prescribed in his carrier. And the last woman I know of has 2 kids and one miscarriage. Oh the humanity! And I couldn't count the times they just missed a period, because I'm not privy to that.

    'If embryonic testing is used to promote abortion ("I'm sorry Ms. Smith, your child has Down Syndrome. When can we schedule the abortion?"), then this also comes here.'

    The doctor would be an asshole and probably face the medical profession's court. The nice thing about abortion is that every child being born is a wanted child, warts and all. Parents' decision. No interference from third parties, whether they are doctors or theists.

    'Against gay marriage, yes, there is a movement, but you didn't mention that one in your litany above.'

    Thanks for bringing it up. Another one for my "litany" then. Nobody is forcing churches that gay people can marry in front of their god, in their religious building or according to their religious rules. There is a difference between a marriage before the law and for the church. There is no reason why gay people cannot have the first one. It is an arrangement that gives security (and some obligations) to the marital partners, e.g. in case of pensions, in case of the custody in case there is off-spring involved, and if one of the partners dies. There is no reason why these regulations cannot be open for gay people. But in most countries theists have still hijacked the whole concept of marriage, conveniently ignoring the difference between a marriage before the law and before the church, even though that goes in their country as well.

    Bert

  137. That's the point of Pastafarianism by JavaRob · · Score: 1

    Exactly, and that's why the Flying Spaghetti Monster religion exists; as a rational point of comparison.

    If someone presents an "argument" for Creationism and so on that is no stronger than your Pastafarian argument, well, that says something.

    If you can't be more convincing than the FSM folks, get the hell off my lawn.

    1. Re:That's the point of Pastafarianism by LSD-OBS · · Score: 1

      I see you, too, have been touched by His noodly appendage :)

      --
      Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  138. Re:2 - The Great Flood (Where are all the Unicorns by kanweg · · Score: 1

    I think that the man who sells fertiliser to the farmer who grows potatoes eaten by the gas station owner who sells gas to the janitor of the hospital the obstetrician works in should go straight to hell.

    Bert

  139. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    Now, I've never understood anybody who said they believed in the bible but didn't take it literally.

    Now, I'm an atheist - but I think you need to look up the word 'metaphor'.

    That's his point.
    If it's metaphor, that means you have to interpret it and draw your own lessons & value from what you read. Shakespeare can be equally valuable -- he was a perceptive observer of humanity and our weaknesses.

    Now apply the word "believe" to that.

    How does one "believe" in a metaphor? You'd have to start drawing lines between parts of the bible that are "fact" and those which are just metaphor.

    And then you have to acknowledge that these lines are human-drawn, and hence open to debate. And maybe none of it is fact, since we know much of it isn't... it gets messy, belief-wise.

    If you just say "well, maybe it's all metaphor, but we believe there are truths to be found in the stories"... well, that's a view an atheist can share (yes, some of the fables in the bible highlight actual human problems...). If it's all metaphor, you don't even have to believe that God exists. It all falls apart.

  140. Re:2 - The Great Flood (Where are all the Unicorns by BarneyL · · Score: 1

    Technically "Fuck y'all" would be 2.33333333 words....

  141. Think again! by JavaRob · · Score: 2, Funny

    Not forcing -- oh really?

    You probably haven't seen this news article -- but we all knew it was coming!

    The proponents of the progressive agenda are finally showing their hand... Be afraid! Be very afraid!

  142. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    Now, if they try and foist that belief on you as fact, but all means shred it apart if it doesn't fit your view, or beliefs about the things that are unknown.

    You mean, if they start printing textbooks and trying to get them into public schools?

    Related: I disagree about the "complementary" thing -- faith in the absolute *truth* of belief is at the core of most religions, not "we don't know, but maybe it's something like this".

    If you believe it's *true*, then it freaks you out when your kids are exposed to "wrong" alternative viewpoints (like science class, like classmates with other religions or none), and you also don't subject public debates (like re gay marriage, birth control, abortion, religion in schools, etc.) to reason if you think your religion has the "true", inarguable answer already.

    That's the conflict.

    Agnosticism doesn't conflict with science (though many people ignore scientific matters of probability and even logical consistency), but most practicing religious people would not classify themselves that way -- they have some believe in the absolute *truth* of what they profess.

    BTW, I should also mention that unfortunately many religions (particularly the stricter versions) say you won't be rewarded for simply being nice. If you have no faith (if you haven't accepted Jesus as your personal savior, for one example), you aren't going to heaven.

    Not that I'm arguing with your approach to life -- just saying that this version of Pascal's wager doesn't really "work" any more than the original does.

  143. Re:2 - The Great Flood (Where are all the Unicorns by Wonko+the+Sane · · Score: 1

    I've counted to 10 before; sometimes I've even counted to 100.

    But there's no way you can convince me that anyone could count to 1000000. That's an enormous difference.

    To assume that you could count to 1000000 the same way that you count to 100 is nothing more than an assertion of faith.

    I'll accept your "microcounting" argument, but "macrocounting" is a tool of the devil.

  144. Why is there a textbook on either one? by cervo · · Score: 1

    In my grade school/junior high science and high school biology evolution was a tiny few pages in a much more general textbook. It certainly did not get more than a week or so of lectures. Basically compared to the entire science class evolution is a tiny footnote (in high school/grade school you don't get much done in a week).

    So the question is why is there a textbook on evolution or creationism? It does not merit an entire science class. Evolution is just a single theory. It's not like you sit in class for a year learning just evolution. It's a few days at the most, maybe even one or two. A textbook for this is overkill. Maybe a creationist or evolution 2 or 3 page worksheet would be appropriate but a whole book is way out of hand.

    My worry is that creationists will dedicate half a year to studying their creationist textbook and then ooops what about all that other stuff that actually matters that you learn if we assume biology then how the body/cells are structured, how heredity works with the various genes, etc....

    And furthermore I don't see what the big deal is. We also learn that people thought the entire universe revolved around the earth. The theory is wrong but we learn it for historical reasons. If evolution is proven wrong, I would expect that we still learn it, why it is wrong, and why the new theory better explains life's origins. Maybe another hour or so of discussion on evolution. It's no big deal. Until creationism is proven it belongs in a religion class. And if it ever is scientifically proven then it has a place in science. Good luck with that though.

  145. Re:2 - The Great Flood (Where are all the Unicorns by Wonko+the+Sane · · Score: 1

    Your amazingly incredibly blissfully wonderfully happy land grows dark and is replaced with the cold uncaring uncertainty of doubt.

    I think that an accurate term for this process is "growing up".

    At least for me the age which I now identify that I transitioned to adulthood is the same age that I transitioned away from belief.

  146. unicorns and time travel by witherstaff · · Score: 1

    People mention unicorns all the time. This is news for nerds so why don't people mention time travel when discussing the Bible?

    Revelations is one of the books of the bible. A frightening large percentage of Americans believe it will occur within their lifetime. However by definition it is in the future. Hence it is either

    A) Time Travel, coming back from the future to tell everyone what occurred.

    B) There is no free will. We are machines pre-programmed to do as we do, the end result is already known.


    I'm all for the time travel aspect when talking about the Bible with anyone. Believers want to think they have free will - it's actually a tenant of the Catholic church. Therefor it must be time travel and that leads to much amusement on my part during the discussion.

  147. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    I think you pretty much entirely missed how logic works. Fact disproves a lot of Christianity. It is therefore false, as a belief. Ok, glad we got that out of the way.

    As for agnosticism, that's not good enough in my books. For instance, scientists can't prove that there aren't bright pink microscopic 16-legged elephants hiding on a planet 28,000 light years away. So, does that mean you have to say, "welll yeah I guess it could be possible but I can't disprove it".

    Sane people would say, "that's preposterous, I'd have to see it to believe it". You don't need to prove something does NOT exist, you need to prove it DOES.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  148. Re:2 - The Great Flood (Where are all the Unicorns by Thumper_SVX · · Score: 1

    I can't believe I'm going to bite on this... but that would be a water hypothesis... not a theory. It's not provable or disprovable (or even testable) and therefore is not a theory.

    Plate tectonics is a theory... we test it often. For example, we're using sensors to "watch" California trying to escape to Alaska.

  149. Re:2 - The Great Flood (Where are all the Unicorns by Beezlebub33 · · Score: 1

    Ask them how the flood just happened to order all the fossil pollens in the right order, and didn't mix them all together.

    Oh, they didn't think about that, did they?

    --
    The more people I meet, the better I like my dog.
  150. Re:2 - The Great Flood (Where are all the Unicorns by Beezlebub33 · · Score: 1

    This is commonly called 'Last Tuesdayism'. Don't be fooled by the to-be-burned-in-hell-forever followers of Last Thursdayism, as their religion is an abomination.

    --
    The more people I meet, the better I like my dog.
  151. Re:2 - The Great Flood (Where are all the Unicorns by blockhouse · · Score: 1

    So? If you object to abortions - don't become a pharmacist!

    Sorry, that's not an acceptable solution. Abortifacient drugs have only been available from the pharmacy in the last few years. Most people who are now pharmacists became pharmacists with no inkling that they would ever have to dispense such things. Many people who are now in pharmacy school (myself included) have no idea what future drugs may come onto the market that conflict with their moral views. Should nobody practice pharmacy, just because at some point in the future, some drug might be developed that we all object to?

    A larger problem is that in forcing pharmacists to dispense abortifacients, the government is interfering with the freedom of individuals. I accept that people are free to seek abortions (though I would disagree with that). But I insist on being accorded the same freedom -- the freedom to choose to contract with such people to deliver services, or the freedom to decline to contract with such people. Tolerance must be a two-way street, otherwise it's not tolerance. It's tyranny.

    Oh, and your strawman fails too. There is no recognized belief system that objects to giving intravenous injections on moral grounds. Let's stick to the realm of what actually exists.

  152. Re:2 - The Great Flood (Where are all the Unicorns by Cyberax · · Score: 1

    Abortifacient drugs have only been available from the pharmacy in the last few years - WRONG!

    Birth control pills are available for about 40 years now.

    "Oh, and your strawman fails too. There is no recognized belief system that objects to giving intravenous injections on moral grounds. Let's stick to the realm of what actually exists."

    Oh, you're wrong. Some brands of Orthodox Christianity (now almost extinct) in Russia forbid injections.

    And there's also Jehovah Witnesses. Do you want to die because ER-medic refuses to perform blood transfusion?

  153. Re:2 - The Great Flood (Where are all the Unicorns by kanweg · · Score: 1

    I still don't get the Jews connection with embryos.

    I'm not promoting abortion. I'm promoting a choice and want every child born to be wanted by his parents. And I'm not promoting to be it an easy procedure to enter. Like euthanasia, there must be strict rules for a proper course of action (and they are there, in my country). It is just that the presumption that there is a god, or gods is not shared by everyone and could be wrong. No one has a red phone to contact him/her/them to find out how to deal with the issue. It takes quite a bit of guts to say that you're better at determining his/her/their will.

    If everybody thinks abortion is a bad idea, there will be no abortions. If some people are willing to risk the wrath of supreme beings, it should be their choice, not yours.

    But I'm wondering, is one of the women I mentioned now guilty of 3 murders because she didn't get the suppositories right away? Or is her doctor guilty of murder by neglect for not recognising the problem quickly enough? And x years ago, those pills weren't available, so no body could be blamed, but now we suddenly have more opportunities to go to hell. Great!

    I hope you'll enjoy heaven and can strike up a good conversation there will all the foetuses and embryos, irrespective of how they got there. It must be a fun place.

    In my country, there were 32.992 abortions in 2006, (I included the ones within 16 days after the period that should have occurred and 4.114 of women coming from abroad to have it done here. I admit the number is higher than I expected). For non-immigrants in my country, there are 7.8 terminated pregnancies per 100 pregnancies.

    Finding data on miscarriages was a bit harder (lots of noise by stories on the events). For the age groups 25-34, 35-39 and 40-44 the percentages were 12% 25% 48% per pregnancy. So, older women are more likely to kill their baby than younger ones. They could have elected to get pregnant at an earlier age (plenty of slashdotters available). And the number of abortions is less than the naturally terminated pregnancies.

    My parents were catholics and my mother used the pill for a while. They were great people and I just happen to believe that counts more than the way in which they prevented their family from becoming bigger than they wanted.

    Bert
    Supreme beings like people who wear their seat belts better than those that don't. And they like rich people better than poor people (who live shorter). Oh, if the pharmacists gives the money he earns with the sale to a charity, he may save the life of a kid in Africa with it. Well, I guess that most people aren't that concerned about saving lives given the state over there. They prefer to control other people to feel well themselves.

  154. Re:2 - The Great Flood (Where are all the Unicorns by Fred_A · · Score: 1

    I want someone to hit the nail on the head with creationisms, but no one seems to ever do that online so I'll give it my best shot.

    Yeah, well I want someone to hit creationists on the head with nails and it doesn't seem to happen much either :(

    --

    May contain traces of nut.
    Made from the freshest electrons.
  155. The Irony of ID by turkeyfish · · Score: 1

    Its ironic but to believe in intelligent design requires the believer to believe in facts that are not true. To do believe in "facts" that are not true is to bear false witness.

    Consequently, those who support ID and creationism in the science classroom are actually bound for eternal damnation because they violate the commandment "Thou shall not bear false witness".

    Its ironic that darwinians are in a position to "pray for the souls" of those who believe in ID.

  156. Re:2 - The Great Flood (Where are all the Unicorns by blockhouse · · Score: 1

    Abortifacient drugs have only been available from the pharmacy in the last few years - WRONG! Birth control pills are available for about 40 years now.

    Nobody really knows how birth control pills work in humans. Based on animal models, we can say to the best of our knowledge that old-school birth control pills prevent ovulation, not implantation. New-school birth control pills prevent the changes in the cervical mucus that allow sperm to enter the uterus.

    Oh, you're wrong. Some brands of Orthodox Christianity (now almost extinct) in Russia forbid injections.

    I'll keep that in mind next time I need an intravenous injection in the backwoods of Russia, where my only source of medical care comes from a brand of almost-extinct Orthodox.

    Do you want to die because ER-medic refuses to perform blood transfusion?

    I take comfort in the fact that there are lots of medics in the ER. If one doesn't want to do a blood transfusion, I'm sure there will be others who do.

    Plus, I thought JW's believed that their rules applied only to them, and not unbelievers.

    And I think you forgot to address my argument about how being forced to dispense abortifacients infringes on my right to contract.

  157. Science the Great Destroyer by turkeyfish · · Score: 1

    The problem that science poses to the religionists is that it destroys their business model.

    Science presents the very real prospect that people can learn to think about the world and the universe themselves using logic and reason and come to the conclusion that the religions of the world really have nothing to offer in terms of understanding.

    It is thus not surprising that the creationists, ID forces and other 21st century versions of witchdoctors and their ilk are keen to keep students uneducated about the power and potential of science.

  158. Re:2 - The Great Flood (Where are all the Unicorns by Cyberax · · Score: 1

    "Nobody really knows how birth control pills work in humans."

    Bullshit. We know _exactly_ how birth control pills work. Search pubmed.org if you don't believe me.

    "I take comfort in the fact that there are lots of medics in the ER. If one doesn't want to do a blood transfusion, I'm sure there will be others who do."

    How about emergency transfusion during airlift, for example?

    Or how about antivax doctor denying your child a vaccination?

    Or fire-fighters refusing to do their job on Sabbath?

    Or this: http://www.telegraph.co.uk/news/uknews/1577426/Female-Muslim-medics-'disobey-hygiene-rules'.html ?

    "Plus, I thought JW's believed that their rules applied only to them, and not unbelievers."

    Birth control pills also do not affect pharmacist, so I fail to see a difference.

    Probably JW are just not powerful enough (yet) to force their believes on others.

    "And I think you forgot to address my argument about how being forced to dispense abortifacients infringes on my right to contract."

    Simple - you have a JOB to do, and other people depend on you. If you can't do your job then don't do it. It's that simple.

  159. Re:2 - The Great Flood (Where are all the Unicorns by zkiwi34 · · Score: 1

    Actually, all too many atheists want people to hear and believe their "god is imaginary" mantra, and many are prepared to go to extremes to get to that point. So, no, atheists are as guilty of pushing their agenda as anyone else is, and it's lame to assert otherwise.

  160. Re:Personally by zkiwi34 · · Score: 1

    I guess you don't know all that much about the dark ages then. You could equally apply what passes for your "stereotype" of the dark ages to the present.

  161. Re:Personally by Alsee · · Score: 1

    I subscribe to the Creation theory.

    And there are people who subscribe to Geocentric Theory.

    However, I don't think either theory should be taught in science classes.

