If it's all marketing then why does Apple have the highest consumer satisfaction rates in the entire industry?
If their products were crap, or even equivalent, consumers would not speak so highly of them, for so long after their purchases.
So you would think. But, a couple things play against that.
1. Customers *expect* that an Apple will be a different experience than, say, a Windows machine. As a result, they're expectations are already geared towards, "This is going to be a good experience." As a result, they are more likely to have a good experience.
2. Face it - Apple products are expensive. