Americans used to do it this way too. The link is to a free download page for a 1944 movie, "A Tuesday In November", described as follows:
Idealized portrayal of 1944 U.S. presidential election, made to show the world that the United States was sufficiently secure to hold a free and fair election during wartime. Shows campaign activities, efforts to ensure the secrecy of the ballot and fairness of the election, and media coverage of the electoral process, all culminating in a giant nighttime gathering in Times Square where a huge crowd awaits the result. Director: John Houseman. Assistant Director: Nicholas Ray. Animation: John Hubley. Music: Virgil Thomson.
Entertaining, if not essential, viewing for anyone interested in e-voting today.
You couldn't really make a cloaking device. Such a device could only cloak itself from one viewer per non-overlapping view at a time. Even then, the computational requirements would be enormous. It would need to calculate what the viewer expects to see by tracing lines from the viewer's eyes through the car to the objects obscured by the car, and compensate for the shading caused by the car, while tracking and updating the viewer's eye positions, etc. It would also need to have some stereo effect to project a different image to each of the viewer's eyes.
Of course, that's if you want industrial-strength true invisibility cloaking. Camouflage would be much easier. It would be like an S.E.P. field..
It seems that Nature is really into guinea-pigs!
This is a better writeup than the New York Times article, by the way. Although it does refer to them as rodents.
While I'm whoring, this page ought to settle some of the phylogenetic fracas here.
Except that 364.25 * the earth's circumference (c. 40,000km) is about 14.5 million kilometers, and the space elevator is not that long. The article says the elevator would be 100,000km long; so that's only enough to wrap itself 2.5 times around the earth. Now, you may resume asking people how long that would take.:)
The linked story doesn't make it clear at all..but the article in Nature does:
(from figure 1 legend):
"Short RNAi fragments (RNAi-S) were constructed using 139-base-pair (bp; corresponding to nucleotide positions 1,139â"1,277) and 161-bp (positions 1,117â"1,277) sequences of CaMXMT1 (GenBank accession number AB048794), with an intervening 517-bp b-glucuronidase ( GUS) fragment as spacer; long RNAi fragments (RNAi-L) contained two identical sequences of 332 bp (positions 946â"1,277) separated by a 517-bp GUSfragment. The resulting constructs were inserted into a pBIH1-IG vector7; the control construct contained a green fluorescent protein gene ( GFP)."
then the vector was put into Agrobacterium, which infects plant cells, putting a piece of its own DNA into the plant's chromosome. This piece of DNA usually contains virulence genes, but you can replace those with any gene you want. Actually, the letter in Nature is very short on details, but leaves no question that these plants are, in fact, transgenic:
"More than 35 transgenic somatic seedlings were obtained from each transformant, each containing short or long RNAi fragments or a control gene encoding green fluorescent protein (GFP)."
Also, they didn't transform the normal coffee plant (Coffea arabica), but a close relative (C. canephora)..but they're working on the real thing now.
>Researchers from Wisconsin-Madison University and NASA's Jet Propulsion Laboratory found that Neptune's southern cloud bands have been getting steadily wider and brighter over the past six years.
I take this to mean that it's only beginning summer in the southern hemisphere. Make sure to take this into account when you're selecting your vacation package.
The reason the coat colors are different, and the scientists expected them to be different, is that some genes controlling coat color are on the X chromosome. Females have two X chromosomes, and males have only one; to balance the expression of genes, female mammals inactivate one of their two X chromosomes. The inactivation occurs randomly (more or less) after the egg has divided several times, so the resulting animal is made up of a mosaic of cell patches, which gives rise to the mosaic coat color. The random nature of X chromosome inactivation is just one of many epigenetic factors controlling development. So no one expected the coat patterns to be the same, even though the genes are identical. Yeah, this is probably redundant, I'm probably not the only one who felt like weighing in.
I think the giant squid would have something to say about that. =)
Hmm. I think all I can say about this story is, animal planet made an entertaining but uninformative tv show, and if you want to know more about evolution, read some Dawkins.