    And they don't think the sun-centered solar system should be taught in science class either.

    Science should be taught not unprovable theories. No one can prove Evolution nor can anyone prove Creation.

    Sure.... lets not teach students ANY science at all.
    Lets not teach the theory of gravity. Lets not teach atomic theory. Lets not teach electromagnetic theory. Lets not teach the theory of optics. Lets not teach any science at all.

    Lets not even teach the heliocentric theory of the solar system.

    All evidence indicates that heliocentrism is the best most accurate explanation for the solar system.
    All evidence indicates that evolution is the best most accurate explanation for the diversity of life on earth.

    All attempts to refute heliocentric theory have failed based on the evidence. All attempts to refute evolutionary theory have failed based on the evidence.

    Heliocentrism makes predictions, and those predictions have been endlessly tested and confirmed.
    Evolution makes predictions, and those predictions have been endlessly tested and confirmed.

    It is impossible to "prove" that the sun goes around the sun, just as it is impossible to "prove" evolution or anything else in science. However no one has ever come up with any remotely sane alternative that is even remotely compatible with the evidence. Every alternative ever suggested by anyone has been refuted by the evidence.

    If they're to be taught in school, put it under Literature like where I learned the Mayan's version of the creation of life.

    The solar system and electromagnetic theory and atomic theory and everything else should be taught in literature class?

    The only problem here is that you have the idea that evolution is wrong, that some people have told you that the evidence establishing evolution does not exist, that you have the idea that evolution is not as powerfully established by the evidence as every other field of science, that you have the idea that evolution is not actually a field of science just like every other field of science. Those things are all wrong.

    If you want to study science, great! There are entire libraries filled with evidence "proving" evolution is true. If you have any interest in learning science, in learning what evolution actually says and how it works and learning what sort of evidence there really is to back it up, great! I'd be more than happy to help, if you have an honest interest in the science and evidence.

    If you don't know any of the science, and you have no interest in learning the science, then I suggest you listen to actual mainstream professional scientists who are experts on the subject. And actual mainstream professional scientists who are experts on evolution unanimously say that evolution is fundamentally right and that it is overwhelmingly established based on all known evidence from every conceivable direction.

    And I suggest you stop listening to non-scientific activist groups running public relations campaigns pushing misinformation that there's no evidence smoking causes cancer, or pushing misinformation that there's no evidence supporting evolution. The anti-evolution activists are nothing more than public relations campaigns spewing factually false information.

    It is easy to convince someone that evolution is right - - - IF they are at all reasonable and rational and willing to honestly consider the evidence. If you want to take me up on that claim, please first indicate if you are a Young Earth Creationist. It is much faster and easier to address the age of the earth, much faster and easier to establish if you are willing to honestly consider the evidence in reasonable rational manner.

    -

    --
    - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  162. Re:My pet peeve about people who believe creationi by Gigahurt · · Score: 1

    Exactly! I wish there was some sort of test before you could buy products that were developed using scientific research. Such as: What are the definitions of a theory and a hypothesis? People could still buy products that are natural or were accidentally discovered.

  163. Re:2 - The Great Flood (Where are all the Unicorns by KevinIsOwn · · Score: 1

    An excellent post. Hear hear.

  164. Re:2 - The Great Flood (Where are all the Unicorns by KevinIsOwn · · Score: 1

    Unless you can cite a person besides Dawkins, who is the only one I can think of who really does much in the way of pushing atheism, most atheists truly don't give a crap what people believe. They aren't out there trying to "save" people from god, there's no organizational structure trying to push atheist missionaries to convert people. Atheists don't care what you believe, most of us just want you to stop trying to "save" us or tell us what to believe.

  165. Re:Personally by Liquidrage · · Score: 1

    If Protestantism evolved from Catholicism, why are there still Catholics?

    Evolution doesn't require that new species completely replace old ones. It's pretty well everywhere in evolution. And if that was a problem for evolution we'd only be able to have one species on the entire planet of everything.

    Pockets of isolation allow mutations to become dominant without completely removing prior genetic material. Think of Australia having many species that only exist there. That's because the evolution there didn't effect animals back in Africa. And isolation doesn't need to be that distinct.

  166. Re:They've got it all wrong by grikdog · · Score: 1

    Actually, solipsist creationism has a long and widely respected pedigree. However, most of my projected minions, where I delegate most of my brains, have pointed out that if "I" am "God", then "I" am a frivolously dangerous schizophrenic paranoid (although We do appreciate your attempts to keep Us amused.) This is like buying a cup of coffee with a 20 billion dollar bill, the one with George W. Bush's picture on it. You can play Evolution without first erecting a Taj-like ontological framework, other than assuming that the world is real. A much quieter enterprise, filled with deeper and subtler revelations.

    --
    ``Tension, apprehension & dissension have begun!'' - Duffy Wyg&, in Alfred Bester's _The Demolished Man_
  167. Re:2 - The Great Flood (Where are all the Unicorns by AK+Marc · · Score: 1

    Should nobody practice pharmacy, just because at some point in the future, some drug might be developed that we all object to?

    Or better yet, do their job. Guns kill people, but gun store owners aren't pro-murder. They chose to sell guns, and they sell them for whatever they are used for. Pharmacists dispense drugs. It should either be legal for me to fill my own prescription, or a pharmicist should be required by law to fill it. To have pharmacists lobying to prevent me from filling my own prescription, then going on to refuse to fill whatever they don't like is a conflict that should be ended. The grocer that doesn't like broccoli still sells it even though he wouldn't use it.

    There is no recognized belief system that objects to giving intravenous injections on moral grounds.

    There are. That you are ignorant of them doesn't make them not exist. The body is a temple and all that. Some Christians are against most medical treatment. Some tribal belief systems object to breaking the skin. Don't push your ignorance off as truth. We get enough of that already from "your type."

  168. Re:2 - The Great Flood (Where are all the Unicorns by kurzweilfreak · · Score: 1

    Let's stick to the realm of what actually exists.

    We would ask the same of you before demanding special rights of your supernatural belief system. Try working on that first, then we'll talk.

    --

    kurzweil_freak

    5th Kyu Genbukan Ninpo/KJJR student

    Be the darkness that allows the light to shine.

  169. Re:2 - The Great Flood (Where are all the Unicorns by kurzweilfreak · · Score: 1
    How many explicitly Atheist Channels are there on tv? Now let's compare that to the number of channels where you can flip to and watch a religious service happening 24/7? There's about 5 in the basic cable package here.

    Sure, I have the right to flip the channel and ignore it. And you have the right to not listen to the atheist saying that your imaginary friend is imaginary. You're just complaining because we have the right to complain, and you just can't stand hearing it.

    --

    kurzweil_freak

    5th Kyu Genbukan Ninpo/KJJR student

    Be the darkness that allows the light to shine.

  170. Re:2 - The Great Flood (Where are all the Unicorns by sydneyfong · · Score: 1

    Sure. But nobody's forcing the believers not to believe in what they believe.

    Christians go around telling people their God exists, and atheists go around saying that no God exists. Fair game.

    Laws are meant to restrict people in doing things that harm others, and "psychological harm due to religious differences" isn't really harm... I mean, the "right to religious-high" isn't a God Given Right (pun intended).

    --
    Don't quote me on this.
  171. Re:2 - The Great Flood (Where are all the Unicorns by sydneyfong · · Score: 1

    Yeah but that's ridiculous. You're obviously lying.

    --
    Don't quote me on this.
  172. Re:2 - The Great Flood (Where are all the Unicorns by TheSpoom · · Score: 1

    The government is forcing Christian pharmacists to dispense drugs that are abortifacient, thus forcing them to be morally complicit in the termination of an unborn life.

    And so the government is (rightly) telling them not to mix religion and public service. You're not giving such medications to those who do not want them.

    Christian doctors who wish to practice obstetrics are forced to learn how to perform abortions.

    Prove it. And even if they are forced to learn how, they never have to actually perform an abortion in their entire career if they don't want to.

    Schools are teaching birth control in such a way as to all but force it upon teenagers -- at least in my school, we were taught that everyone should use birth control and that natural methods were not methods at all.

    In nearly all cases, teenagers can be excused from sex ed programs by their parents. And even if they aren't, they have this thing called 'free will' that allows them to choose not to use birth control methods of which they don't approve. In addition, science has repeatedly shown that so-called 'natural family planning' is not nearly as effective as newer methods of birth control. Perhaps it should be shown in addition to other methods, but showing students actual numbers for how effective methods are is not doing them a disservice.

    Remember that most Christians believe that abortion is the murder of an innocent human being...

    Bullshit. Since when do you speak for "most Christians"?

    For that matter, a large number of so-called birth control methods are in fact abortifacient (read the package insert for most incarnations of "The Pill") so fall in the same category.

    And so, one does not have to take it if one has the belief that it would be wrong to do so.

    The cloned being, even if development is stopped at the blastula level, is still a human being (that is, it has 46 chromosomes, and if it were allowed to develop, could only result in a being that all persons, even atheists, would have to admit is a human being). Thus Christians consider it morally unacceptable, even for Atheists. If embryonic testing is used to promote abortion ("I'm sorry Ms. Smith, your child has Down Syndrome. When can we schedule the abortion?"), then this also comes here.

    Laws exist to prevent people from harming other people and their property. If you can prove that a being is hurt or destroyed in the process of stem cell research and testing, then there is a good reason to have a law against it. Oh wait... That's a personal belief that you're trying to force on others.

    Premarital sex and gay sex... I don't think there is a lot of movement to actively ban this activity. ...There is a movement to actively promote this activity.

    Are you stating that the government actively promotes premarital sex? Like, they're advertising that it's a fun thing to do or something? I've certainly not seen such literature...

    --
    It's better to vote for what you want and not get it than to vote for what you don't want and get it.
    - E. Debs
  173. Re:2 - The Great Flood (Where are all the Unicorns by johanatan · · Score: 1

    Yea, and who exactly defined Creationism the way you quote. I would think that the best definition of Creationism would come from Creationists, not the secular humanists holding positions of power on Wikipedia. If you haven't noticed yet, Wiki does not represent non-mainstream ideas very well--tyranny of the masses, you know?

  174. Re:Personally by Fred_A · · Score: 1

    Presumably you didn't quite understand the purpose of schools.

    --

    May contain traces of nut.
    Made from the freshest electrons.
  175. Re:Liberals and Conservatives both deny science by Anti+Globalism · · Score: 1

    As Ron Paul said it, Left and Right are artificial constructions to distract people from substantial political issues. Democracy is a charade and people supporting it are voting for their own death.

  176. Re:My pet peeve about people who believe creationi by hierofalcon · · Score: 1

    The Bible states that God created the Earth "In the beginning". Nowhere does it state that this was 4,000 years ago (or even 4,000 B.C.). It is perfectly reasonable, and some fundamentalists would say required, to accept the fossil record and to accept the age of the earth as dated by scientists as approximately correct. Our interpretations of the fossil record may not match yours 100%, but we accept it as evidence of all the critters that have existed in the past. For us, there is no place to put Satan's rule of the planet as noted in some non Genesis portions of the Bible except before Adam. There are more than the Amish who are disgusted with parts of the ID theory. It doesn't fit with a complete reading of the Bible.

  177. Re:2 - The Great Flood (Where are all the Unicorns by johanatan · · Score: 1
    Well, speaking as an YEC who routinely speaks out against evolution (and reads much on the subject), I can tell you why 'they' oppose evolution so strongly. [And, it's not just because it's a convenient place to fight].

    There's a very vocal group of extremist and evangelical atheists (Hitchens, Dawkins, & Dennett et al) that have convinced the world that evolution proves materialism and thus atheism. This is total and clever reversal of the inference (and for those of you who like to talk about circular reasoning so much, there's a few loops you can go through there). The only way one can possibly arrive at pure coincidence as an explanation of the origin of life on this planet, is if you *start* from materialism. This debate is not about science at all. It is about philosophy masquerading as science. Evolution is not the problem (even if it were true). The problem is the phony implications pushed by extremist atheists. Evolution does nothing to support their philosophy and they should stop claiming that it does. I recommend one of two things (and preferably both) to bring a truce to this situation:
    • Educating the masses on philosophy and the philosophy of science in particular.
    • Restraining your vocal evangelical atheists from pushing their philosophy of materialism in the 'science' classroom and the popular media.

    Either of those two things will bring a quite quick-like end to all of the opposition you guys are facing from Creationists and ID theorists (of course, there is a third option, but it is so outlandish that I almost didn't mention it--don't rule out 'design' a priori as a cause for high order--I know, it is hard to imagine order arising via intention).

  178. Re:2 - The Great Flood (Where are all the Unicorns by mdwh2 · · Score: 1

    No business is forced to become a pharmacists. No one is forced to work at a pharmacy. Or become a doctor. If you were in intensive care, you'd be fine if the doctor refused to give you a blood transfusion because he was a Jehovah's Witnesses?

    As for your Nazi analogy, I'm not sure I would have much symapthy for someone who willingly took up a job as concentration camp guard, for example, anyway. So even if we agreed it was murder, it's not a problem, as no one is forced to take the job of a doctor or pharmacist.

    Schools are teaching birth control in such a way as to all but force it upon teenagers

    Wow, really, teenagers are forced to have sex? I wish I went to your school.

    at least in my school, we were taught that everyone should use birth control and that natural methods were not methods at all.

    You'd rather that teenagers had sex without contraception?

    There is a movement to actively promote this activity.

    In what sense? People are encouraged to take up gay sex? Of course not. All that is wanted is to keep people outside of people's private sex lives.

  179. Re:2 - The Great Flood (Where are all the Unicorns by mdwh2 · · Score: 1

    Whether a particular drug happens to exist or not is besides the point - the point is that if you are the sort of person who could only dispense a drug if you personally morally approved of it, then it ought to be bleeding obvious that getting into that profession is a rather risky business, whether or not you are okay with the drugs that are currently being dispensed. Even more so, given that it is well known that new drugs are always appearing.

    Many people who are now in pharmacy school (myself included) have no idea what future drugs may come onto the market that conflict with their moral views.

    If that's a problem with you, then you were foolish to start in the profession in the first place.

    Should nobody practice pharmacy, just because at some point in the future, some drug might be developed that we all object to?

    Of course not, and no one is claiming such a thing. Instead, leave it to the people who are willing to sell legally available drugs without worrying about whether it's a drug they personally morally approve of or not.

    I write software for a living. If someone uses my software for evil, that's up to them - if I was the sort of person who had a problem with people using the software I write in a particular way, it would have been foolish to take up my particular job, and there'd be no use crying about it afterwards.

    Moreover, if I don't like it, then I am free to leave. I don't get to both get paid, and not do the job - that's ridiculous.

    A larger problem is that in forcing pharmacists to dispense abortifacients, the government is interfering with the freedom of individuals.

    Like it or not, the pharmacy industry is regulated. AIUI, if you want to be licenced as a pharmacy, then expect to follow the Government's rules. If a business doesn't want to be a pharmacy, then no one is forcing them.

  180. Re:2 - The Great Flood (Where are all the Unicorns by mdwh2 · · Score: 1

    I take comfort in the fact that there are lots of medics in the ER. If one doesn't want to do a blood transfusion, I'm sure there will be others who do.

    Well, if a pharmacy is able to get another member of staff to dispense, that's fine with me, and up to them. The problem is they don't always do it. Moreover, in some hospitals at some times, there may only be one doctor available in the ER.

    Plus, I thought JW's believed that their rules applied only to them, and not unbelievers.

    Yes, good point - JW's believe their rules are only for them, and don't try to force their morality onto others. That way, we don't get into stupid situations like a doctor refusing to give blood transfusions - because that's exactly the sort of mess we'd get to if JW's behaved like the anti-birth-control-pill pharmacists.

    What a novel idea - perhaps there's a lesson to be learnt there?

  181. Re:Personally by kurzweilfreak · · Score: 1
    The explanation is that the question is a non-starter: man didn't come from monkeys. Man and monkeys have a common ancestor. We also have a common ancestor with cats, fish, and everything else around, depending on how far back in the tree of life you want to look. In fact, everyone's favorite "militant atheist" (what the fuck is that supposed to mean anyway??) wrote a book on exactly that. It's a very entertaining and informative read, like all of Dawkins' works.

    At least the question would be a little closer to the truth if it had been apes instead of monkeys, although of course it would still be incorrect.

    --

    kurzweil_freak

    5th Kyu Genbukan Ninpo/KJJR student

    Be the darkness that allows the light to shine.

  182. Re:Personally by kurzweilfreak · · Score: 1

    Besides the fact that none of your points you bring up ever make sense logically, it certainly doesn't help your case that you can't even put together a coherent sentence.
    Or that you're just an ignorant, argumentative fuckwad. If you want to play pretend with everyone about your god, go to fucking church. No one is stopping you. Just stay the fuck away from our public, tax-payer funded schools. Why are you so unable to do that?

