Slashdot Mirror


User: ShadyG

ShadyG's activity in the archive.

Stories
0
Comments
170
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 170

  1. Re:Changing earth orbit on Going Up? · · Score: 1
    It's technically possible to affect the Earth's motion by making it woble, but it would require so much more mass than they're talking about that it is not worth mentioning. The moon has 1/6 the mass of the Earth, and its effect on our orbit is just sufficient to cause us to have tides. Depending on where the elevator was placed, it could augment or suppress the tides, but only if it was a significant fraction of the mass of the moon.

    -- ShadyG

  2. At Will Employment on Getting Fired For Not Taking A Promotion? · · Score: 1
    Most states -- including virtually all with decent high-tech industries -- support the concept of "at will" employment. That means you can quit for any or no reason, and the company can fire you for any or no reason (notwithstanding federal and state anti-discrimination laws). Notice is not required, nor is cause.

    In a few states -- such as Massachusetts IIRC -- cause is required or the employer faces a wrongful termination suit. But specifically California is wide open on this issue. You can be fired for wearing an earring to work (a la Disney), much less refusing to accept a promotion.

    -- ShadyG (NAL)

  3. Re:So now DVD is OK all of a sudden? on Princess Mononoke Released On DVD · · Score: 1
    But there are ways to enjoy entertainment without lining the pockets of those who would use such funds to diminish our rights. Sticking to your principles is admirable, but does not necessarily mean a total deprival of movies for the rest of your life.

    The way I see it, it's about money. If I keep my money from flowing the direction of the MPAA, I compromise nothing by watching a movie. I currently own about 40 DVDs. 25 or so I got used, and the rest are not affiliated with the MPAA. No evil money. I saw Princess Mononoke in the theatre, but I paid for a ticket to an independent film showing at the same multiplex. No evil money.

    It comes down to creativity, and an eye on the ball. The MPAA doesn't declare victory if you enjoy their movie. They claim victory when they capture revenue because of it.

    -- ShadyG

  4. Doesn't work with IntelliMouse on The Most Powerful Mouse in the World · · Score: 1
    Building here is only 3 stories. But just for the record, the IntelliMouse is not quite as durable.

    -- ShadyG

  5. Re:Deregulation on Power Shortages And Tech Industry · · Score: 1
    As for a socialist country not running out of power, are you serious? Just because you belong to a certain type of society doesn't mean that your country won't exceed it's power supply.

    Actually, in a way it does. A socialist country is economically protected from the kind of efficient, highly productive industrial capacity of a capitalist system. Without attempting to estimate the difference in power supply capacity, an economic system with a higher output will necessarily require higher inputs. The lack of productivity in a socialist system effectively limits its demand for power and other manufacturing resources.

    -- ShadyG

  6. Re:Bummed. Really, really bummed. on Adobe Discontinues FrameMaker for Linux · · Score: 1
    In a fluid market space, no such decision ought ever to be final.

    Yes, this is a grammar post, so feel free to moderate me down. I simply couldn't let the opportunity pass to commend alumshubby on his correct avoidance of a split infinitive, when such an error could so easily have been made.

    In a day when "loose" is inexplicably the present tense of "lost," it's worth a (Score:-1, Offtopic) to point out a good example of diligent adherence to correct English.

  7. CRT's? on Volcano Cowboys · · Score: 1
    Not every nerd career takes place entirely behind a flickering CRT.

    Some of us are quite happy with our LCD's, thank you very much.

  8. Re:Probe me... on Net Security With "NanoProbes" · · Score: 1
    You left out 'finger'.

    -- ShadyG

  9. It's their perogative on IOC Clamps Down on Athlete Web Diaries · · Score: 1
    As long as an athelete has voluntarily signed away his or her right to speak as a condition of participating, this is no different from a NDA between business partners. The IOC cannot prohibit those not involved with the organization from speaking about what they saw, but the athletes are kind of like employees. Just instead of being compensated with money, they get a chance to win medals and represent their country.

    On the other hand, we can bring into question why it has to be this way. Why should the IOC have the authority to go to such lengths to protect its revenue stream? Business -- even non-profit business -- is one thing, but the Olympics are ostensibly about a goodwill meeting of nations and peoples in peaceful competition. It's not about property rights and revenue streams. Should we hold it up to an ideal? Or is it more realistic to accept its status as an organization that needs money to fund the events, activities, and workers involved in putting the games together?

