Slashdot Mirror


User: ggvaidya

ggvaidya's activity in the archive.

Stories
0
Comments
904
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 904

  1. Re:computers not intelligent on MIT Looks to Give Group Think a Good Name · · Score: 1

    Lemmings don't actually jump off cliffs. I wish I had time for a longer response/discussion, but I'm dead sleepy =P. Sorry.

  2. Re:"Given enough eyeballs... on Google Unveils Code Search · · Score: 2, Interesting

    Some of those are a hack around the VC 6 "for loop doesn't scope as per ANSI" bug. This forum post explains when its used.

  3. Fourthed! on SAT Advice for a Foreign Student? · · Score: 1

    I ended up taking the SATs because a friend talked me into it (he was very enthusiastic about getting into an American college, me not so much). The *only* really prepping I did was reading through the SAT book a week or two before the test, and doing a few example tests from the back. I can't stress enough how much the book helped "up" my score. My favourite part was figuring out which one or two of the answer were impossible (for instance, in "difficult" questions, there was almost guaranteed to be one answer which was simple, obvious and wrong). Once you'd eliminated those, you're odds of getting the right answer, even through random chance, was already higher than your coexaminees, which is all you really need.

    Of course, this was the pre-2004 SATs, so your mileage may vary.

  4. Re:Most bots are not resource hogs on Botnet Business Model Comes to Life · · Score: 1

    Up to you :).

  5. Re:Most bots are not resource hogs on Botnet Business Model Comes to Life · · Score: 1

    I like the way you said that :). Mind if I quote you?

  6. Okay ... on Global Text Project – Wiki Textbooks · · Score: 2, Funny

    I can't tell if you're an elephant enthusiast, or if you're making a very subtle reference to the story of the blind men and the elephant ...

    Ah, the joys of making random inferences late at night ... !

  7. Re:Screw corporate Email. on When Can I Expect an Email Response? · · Score: 1

    All the best.

  8. Re:Proof on Star Trek PhD Thesis Wins Academic Prize · · Score: 1

    This just proves that PhD stands for "piled higher and deeper."

    Nonsense! Everybody knows it stands for "Permanent Head Damage" =)

  9. Re:revolution indeed on Hardware Headaches Inevitable? · · Score: 1

    Sounds like the Wheel of Reincarnation is spinning again. Not that that's a bad thing ...

  10. Re:TNG on Star Trek... Inspirational Posters? · · Score: 1

    There's a motivation-poster-maker amongst Fd's Flickr Tools. Is that what you're looking for?

  11. Re:candlemaker? on Lotus 'Agenda' Returns as Open-Source 'Chandler' · · Score: 1

    When I hear "chandler", I think of specialised retail dealers, like ship chandlers, who'd specialise in supplies needed by ships while docked at a port.

    Something more to think about ...

  12. Re:pffft ... on Knock Some Commands Into Your Laptop · · Score: 1

    *Enable*?! You'd need to *disable* the self destruct which kills Toshiba laptops just after warranty expires.

    (FIRMLY tongue-in-cheek: my faith is Tosh laptops was shattered after a friend's collapsed - and I mean *collapsed*, the keyboard and display failed within a week of each other, and all of it months after the warranty had expired. My faith is currently being restored by my laptop, which - apart from a somewhat dodgy cpu fan - has been running problem free for almost four years)

  13. Re:slashback, pathetisad, friday on Slashback: SGI, Exploding Dell, Gizmo · · Score: 3, Funny

    Actually, it's Saturday morning here already ... and I try to be as unproductive as possible on Saturday mornings. Hence this post :).