    --

    kurzweil_freak

    5th Kyu Genbukan Ninpo/KJJR student

    Be the darkness that allows the light to shine.

  183. Re:2 - The Great Flood (Where are all the Unicorns by KDR_11k · · Score: 1

    Well, you can probably name a number large enough that noone could count to it since doing so would exceed the human lifespan (and you can extend that to computers and the lifespan of the universe) but then again it's math and practicality is somebody else's problem there.

    --
    Justice is the sheep getting arrested while an impartial judge declares the vote void.
  184. Re:America is evolving backwards by philspear · · Score: 1

    Evolution does imply a direction though. "Survival of the fittest" has a specific meaning. Fit does not mean more intelligent, quicker, happier, or better. It is just the ability to successfully procreate. By that definition fruit files are fitter than humans.

    I may be overstepping my knowledge here, but I think that's not completely true. I think random drift, and/or change that doesn't affect fitness is still evolution, though I could be wrong.

    If you had a population of birds that over several generations turned from black to brown, it could be that the black ones are less fit, like maybe a predator can see and eat the black ones easier, in which case it would be evolution in a direction, to get more fit and have better reproductive success.

    It's entirely possible though that it has nothing to do with fitness and could just be luck of the draw. Black birds and brown birds could be equally fit, but the brown was just a dominant trait. I think that's still evolution, and is not in a fitter direction.

    I think Gould would call that a structural constraint on evolution. Whether that is still evolution I don't know.

    Either way, the AC was talking about evolution in terms of america getting dumber and less moral, or something like that. The equivalent there would be an animal getting dumber or slower, not loss of fitness. He seemed to be of the mindset that if an animal gets dumber, that's de-evolution, and that in this case, america is getting worse and is "evolving backwards," which we both agree is a misunderstanding of evolution.

  185. Fighting Fire With Fire = FAIL by burnitdown · · Score: 1

    I know this from having been to several meetings. The atheist community is one of the most bitter and spiteful I have ever seen and actively wish to see all "non-rational" belief systems torn down and replaced with their "belief" system on a level that matches any religion. Pure tribalism at its best, two sets of group-think throwing stones at each other. the Atheists attack christen beliefs and they attack the atheists through ID.

    The solution to the problem is not the one shown on /. of armchair intellectuals decrying the ignorance of the bible belt hicks, while smugly reassuring each other that they have the "best" ideology. It is through an understanding of their actions and why they do them and coming to terms with them. Calling their text book stupid isn't going to get them to stop. I don't know what the solution is, but I know what it isn't.

    I couldn't agree more. Also: if "freedom" is our goal as a society, they have the right to have their belief, and to belief that a symbolic religion is more important than science. That's "freedom."

    This guy had a good take:

    The people who concretely affirm that there is in fact no higher being whatsoever are among the people that I do not agree with nor trust. I see such declarations as the epitome of self importance. Hard atheism is a belief structure and it is just as prideful and dangerous as the unflinching beliefs of religious extremists. ...But, like hard-line religious fanatics, the hard atheistsâ(TM) character flaw is an uncompromising belief in self. The individual fanatic and hard athiest both share the belief that they are right and disagreeing others are terribly misguided and wrong...

    "Why Hard Atheists Shouldn't be Taken Seriously" by Edgar Alverson

    It seems to me that the neutral position is agnosticism.

    Atheism, or asserting definitively that a God/gods do not exist, is making a similarly conjectural and unprovable/non-disprovable assertion to theism.

  186. Re:2 - The Great Flood (Where are all the Unicorns by burnitdown · · Score: 1

    Now, I've never understood anybody who said they believed in the bible but didn't take it literally.

    Umm...

    Aren't all religions symbolic? Why would you make a literal religion? Not abstract enough.

    It's a type of communication, like a high-level language versus the language of details. Symbols mean things. Ever read C.G. Jung on this topic? The first chapter of "Man and His Symbols" should do nicely. Or Joseph Campbell.

    I wouldn't take a work of literature literally, nor would I take a poem literally, nor would I take a politician literally except when they indicate they are speaking as such. It doesn't make sense to try to find a literal religion, unless you're a Scientologist.

  187. Re:2 - The Great Flood (Where are all the Unicorns by burnitdown · · Score: 1

    Pro-choice people don't force abortions on other people who are against abortions.
    Pro-alcohol people don't force muslims and mormons to drink the stuff.
    Pro-stem cell research people don't require you to have your DNA fixed.
    Would-be parents with a serious inheritable disease don't force other people to have their embryo/egg tested.
    Pro sex toy people don't want to force the use of the toys on other people who think sex is sin.
    Gay people don't want to force you to have sex with a same sex person.
    Nobody is trying to force christians to have premarital sex.
    Nobody is trying to force catholics to use birth control.
    Atheists are not trying to bully other peoples' children into saying out loud brainwashing slogans such as "one nation, god is imaginary" five times a week. (You are free to do your brainwashing at home.)

    You are ignoring the fact that actions have consequences. While the Christian side tries to negate actions, allowing those actions to continue can have consequences too.

    I'm not the one trying to stop other people from dumping toxic waste in their backyards, therefore I'm not the aggressor.

    I am not attempting to defend Christians or attack them, but I detest bad argument.

  188. Re:2 - The Great Flood (Where are all the Unicorns by malkavian · · Score: 1

    Legs don't really work at the microscopic level. Which puts it in the "highly unlikely" level. Specific pigmentation.. Unlikely again, due to the size..
    And as for proof, you only need to prove it does exist if you hypothesize that it does. You only need to disprove it if you hypothesize that it doesn't.
    If you think that the question of it existing is entirely irrelevant (which is, as things stand at the moment for humanity), the only sane thing to do is entirely avoid trying to answer the question at all.
    If it helps you sleep at night, you're quite at liberty to believe that it does. And I defy anyone to prove (with current technology) that it specifically does NOT exist. That's the point of science. You get a clear cut answer without bias.

    As for agnosticism not being good enough in your books, then, I'm afraid that makes you a zealot in your beliefs. If you choose to believe that there is no god, then fine. That's your choice. But really, I want to see some hard evidence (not just saying 'the bible has inaccuracies, therefore there is no god', as that really is not a logical conclusion, for the same reason it can't be used for the proof of existence of a god). Go for it. Mathematical proof and/or full experimental workings.
    I know that the best I can do will neither prove, nor disprove the matter. The best of the scientists we have on the planet can neither prove nor disprove. To me, that makes the matter unsolvable by science, therefore it remains an article of belief, which is not subject to science or logic, therefore, it's not something I want to spend forever getting hung up over, or have fights about.

    Personally, I find agnosticism to be the most satisfying path. If the atheists are correct, then they never get to tell me "I told you so". If the religious are correct, then one small group of people get to thumb their noses at the rest of the world and go "nyah nyah" for eternity, as they were the only ones that got the right god. Which would be distinctly embarrassing for most. Especially if it was a fringe cult that had only a handful of members that got it right. As an agnostic, I just get to say "Phew, that's a relief. Oblivion for sentience is a kinda harsh thing to truly take on board without needing something to shore up a damaged psyche".

  189. ID vs Darwin by voxner · · Score: 1

    I participated in a seminar about ID in my college. The PBS site has a set of movies which offer an interesting insight into the debate.
    PBS Nova

  190. Re:Personally by ScrewMaster · · Score: 1

    and why do you think only monks and religious figures could read and write?? because anyone else was deemed a heretic and burned at the stake.

    He's also forgetting that all the major religions of the day ruthlessly suppressed any scientific or technological advance which didn't fit into existing religious dogma (most of it, in other words.) Unless, that is, they could personally profit by that knowledge. That really was my point, which Smoker2 completely misunderstood. They may very well have been the geeks of their time (although no true geek would have behaved that way), but they were also, by and large, selfish pricks who deliberately held humanity back for a very long time.

    Fact is, with the head start the Greeks and the Romans gave us, we should have gone a lot farther in a lot less time than we did. There are many reasons for why we didn't, true, but the Church (pick one) did it's part to keep us in the Dark.

    --
    The higher the technology, the sharper that two-edged sword.
  191. Re:2 - The Great Flood (Where are all the Unicorns by th3rmite · · Score: 1

    Now, I've never understood anybody who said they believed in the bible but didn't take it literally. What. The. Fuck.

    OK, how about: "I believe in The Complete Works Of Shakespeare, but I don't take it as a literal historical document." Say what now? What does "believe in" *mean* then?!

    If I were to tell you that it was raining cats and dogs outside, would you not believe me that it was raining? Just because you don't believe that there is actually dogs and cats falling from the sky doesn't mean you can't believe what I said was true.

  192. Re:America is evolving backwards by LowlyWorm · · Score: 1

    I would agree that random mutations are part of the evolutionary process. Some confer no advantage or are detrimental but in the classical sense (the Darwin not the Wallace model) progress in terms of evolution must mean the ability to pass on genes. I do agree that in a general semantic sense you are probably right, if by evolution you mean any change in an organism over time. As for Americans getting dumber, well that seems to fit.

    --
    Time flies like an arrow. Fruit flies like a banana.
  193. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    the argument of young-earth Creationists is that macro-evolution and a billions-of-years-old universe is NOT provable fact

    Erm, yeah... http://slashdot.org/comments.pl?sid=977815&cid=25174421

    The existence of God clearly falls completely outside the realm of empirical science

    And therefore falls outside the realm of the observable universe which is tied to things like cause and effect. And therefore is not in the universe. And therefore does not exist. No flaw in the understanding of science here, mate.

    If god exists, it is only as an outside observer, and undetectable. If he is not just an observer but is actively "involved", his actions will be scientifically measurable in SOME regard, most likely by some heinous breach of the laws of thermodynamics.

    So, either he doesn't exist, or he does but exerts absolutely no control over anything in the universe, including doing things like talking to humans and writing on clay tablets -- and by definition therefore, all religion and understanding of him does not come from him.

    Perhaps you need to think that one through a bit more and see how illogical your statement is.

    Would you call their work unscientific?

    In that paragraph you managed to commit several crimes against logic. I emplore you to actually think about the words you've written.

    Why would you assume that anybody would be so stupid and bigoted as to disagree with everything an individual says, on the basis of a certain unrelated characteristic or opinion? Newton could have dedicated his life work to an anally prolapsed ferret for all I care -- his work stands for itself.

    I find that most people who are offended by religion in general (as opposed to being offended by some specific aspect of a particular religion) completely misunderstand what religion is

    How amazingly confused you are by reality. Seriously now, run that by me again? Seriously?

    I know exactly what religion is. I come from a deeply religious background. The foundation of religion is clinging to superstitious and unreasonable beliefs and fairytales. Religious people can turn that into any number of good and bad things.

    Religion is offensive because it promotes false belief and false motives. There are many things which people should just get over and tolerate, but I do not consider the active choice to hold false beliefs, as one of those things.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  194. Re:2 - The Great Flood (Where are all the Unicorns by Phroggy · · Score: 1

    If the supernatural exists, it is a part of nature, and, thus, natural.

    The supernatural is, by definition, not a part of nature. The God that created the laws of physics cannot be measured by them.

    Many religions (inlcuding Christianity), however, has the rule that their god frowns upon any attempt at proving their existence. Pretty convinient, huh?

    The problem is not that God doesn't want to be proven to exist, but that He hasn't sent any physical proof into our world in the last 2,000 years, and that was long enough ago that nobody believes the people who actually did have proof at the time. One passage that comes to mind is the second chapter of the book of Acts, where Peter addresses a crowd and says essentially "you know this is true, because you have seen it." At the time, the miracles performed by Jesus Christ weren't myth or superstition, they were actual events that many people witnessed themselves. However, because there was not a culture of documenting such things in writing, most of them didn't write it down. No measurements were taken, no scientific study was done, because at the time that just wasn't thought of as being important. A lot of what we do have is letters that were written with the expectation that the recipients would have full understanding of the context in which they were written, which isn't true today.

    God will reveal Himself again one day, in a way that can be directly observed and measured. Until that day, there can be no proof.

    --
    $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
    $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
  195. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...Any time you have evidence that the Earth is older...

    To ascertain age, that is to measure time, you have to have a clock. You also have to assume (believe guess) that this clock has ALWAYS ticked at the rate we observe it ticking today. That assumption may or may NOT be correct. It still is and will forever remain an assumption and NOT a measured observed FACT of science.

    It just happens that the majority of assumers (believers) labeling themselves scientists BELIEVE that it has ALWAYS ticked at the same rate we observe today. That may be correct, but it still only belief.

    If the time yardstick is made of metal or wood, constancy is a reasonable assumption. Since we don't really understand time, how do we know the time yardstick isn't like a rubber band that once was highly stretched and has relaxed a lot by now? IF that is the case, and it could be true, then all time guesses into the past based on the present could be WAY wrong.

    --
    All theory is gray
  196. Re:2 - The Great Flood (Where are all the Unicorns by Phroggy · · Score: 1

    Pro-choice people don't force abortions on other people who are against abortions.

    Sure they do, if you take the view that a fetus is a person.

    --
    $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
    $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
  197. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    Your logic is utterly and completely flawed. From reading your other posts, it's quite evident that you lack the ability to understand sound logic for what it is. Everything you read and write goes through several different mental filters which ruin the meaning. You adhere to many vastly incorrect assumptions. I'm sorry, but I just can't help you there.

    But really, I want to see some hard evidence

    You do NOT *prove* the nonexistence of something. That's not how logic and reason work. It's the other way around. You prove the existence of something, and you prove that an interpretation of something is correct.

    The corollary is if a certain phenomenon is observed but not enough facts are known, a hypothesis is formed and tested, and supporting evidence is sought.

    There is no such "phenomenon" in the universe that can lead any logical or sane person to hypothesize about the existence of a god. Nothing in the universe points to this. Everything has cause and effect. The effects whose causes are not yet understood still do not point directly to anything resembling a higher being, and therefore it is entirely erroneous for such thinking to enter the process.

    The only truly BIG question we have, and will always have, is how the universe came about in the first place. We aren't guaranteed to ever work this one out because the concept of information itself is not valid past the big bang. This *still* does not point directly to the existence of any being. It is merely an unanswered question, and only the lazy mind will lean back to a vague and untestable concept in order to satisfy their curiousity.

    I'm afraid that makes you a zealot in your beliefs

    There's nothing wrong with being zealous. I'm a zealot in my belief against homophobia. I'm a zealot in my belief for integrity and truth. I'm a zealot in my belief for many, many things, and my belief against stupidity and lack of reason and proof is just one of those things.

    Now, as for your last paragraph, in order to merely state those points of view, betrays a phenomenal amount of ridiculous assumptions and ignorance.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  198. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    Yeah, you probably missed the point of everything I said about "believing in" it. I read Arthur C. Clarke books. I learned a lot from them, but I can never say I "believe in" them. If I were to take any of his stories as fact, I would be a fucking idiot -- because they're fictional and they never happened.

    Do you see the correlation?

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  199. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    Right, so if you don't take it literally, you can't believe in it. By definition. Make sense now?

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  200. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    In your example, there are certain aspects which simply MUST be taken literally. Such as the existence of god and that he's talking to someone. Simply put, it would be preposterous to believe that assumption. Therefore, you can't believe in it.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  201. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 2, Insightful

    I believe your comment was a longwinded way of saying "it's all metaphor".

    So, if the bible is all metaphor, what does god stand for?

    Let me push this a bit further.

    If you told me, "I just counted about 68 dogs and at least 93 cats raining out of the sky over the course of sixty seconds", I would know you're not just using a figure of speech, and I would probably be able to disprove it. The same is true for the bible, which states many, many, many things as factual. And even if you ignored ALL of that, simply accepting certain concepts presented in the bible, metaphor or not, would place you quite squarely in the realm of falseness.

    It is simply illogical to state that you believe in the bible, because it is utterly impossible. You can say you enjoy the bible, or you learn from the bible, or any of those things, but stating belief in it is as ridiculous as stating belief in any other provably incorrect account of a set of events, or any other work of fiction.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  202. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...I've met many creationists who, for example, thought that fossils were ...

    Have you ever met an evolutionist who has actually MADE a fossil, rather than speculate about how they were made? If it cannot be duplicated in the lab or observed in nature TODAY, is is NOT science, but belief (assumptions). Adding lots of time does NOT solve the problem.

    The word "assume" is the scientific code word for believe (faith). Can any evolutionist cite a "scientific" paper and its references, of major importance, of say more than five or six pages, that does NOT contain "assume", "believe" or similar expressions?

    Science, like every human endeavor, has two components. Facts and belief. All of our lives are governed much more by what we believe than what we actually KNOW for sure. Scientific textbooks ought to carefully separate the facts of science from the beliefs of scientists. Facts should be stated as such, as should beliefs and interpretations of facts be labeled.

    --
    All theory is gray
  203. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    That's nice. What's your point?

    Anyone who knows anything about it won't tell you that the ages of things are established FACTs. The only facts in science are the observations. The conclusions drawn from them are not facts and are not considered as such.

    The current assumption is that these clocks have remained consistent. This is because there has yet to be any evidence to the contrary, and because it's hard to get any useful results at all if they haven't. But this isn't treated as some kind of invariable fact the way fundamentalists treat the creation of the Earth in 4004BC. If something comes along to show that these clocks have changed through time then that will simply change the way things are done.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  204. Re:2 - The Great Flood (Where are all the Unicorns by zkiwi34 · · Score: 1

    They (atheists) I would aregue do care very much what other people believe. Just look at slashdot and the vitriol being poured by *drum roll* atheists. As far as your "lack of organization" theory, that's baloney.

  205. Re:2 - The Great Flood (Where are all the Unicorns by zkiwi34 · · Score: 1

    No, I'm merely pointing out that in the modern world it is systematically ok to bash religion. People keep babbling the assertion that religion has no place except in its own "safe little box" yet are quite happy for science, and philosophy (and other realms) to go outside "safe little boxes" (as in only a loony would believe anything but what we think science/philosopy/etc tells us). It's a pathetic double standard, that I find very objectionable.

  206. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    Science is not a collection of facts. Science is a technique to gain knowledge about the world.

    Yes, "assume" is just another way to say "believe". Ask any good scientist about this and he'll admit that certainly the flow of time in the past could have been different. But in the absence of evidence for such a thing, the question cannot go beyond simple speculation.

    Evolution is not a fact. It's "just a theory", an idea which fits the available facts extremely well and makes a great many accurate and useful predictions. That's all it is, and all it ever claimed to be.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  207. Re:2 - The Great Flood (Where are all the Unicorns by kurzweilfreak · · Score: 1

    No, I'm merely pointing out that in the modern world it is systematically ok to bash believing in the tooth fairy. People keep babbling the assertion that believing in the tooth fairy has no place except in its own "safe childhood age" yet are quite happy for science, and philosophy (and other realms) to go outside "safe childhood ages" (as in only a loony would believe anything but what we think science/philosopy/etc tells us). It's a pathetic double standard, that I find very objectionable.

    As long as it's your religion, right?
    Some people, when they see bullshit, don't have a problem with calling it out. Others get offended when their sacred bullshit is called on. It's systematically ok to bash religion these days because for the most part you don't get killed for doing so anymore. For the most part.

    --

    kurzweil_freak

    5th Kyu Genbukan Ninpo/KJJR student

    Be the darkness that allows the light to shine.

  208. Re:2 - The Great Flood (Where are all the Unicorns by Phroggy · · Score: 1

    And therefore falls outside the realm of the observable universe which is tied to things like cause and effect. And therefore is not in the universe. And therefore does not exist. No flaw in the understanding of science here, mate.

    You're limiting your definition of "exists" to exclude anything that is outside of our physical universe. When you define your terms this way, of course nothing supernatural "exists".

    If god exists, it is only as an outside observer, and undetectable. If he is not just an observer but is actively "involved", his actions will be scientifically measurable in SOME regard, most likely by some heinous breach of the laws of thermodynamics.

    So, either he doesn't exist, or he does but exerts absolutely no control over anything in the universe, including doing things like talking to humans and writing on clay tablets -- and by definition therefore, all religion and understanding of him does not come from him.

    Alright, that's fair. I would argue that the influences of the Holy Spirit are subtle enough that they cannot be measured (at least not practically - I don't mean that they couldn't be measured theoretically, merely that we don't really have a way to do it right now), but beyond that, God has not chosen to reveal Himself to us physically in the last 2,000 years. That's not a permanent situation; God will reveal Himself to us again - but not even Jesus Christ knew when that would be. Unfortunately in the mean time, we have nothing to measure.

    The other issue is that God usually uses natural phenomena to achieve supernatural goals. God exists outside of time, which means if God wants to cause something to happen tomorrow, He can set events in motion thousands of years ago that will culminate at that exact point - no heinous breach of thermodynamics required. For this kind of event, the only thing that makes it supernatural is the prophecies foretelling it and the significance ascribed to it; the event itself is a natural event.

    --
    $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
    $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
  209. Re:America is evolving backwards by philspear · · Score: 1

    As for Americans getting dumber, well that seems to fit.

    Well... at least we've evolved past burning women at the stake for being witches.

  210. Re:2 - The Great Flood (Where are all the Unicorns by mfnickster · · Score: 1

    Evolution is not a fact. It's "just a theory", an idea which fits the available facts extremely well and makes a great many accurate and useful predictions. That's all it is, and all it ever claimed to be.

    I'd just like to point out that the existence of a theory of evolution does not, in principle, exclude evolution from also being fact. After all, it is a theory about a process that is proposed to exist in nature, and if it does, it will continue to be true to its nature whether the theory is correct or not.

    Ultimately, science and religion must converge to whatever the ultimate "truth" is. Some may say that reality is subjective (as New Agers seem to be fond of believing), but as long as there is a real world to know anything about, it must be the ultimate arbiter of knowledge. Theories and beliefs that don't jibe with reality will eventually get thrown out, either methodically (as with science) or through attrition (as with religion). Religions evolve too; they arise, change, split, and go extinct all the time.

    --
    "Slow down, Cowboy! It has been 3 years, 7 months and 26 days since you last successfully posted a comment."
  211. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    Good point about evolution being a fact. It may or may not be one, but the evolution that scientists talk about is not a fact of evolution, but a theory.

    As for religion and science converging, it seems like crap to me. Science is the realm of what is, religion is the realm of what's beyond. They are essentially unrelated and ought to stay that way.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  212. Re:2 - The Great Flood (Where are all the Unicorns by zkiwi34 · · Score: 1

    No, because it's pretty much been going on for far too long to be considered a backlash.

  213. Re:2 - The Great Flood (Where are all the Unicorns by zkiwi34 · · Score: 1

    Interesting but rather lame attempt at quotation. Oh, and as far as bs is concerned, science and philosophy is full of it, so don't try and claim they are somehow "higher" or "less fallible" than other human constructs. Just see what Chandrasekhar had to go through as one example of how science "works" in practice.

  214. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    You can't prove evolution. It's the nature of scientific theories that they can never be proven, only potentially disproven. Young-Earth Creationism is not science because it's not falsifiable. That is, in a hypothetical world where it's wrong, there is no conceivable test which can show it to be wrong, because any result can be explained by "God did it". Whereas in a hypothetical world where evolution is wrong, there are plenty of tests which could disprove it.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  215. Re:Personally by zkiwi34 · · Score: 1

    So, that explains the success and also literacy of fun pagan cultures like the Norse and their offshoots. It was all the monks fault. And of course the Chinese, Indians and Mongols were all kept in ignorance by Christian monks. Please tell me you have not had a formal education in history. For if you have, I'd have to ask you to go back to your teachers and ask to have your class grades changed to fails.

  216. Where is the review? by Bartemis · · Score: 1

    I tried to find a link here which would dice the EE book into little pieces but, I could not find one. The only review linked appears to trash the teaching methodology, not the content. Where can I find a review of the scientific content, or lack thereof?

  217. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...This is because there has yet to be any evidence to the contrary....

    Well there is evidence that the electromagnetic properties of the medium of space itself have indeed changed over time. This would demand that certain numbers, assumed to be "constants" have changed as well. One of these is Planck's constant which is measured to be smaller today than when it was first measured. Light-speed is related inversely to that. That means light moved much faster through the medium of space, when the Universe was very young, small, dense and hot. Just as sound travels faster in rock or water than in air, so too light traveled faster through a denser Universe.

    There is evidence from past light-speed measurements using a gravity time-base, which have shown a decrease since such measurements were first done in the early 1600s. When an atomic time-base clock is used, this is not seen, since the product hc appears to be truly constant, with h and c moving in opposite directions. If a ruler elongates at the same rate as a distance to be measured by it, the distance will always be measured to be the same, even though it really is changing. Gravity equations have neither h nor c in them. Therefore, any clock based on gravity will not be affected by the changes in h or c and measure them directly, without any correction factors needed.

    Since Planck's "constant" appears in equations describing the behavior of atoms, radioactive clocks must also be affected. So there IS evidence that call into question the belief that these "clocks" are truly constant over time.

    It is interesting that it possible to determine the approximate, highly non-linear function of the slow-down of the speed of light over time. If that correction is applied, the time scales given by the Bible and those given by the atomic clock measurements of radioactivity are not nearly so far apart, so they cannot be attributed to simple errors in measurements and biblical interpretation. The billions and millions shrink down into the range of only thousands.

    --
    All theory is gray
  218. Where is an actual review? by Bartemis · · Score: 1

    From the 'review': 'What follows is not a comprehensive examination of the information contained in the text (which would require more text than EE itself), but rather a summary of the history and politics that make the book significant, and my own perspective as a biologist on how that context produced a text that's wildly inappropriate for use in a science classroom.' Why do you say 'a review shows it to be chock full of bad science and questionable reasoning', in light of the above admission that the reviewer isn't even actually reviewing the book?

  219. Re:2 - The Great Flood (Where are all the Unicorns by kurzweilfreak · · Score: 1

    Says the person typing on the computer that was conjured up by prayer. Oh, what? You aren't? Science you say?
    Science works, bitches.

    --

    kurzweil_freak

    5th Kyu Genbukan Ninpo/KJJR student

    Be the darkness that allows the light to shine.

  220. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...But in the absence of evidence for such a thing...

    I will include a portion of a reply I made earlier on this subject.

    There is evidence that the electromagnetic properties of the medium of space itself have indeed changed dramatically over time. This would demand that certain numbers, ASSUMED to be "constants" have changed as well. One of these is Planck's constant which is measured to be smaller today than when it was first measured. Light-speed is related inversely to that. Light moved much faster through the medium of space, when the Universe was very young, small, dense and hot. Just as sound travels faster in rock or water than in air, so too light traveled faster through a denser Universe.

    Since Planck's "constant" appears in equations describing the behavior of atoms, radioactive clocks must also be affected. So there IS evidence that call into question the belief that these "clocks" are truly constant over time.

    --
    All theory is gray
  221. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...Ultimately, science and religion must converge to whatever the ultimate "truth" is...

    Scientific FACT and interpretation of these facts are two entirely different things. What is actually written in the Bible and how it is interpreted are also often quite different.

    Nobody has ever demonstrated a scientific fact to be in conflict to any actual written statement in the Bible. The interpretations of both often do conflict greatly however. Therefore, scientific and biblical TRUTH are NEVER in conflict, only the opinions of men about the meaning of both. Scientists do and of necessity have to make certain assumptions (beliefs). If these assumptions are wrong, then the conclusions will also be wrong. Using computers only obfuscates and/or amplifies the errors.

    --
    All theory is gray
  222. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...but the evolution that scientists talk about is not a fact of evolution, but a theory...

    Exactly right! Why then do most text books present it as fact? Why is then so objectionable to present ID as just another theory as well? After all, both are only theories trying to explain the actual facts we observe and measure.

    --
    All theory is gray
  223. Re:America is evolving backwards by LowlyWorm · · Score: 1

    Social evolution is another can of worms.

    --
    Time flies like an arrow. Fruit flies like a banana.
  224. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...Plate tectonics is a theory... we test it often....

    Yes, indeed, scientists observe California move a few inches and then extrapolate that movement and come up with utter crap stating that in x number of millions of years California will be next to Alaska. They assume (believe) this rate will be or has been constant for all that time. They do this backwards in time also. It can be observed that the continents sort of fit together like a huge jigsaw puzzle. What cannot be derived from this however is the time scale over which this continental drifting took place. This assumed, not measured or observed. Assuming that rate of present processes can be applied over vast time scales may be correct, but it is nevertheless an unprovable assumption. Most processes observed in nature today are neither linear nor constant.

    It is quite conceivable, that when the earth was younger and hotter, the underlying layers where more fluid. This would mean that the continents moved much more easily and faster than we observe them to be doing today.

    --
    All theory is gray
  225. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ..i suppose you think coal can be made in 4000 years as well?...

    Why do you think it can NOT be made in that time or less? After all we can make charCOAL in hours today. We can make oil out of vegetable and animal organic matter in hours or days also. What evidence do you have that it MUST take millions of years to do these things?

    --
    All theory is gray
  226. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ....By all human measurements, the rocks will appear to be hundreds of thousands of years old...

    Shortly after you were born, someone tattooed a ruler onto your little body. It is the only ruler anyone has. Therefore you are still only as tall as you were then, as measured by that ruler.

    Scientist measure time by the atomic clock. They assume (believe) that this is an independent standard of time measurement. The problem is that they don't know that this standard of time changed right along with the growing universe. The nature of space itself demands, as evidence shows, that the ruler of time, not time itself, must change as the universe expands, just as the ruler tattooed on a baby would.

    --
    All theory is gray
  227. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...I believe that light travels (roughly) 186000 miles per second...

    Can you prove it ALWAYS did travel at that speed for all time? No? Well then, maybe it travelled much faster through a smaller, denser Universe than we measure today? Maybe sort of the way sound goes much faster through a denser medium, such as water than through air? Could that be possible? Is there any evidence of this?

    --
    All theory is gray
  228. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...they risk being proved wrong by scientific evidence...

    Be careful not to confuse hard facts with the interpretation of these. There are NO hard facts that prove age one way or another. Both are based on certain assumptions (beliefs). Only scientific and biblical interpretations are in conflict. The facts are not.

    --
    All theory is gray
  229. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ..."Creationism", for those who think magic is involved...

    Evolutionists believe in magic also. By their magic, a frog, or even a rock can turn into a handsome prince.

    Here is how their magic works:

    When children are small, we often tell them about Santa Claus, fairies, hobbits, trolls, witches, ghosts, goblins and a multitude of other mythical creatures. Some of these have magical powers that can help them accomplish impossible tasks. Magic can spin straw into gold and a kiss can turn a frog into a prince. However, children grow up, and learn that all of these tales are not really true, but imaginative fiction. There is one tale however, that continues to be told repeatedly and with ever increasing imagination and detail all the way through the highest degree a university can bestow. It is a tale that public educators try to make even adults believe that it really happened "once upon a time", not in a galaxy far, far away, but right here on our own planet.

    In many of these stories we have magical tools, actions or words, such as wands, kisses, rings, incantations, swords and almost anything else that can help the hero or villain accomplish otherwise impossible tasks. In this modern tale, there are only two magical things. One of these is chance. The other one, by far the most important and powerful magic, is time.
    Let's exmine, how these magical twins can turn, not only a frog, but even a rock, into a handsome prince. Children's stories often begin with "Once upon a time...." This tale is similar. You can find the intoning magic words: "Billions of years ago...." in big thick books with lots of fanciful, beautifully done illustrations. It is amazing how often the word "assume" is found in these authoritative appearing tomes. "Assume" is a more educated way of saying "believe", but when you assume something, you don't know it, but are guessing.

    Somewhere near the beginning of such books you can read: Billions of years ago, ceaseless torrents of rain washed minerals from the rocky (minerals come from rocks) land and other compounds formed by the aid of innumerable lightening bolts into the pre-biotic soup (Campbell's?) of the warm seas. There these compounds, bumping into each other, by chance over time, made larger molecules called amino acids. These are the basic building blocks of all life, sort of like the bricks of a house.

    After more time, (magic) these amino acids and other components organized themselves into single celled organisms, such as simple (actually very complex) bacteria. Some of them called algae, in time evolved to use sunlight to get energy. Green algae are part of the plant kingdom. In the course of millions of years, algae turned into roses, sunflowers and 300 foot tall redwood trees as well as all other plants we have today.

    Some of these bacteria and other single celled organisms floating around in the lukewarm oceans, again by chance, came together as beneficial co-ops of multi celled groups. By unknown means or the magic of chance, over time, some of these became animals such as worms, snails and millions of years later, (a lot more time) some of them became fish.

    Some of these dwellers of the sea, after several million years, got bored with the ocean and were able to also live on land. When the tide went out, some of them were left stuck on the beach. Somehow, maybe by trial and error (chance) some did not dry out, but figured out (smart, because they had brains already) how to breathe air for a while. Creatures that can live both in the water and on land are called amphibians. This is where the frogs come in.

    After more time, some of these left the water and evolved to live entirely on land. They found they could also make a good living there, eating plants and each other. After a lot more time some even figured out how to fly. The Wright Brothers copied them and made the first airplane. They had first been insects or reptiles, some of which could fly, but then after more time, evolved into birds, which are much better fliers, partly

    --
    All theory is gray
  230. Re:2 - The Great Flood (Where are all the Unicorns by TrekkieGod · · Score: 1

    As an ex-christian I'll help interpret for you. Since I understand both sides of the fence.

    I'm an ex-catholic turned agnostic, and I'm a bit curious about your explanation. From what you said, from personal experience, being certain that you were right brought you a lot of happiness. Any uncertainty brought you pain. That leads me to two questions:

    What exactly brought you comfort from your beliefs? I turned agnostic because I never really had the warm fuzzy feeling from the whole god thing. Was it just a fear of mortality, and the certainty that you wouldn't "die" and instead would lead an eternal life of bliss? I guess that's why I never got the happy feeling, I really don't find anything to fear from fading into nothingness. It's nothingness, how can you fear something you'll never experience?

    Since you did get the "beautiful all enveloping right-hemisphere of the brain oneness with God" religious experience thing that I've never had, what exactly made you stop being a christian?

    --

    Warning: Opinions known to be heavily biased.

  231. Re:2 - The Great Flood (Where are all the Unicorns by Darby · · Score: 1

    Can you prove it ALWAYS did travel at that speed for all time? No? Well then, maybe it travelled much faster through a smaller, denser Universe than we measure today?

    Is there any rational reason to suspect that it did? Is there any evidence for such a thing?

    Of course not.

    You keep insisting on idiotic things because you are desperate to believe a very stupid old fairy tale.

    That makes you both sad and pathetic. It does not mean that you've raised any valid points. You haven't.

  232. I had no idea! by rts008 · · Score: 1

    So that would be the Slashdot Bukake website?

    Have to go scrub my brains out with bleach now.

    --
    Down With Slashdot BETA!!! I've been around the corner and seen the oliphant; you can only abuse me from your perspecti
  233. Re:2 - The Great Flood (Where are all the Unicorns by MPolo · · Score: 1
    I already lost karma on this thread ("Overrated"), and it doesn't really seem like we're communicating with each other, but to answer your implicit question:

    I still don't get the Jews connection with embryos.

    Just for a second, look at this from the other side. There we hold that embryos and fetuses are human beings. You say I shouldn't be concerned if other people are killing human beings as long as I'm not killing them myself. Imagine that we were talking about four-year-olds. Would you remain silent while one sector of your society slaughtered all four-year-olds who didn't meet a certain standard?

    The real non-sequitur here is the whole miscarriage argument. No one (except apparently you) thinks that a miscarriage is the same morally as an abortion. There is no free decision to kill a living being in a miscarriage. It's like the difference between your four-year-old son dying of cancer despite your best efforts to heal him and you pulling out a pistol and shooting your four-year-old. They are not anywhere near related.

    As for embryos in Heaven, we really have no idea what will happen there. Some medieval philosophers held that the soul was created at some point after conception, so that, while maintaining that abortion was always evil, the question of the destiny of these souls is moot. However, I don't really see that position as tenable today, given the state of our knowledge of embyology, and would see conception as the only real moment where the creation of the soul could occur.

    Oh, if the pharmacists gives the money he earns with the sale to a charity, he may save the life of a kid in Africa with it.

    And I suppose if the guards at the concentration camps gave their salaries to a charity to save the life of a child in Africa, that would make it O.K., too... The Nuremburg courts wouldn't have agreed with you there.

  234. Re:2 - The Great Flood (Where are all the Unicorns by burnitdown · · Score: 1

    Right, so if you don't take it literally, you can't believe in it. By definition.

    I don't think you understand.

    Metaphors can describe reality as well as literal texts, and unlike literal texts, they describe it in abstraction and can remain accurate over the centuries as varying scientific ideas come and go.

    (See how much the ancients knew about science that we didn't know they knew -- The Ancient Mechanics and How They Thought at the New York Times)

    This is why you can believe in them more than you can believe in literal texts; a literal text is detail work you need proven, a metaphorical text is a theory in abstraction.

  235. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    Holy crap; I was joking, but some other commenter replied to you saying the same shit, but absolutely seriously.

    Apparently plate tectonics is *also* disputed by the creationists, and subject to the same muddy "theory" attacks? I guess it must be, though I hadn't thought of it... after all, it's yet another pile of evidence that points to an earth much older than a few thousand years.

  236. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    Yes, indeed, scientists observe California move a few inches and then extrapolate that movement and come up with utter crap stating that in x number of millions of years California will be next to Alaska. They assume (believe) this rate will be or has been constant for all that time. They do this backwards in time also.

    Once rock is forced up to the surface, it doesn't weather the same as rock still in liquid (or solid) form under the surface.

    I'm no geologist, and I came up with that just off the top of my head. Why would they assume constant movement? They can't, so they have to correlate those observations with other sources of data to come up with any kind of extrapolation.

    We have far more ways of gathering data on the plate movements than just taking California's movement over a few years and extrapolating to millions of years.

    It can be observed that the continents sort of fit together like a huge jigsaw puzzle. What cannot be derived from this however is the time scale over which this continental drifting took place. This assumed, not measured or observed. Assuming that rate of present processes can be applied over vast time scales may be correct, but it is nevertheless an unprovable assumption. Most processes observed in nature today are neither linear nor constant.

    It is quite conceivable, that when the earth was younger and hotter, the underlying layers where more fluid. This would mean that the continents moved much more easily and faster than we observe them to be doing today.

    Sources?

    Follow-up: I did 30 seconds of research and pretty much confirmed my guesses -- the plate tectonics concept sat on the shelf for years because of lack of solid evidence... until the 1950s, when we developed methods of mapping out the ocean floor, which held a lot of clues.

  237. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    I can't believe I'm going to bite on this... but that would be a water hypothesis... not a theory. It's not provable or disprovable (or even testable) and therefore is not a theory.

    I should also mention that it's not even a hypothesis, not in scientific terms.

    A hypothesis must be a reasoned explanation of existing observations that IS testable (but not yet tested). It has to be coherent and not already disproved by existing evidence.

  238. No such revolutionary, evolutionary law! by Chuichupachichi · · Score: 1

    "Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof", The fact that that statement is, in its entirety, regarding the same subject matter. Not even as two separate sentences, but merely separated by a comma. But more importantly, that the 2nd part clearly reveals the writer's "defense" of religion. Is what reveals that the intent in saying "no law respecting an establishment", was to ensure 1 of 2 things. Either it means that Congress can't force the citizens to deny their religion for a single, national religion, established by the state. Thus protecting the freedom "for" the religions practiced by citizens. Not elimination of religion from all public institutions. Or, it means that Congress will make "NO" law!!! Regarding(respecting) an establishment of religion. Such as a law prohibiting the establishment of the citizens religion. I makes sense. Congress can't prohibit the establishment of a religion, "or prohibit the free exercise thereof"! It makes even more sense when one adds the reason for the pilgrimage from England of the persecuted(prohibited) original settlers. Also, the fact that during the Revolutionary War, Congress, were nicknamed "The Bible Congress". "Separation of church and state", has also been misinterpreted. It was amended in the 1800's as a result of the massive waves of Catholic immigrants from Europe at the time. The predominantly Protestant population in America, knowing the history of Europe. In which every time a nations rulers were Catholic, it was in fact, the Vatican who truly ruled that country. The amendment's intention was to prevent a repetition of that history. Otherwise, it makes no sense that a religious majority(by far) populations' representatives. Would amend something equivalent to "shooting themselves in the foot". This would be highly unlikely, since Protestants' history, is one of placing an emphasis on being a learned people. It was the Romans who outlawed reading! Besides, the notion of that "ID" science is somehow the promotion of some religion, is absurd. It does two things. It reveals the scientific data discovered, which exposes evolution as the hoax that it is. Since if they don't, who will? Evolutionary scientists are the ones whom have, numerous times, morphologically evolved their theory to accommodate the new, damning, empirical data. The theory, is the only thing that has evolved by extensive mutation. Appropriately enough! Also, ID science reveals the often times found in nature, extremely improbable, if not impossible. Particularly configured existence of many things, if intelligent design were absent. The "very real" science which ID'ers have drawn attention to in recent years. Is science of which its validity is made evidential, from the fact that its the reason why Dawkins went on a religion intolerance, hating rampage. That when science is obviously burying evolution, the strategy was to attempt to first bury evo's only real competition. Thus, evo would gain indirect, pseudo validation. Even the existence of Atheism can't escape the truth of Gods existence and couldn't exist without him. For if he didn't, what would there be to attach the "A" to?

    1. Re:No such revolutionary, evolutionary law! by LarsG · · Score: 1

      "Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof"

      It is generally interpreted to say that government should not prefer one religion to another, and by extension to keep church and state separate. Which is not surprising, considering that many of those that left the old world for the new did so because they were persecuted for their beliefs by the governments in the old world.

      Besides, the notion of that "ID" science is somehow the promotion of some religion, is absurd.

      Oh really? There is quite a paper trail showing that ID was developed by a group of United States creationists who reformulated their argument in the creation-evolution controversy to circumvent court rulings that prohibit the teaching of creationism as science. "The only apparent difference between the argument made by Paley and the argument for ID, as expressed by defense expert witnesses Behe and Minnich, is that ID's 'official position' does not acknowledge that the designer is God."

      It does two things. It reveals the scientific data discovered, which exposes evolution as the hoax that it is.

      Sure, whatever. Mind coughing up some supporting evidence or are we just going to throw unsupported absolutist statements at each other?

      Evolutionary scientists are the ones whom have, numerous times, morphologically evolved their theory to accommodate the new, damning, empirical data.

      "Damning empirical data?" There you go again. Sources please.

      Besides, it is actually the nature of science not to take our current theories as unchanging truth but to constantly test them and alter the theories if they are not consistent with observed behaviour. That might seem anathema if you base your world view on a single unchanging book, but to use that as an argument to denounce science is bunkum.

      Also, ID science reveals the often times found in nature, extremely improbable, if not impossible. Particularly configured existence of many things, if intelligent design were absent.

      Again, sources please. Flagellum and the immune system is not as slam dunk as you seem to think they are.

      from the fact that its the reason why Dawkins went on a religion intolerance, hating rampage.

      Sources?

      Thus, evo would gain indirect, pseudo validation.

      Really? If A is shown to be invalid, it does not follow that B is true. Simple logic.

      --
      If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  239. Re:2 - The Great Flood (Where are all the Unicorns by kanweg · · Score: 1

    I'm trying to communicate. And I thank you for your response.

    My point is that the "value" of an embryo/foetus increases during pregnancy. Yes, like the woman you mentioned, the women I mentioned were struck by their miscarriages. But I'm sure that if they'd lost a baby, they'd visit the grave frequently. I doubt they still know the dates of their miscarriages and they are not on the calendar which apart from birth days contains the date of departure of deceased family members (sorry, struggling with English here). I've never heard of a woman mourning over the fact that she was a week late with her period. Just some disappointment. So, I think I've provided you with the foundation of my statement of increase in "value" (for lack of a better word. Don't take it as dollars, or something).

    I certainly don't think that a miscarriage is morally the same as an abortion. Per the above, a fertilized egg is less "valuable" than a 3 months foetus and that is less "valuable" than a baby. At some (early) point it is acceptable to be outweighed by other circumstances and an abortion may be acceptable. As an example of the relevance of circumstances, in case of rape I'm fine if the point is a bit later.

    If you're think that the soul is created at the moment of conception, then I don't understand your problems with the pill etc (as taught to you in school). Woody Allen (for once I thought him funny) told a joke that he was involved in a case of anticonception. He asked a girl to sleep with him, and she said no.

    I'm sorry to learn that you misunderstood my donation example, but then I certainly was indirect there. I was trying to mock the pharmacist for not putting equal weight to human lives as such. A life involved in an issue of religious debate is more important than a life elsewhere where life just plain sucks.

    Bert

  240. Re:Evolution textbook!? by Chuichupachichi · · Score: 1

    "There followed a long decline. Wars, on and off, with the crusaders of Europe raiding into the Middle East. Various rulers of Arabic and Persian and Turkish dynasties competing for domination of the Islamic world. A gradual eclipse as the nations of Europe set about building their empires" Thats not the reason why Arab science didn't progress into becoming self sustaining science. Also, the reasons you gave, are not the ones for which it did in the western world. Think about it. If Arabs fighting amongst themselves while competing for domination and invasions from foreign powers, were what caused their science to stagnate. Then how would Europe have been any different? Europe's empires were built through war and there were plenty of foreign invaders also.

  241. Re:2 - The Great Flood (Where are all the Unicorns by MPolo · · Score: 1

    If you're think that the soul is created at the moment of conception, then I don't understand your problems with the pill etc (as taught to you in school).

    The problem with contraceptives is (in general) unrelated to the abortion debate. Although most instances of "The Pill" have an abortifacient effect if taken after conception. Since we're pretty far off topic here, I'll just appeal to "Humanae Vitae" by Pope Paul VI, which explains the moral problem with artificial contraception.

    I think I understood your point with the pharmacist, but if you really believed you were facilitating a murder by dispensing a drug (position of the pharmacist), would you do it, thinking that you can donate to a charity and save a life somewhere else, so that the world will not be plus or minus a life? I wouldn't find that all-too-acceptable.

  242. Re:2 - The Great Flood (Where are all the Unicorns by Mr.+Slippery · · Score: 1

    Ask them how the flood just happened to order all the fossil pollens in the right order, and didn't mix them all together.

    A wizard did it. I mean, an almight god[dess] did it.

    --
    Tom Swiss | the infamous tms | my blog
    You cannot wash away blood with blood
  243. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    Exactly right! Why then do most text books present it as fact?

    Because it is burdensome and redundant to preface every single topic discussed in a science textbook with "this is not, and cannot be, proven, it is simply believed to be true to the best of our knowledge at the time this text book is written." Much simpler to talk about the nature of scientific investigation somewhere near the beginning and let that inform the rest of it. That's certainly what all of my high school textbooks did.

    Why is then so objectionable to present ID as just another theory as well? After all, both are only theories trying to explain the actual facts we observe and measure.

    Because ID, not being falsifiable, is not a scientific theory at all.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  244. Re:2 - The Great Flood (Where are all the Unicorns by kanweg · · Score: 1

    No, that would not be acceptable. A hero could rescue a child from a pond and then have the right to kill another? Of course not.

    The point I intended to convey is that if a life is a life, the pharmacist should be equally concerned with both ways a life gets lost. And it is my hypothesis/suspicion that the pharmacist isn't equally concerned, supported by the "would he spend (the) money on saving the life in Africa" argument.

    Back the drug. The pharmacist doesn't know the position the parent(s) are in and should not impose his judgement. (BTW Drugs to induce abortion are prescription drugs, not over the counter drugs).

    About the pope. He doesn't have a hot line with god. And then, which one with thousands of religions and multiple thousands of gods. I guess all religions claim to be right despite being contradictory, so which one are we to believe. Why not ask the Dalai Lama instead? As far as I'm concerned, the pope, queen, the professor, the janitor, the baker and I all go to the bathroom every day. I respect a person based on his properly supported arguments, not on his function.

    Bert
    Hosea 13:16 Samaria shall become desolate; for she hath rebelled against her God: they shall fall by the sword: their infants shall be dashed in pieces, and their women with child shall be ripped up.

    Deuteronomy 2
    33 And the LORD our God delivered him {THAT IS, THE LEADER OF THE ENEMY} before us; and we smote him, and his sons, and all his people.
    34 And we took all his cities at that time, and utterly destroyed the men, and the women, and the little ones, of every city, we left none to remain:

    And those are just two quotes from the bible. Read it and conclude for yourself: Your deity really doesn't care about innocent children. But then I may be wrong. I'm not a jew so I may indeed not have the privilege of smiting fertilized egss and all.

  245. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...Why would they assume constant movement?...

    You tell me and we'll both know. There is plenty of evidence that the earth's crust and the continents move around like ice floes in the arctic oceans. We know by measurement how fast they drift today, but there is no way to MEASURE how fast the travelled in the past. We can make some assumptions which may or may not be right. In the absence of having information how the rate of movement changed, I suppose a linear guess is as good as any. However we do know from most phenomena in nature that linearity of anything is strangely rare. So it is likely that the rate of movement, was NOT linear and we are left guessing how LONG the drifting continents took to get to where they from where they were.

    Extrapolating anything where the curve of the rate of change is unknown is pure guesswork.

    We do observe that the interior of the Earth is rather toasty still. This means that in times past the molten rocks of the mantle, upon which the continents and the oceans float should have been hotter and therefore less viscous and so allowed the continents to move more freely than they do today. Maybe science will figure out how much more fluid things were way back in time and then come up with a reasonable estimate of fast the continents could have drifted around. It would most certainly be much faster than what we observe today.

    --
    All theory is gray
  246. Re:Evolution textbook!? by beckerist · · Score: 1

    Brand spankin' new, never before seen in nature! JESUSONIUM! Throw some in your water, it instantly becomes wine! Bury it for three days and it instantly becomes a chocolate bunny! You can eat and drink it, heal yourself and best of all, if you accept all of this, you will be rewarded with eternal bliss.

    Otherwise, I suppose, you can rot in hell.

  247. Re:2 - The Great Flood (Where are all the Unicorns by malkavian · · Score: 1

    How strange. Parts of both my degrees involved logic; from them, I found that it is as interesting to know that some conditions cannot exist as it is to prove they do.
    Based on what you're attempting to prove/achieve, you prove that certain events/conditions do occur, or that they do not/cannot (basic example, though mathematically tortuous, take finding the conditions where 1+1=7 in base 10).
    I believe that's easier to prove that the condition where that is true does not exist, than to prove that it does.

    True, all that we understand now does not point to a higher being. However, it also doesn't preclude that (thus some very logical, and very bright physicists are also religious, and find absolutely no contradiction, as they understand that what they know now will likely be considered about as primitive as we consider cavemen using sparks to light fire, which was the height of technology back then).

    Again, wholeheartedly with you on the big question being the nature of the universe. A person that denies what is observed by relying on "a book/person told me that is not true, so it is not true despite evidence" is, quite simply, wrong. Possibly deluded. Highly likely scared.
    However, if there is a question for which we have no answer, and cannot answer (with the best of our technical ability), and has no bearing on every day life, apart from to influence being happy, then by all means, choose what you believe (or don't believe). Saying you know better is simply not true. You believe otherwise based on your perceptions.

    Just a note to you, assuming that someone else is ignorant, because they don't subscribe to your point of view is both rude, and closed minded.
    You seem pretty well educated, and quite bright, and I honestly think that attitude is beneath you.
    I agree with some of what you say, disagree with other parts. Can see the way your arguments flow, and believe that you're employing some spurious logic of your own in there.
    You just spoiled what could otherwise be a decent discussion with off handed rudeness. *Shrug*
    I suspect you are quite likely right in the atheistic view, but rather hope you're not. I choose to say "I don't know". Which is entirely correct.

  248. Re:Rebuttal rebuttal by LarsG · · Score: 1

    Evolution has been singled out for special ire by Discovery, as it provides an explanation for the origin of humanity based solely on natural processes.

    There's two claims here-- 1. Evolution is singled out. 2. It is singled out because it offers an explanation for the origin of humanity based solely on natural processes.

    On the first:

    William Paley predated Darwin. And, certainly Creationists have not in the interim ceased 'preaching' the same message which has gone forth since before either of them.

    They have certainly modified the message over time. You are familiar with the "God of the gaps" argument, I presume? Whenever science comes up with a decent explanation of something that the creationists claimed "god did it", they change their message. See dover trial and the flagellum argument for one example, or their find/replace of "God did it" with "some intelligent designer did it" when they changed their name from creationism to ID.

    Does evolution really offer an explanation for the origin of humanity based solely on natural processes? If you really believe that, then ask yourself two questions. 1 - Where did the original matter making up the primordial soup (or the infinitesimally small mass before the big bang) come from? and 2 - What about these natural laws that seem to govern the universe which make natural processes possible?

    That is a moving the goalposts argument.

    And, even if evolution did offer this explanation, it is solely a conjecture that rebuffing evolution is ID theorists' sole motive in advancing their theory.

    Conjecture, my hindquarters..

    "The concept of intelligent design (hereinafter âoeIDâ), in its current form, came into existence after the Edwards case was decided in 1987. For the reasons that follow, we conclude that the religious nature of ID would be readily apparent to an objective observer, adult or child."

    It is quite clear that the ID movement was born after the creationists' failed attempts to get creationism into the school curriculum. If rebuffing the theory of evolution isn't their goal then what is?

    Why should I continue any further? [..] Why should I waste any more time on this?

    I ask myself the same question. (1) "Creationists not changing their message" and (2) "ID is not an attempt to rebuff evolution". I typically stop rebuffing /. comments after the first few errant statements, but in this case, two are enough.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  249. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    So, which papers have you read where an actual scientist takes constant speed for plate movement as assumed? You keep saying "they assume this", but I can't find even "geology for laypeople" web pages containing that huge logical gap. Can you?

    1) what are you actually arguing for (i.e., do you believe the plates moved drastically faster, say, 5500 years ago)?

    2) You ignored the rest of my comment -- about there being many other sources of information, not just current direct measurements of drift. The theory didn't have any real backing until other sources of data fell into place.

    We also do have a good understanding of how heat transference works (again, bringing to bear another set of observations and scientific knowledge) that will give us separate data on how fast heat can actually convect through the mantle, crust, etc. From what I remember of geology (ages ago), it's a pretty damned slow process -- which we know not because we just extrapolate, but because heat doesn't convect through rock at random; it obeys natural laws.

    Based on all of those differing sources of data, scientists can define *ranges* of when the continents would have been at different locations. That's how it works when you don't have exact ways to pin down a date -- you calculate your margin of error based on the precision of your data and you work from there.

    Because when plates move it makes such dramatic changes on the surface (mountain ranges which then age on the surface, volcanoes, levels of sediment on the sea floor, etc. etc..) we don't just have to guess at historical movement, we can track it *also* based on all of that external change.

    It would most certainly be much faster than what we observe today.

    Er... WHEN would it have been "much faster" than today? If you want to make actual arguments, I can probably address them, or at least tell you where to look. If you want to look at areas of plate tectonic theory that still need expansion, sure -- like all theories, it's still being extended as new observations become possible, and if you could actually advance it you'd probably win some awards (tenure, at least). You can also ask the scientists themselves which parts they'd most like to improve.

    If you want to draw a conclusion that's drastically different from what actual geologists support, though, you have to be able to address the whole body of data their theories cover. If you don't even understand the basis for the theory in the first place, you don't have much hope of saying anything coherent at all.

  250. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ....Because ID, not being falsifiable, is not a scientific theory at all...

    That line of reasoning is absolutely pure BS. If I find a watch or other complex device somewhere, I can claim it is designed and you can deny that claim. The same is true of complex natural things. We know that man-made things are designed. How do we know this? How do we know for example that Stonehenge is a man-made object and not a natural rock formation? There are many mountains and rock formations on earth. In North Dakota at Mount Rushmore there is a mountainside which is quite different from any other mountainside. It happens to have the likenesses of several American presidents chiseled into it. How do we know that this is not a natural rock formation, but of human, intelligent origin?

    The same evidences of design can be found in human systems and devices, is also present in the systems and devices that exist in the natural world.

    --
    All theory is gray
  251. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    Not sure where your definition of supernatural comes from, but most people use the concept to describe something that is in this universe and that interacts with it in some way beyond the possibilities of nature and beyond cause-and-effect as defined by possible physical forces. See the laws of thermodynamics if you are unsure what I'm getting at.

    Also, there is absolutely NO proof that god has ever revealed himself in any shape or form. Your assumptions are based on hearsay and zero evidence. See the problem?

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  252. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    I don't assume you are ignorant because you don't share my point of view. I assume you are ignorant because you fail to re-assess the very fundamental assumptions from which you launch your arguments -- assumptions which are clearly flawed to begin with. It's not rude to point this out, although when dealing with someone whose arguments are so, it is fruitless to discuss anything.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  253. Re:2 - The Great Flood (Where are all the Unicorns by LSD-OBS · · Score: 1

    I understand perfectly. Metaphor, by its very DEFINITION, is not literal. Get it? You can't "believe" in something if it has no literal meaning. As I said before, and as should be obvious, you can choose to interpret or learn from such things, but unless you take the writings as written literal truth, it is not possible for you to believe in them.

    Another thing I said before, if it is metaphor, explain the book of Numbers? Then explain Leviticus. Did people not take those texts as perfectly literal? How about the gospels. Do people not take those as literal accounts?

    Do you see how completely flawed it is to say these things are metaphor? They were clearly never intended as such.

    --
    Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
  254. Re:2 - The Great Flood (Where are all the Unicorns by Free+the+Cowards · · Score: 1

    The claim that a watch was made by humans is falsifiable. Search the planet for the manufacturer. If none is found, the watch was not made by humans.

    The claim that Stonehenge was made by a particular group of humans is falsifiable. The area in and around the stones will contain their artifacts if so. Search that area, and if none are found, the claim is false.

    ID is not falsifiable. No matter what you find, "God did it" is always a conforming response. If we find a specific mechanism for how a particularly "irreducibly complex" construct came to be by natural evolution, ID will not be false, it will just come up with some other reason why there must be an intelligent designer. ID has many of the trappings of science but fundamentally it is not science, but religion.

    --
    If you mod me Overrated, you are admitting that you have no penis.
  255. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...Er... WHEN would it have been "much faster" than today....

    That "when" questioned is not only asked in the science of geology but in all other sciences trying to probe what might have happened in the past. To answer that question, not only in geology, but other sciences as well, present-day observations are applied to the past. It is _always_ assumed that this is a valid way to proceed. Such assumptions may be correct, but they are nevertheless assumptions and always will be. We simply do not _know_ how to answer these "when" questions without making some assumptions.

    For example, scientists come up with dates of rocks and other things based on the phenomena of radioactivity. They can confidently give ranges of dates, but they are all based on the _assumption_ that the rate of radioactivity has always been what we observe it to be today. Again, this may be a valid assumption, but it is still an assumption. In a sense, the interpretations (not the facts) of science are based as much on faith as any religion.

    --
    All theory is gray
  256. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    The same evidences of design can be found in human systems and devices, is also present in the systems and devices that exist in the natural world.

    Sorry, no. (Or in your words, "pure BS")

    We know humans. We can study them and get a reasonably good assurance that they are intelligent. We also can tell what other properties they have, like their ability to make and use tools and their ability to organise to make works that would require more than one human. We also have a reasonably complete written record of at least some of human history. Not to mention the remains of human artefacts, which would indicate that humans inhabited a particular place at a particular time.

    Using that knowledge, it isn't that difficult to infer that Stonehenge, the pyramids, the stone faces of mt. Rushmore or the Easter Island stone statues were made by man.

    When it comes to God, we have hardly any such knowledge. We can't exactly ask him to step into a lab so we can test his cognitive abilities or what tools he has available for shaping the world. How, then, can we make any reasoned argument whether any systems or devices that exist in the natural world are God-made?

    To say "sorry, we don't know how that could happen by purely causal mechanisms" is not the same as "God must have done it". That is just the faulty argument of god-of-the-gaps. It tells us to infer design when we have ruled out all the chance (i.e. non-design) hypotheses we can think of. The design hypothesis says nothing whatsoever about the identity, nature, aims, capabilities or methods of the designer. It just says, in effect, "a designer did it".

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  257. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    In a sense, the interpretations (not the facts) of science are based as much on faith as any religion.

    As opposed to certain religions, science does at the very least allow for their interpretations to change. That is pretty much the only "tenet" that science has - that current interpretations are not holy and that if facts are found that contradict current interpretation, then the interpretation must change to fit the facts.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  258. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    but they are all based on the _assumption_ that the rate of radioactivity has always been what we observe it to be today. Again, this may be a valid assumption, but it is still an assumption

    But where should one draw a line on these assumptions? We have seen nothing so far to indicate that decay rates have changed over time (including analysis of spectra of supernovas) so it seems like a reasonable assumption to make.

    We also make the assumption that our senses don't (intentionally) lie to us and thus most of us assume that we are not used as biological batteries with our brains plugged into the Matrix.

    We have to draw the line somewhere, because if we take the path of doubting every assumption would have us all in catatonic state because we would be unable to trust anything at all.

    In most cases we feel fairly comfortable with making assumptions when we have a considerable amount of facts that seem to support the assumption and a lack of contradicting facts - even when actively looking for contradicting facts.

    So my question would be - where do you draw that line?

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  259. Re:Evolution textbook!? by Hurricane78 · · Score: 1

    How is this on-topic? Or is that your style of showing your very own schizophrenia? (just jokin' ;)

    --
    Any sufficiently advanced intelligence is indistinguishable from stupidity.
  260. Re:2 - The Great Flood (Where are all the Unicorns by Phroggy · · Score: 1

    Not sure where your definition of supernatural comes from, but most people use the concept to describe something that is in this universe and that interacts with it in some way beyond the possibilities of nature and beyond cause-and-effect as defined by possible physical forces. See the laws of thermodynamics if you are unsure what I'm getting at.

    How about Merriam-Webster? "Of or relating to an order of existence beyond the visible observable universe." Or the American Heritage Dictionary: "Of or relating to existence outside the natural world."

    Also, there is absolutely NO proof that god has ever revealed himself in any shape or form. Your assumptions are based on hearsay and zero evidence. See the problem?

    There is no proof any more. There was proof 2,000 years ago. There were eyewitnesses to clearly supernatural events, and natural events that fulfilled centuries-old prophecies in a significant way. But we no longer have this proof; all we have is what people wrote about it later. And since God has not chosen to reveal Himself in a testable way since then, we have no current proof. I don't claim otherwise. However, the absence of proof is not proof of absence.

    By definition, the existence of God cannot be disproven by science. That doesn't mean God exists, and it doesn't mean God doesn't exist. Either belief must be held on faith, and I respect your belief in this matter even though it differs from mine.

    --
    $x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
    $x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
  261. Re:2 - The Great Flood (Where are all the Unicorns by mfnickster · · Score: 1

    There is no proof any more. There was proof 2,000 years ago. There were eyewitnesses to clearly supernatural events, and natural events that fulfilled centuries-old prophecies in a significant way. But we no longer have this proof; all we have is what people wrote about it later.

    There is no proof anymore that Zeus appeared to Europa as a white bull. There was proof 2,000 years ago. There were eyewitnesses to clearly supernatural events... But we no longer have this proof; all we have is what people wrote about it later.

    Naturally, you believe that story as well, right?

    --
    "Slow down, Cowboy! It has been 3 years, 7 months and 26 days since you last successfully posted a comment."
  262. Oh the twisted logic... by Slur · · Score: 1

    Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.

    And here's an equivalent:

    God created the universe just a few minutes ago, with all this stuff in it, to appear as though we've all been here for thousands of years.

    In fact, he didn't bother to create a whole universe. Just the parts anyone happens to be looking at right now.

    God sure is one clever creator!

    --
    -- thinkyhead software and media
    1. Re:Oh the twisted logic... by Free+the+Cowards · · Score: 1

      Here's one I like: God created the universe tomorrow, with all this stuff in it.

      I can disprove it now, because I am conscious and active now, which proves that I must exist right now.

      But tomorrow, I'll only have the memory, and that memory could have been created along with everything else.

      --
      If you mod me Overrated, you are admitting that you have no penis.
  263. Re:2 - The Great Flood (Where are all the Unicorns by Slur · · Score: 1

    You've been modded "funny" but frankly I know you're not kidding.

    Deceived monkeys can be dumb. dumb. dumb.

    --
    -- thinkyhead software and media
  264. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    .....The design hypothesis says nothing whatsoever about the identity, nature, aims, capabilities or methods of the designer. It just says, in effect, "a designer did it"...

    That is true, even in human terms. However there are some things we can infer from a design. Since this is a computer oriented nerdy forum, the design of software in general or operating system specifically comes to mind. We can infer that those who designed the UNIX-based operating systems are better, smarter designers than those who came up with Windows. We can safely infer, that those who designed a 747 airliner had a bit of knowledge about aerodynamics and mechanics.

    Of course we know nothing about what kind of people they are, what kind of families they have, what cars they drive etc. The only way we can get that kind of information is if these designers choose to reveal it to us and we get to know them in person.

    We can infer from the intricacies and complexities of the universe we find ourselves in, that the designer has knowledge and information about the natural world far beyond our own. Especially in living things, he has come up with technology, the workings of which we have only very faint clues. For every answer that science gives, ten new questions arise.

    In this book we call the Bible, there are many hundreds of statements along the lines of "thus says the Lord". How can we ascertain the authenticity and authorship of these writings? How do we determine truth or falsehood in human affairs, such as in courts of law? If you are preparing a document, how can you ensure that the recipients of this document will have a reasonable assurance that it is truly from you and not an artful forgery?

    This has been and still is an ongoing problem in human communications. We do this with computers of course using encryption and passwords. These are used both to authenticate and to protect the message. The essence of these authentication methods involves knowledge that only the true author possesses.