    -- ShadyG

  10. All a matter of classification on Open Publishing: The Net and the E-book · · Score: 5
    All this is about is an attempt to exploit the DMCA by disguising books as software. As long as the intellectual property is digitally protected, a lot of rights granted to book owners/readers do not extend to those who use e-books. It's basically a transition from an ownership-based model to a licence-based one.

    -- ShadyG

  11. Re:I feel your pain, but learn the language on Questioning The IT Labor Shortage · · Score: 1
    brokeninside said:

    To quote the Giant, 'you keep using that word, I don't think it means what you think it means.'

    Mandy Patinkin (Inigo Montoya) is hardly large enough to be considered a "giant."

    -- ShadyG

  12. Thank you Richard on Rich Stevens Article in Salon · · Score: 2

    I've never been part of the UNIX community. I just decided one day to learn C; helped debug a MUD, read some books. No classes, no mentors, not really any guidance or intention of taking it any further than a hobby. That was around my sophmore year of college.

    It was just last week I found out about Richard Stevens death and I could not believe how much I could feel for a man I had never met. It's been about a year now that I've been religiously stopping in every bookstore I pass to see if they yet have a copy of "UNIX Network Programming vol 3." My girlfriend asked me if there were other books that would cover the same subject matter. She didn't understand.

    So I'm on Amazon to see if it's planned to be published and read a review on vol 2 that mentions his passing. I was floored. Just as much as Steve McConnell's books helped me transition from a programmer to a software engineer and engineering manager, Richard Stevens is largely responsible for getting me here in the first place.

    I regret never being able to read volume 3. I regret all the learning that I and others will miss out on because the world is without him. Most of all I regret never thinking to send a simple email to thank him for what he has given us all.

    I did have a mentor, we just never met.

    Rest in peace, Richard.

    -- ShadyG

  13. Re:Interesting.. on Several Boycotts Of RIAA Organizing · · Score: 1
    Sure, I'll go to see X-Men. That doesn't mean I'm supporting the MPAA though. I intentionally choose theatres that show a mix of MPAA and independent films so that I can always purchase a ticket for an independent one. Once inside I see whatever movie I want, but my money never goes to the MPAA. I even got caught once and explained what I was doing. The theatre employee said it was a good idea and let me go in anyway.

    I encourage everyone to do the same. Only pay for independent films. Only purchase independent or used DVDs. It's not all that difficult to see what you want to see while still maintaining control over where your money goes.

  14. Price Discrimination on On the Time Preference for Information... · · Score: 1

    Discrimination based on time is essentially no different from any other form of price discrimination. By this, I mean that the ultimate goal of a supplier is to sell to each customer at the maximum value that customer is willing to pay for the product.

    In a one-price system, supply meets demand at an equilibrium point that describes an agreed fair price for the system as a whole. The graph looks somewhat like a big 'X' marking the spot. Charging less gets you more customers, but revenue is maximized by targeting that point. Now, there's a lot of empty space under that graph where the product could be sold for a different price. If you can get the people who are willing to pay more to do so, you get more revenue. If you can then charge less (down to production cost) to those who are under the price, they suddenly become customers.

    Anyway, a good example of this is movie tickets. They charge an adult rate that covers the highest-paying people. Then they give discounts for those they can determine are not willing to pay as much -- elderly, students, early birds, large groups, etc. By this practice, and in the future by determining a finer pattern by which to discriminate, they maximize revenue for a product that essentially has fixed production (operating) costs.

    Now we turn our attention to the topic at hand, that being temporal discrimination. Everything of utility is more valuable now than it is in the future. This is the essense behind interest. A dollar now is worth more than the same dollar later. And it's not because of inflation or exchange rates or any of the other red herrings we have thrown at us. It's simply a natural preference related to the excercise of choice. As long as we hold on to that dollar, we may change our minds about what to do with it. It may become valuable in a way we don't see at the present.

    Going back to movies, an efficient way for a theatre to take advantage of temporal price discrimination would be to charge a lot for a movie on opening weekend, then allow the price to decrease until the film is finally dropped from the theatre. All the while, the price would be set such that the theatre continues to be filled and thus revenues are maximized.

    So what does this have to do with a debate about being allowed to continue to use music in the future? It is simply that there is nothing special about this particular brand of price discrimination. If the People decide that the practice is evil and un-American, it can be prohibited. If we decide that each customer should be allowed the liberty of deciding for himself what he will or will not pay, then so be it.

    The point is that this should be done across the board, not cherry picked by industry based on what the hot topic for the day is.