Yes, that's exactly right. That was my hunch on reading the headline and the new scientist article, and here in their actual article are two sentences that 'deal' with this:
"In principle, one can argue that an author might copy a citation from an unreliable reference list, but still read the paper. A modest reflection would convince one that this is relatively rare, and cannot apply to the majority."
Hmmm. A less modest reflection might convince one that their analysis shows precisely that it does apply to the majority..because people have been copying and pasting for decades, and that has nothing to do with what has been read or not.
Re:More ambitious multiverses
on
One of Many
·
· Score: 1
I suspect they're onto something too.. I like the idea that other universes aren't "over there" in the sense that you could travel from our universe to another one, but they're just in a different part of parameter space. The link to uncertainty is also fascinating to think about..i.e., when you see the outcome of a quantum experiment, maybe you don't collapse a wave function, or cause the universe to split, but merely find out which universe/program you're in.
I'll go ahead and link to the mailing list (the "everything list") where these guys occasionally post.. there are lots of interesting discussions. The archive is here.
> we need a moderation that roughly sums up this: "these exact arguements, and the common rebuttals of them, have been posted on slashdot a million times before, and the discussions that inevitably come from them are both predictable and pointless."
Yes, but this is what memes do.. they replicate. Slashdot and its ilk are fertile grounds for the creation/evolution flamewar meme.
Haven't you ever wondered -- no matter which side you're on, or if you're on a side at all -- about the meta-question, of why people bother engaging in these arguments? (Yes, I know.. this post is a common meme too.)
To veer back on topic, I'll say this: when will the distributed computing version of this get built? I'd rather participate in the search for artificial intelligence @ home, than extraterrestrial. No, I can't built it myself.
had to be followed by a list (or lI, if you wanted to save a keystroke..) to actually display the files -- because it put the list of files into memory as a fake basic program! woe to you if you want to see the directory before you save your basic program...
and remember hitting shift-run/stop after the ",8,1" part to automatically run what was loaded?
Human chess grandmasters don't run massive simultaneous mega power number crunching sequences to figure out how to win, they use a combination of strategy and intuition.
Ah.. but how do you know that what grandmasters call "intuition" isn't in fact a massively parallel tree search going on in the brain? After all, intuition isn't "magic".. one way or another the information of the chess position is processed and a great move gets made. Then when you ask the person how they thought of it, they may reply that it was intuition -- but doesn't this just mean that they don't really know?
In other words -- the parts of their brain that are responsible for giving verbal reports on what it was like to think of the move may not have enough access to the parts of their brain that came up with the move; so the verbal report subroutine just does the best it can.
I'm not claiming that human players do use the same kind of brute force that chess computers do; just that they may be doing so (because the brain is, manifestly, a massively parallel computer) and we can't take players' verbal reports to the contrary as evidence that they are not doing so. Granted, strategy (as opposed to "intuition") constrains the search space to a great degree and you must learn the principles of chess strategy (as opposed to just the goal of the game and how the pieces move) to get anywhere. But what separates the grandmasters from the mere masters, I am claiming, may in fact be the brain's skill at brute-force parallel searching.
Not only did I notice that, I also noticed that they give no source for the "love experiment".. if you're going to fearmonger, at least you should give sources and details (how many women, what percentage of them fell in love, what was the gender of the experimenters, did the control group also fall in love)..
Why do these articles always miss the point that there already exist very effective, time-honored ways to control other people's minds and behavior - violence, FUD, propaganda.. ah well, other people will post the same thing. Ready to be modded redundant.
