Slashdot Mirror


User: vandelais

vandelais's activity in the archive.

Stories
0
Comments
354
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 354

  1. Anyone ever heard of Pac-Man? on Genre-Defining Games? · · Score: 1

    It was this old game where this little yellow dude ....

    Not sure what genre(Arcade/console/puzzle), but for a lot of people a generation older than me, it would be the first and maybe only video game they could name.

    Can't believe no one has mentioned Tomb Raider, even though it could be a considered a derivative of the treasure game Pitfall!

    Pitfall! is also a defining game for the stepping-on-alligator-heads genre which, to my knowledge, encompasses a grand total of one game.

    and finally, Leisure Suit Larry!

  2. Trade offs--Greenhouse vs. particulate matter on Burn Grass, Get Green Biofuel · · Score: 1

    According to the brochure XCel Energy sends out, they detail where their power production comes from in percentages. It appears that particulate matter would be the trade-off no one seems to be acknowledging. It's bad enough our automobiles produce this scourge, but if industrial power production shifts to this source of fuel, buy stock in any company making anti-asthma
    medication.

    Air Emissions by Fuel Type
    (lbs/ thousand kwh)

    C02--S02-N oxides--Partic Matter--Hg
    Coal------------2358/6.3/5.3--/0.41/.0 0006
    Nat gas---------1344/0.03/1.8--/0.06/.00000001
    Oil--- -----------1909/2.1/9.1--/0.43/.000007
    Refuse Fuel-----6300/1.3/9.4--/0.34/.0001
    BIOMASS------3 139/0.4/7.9--/0.88/.00003
    Purchases-------1839/5. 5/4.0--/0.33/.00004

  3. Choosing a date for a product announcement on Mac OS X Tiger Goes Gold · · Score: 0

    2 Things you don't let your marketing dept do if you can help it if you are a Fortune 500 company.

    1) Guarantee your product intro will not be even the lead financial story of the day by introducing it the day the Dept of Labor releases monthly non-farm payrolls.

    2) Introducing a product on April Fools day, a national holiday or 9/11.

  4. Re:Exact phrase searches .. on Bill Gates Interview w/ Spiegel · · Score: 5, Funny

    SPIEGEL: When one puts the sentence "Bill Gates is the devil" into the Internet search engine Google, one gets thousands of hits. Does this bother you?

    Gates: Slashdot runs a lot of duplicate stories.

  5. Virginia, huh on Massive Layoffs At AOL · · Score: 1

    I think the military is hiring.

  6. possible locations for the parks include on Scientists Propose 'National Parks' On Mars · · Score: 1

    Olympus mons, the largest volcano in the solar system (and surrounding area).

    No sense colonizing that unless Austin Powers figures out how to land Big Boy near that thing.

    Muhahaha....Muhahahaha........muhahahaha!

    He only wants a million dollars, anyway.

  7. 5 topics? on U.S. Attorney General John Ashcroft Resigns · · Score: 2, Funny

    [ News ]
    [ United States ]
    [ Republicans ]
    [ Your Rights Online ]
    [ Politics ]

    Why not Upgrades?

  8. Had to wonder... on NASA Retires Vomit Comet · · Score: 2, Funny

    Honorable or dishonorable discharge?

  9. Al Jazeera did not translate one phrase properly on New Bin Laden Tape Surfaces · · Score: 4, Funny

    "Ashlee Simpson and her band of infidels had failed Americans with her Saturday Night Live performance, deceiving the nation and putting it at risk from further al Qaeda strikes", bin Laden said. The speech was his clearest claim yet of responsibility for the Sept. 11 strikes of 2001.

  10. Seriously on Economist Endorses Kerry, Reluctantly · · Score: 0

    How can you vote for someone that doesn't even know how to wear a baseball cap properly?

  11. Sounds like on Thinking About the SnitchCam · · Score: 1

    Taco's days of stealing gasoline are over.

  12. Spoiler alert on Human Gene Count Slashed · · Score: 4, Funny

    gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac

  13. Why the Times? on Firefox Seeks Full Page Ad in New York Times · · Score: 5, Insightful

    Why not USA TODAY? If the purpose of the ad is to spread awareness AND educate-USA today or the Wall Street Journal would be a better choice. Not to get into an argument about the political leanings of the paper, the Times readership tends to be more informed and better educated about this topic.

  14. Spoiler alert on Solar Minimum Coming Sooner Than Expected · · Score: 4, Funny

    Kaboom!

  15. Foreign website political ads on FEC May Regulate Online Political Activity · · Score: 1

    They'll just put ads on the BBC website and tell the FEC to stick it.

  16. Didn't Van Hollen put out an album called 1984? on Political Cybersquatting Or Free Speech? · · Score: 2, Funny

    I think it would be funnier if he linked to the Van Halen site.
    Maybe he's just a gigolo.

    I'm just a gigolo and everywhere I go
    People know the part I'm playin'
    Paid for every dance, sellin' each romance
    Ooh, what they're sayin?
    There will come a day, and youth will pass away
    What'll they say about me?
    When the end comes I know they'll say just a gigolo
    And life goes on without me

  17. Halo Haiku! on Halo 2 Goes Gold · · Score: 5, Funny

    Blue team has the flag.
    Where did that grenade come from?
    Red team-flag returned!

  18. Bad boys bad boys on Presidential Candidates Arrested at Debates · · Score: 0, Offtopic

    Whatcha gonna do?

  19. Obvious unsaid next steps on RFID Drivers' Licenses Debated · · Score: 1

    would be to use the RFID to store visa expiration dates as a part of the license.

    Sounds to me like the ACLU is trying to defend obstructing law enforcement's unobfuscated access to information that can be useful in determining who has obtained lawful entry/residence into the country.

  20. Halo Haiku! on Halo 2 Pre-Orders Reach 1 Million · · Score: 4, Funny

    Blue team has the flag.
    Where did that grenade come from?
    Red team-flag returned!

  21. Halo Haiku anyone? on Halo 2 Ready to Ship · · Score: 1

    Blue team has the flag.
    Where did that grenade come from?
    Red team-flag returned!

  22. Reporter, would you read the witness testimony? on Order in the e-Court! · · Score: 1

    Judge Ito: "Defense, you may cross-examine the witness."

    atty: "Denny Crane!"
    Witness: "What?"
    atty: "Denny Crane."
    Witness: "Did you ask me a question?"
    atty: "Denny Crane!"
    Witness: "What?"
    atty: "The defense rests...Denny Crane."

  23. They're just as bad as the CBO on US Candidates Ignore Looming Debt Crisis · · Score: 1

    They come out with numbers that cannot be relied upon.

    A few years ago, they said it would go broke in 2039. Now they say 2047. Next year it will be 2055. It's all based on bogus assumptions of low productivity growth and the senior citizen demographic being completely unwiling/unable to work into what are traditionally called the retirement years.

    And both parties use these bogus numbers to try to scare people.

  24. It's for when the Cubs win the world series. on Chicago Pondering Huge Camera Network · · Score: 1

    That way there will be a video record of the apocalypse.

  25. Re:Privacy in public on Chicago Pondering Huge Camera Network · · Score: 1
    "It means that next time there are protests at, say, a political convention in Chicago, they'll be able to track everyone down and arrest them. There will be chilling effects on our 1st amendment right to assemble."

    Bull--how did this get modded as insightful? It means that there will be 'chilling effects' (what a stupid phrase anyway--ooo, cold) on the lawless's imagined 1st amendment right to prevent/disrupt lawful assembly by those they disagree with.