    This is exactly what God has done in the Bible. Because he is eternal and outside of and not subject to time, he uses his perfect knowledge of all time to write history in advance. We humans are singularly bad predicting the future. We can't even accurately predict the weather or the stock market. These predictions of the future in the Bible are not vague or self-fulfilling, but quite specific of events, places and times and NEVER miss. In ancient Israel, anyone who made predictions that clearly failed to come to pass was subject to capital punishment. Being a prophet or soothsayer was a rather dangerous profession back then.

    There are plenty of books that describe many of these Bible prophecies, how they were fulfilled in the past and how they are being fulfilled today. If you are truly interested, I am sure you can find some and study them.

    --
    All theory is gray
  265. Re:Rebuttal rebuttal by johanatan · · Score: 1

    William Paley predated Darwin. And, certainly Creationists have not in the interim ceased 'preaching' the same message which has gone forth since before either of them.

    They have certainly modified the message over time. You are familiar with the "God of the gaps" argument, I presume? Whenever science comes up with a decent explanation of something that the creationists claimed "god did it", they change their message. See dover trial and the flagellum argument for one example, or their find/replace of "God did it" with "some intelligent designer did it" when they changed their name from creationism to ID.

    I don't justify or feel responsible in any way for the arguments of the last 200 years or so coming from Creationists. And, I'm sure that you would not want to claim responsibility for the embarrassing moves your side has made either (such as the 'discovery' of cro-magnum man or neanderthal man based entirely on archaeological unearthing of one single pig's tooth!).

    My point remains the same, but maybe I should've used Moses instead of Paley as surely you couldn't say that Moses was 'targetting' evolution some 3200 years before Darwin? I think it is safe to say though that Moses' work was in part to combat paganism and early forms of atheism (which are philosophical stances, not scientific ones). Genesis was never intended to provide detail about scientific processes.

    And, Dover proves nothing except that a liberal judge continued the status quo. The supposed 'refutation' of irreducible complexity does nothing more than multiply imagination upon imagination. And those imaginations come up very short. Even if they were sufficient (and they're not--they're way short) to explain how the bacteria flagellum *could* have evolved, they certainly come no where close to showing how they *did* evolve. You should read Michael Behe's book on this subject--_Darwin's Black Box_. There's way more proteins and enzymes involved than can be explained with a simple vague guess as to how it might have happened. What Dr. Behe says is lacking is detail of a step-by-step process (and this process is still yet to be detailed).

    The evolutionists' argument here is really a logical fallacy--argument ad ignorantiam. While providing only far-fetched and imaginative theories about everything from how smart Neanderthal man was to how much fur specific dinosaurs must've had, they claim that since no one has disproved evolution (and their imaginations), it must be true.

    How can you say I moved the goalposts when the author used the word 'origin'? Is not origin an endpoint? Is there such a thing as an original origin. Or, is one origin more original than another? Obviously, if the author had chosen another less absolute word, then my refutation would not have applied.

    And, even if evolution did offer this explanation, it is solely a conjecture that rebuffing evolution is ID theorists' sole motive in advancing their theory.

    Conjecture, my hindquarters.. "The concept of intelligent design (hereinafter ÃoeIDÃ), in its current form, came into existence after the Edwards case was decided in 1987. For the reasons that follow, we conclude that the religious nature of ID would be readily apparent to an objective observer, adult or child." [wikisource.org] It is quite clear that the ID movement was born after the creationists' failed attempts to get creationism into the school curriculum. If rebuffing the theory of evolution isn't their goal then what is?

    Well, I personally consider myself an ID theorist (attacking the problem from an information science perspective), so I can speak for myself. I think the theory has interesting ideas and merits on its own. Rebuffing evolution certainly isn't my sole motive. I agree that Creationism has morphed into ID, but isn't it the message that should matter, not the messenger? [Also, I know a bi

  266. Re:Rebuttal rebuttal by johanatan · · Score: 1

    P.S. It is another logical fallacy to conclude that ID theory has nothing scientific to offer because its predecessor Creationism included religious aspects: ad hominem.

    Science should be concerned with deciding the truth values of claims no matter their source.

  267. Re:Evolution textbook!? by Slur · · Score: 1

    I love that quote. Of course, Buddhism strongly emphasizes constant deconstruction of the self, questioning what one is told, investigating and proving things to oneself through evidence. The New Testament also emphasizes critical examination in the accounts of Christ and the Pharisees, but most Christians seem content to take the criticism not intended for themselves... just other hypocrites.

    From http://www.pfo.org/pharisee.htm ...

    One modern Jewish scholar has commented on a variation of this line of thought.

    "Matthew's Gospel is particularly antagonistic to the Jewish establishment. But when Jesus refers to Pharisees as "hypocrites" (Matthew 23:13) and a "brood of vipers" (Matthew 23:33), he is berating fellow Jews. Jesus undoubtedly regards his violent language as following the tradition of the prophets when they castigated fellow Jews of their day. In other words, it is a family quarrel. Jesus looks upon himself as continuing the Jewish tradition of self-criticism."

    --
    -- thinkyhead software and media
  268. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...We have seen nothing so far to indicate that decay rates have changed over time (including analysis of spectra of supernovas) so it seems like a reasonable assumption to make...

    We DO have some evidence that the electromagnetic properties of the medium of space itself have indeed changed dramatically over time. This would demand that certain numbers, assumed to be "constants" have changed as well. One of these is Planck's constant which is measured to be smaller today than when it was first measured. Light-speed is related inversely to that. That means light moved much faster through the medium of space, when the Universe was very young, small, dense and hot. Just as sound travels faster in rock or water than in air, so too light traveled faster through a denser Universe.

    There is evidence from past light-speed measurements using a gravity time-base, which have shown a decrease since such measurements were first done in the early 1600s. When an atomic time-base clock is used to measure the speed of light, as is being done today, this is not seen, since the product hc appears to be truly constant, with h and c moving in opposite directions. If a ruler elongates at the same rate as a distance to be measured by it, the distance will always be measured to be the same, even though it really is changing. Gravity equations have neither h nor c in them. Therefore, any clock based on gravity will not be affected by the changes in h or c and measure them directly, without any correction factors needed.

    Since Planck's "constant" appears in equations describing the behavior of atoms, radioactive clocks must also be affected. So there IS evidence that call into question the belief that these "clocks" are truly constant over time.

    --
    All theory is gray
  269. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    Of course we know nothing about what kind of people they are, what kind of families they have, what cars they drive etc.

    Are you purposefully trying to miss the point, did I trig some sort of mental block?

    To rephrase my point - we know humans to the point where we have a reasonably good grasp of our mental capabilities, what kind of tools we had available at different times in history, what government/social structures we had (or were likely to have), what motives and incentives we might have had, etc..

    The purpose of this is so that when we are presented with an artefact and ask the question "did Man make this?" we have a large amount of background material that can help us decide the likely answer for this question. First of all, would man - at that point in time - have the required tools to make this artefact? Second, would he have any likely motive for making it? Continue down this line of questions for every property of the artefact and what was known about humans at the time and place the artefact was made.

    On the other hand - An attempt to do the same line of reasoning with "did intelligent designer make it?" to something like the flagellum would be an exercise in futility. We simply don't know enough (or anything at all) about this supposed intelligent designer to make any sort of reasoned judgement as to whether this intelligent designer made the artefact or not.

    These predictions of the future in the Bible are not vague or self-fulfilling, but quite specific of events, places and times and NEVER miss

    Ok, now I definitely know that you are either trolling or so brain-addled that you are in dire need of professional help. Never miss? The end-times have been proclaimed how many times exactly? Oh, or were those foretold by people not following the right kind of Christianity?

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  270. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    In a sense, the interpretations (not the facts) of science are based as much on faith as any religion.

    This is a profound misunderstanding of science.

    You're (unknowingly) pointing to the exact reason why the scientific method was developed, and why the scientific approach has been so extremely successful at winnowing out valid, supported, useful theories from all of the possible conceptions of how the world works.

    Removing faith from the search for knowledge was essential. Removing "unquestionable fact" from consideration was essential. No theory or conclusion is ever a closed book -- as more observations are made (and more are possible, because our technology continues to advance), theory must always be updated to account for those observations.

    It's amazing to me that we're born into a world where one set of grownups tell us that X and Y happened magically, done by a magic invisible being, and we must take their word for it because *other* people wrote it down rather cryptically a long time ago, and there's no way to investigate for ourselves. And ANOTHER group of grownups tells us no, we can get a pretty good idea of how X and Y happened if we gather up the clues left everywhere and apply a strict process to weed out the weak ideas... and here, you can try it for yourself, and read how we figured it out in as much depth as you want, and even help us figure out more.

    Why does anyone join the first group? Because they seem nice? (well, not all of them...) Because they were forced to decide while still children (and it can be hard to change)?

  271. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    Sources?

    And what alternate interpretations have you considered and discarded?

    Unfortunately, there's a large mass of scientific-sounding drivel on the internet that makes incoherent points based on basic misunderstandings of the science involved -- you can often do a tiny amount of research and find that they are misrepresenting the situation, often maliciously and with an unsubtle agenda.

    If you provide some sources perhaps you might get help evaluating them.

    If you're actually doing ground-breaking research yourself, bravo, and let us know when the Nobel prize ceremony is. I'm not getting that sense, though.

  272. Re:2 - The Great Flood (Where are all the Unicorns by JavaRob · · Score: 1

    Minor addendum -- we also have other sources of data that are less precise, but that provide independent dating methods.

    Example -- different kinds of rock erode at different rates. We don't know exactly what the weather has been like over X millions of years, but we can deduce a range (hint: huge mountains of hard rock don't get worn to nubs in a thousand years). Sediment build-up is another similar clue.

    That's how science works -- you gather *all* the clues possible, and if your theory doesn't account for all of them, it has to change.

  273. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    We DO have some evidence that the electromagnetic properties of the medium of space itself have indeed changed dramatically over time.

    Source?

    One of these is Planck's constant which is measured to be smaller today than when it was first measured.

    Source?

    There is evidence from past light-speed measurements using a gravity time-base, which have shown a decrease since such measurements were first done in the early 1600s.

    Which measurements? You know, this would be so much easier if you would do the very basic courtesy of providing sources for your assertions.

    If a ruler elongates at the same rate as a distance to be measured by it, the distance will always be measured to be the same, even though it really is changing.

    Though it would be possible to measure the changes of the ruler. For one, if you elongate it enough it would simply break apart because the molecules in the ruler would be too far apart for the intermolecular bonding forces to hold them together. That is, unless you also assume that the inter- and intra-molecular forces change accordingly.

    Since Planck's "constant" appears in equations describing the behavior of atoms, radioactive clocks must also be affected.

    But it does not follow that it would affect other kinds of clocks, and even if it did it might not affect them to the same degree. If we were to compare these clocks, it would be fairly straight forward to discover that something funky is going on with the atomic clock.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  274. Re:2 - The Great Flood (Where are all the Unicorns by Dimensio · · Score: 1

    There is evidence that the electromagnetic properties of the medium of space itself have indeed changed dramatically over time.

    Then you should be able to reference this evidence. Please do so.

  275. Re:Evolution textbook!? by beckerist · · Score: 1

    Hey, at least 3 of the voices in my head thought it was funny! (Yeah we do!)

  276. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...You know, this would be so much easier if you would do the very basic courtesy of providing sources for your assertions...

    Well, if you really want to dig deeply into this, here is a place to start:

    http://www.setterfield.org/report/report.html

    Pay special attention to the references given at the end of the article. I hope you have plenty of time to look into this with an open mind.

    Remember, that real progress in science has NEVER been done by the consensus of the majority or a large committee.

    Any time constancy and linearity over a large amount of time is promulgated, it is time to get suspicious. About the only thing constant in nature is change. We live in a dynamic, ever changing universe. Postulating slow uniform processes over great spans of time is not in keeping with the observed dynamics of the Universe. The entire solar system bears the hallmarks of a violent past. On Earth there is evidence of sudden catastrophes, such as impacts of asteroids, monstrous volcanic outbursts and floods that made great changes very quickly. One look look at the moon or mars will show you the great number of these events.

    Therefore, it is not so far fetched to assume that NOTHING is truly constant for very long. Ask any Physicist. There is NO law of physics that says that the speed of light MUST be constant.

    --
    All theory is gray
  277. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    A couple of comments on c decreasing:

    Once fairly accurate measurements of c became available (post 1960), the supposed c decay seems to vanish. So, he uses the measurements of c pre-60 (which have huge potential errors) to build the case for his decaying c argument but his proposed graph conveniently levels off post-60.

    A decaying c would also have wide ranging effects, which we should be able to observe today. For one, e=mc^2. With a higher c, chemical reactions would release more energy than it does today. Not to mention that it would alter the fine structure constant (α = vH/c), which we would definitely be able to observe the effects of (the temperature of stars depends strongly on α, so we should be able to detect even a slight change - one of which is that we would have been bbq'd by the sun in the 1000 or so years after genesis).

    And that's only scratching the surface of the changes that c-decay would imply, change one of the basic values of physics and lots of stuff happens.

    Oh, and it would be interesting to see how one would reconcile this with the idea of c-decay.

    There is NO law of physics that says that the speed of light MUST be constant.

    That is true, as far as I know. However, that is not the same as saying that the effects of this historic change of c would not be DETECTABLE today.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  278. Opens with a Lie by island001 · · Score: 1

    "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school." ~ I guess that the big chicken thinks that this lie will go a long way to convince anybody that isn't in the choir to join the side of "honest science". ~ How... ideological...

  279. Abstraction versus literality by burnitdown · · Score: 1

    I understand perfectly. Metaphor, by its very DEFINITION, is not literal. Get it? You can't "believe" in something if it has no literal meaning.

    People can believe anything they want. As I showed you, abstraction is what differentiates metaphor from literal text. People can believe an abstract solution more than a literal one.

    For example:

    (a) I believe the sun will come up tomorrow, because every part of life is a cycle, including both days and seasons.

    (b) I believe the sun will come up tomorrow because of the rotation of the earth.

    The first is not a literal description, but it is accurate, even if abstract.

    The second is literal.

    People can believe both, and in many cases, prefer the abstraction.

  280. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ....Once fairly accurate measurements of c became available (post 1960), ...

    That is the time when the atomic clocks began to be used for the time base for this. The clocks change exactly the same as the quantity to be measured. The earlier measurements were all made using orbital clocks based on gravity. Gravity is disconnected from atomic behavior. Measuring with the distance between points with a ruler that stretches at the same rate as the distance does, will give you a constant measurement. If someone tattoos a ruler on a child's body, that kid doesn't grow at all, as measured by that ruler. Atomic clocks are not an independent measuring stick to measure time or distance.

    We KNOW that light is affected by the medium it traverses. Space is not an empty nothing, but has electromagnetic properties that HAVE to change as space expands. The fact is that space is not expanding much any longer and so the change of the speed of light is very small, yet still measurable IF an independent clock is used.

    Recently there were headlines even, that light has been slowed to crawl in the lab. Don't you think that if light can be slowed down way, it can also be speeded up? There is no way we can actually MEASURE the distances to objects using trigonometry more than a few light years away. The biggest base we have is the orbit of the earth. That is a very tiny distance compared to the galaxy dimensions. The angles become simply too small to measure. The stated distances are arrived at by brightness comparisons and the Hubble red-shift = distance assumption. It is because such vast distances are assumed, that makes the energy output of things like quasars appear to be so great. If the distances are really much less, then these objects become quite normal stars.

    from the link article: (..Let's start by considering a pulsar which is 170,000 light-years away..

    Here is again one of these flat out statements based on an assumption, namely that said object really is that distant. So there again ONLY if that assumption is true, does all the math pan out and bolster the writer's argument. Slinging math around is great only if the underlying numbers are based on actual measurements and not baseless assumptions.

    from the link article: (..The amount of coal and oil existing today greatly exceeds what could have been produced by decaying plants and animals ..)

    Again, the underlying assumption here is that the growth conditions and the biosphere was similar to what we have today. There is evidence that life on earth was much more prolific when the earth was young.

    The creationists also make assumptions about the biblical text that are not really there. Creationists forget that the main purpose of the Bible is not to give us an accurate account of how God did things, but to tell us of His love and what plans he has for mankind.

    When it comes to the past, only someone who was actually there can give us an accurate account of what REALLY happened. Since God doesn't give us any where near as much detail as we'd like, both sides have to do a lot of guesswork.

    I suppose you might have noticed my sig by now!

    cheers -- have a good day!