  15. Re:GAMES! on How Is Wine Doing These Days? · · Score: 2
    If you've already got Windows installed to run Office, why would you boot up under Linux to play the games in WINE that you could otherwise run under Windows?

    Office support in WINE is much more important than game support because Office is much less likely ever to be ported. Games are being ported to Linux all over the place. But for Microsoft it simply is not strategic to port Office while their application and OS interests are interdependent.

    Additionally, Office is used to access and create content that is often used in other places. So for a Linux user, switching to Windows for Office is much more of a hassle than switching for games becuase of the need for interoperability between apps.

    OT: It occurrs to me that Microsoft could harm Linux development by releasing their own distribution. They'd grab a large market share immediately because of their name, and then how many developers would balk at writing free code for MS to make money off of?

    -- ShadyG

  16. Re:What exactly this Human Genome is at this point on Human Genome Project Believed Complete · · Score: 1

    Oh my God. Are you sure that was CTAATTTGCCCACTTTTCTTGAACTTCACATCA? Not CTAATTTGCCCACTTATCTTGAACTTCACATCA? On chromosome 22? Holy shit. No wonder...

  17. Count the freckles? on Taking On A Spammer · · Score: 1

    I only see one. Hugely disappointing. I was hoping for a challenge.

  18. Usefulness on Electric Plug 14Mbps Spec Agreed On · · Score: 1

    The first thing I did was try to compare the value of a system based on electric wiring over Ethernet. I can immediately see two advantages; the network cables are already there, and any number of nodes could exist without the added complexity of hubs and switches.

    Now of course immediately, the usefulness in networking is with computing devices, most of which are pre-equipped with Ethernet capability, and most of those at 100bT. But perhaps the real future here is in other kinds of networked devices. As it becomes more feasible to network your coffee maker, lights, microwave, alarm clock, and other household appliances, I can definitely see the value in using existing network architecture rather than installing a whole new one.

    The one technology I see as the killer here is wireless communications. If we're talking intra-unit communications, the advantage easily shifts toward 11mbps IEEE 802.11b. Yes, it's slower. I'm getting a good deal less than 11mbps (more like 2), but it works. It's shipping; it's here. And I predict that by the time we see a working system based on this new technology the bugs will be worked out in the wireless sector. That would effectively make the power-line-based system obsolete before it's even a reality.

    All we need is bandwidth comparable to today's Ethernet (100bT, not necessarily Gbit) and a range increase on an order of about 2-3x (can almost get this now with an external antenna). I could easily see running an entire household worth of appliances off of such a network, and possibly hook a few personal computers in as well.

  19. Destruction vs. Re-invention on Taking Games Seriously · · Score: 2

    There are always those who decry any evolution of a given culture as equivalent to destroying it. Likewise -- as in this case -- any new culture to emerge is often viewed as having the effect of marginalizing current cultures. The reality is that new cultures emerge, others fall by the wayside, and still others evolve to reflect changes in the views of their members.

    One of the earlier examples of this would be the spread of music outside of the church. This was resisted vigorously from the idea of anything other than monophonic unison chanting through harmony, polyphony, accompaniment, etc. Especially interesting is that before that time, relatively complex quasi-orchestral music had been the norm before culture altered its course toward the "music is religious" idea.

    Follow the pattern through radio destroying books, movies destroying radio. Television destroying a culture of children going outside to play. At the end of the day, all we have is a richer society with more options for entertainment, more lifestyle choices, and more culture than at any other time in history. And the pattern shows no signs of letting up.

    When the next shift in culture appears, will those who are comfortable with this one cry out, "You're destroying our culture! What will happen to the Internet?"

  20. Re:growing or shrinking? on Black Holes' Growth Measured · · Score: 2

    I thought that the reason light couldn't escape the black hole's grasp was because the mass of the black hole had stretched the local space/time curvature so much, that the light was essentially going around in circles inside the black hole's event horizon, not that the gravity of the black hole was directly "attracting" the photons.

    Light can orbit a black hole at the event horizon because at that radius the attraction from the black hole is exactly enough to keep a particle in orbit at the speed of light. It is no different than the much less massive Earth's gravity keeping a satellite in orbit at a much lower speed. Light inside the event horizon however does not stay in orbit, and cannot escape as the gravitational force at that distance requires an escape velocity greater than the speed of light.

    Then again, perhaps matter inside the event horizon does orbit something. The point is we cannot detect that due to the aforementioned escape velocity. Einstein postulated that information itself can travel no faster than the speed of light, so if the evidence of an orbit cannot escape, it can be argued not to exist.