  14. Re:London, Madrid or New York on Mumbai Bombings Give Outsourcing Community Pause · · Score: 1

    To begin with, please don't bandy words like genocide about; they've been created for very specific reasons. NONE of the three attacks you cite (or the Mumbai blasts) are systematic attempts at destroying a race (genocide). They are systematic attempts at terrorising a population. Nobody was trying to kill the Hindus or the Muslims or the Christians -- they were attacks on the people of America, the UK, Spain and India. In 1993, Rwandan militants began systematically annhilating members of a minority race; in 1945, Nazi supporters began systematically killing every Jewish person in Europe. That is not what is happening here. What is being destroyed is not a race, or even a people, but the feeling of security, and it's insulting to compare an attack against people who were unlucky enough to be on the wrong train at the wrong time (or in the wrong building) to the annihilation of a people because of belief, race, citizenship or skin color.



    My main issue with your post, however, is the simplistic, self-serving and condescending attitude you show. Subhumans? Monsters? Who the hell do you think you're talking about, buddy, lions and tigers? You're talking about human beings, believe it or not, real living flesh-and-blood people who live and breathe and fuck and die just like you do. Human beings who happen not to live in your country, and who will not be treated as subhuman because of where they're born. Some of these humans believe that it is in their best interest that outrages like the Mumbai blasts occur. I think killing innocents is about the most damnably evil think you can do, but that's just my opinion, and it's just one in a million. In a billion. They think differently, and in a free country, they have a right to think it, and to talk about it, and whatever else they want to do, just as long as it doesn't adversely affect anybody else. We are NOT going to rein in every single person who believes in violence unless a crime has been committed. Something about not being guilty before being proven so comes to mind.




    Also: I'm also not sure exactly how you're holding me responsible for murders carried out by people who are very likely my countrymen (or atleast that's how I read "responsibility of the good, law-abiding, and civilized peoples from the disfuctional lands"); I'm don't think it would be fair to hold you responsible for Abu Gharib, or Vietnam, or slavery. Societies will always try to "isolate and neutralize the monsters who live in [them]", but we will not "isolate and neutralize" somebody with extreme beliefs or philosophies. We'll arrest them when we can prove they committed a crime in a court of law. Otherwise, they have the exact same rights to say, think and believe what they want as I do.




    We've got a lot of faults, I know, but we're NOT subhuman or monsters, and it's insulting to suggest we are. About the only thing you got right in your post was that we're from distant lands.

  15. This is a (nazi) troll on Indian Satellite Lost in Launch Explosion · · Score: 1

    Err ... rockets are hard. Rocketry is hard.

    Just sayin' :p.

  16. Re:Christians claim to be children of Abraham? on The Shallow Roots of the Human Family Tree · · Score: 1

    Brilliant! Mind if I quote you on that?

  17. Re:Specifically on Google Earth v4 Released - Linux Support at Last · · Score: 2, Insightful

    *Cough*

    It's a bit slow (because my poor lappie has no graphics acceleration to speak off), but between it and Flickr, I'm all set.

  18. There's gonna be a lot of posts like this, but: on Duke Nukem Forever Due This Year? · · Score: 1

    I gotta say it: you nailed it. Funniest DNF joke (I've seen yet). Are you going to go on?

    Wish I had mod points for this thread ...

  19. Re:Where to start on Starting an Education in IT? · · Score: 1

    Well said!

  20. Yes, but ... on Dan Geer's Monoculture Bomb Goes Off · · Score: 1

    ... can it evolve Linux?

    (Sorry, couldn't resist :P)

  21. Somebody tagged 'ed'?! on What Should One Know to be Truly Computer Literate? · · Score: 1

    Now that's just CRUEL! :p

  22. Re:Because it evolved on Human Genome Sequencing Completed · · Score: 1

    *stands up and applauds*

  23. Re:Part of the sequence: on Human Genome Sequencing Completed · · Score: 1

    Why do you think I used the 'AAAAAATTT' trigraph? :p

  24. Re:Part of the sequence: on Human Genome Sequencing Completed · · Score: 4, Funny

    ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique "arthropod" module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT

  25. Re:First Recipie on Bio-Engineered Rice Uses Human Genes · · Score: 1

    Haha! Haven't heard that one before! Hope the mods find you :)