    --
    All theory is gray
  281. Re:2 - The Great Flood (Where are all the Unicorns by kurzweilfreak · · Score: 1

    But the abortion-rights lobby decided that it would be far too traumatic for a woman to hear, "I'm sorry, I can't fill this prescription, but Joe's pharmacy down the street can."

    I'm sure that wouldn't be too traumatic, but what about when a pharmacist not only refuses to fill the prescription, but also refuses to have it transfered or give it back to the woman to take down to Joe's?

    --

    kurzweil_freak

    5th Kyu Genbukan Ninpo/KJJR student

    Be the darkness that allows the light to shine.

  282. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    That is the time when the atomic clocks began to be used for the time base for this. The clocks change exactly the same as the quantity to be measured.

    So the speed of oscillation of caesium atoms changed at the same rate that the speed of light in a vacuum does? Sounds like a convenient radom event to me.

    Besides, how would this change in atomic clocks not be detected by comparing it to other potential sources of time. Or did those happen to change at the same rate too?

    We KNOW that light is affected by the medium it traverses. [..] Recently there were headlines even, that light has been slowed to crawl in the lab.

    That is true. So?

    Space is not an empty nothing, but has electromagnetic properties that HAVE to change as space expands. The fact is that space is not expanding much any longer

    Source? Or is this an assumption? ;-p

    There is no way we can actually MEASURE the distances to objects using trigonometry more than a few light years away. The biggest base we have is the orbit of the earth.

    Correct. Parallax works out to about 200ly.

    That is a very tiny distance compared to the galaxy dimensions. The angles become simply too small to measure. The stated distances are arrived at by brightness comparisons and the Hubble red-shift = distance assumption.

    Not quite. We usually use Cepheid variables. You use stars that are close enough for parallax distance measurement for calibration.

    Red-shift really only tells you how fast they are moving, and while there is a relationship between the amount of shift and distance we shouldn't use that alone.

    Creationists forget that the main purpose of the Bible is not to give us an accurate account of how God did things, but to tell us of His love and what plans he has for mankind.

    Agreed. So why do you insist on a quite literal interpretation of genesis and the flood?

    When it comes to the past, only someone who was actually there can give us an accurate account of what REALLY happened.

    Just one sec, I need to change the battery of my camcorder before I go for a trip in my time machine.

    While absolute concrete utterly non-disputable evidence is hard to come by, there is more circumstantial evidence out there than you seem to believe.

    Since God doesn't give us any where near as much detail as we'd like, both sides have to do a lot of guesswork.

    Science at the very least has the advantage of having some system to the guesswork. Scientific method refers to bodies of techniques for investigating phenomena, acquiring new knowledge, or correcting and integrating previous knowledge. To be termed scientific, a method of inquiry must be based on gathering observable, empirical and measurable evidence subject to specific principles of reasoning. A scientific method consists of the collection of data through observation and experimentation, and the formulation and testing of hypotheses.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  283. Re:Rebuttal rebuttal by johanatan · · Score: 1

    Actually, your citations of other finds do nothing to refute my point about the one particular find where scientists worldwide got all giddy over a pig's tooth. If I'm not mistaken, it was before the other finds you cite (if they are for real this time.... once bitten, twice shy you know).

    And, explaining how the guy could've made the mistake, although noble, hardly erases the mistake.

  284. Re:Rebuttal rebuttal by johanatan · · Score: 1

    I suppose that is the one. Unfortunately, it seems, the right's judges have a bit more of a tendency to forget how they got there than the left's do. Sandra Day O'Connor also comes to mind.

  285. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ..Science at the very least has the advantage of having some system to the guesswork..

    Actually science is NOT t all guesswork. It is based on present observations and experiments, done in real time, TODAY! The guesswork is in the interpretation of the data so gathered. We measure the speed of light today and it is a certain speed. That tells us nothing about what it was a million or even a thousand years ago. We assume the stars are a certain distance away and try to match brightnesses assuming that the other stars are equally far away and equally bright.

    In 1968, the scientific community changed Planck's constant from 0.0014350 to 0.0014388. Why, just for fun or is it because it indeed is not truly constant?

    (...Besides, how would this change in atomic clocks not be detected by comparing it to other potential sources of time...)

    The only other source of time is orbital time which is dependent on gravity. Gravity equations do not contain a time element such as c or h. The atomic clocks indeed have lost a few seconds since 1967 against orbital clocks. In 1967 the time standard was changed from an orbital definition to an atomic definition.

    If light can be slowed down, then its speed is not a constant.

    http://en.wikipedia.org/wiki/Slow_light

    If it can be slower, then why not also faster?

    --
    All theory is gray
  286. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    ..Science at the very least has the advantage of having some system to the guesswork..

    Actually science is NOT t all guesswork. It is based on present observations and experiments, done in real time, TODAY!

    I notice that you conveniently didn't address my point that science sets strict scrutiny standards to how they deal with their guesses.

    You observe something or test something in the lab. You make a guess based on those facts. Then comes the crucial step - you look at this guess and then ask "what else would we expect to see if the guess is correct?". Then you go back to the lab or out in the field to see if the new facts you uncover fits with the guess or not. See the link to The Scientific Theory that I included in my previous post for a more detailed description of the process.

    That second step - the "what else would we expect to see" and then going out and looking for those other facts is what is conspicuously missing from your guesswork like "c-decay" or "earth's rotational axis was altered during the flood". Hence, the trust one would apply to those guesses is small because they lack corroborating evidence. Not to mention that those theories have significant problems that have not been addressed in a satisfactory manner.

    Scientific guesses only gets elevated to scientific theory once the guess has been poked and prodded at from every angle possible for us to do by doing work in the lab or going out and observing facts.

    *that* is the main reason that you don't see ID in school textbooks. They have not done this meticulous work of testing their guesses in every way possible.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  287. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ....you look at this guess and then ask "what else would we expect to see if the guess is correct?"...

    The problem is that when the evolutionists guesses do NOT accord with observations TODAY, they resort to telling everybody that evolutionary processes are very SLOW and take so much TIME, so of course we don't see them taking place today.

    Everybody, not just highly educated scientists, observes and has observed for centuries that living things do NOT evolve the way evolution preaches. Dogs forever produce ONLY more dogs, cats make more cats, birds lay eggs which only hatch into more birds of a certain kind. Woodpeckers don't produce sparrows or ostriches. This holds true in more "primitive" life forms also. One celled algae produce only more algae. Your mother would have been very upset and unbelieving if the doctors or nurses had brought a chimpanzee to her instead of you and told her that she just had experienced evolution happening backwards. After all, evolutionists preach that evolution can happen the other way also and might be called devolution.

    The Creator simply tells us in the Bible that is what He did. He made each kind reproduce after their own kind. Birch trees don't make Pine or Fir seedlings, only more Birch trees. This is ALL we observe. Creationists don't HAVE to make guesses about the past, because they are TOLD what happened by the one that made it happen. We all see it STILL happening every day of our lives as corroborating evidence that what God has said about this subject is true.

    When evolutionists are confronted with this undeniable FACT of nature, they dismiss all that everyday fact with: "It takes millions of years for that sort of evolution" and so we can't expect to see this in our life time".

    I say that is BS and a cop out into the magic land of time. If it can't be seen or duplicated TODAY, it didn't happen. You can go visit the pyramids and if someone really wanted to build one today, they could, even though they were made thousands of years ago. All history, including natural history cannot be scientifically tested, but must be believed by whatever records we have. There is no way to experimentally or observationally determine that Julius Caesar ever lived. You have to BELIEVE the written records of historians.

    We find fossils all over, but WHO has ever made a fossil? Make me a fossil and explain how you did it. Take an e-coli bacteria and evolve it into a streptococcus or spirochete or the other way round and explain how you did that in an experimental report. You'd win a Nobel prize for sure. Experiments and observations is what REAL science is all about, not speculations and conjectures of what might have taken place millions of years ago, but cannot be duplicated or observed today.

    (..what else would we expect to see..)

    The current interpretation of the observed red-shift of distant starlight is the doppler effect. Another interpretation of it is that it is caused by the slowing of the speed of light. Not the "tired light" interpretation, but the changing nature of space itself. This change must also change the energies of the atomic orbits. Since atomic phenomena are quantized, the red shift should also be quantized. This is indeed what scientists have observed. The red-shift is not smooth, but occurs in tiny jumps. If you are interested look here:

    http://www.cs.unc.edu/~plaisted/ce/redshift.html

    This is credible evidence that allows calculation of exactly how much the speed of light has changed. It also gives us a basis for correcting radiometric time bases into the past, because Planck's "constant" is inversely related to c. Planck's constant has been _measured_ to be increasing still today.

    Evolution is NOT science, but a philosophy dependent on the magic of time. If any scientists who believes in evolution could ever make it happen now, in the lab or observe it in nature, there would be screaming headlines everywhere.

    --
    All theory is gray
  288. Re:2 - The Great Flood (Where are all the Unicorns by GWBasic · · Score: 1

    There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.

    It's important to understand the difference between philosophy and religion.

    The concept, not belief, that God created everything; (including the Big Bang, Multiverse, and what came before and outside of them,) is so universally accepted that our Supreme Court allows us to put "In God We Trust" on our money, even though our Constitution expressly forbids Congress from endorsing any religion through law.

    Philosohpy argues for the existance of God through the logic; there is no belief at all. Religion, or Faith, would state things like "God loves you", "creation is good", "man is the keeper of the world."

    Many people approach God as a subject of philosophy, and not faith or belief.

  289. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    That is such a blatant misunderstanding of the Theory of Evolution that I find it absolutely mind blowing.

    ToE is about gradual change. We see gradual change. DNA comparisons show gradual change. The fossil record shows gradual change.

    ToE does *not* say that the offspring will differ greatly from its parents. If we saw sparrows giving birth to mockingbirds, it would not be a proof of ToE - it would be the exact opposite.

    But then again, if you manage to misunderstand so thoroughly what ToE actually says then I really see no reason to continue this attempt at having a reasoned discussion with you.

    At the very least, it has provided me with a good example of the rationalisation that happens in the mind of someone who feels that his childhood beliefs are under attack.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  290. Re:2 - The Great Flood (Where are all the Unicorns by arminw · · Score: 1

    ...The fossil record shows gradual change...

    That is not true. The so called evolutionary column is found NOWHERE on earth in any single spot. "Earlier" life forms are at times wildly jumbled up with "later" ones, all in the same layer.

    (...ToE is about gradual change...)

    ToE is about _widely believed_ gradual change. There, fixed it for you. Nobody, anywhere has ever demonstrated sparrows giving birth to mockingbirds, but evolution teaches that "eventually", over time, a LOT of time, birds became mammals, apes evolved into humans and other magic we don't see happening. Without lots of time even evolutionists admit that ToE cannot work. The actual real evidence we have TODAY, shows that evolution doesn't happen at all, at least not the monkey to man sort. Believing that it can or did happen is OK, but it is a belief, not an observed scientific fact. I can give you the story how the magic of time helped here and there by chance, as described in public school text books, can turn not only a frog, but even rock into a handsome prince. A pretty maiden's kiss is not needed.

    Can you not understand that science is what we observe happening TODAY and _history_ is what happened in the past? Nobody can do experiments or observe past history. We have to rely on human or natural witnesses. Fossils are nature's witnesses as are radioactive rocks and light from outer space. Pyramids, cuneiform tablets, papyrus and animal skin scrolls, such as the dead sea scrolls and the books of the Bible are witnesses of human history. ALL witnesses, natural or human NEVER prove anything, but must be BELIEVED or not.

    You believe, have faith, that natural witnesses are testifying that monkeys eventually, over lots of time, became human. I believe, have faith in what God had written in the witness of a historic book. There He tells us that He created monkeys, men and all other creatures distinct and only able to each reproduce their own kind. We STILL see this and only this happening today. That makes the biblical interpretation far more believable than the evolutionary conjecture. Even so, we are both stuck with belief as far as the past goes.

    --
    All theory is gray
  291. Re:2 - The Great Flood (Where are all the Unicorns by ChaosDiscord · · Score: 1

    You're closing your mind. As a result, you're arguing poorly and being unnecessarily hostile. As a result, many religious people tend to stop listening to athiests, since the most outspoken atheists tend to make sloppy, ignorant arguments, nitpick minor details, and generally act like dicks. If you're sincere about wanting to eliminate religion, maybe you should actually listen to your opponents for a while to learn to better communicate with them. I assure you that mocking them is not going to help your cause.

    As to the Bible, when someone says they believe the Bible or believe in the Bible, they (usually) mean they believe that it is the divinely inspired word of God. Exactly what this means varies from one Christian denomination to another, and even from person to person. Sure, some believe it absolutely literally. Others believe parts are "true" in that they are truly divinely inspired metaphorical stories (say, chunks of old testament), while other parts are true in a literal sense (say, the gospels of the New Testament). It was written over the span of hundreds of years by dozens of authors in multiple languages targeting wildly different initial audiences; expecting it to be a a singular thing seems a bit much.

  292. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    That is not true. The so called evolutionary column is found NOWHERE on earth in any single spot.

    Red herring.

    "Earlier" life forms are at times wildly jumbled up with "later" ones, all in the same layer.

    At times.

    ToE is about _widely believed_ gradual change. There, fixed it for you.

    Are you saying that we have not observed gradual change?

    Nobody, anywhere has ever demonstrated sparrows giving birth to mockingbirds

    Neither do we expect to see that.

    The actual real evidence we have TODAY, shows that evolution doesn't happen at all, at least not the monkey to man sort.

    That makes as much sense as saying:" The actual real evidence we have TODAY, shows that gravity doesn't happen at all, at least not the earth falling into the sun sort."

    Believing that it can or did happen is OK, but it is a belief, not an observed scientific fact.

    You move the goalposts all the way to exact detailed fact. That is a quite convenient rationalisation if you want to keep your belief in a young earth, a literal genesis and a global flood.

    That is probably the only rationalisation you can use to keep your internal model of how the world works intact. You set the barrier for proof so high that it makes it possible for you to ignore the substantial amount of circumstantial evidence which implies that it isn't so. You eagerly grasp any tiny detail you can find that casts doubt on current scientific theory, no matter how flimsy.

    Can you not understand that science is what we observe happening TODAY

    That is part of science, but not the most important part. The important part is (1) the process of taking the things we observe and make reasoned guesses at how the world works and (2) then look at what those guesses imply and then go out and do observations/tests to see if those guesses have any value.

    Fossils are nature's witnesses as are radioactive rocks and light from outer space. Pyramids, cuneiform tablets, papyrus and animal skin scrolls, such as the dead sea scrolls and the books of the Bible are witnesses of human history. ALL witnesses, natural or human NEVER prove anything, but must be BELIEVED or not.

    Yup, as I said above - you set the standard for proof so high that in your mind there is no difference between (1) a scientific theory with heaps of supporting evidence and (2) what someone wrote in a book.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  293. Re:2 - The Great Flood (Where are all the Unicorns by LarsG · · Score: 1

    We have actual specimens of actual creatures which have some features of men, some features of apes. Interestingly enough, the older ones are more apelike, the younger ones are more human-like.

    Agreed. But in his mind the following happens:

    "Can you not understand that science is what we observe happening TODAY and _history_ is what happened in the past? Nobody can do experiments or observe past history. We have to rely on human or natural witnesses. Fossils are nature's witnesses as are radioactive rocks and light from outer space. Pyramids, cuneiform tablets, papyrus and animal skin scrolls, such as the dead sea scrolls and the books of the Bible are witnesses of human history. ALL witnesses, natural or human NEVER prove anything, but must be BELIEVED or not."

    In arminw's mind the specimens are not real, they are instead "witnesses". Thus he is free to choose which witnesses he wants to believe, and the truth value that his mind assigns to those specimens can then be set lower than the truth value his mind has set for the bible and genesis/flood. All this is so that he does not have to change the model he currently has of how the world works.

    --
    If J.K.R wrote Windows: Puteulanus fenestra mortalis!
  294. Re:2 - The Great Flood (Where are all the Unicorns by MightyDrunken · · Score: 1

    ...If you CHANGE those numbers, you CHANGE a lot of things...
    Originally posted by by arminw (717974)

    Not so. For example, take the famous equation e=mc^2. Atomic rest masses "m" are proportional to 1/(c^2). Thus when c was higher, rest masses were lower. If the rest mass does down as c goes up then energy will be conserved.

    LOL arminw you are a God of illogical thinking, having your cake and eating it too!
    Simply put on this off-topic discussion. The majority of evidence points to an unchanging value of c, with a small amount of evidence which could be a changing value of c.
    Either way this has nothing to do with evolution because many different lines of evidence points to the Earth being billions of years old. Such evidence includes geology, cosmology, radio active decay and evolution.