I wonder though; the latency of communication between the extreme ends of the colony must be so high that it's a stretch to say that they're cooperating.. do the actions of an ant at the extreme west edge affect anything that happens at the extreme east edge in an informationally sensitive way? If not, then while they may be a "supercolony" in that even members of the extremes will tolerate each other if artificially brought into proximity, it's harder to argue that they're cooperatively working together in the way a single ant nest does. But that would depend on the details of the forthcoming article..for instance, if the shape of the supercolony maximizes the "elimination of 90 percent of the other types of ants" that normally live nearby, that might be a qualitatively different behavior from a conventional ant colony that could be interpreted as intelligent.
But this is scary...while reading the article, I looked up from my monitor, and saw..an ant crawling up the wall! And I've never seen one here before!
The cumulative product of (1-x) for all the collision probabilities listed is.99679; we have a 0.32% chance (1 in 311) of getting hit by one of these objects in the next 100 years, if I did it right. So 1950DA doubles our chance? Neat.
You're exactly right. Viruses can infect organisms because they've been evolving in lockstep with them for millions of years, in an evolutionary arms race. This is why humans, but not, say, sunflowers, get herpes. But sunflowers are much more closely related to humans than anything on Europa would be. So if people are worried about our infecting Europans with terrestrial viruses, they should be even more worried that their flowers will catch colds from them. Terrestrial free-living organisms (bacteria/archaea) might be another matter, though - they might find Europans very tasty, if they can survive the conditions there.
One of the key characteristics of life as we know it is chirality [chiral.com], which is...(snip)
I don't understand this at all..
First of all, it's very hard for a molecule beyond a certain size to not be chiral - if you have an atom coordinated to 4 different groups, that's all you need. And although organisms are full of chiral molecules, that doesn't mean that chirality is somehow a "key characteristic of life" - it's just a trivial consequence of the fact that you need big, complicated molecules to build robustly self-reproducing objects.
Carbon-based organic molecules have this property but phosphorus-nitrogen ones do not.
But the polyphosphazene polymers you provide a link to could easily be chiral, if the R groups are different! Chirality suggests that organic molecules might need to embody certain mathematical characteristics that are fundamental to life. What we would need, therefore, is a mathematical definition of life.
But why do we need a mathematical definition of life, or indeed any definition of life at all? It's not as if, should we find something on Mars that reproduced and grew, and had a sophisticated metabolism to extract energy, but didn't fit some dimly imagined 'mathematical definition', we would shrug our shoulders and say, "Well, that's quaint, but it isn't life, you know.. let's ignore it.". The word "life" is like the word "game" - it's a word we have no problem using in daily life, but coming up with a precise definition is both pointless and impossible.
>The interesting thing will be whether they are a different evolutionary track, the origin of the evolutionary track we're on, or a different branch of the evolutionary track.
They (if by they you refer to the crabs, mussels, and worms) are merely species of crabs, mussels, and worms that at some time in the past became adapted to living in a different environment. They're no different in this respect from any other species.
The article was a little unclear:
;"Now that we have them here, we are studying their rate of primary production (the rate of
;carbon fixation) in that environment, where there is no sunlight and they survive by
;chemosynthesis," Childress told NewsFactor."
Actually the crabs, mussels, and worms do not directly get their energy from the hydrogen sulfide. That's the job of chemoautotrophic bacteria, who are the real freaks. These bacteria use the H2S as their energy source (this is where the 'primary production' happens); they are in turn the base of the 'food chain' in the vent communities. See a NASA page or a page from U of Georgia for more.
Here's a link to check whatever protein sequence you want against the human genome. Make sure to select "blastp" (for protein sequences) in the pulldown menu. Use the alphabet provided above.. it will find near matches too. Enjoy..
Interestingly, this is an argument against the existence of other advanced technological civilizations in our galaxy.. it would take on the order of hundreds of thousands of years for a rapidly expanding population to colonize the whole galaxy, right? And our galaxy is billions of years old. If this sort of thing was a likely outcome for a civilization that attained space travel, the odds are overwhelming that had any such civilizations existed, they would be here now instead of us. I don't know, maybe after hundreds of millenia of not having to fight tooth and claw for survival, these types of urges get lost from the genetic makeup.
Americans used to do it this way too. The link is to a free download page for a 1944 movie, "A Tuesday In November", described as follows:
Idealized portrayal of 1944 U.S. presidential election, made to show the world that the United States was sufficiently secure to hold a free and fair election during wartime. Shows campaign activities, efforts to ensure the secrecy of the ballot and fairness of the election, and media coverage of the electoral process, all culminating in a giant nighttime gathering in Times Square where a huge crowd awaits the result. Director: John Houseman. Assistant Director: Nicholas Ray. Animation: John Hubley. Music: Virgil Thomson.
Entertaining, if not essential, viewing for anyone interested in e-voting today.
Yeah, I know you all see it too, but the judge's initials are YHBT..=)
HAND.
It looks like how people are downloading the videos is more fun to talk about than the videos themselves!
You couldn't really make a cloaking device. Such a device could only cloak itself from one viewer per non-overlapping view at a time. Even then, the computational requirements would be enormous. It would need to calculate what the viewer expects to see by tracing lines from the viewer's eyes through the car to the objects obscured by the car, and compensate for the shading caused by the car, while tracking and updating the viewer's eye positions, etc. It would also need to have some stereo effect to project a different image to each of the viewer's eyes.
Of course, that's if you want industrial-strength true invisibility cloaking. Camouflage would be much easier. It would be like an S.E.P. field..
Is the guinea-pig a rodent?
No, the guinea-pig is not a rodent.
It seems that Nature is really into guinea-pigs!
This is a better writeup than the New York Times article, by the way. Although it does refer to them as rodents.
While I'm whoring, this page ought to settle some of the phylogenetic fracas here.
Except that 364.25 * the earth's circumference (c. 40,000km) is about 14.5 million kilometers, and the space elevator is not that long. The article says the elevator would be 100,000km long; so that's only enough to wrap itself 2.5 times around the earth. Now, you may resume asking people how long that would take. :)
The linked story doesn't make it clear at all..but the article in Nature does:
(from figure 1 legend):
"Short RNAi fragments (RNAi-S) were constructed using 139-base-pair (bp; corresponding
to nucleotide positions 1,139â"1,277) and 161-bp (positions
1,117â"1,277) sequences of CaMXMT1 (GenBank accession number
AB048794), with an intervening 517-bp b-glucuronidase ( GUS)
fragment as spacer; long RNAi fragments (RNAi-L) contained two
identical sequences of 332 bp (positions 946â"1,277) separated by a
517-bp GUSfragment. The resulting constructs were inserted into a
pBIH1-IG vector7; the control construct contained a green fluorescent
protein gene ( GFP)."
then the vector was put into Agrobacterium, which infects plant cells, putting a piece of its own DNA into the plant's chromosome. This piece of DNA usually contains virulence genes, but you can replace those with any gene you want. Actually, the letter in Nature is very short on details, but leaves no question that these plants are, in fact, transgenic:
"More than 35 transgenic somatic seedlings
were obtained from each transformant,
each containing short or long RNAi
fragments or a control gene encoding green
fluorescent protein (GFP)."
Also, they didn't transform the normal coffee plant (Coffea arabica), but a close relative (C. canephora)..but they're working on the real thing now.
>Researchers from Wisconsin-Madison University and NASA's Jet Propulsion Laboratory found that Neptune's southern cloud bands have been getting steadily wider and brighter over the past six years.
I take this to mean that it's only beginning summer in the southern hemisphere. Make sure to take this into account when you're selecting your vacation package.
Hmm. Slow news day, I guess.
The reason the coat colors are different, and the scientists expected them to be different, is that some genes controlling coat color are on the X chromosome. Females have two X chromosomes, and males have only one; to balance the expression of genes, female mammals inactivate one of their two X chromosomes. The inactivation occurs randomly (more or less) after the egg has divided several times, so the resulting animal is made up of a mosaic of cell patches, which gives rise to the mosaic coat color. The random nature of X chromosome inactivation is just one of many epigenetic factors controlling development. So no one expected the coat patterns to be the same, even though the genes are identical.
Yeah, this is probably redundant, I'm probably not the only one who felt like weighing in.
I think the giant squid would have something to say about that. =)
Hmm. I think all I can say about this story is, animal planet made an entertaining but uninformative tv show, and if you want to know more about evolution, read some Dawkins.
Hmmm. A less modest reflection might convince one that their analysis shows precisely that it does apply to the majority..because people have been copying and pasting for decades, and that has nothing to do with what has been read or not.
catgaacttcttcaatggcaacgtcttgattaa
I suspect they're onto something too.. I like the idea that other universes aren't "over there" in the sense that you could travel from our universe to another one, but they're just in a different part of parameter space. The link to uncertainty is also fascinating to think about..i.e., when you see the outcome of a quantum experiment, maybe you don't collapse a wave function, or cause the universe to split, but merely find out which universe/program you're in.
I'll go ahead and link to the mailing list (the "everything list") where these guys occasionally post.. there are lots of interesting discussions. The archive is here.
> we need a moderation that roughly sums up this: "these exact arguements, and the common rebuttals of them, have been posted on slashdot a million times before, and the discussions that inevitably come from them are both predictable and pointless."
Yes, but this is what memes do.. they replicate.
Slashdot and its ilk are fertile grounds for the creation/evolution flamewar meme.
Haven't you ever wondered -- no matter which side you're on, or if you're on a side at all -- about the meta-question, of why people bother engaging in these arguments?
(Yes, I know.. this post is a common meme too.)
To veer back on topic, I'll say this: when will the distributed computing version of this get built? I'd rather participate in the search for artificial intelligence @ home, than extraterrestrial.
No, I can't built it myself.
load "$",8
had to be followed by a list (or lI, if you wanted to save a keystroke..) to actually display the files -- because it put the list of files into memory as a fake basic program! woe to you if you want to see the directory before you save your basic program...
and remember hitting shift-run/stop after the ",8,1" part to automatically run what was loaded?
Human chess grandmasters don't run massive simultaneous mega power number crunching sequences to figure out how to win, they use a combination of strategy and intuition.
Ah.. but how do you know that what grandmasters call "intuition" isn't in fact a massively parallel tree search going on in the brain? After all, intuition isn't "magic".. one way or another the information of the chess position is processed and a great move gets made. Then when you ask the person how they thought of it, they may reply that it was intuition -- but doesn't this just mean that they don't really know?
In other words -- the parts of their brain that are responsible for giving verbal reports on what it was like to think of the move may not have enough access to the parts of their brain that came up with the move; so the verbal report subroutine just does the best it can.
I'm not claiming that human players do use the same kind of brute force that chess computers do; just that they may be doing so (because the brain is, manifestly, a massively parallel computer) and we can't take players' verbal reports to the contrary as evidence that they are not doing so. Granted, strategy (as opposed to "intuition") constrains the search space to a great degree and you must learn the principles of chess strategy (as opposed to just the goal of the game and how the pieces move) to get anywhere. But what separates the grandmasters from the mere masters, I am claiming, may in fact be the brain's skill at brute-force parallel searching.
Not only did I notice that, I also noticed that they give no source for the "love experiment"..
if you're going to fearmonger, at least you should give sources and details (how many women, what percentage of them fell in love, what was the gender of the experimenters, did the control group also fall in love)..
Why do these articles always miss the point that there already exist very effective, time-honored ways to control other people's minds and behavior - violence, FUD, propaganda..
ah well, other people will post the same thing. Ready to be modded redundant.
I wonder though; the latency of communication between the extreme ends of the colony must be so high that it's a stretch to say that they're cooperating.. do the actions of an ant at the extreme west edge affect anything that happens at the extreme east edge in an informationally sensitive way? If not, then while they may be a "supercolony" in that even members of the extremes will tolerate each other if artificially brought into proximity, it's harder to argue that they're cooperatively working together in the way a single ant nest does. But that would depend on the details of the forthcoming article..for instance, if the shape of the supercolony maximizes the "elimination of 90 percent of the other types of ants" that normally live nearby, that might be a qualitatively different behavior from a conventional ant colony that could be interpreted as intelligent.
But this is scary...while reading the article, I looked up from my monitor, and saw..an ant crawling up the wall! And I've never seen one here before!
The cumulative product of (1-x) for all the collision probabilities listed is .99679; we have a 0.32% chance (1 in 311) of getting hit by one of these objects in the next 100 years, if I did it right.
So 1950DA doubles our chance? Neat.
You're exactly right. Viruses can infect organisms because they've been evolving in lockstep with them for millions of years, in an evolutionary arms race. This is why humans, but not, say, sunflowers, get herpes. But sunflowers are much more closely related to humans than anything on Europa would be. So if people are worried about our infecting Europans with terrestrial viruses, they should be even more worried that their flowers will catch colds from them.
Terrestrial free-living organisms (bacteria/archaea) might be another matter, though - they might find Europans very tasty, if they can survive the conditions there.
One of the key characteristics of life as we know it is chirality [chiral.com], which is...(snip)
I don't understand this at all..
First of all, it's very hard for a molecule beyond a certain size to not be chiral - if you have an atom coordinated to 4 different groups, that's all you need.
And although organisms are full of chiral molecules, that doesn't mean that chirality is somehow a "key characteristic of life" - it's just a trivial consequence of the fact that you need big, complicated molecules to build robustly self-reproducing objects.
Carbon-based organic molecules have this property but phosphorus-nitrogen ones do not.
But the polyphosphazene polymers you provide a link to could easily be chiral, if the R groups are different!
Chirality suggests that organic molecules might need to embody certain mathematical characteristics that are fundamental to life. What we would need, therefore, is a mathematical definition of life.
But why do we need a mathematical definition of life, or indeed any definition of life at all? It's not as if, should we find something on Mars that reproduced and grew, and had a sophisticated metabolism to extract energy, but didn't fit some dimly imagined 'mathematical definition', we would shrug our shoulders and say, "Well, that's quaint, but it isn't life, you know.. let's ignore it.". The word "life" is like the word "game" - it's a word we have no problem using in daily life, but coming up with a precise definition is both pointless and impossible.
>The interesting thing will be whether they are a different evolutionary track, the origin of the evolutionary track we're on, or a different branch of the evolutionary track.
They (if by they you refer to the crabs, mussels, and worms) are merely species of crabs, mussels, and worms that at some time in the past became adapted to living in a different environment. They're no different in this respect from any other species.
The article was a little unclear:
;"Now that we have them here, we are studying their rate of primary production (the rate of
;carbon fixation) in that environment, where there is no sunlight and they survive by
;chemosynthesis," Childress told NewsFactor."
Actually the crabs, mussels, and worms do not directly get their energy from the hydrogen sulfide. That's the job of chemoautotrophic bacteria, who are the real freaks. These bacteria use the H2S as their energy source (this is where the 'primary production' happens); they are in turn the base of the 'food chain' in the vent communities. See a NASA page or a page from U of Georgia for more.
Here's a link to check whatever protein sequence you want against the human genome. Make sure to select "blastp" (for protein sequences) in the pulldown menu. Use the alphabet provided above.. it will find near matches too. Enjoy..
Interestingly, this is an argument against the existence of other advanced technological civilizations in our galaxy.. it would take on the order of hundreds of thousands of years for a rapidly expanding population to colonize the whole galaxy, right? And our galaxy is billions of years old. If this sort of thing was a likely outcome for a civilization that attained space travel, the odds are overwhelming that had any such civilizations existed, they would be here now instead of us. I don't know, maybe after hundreds of millenia of not having to fight tooth and claw for survival, these types of urges get lost from the genetic makeup.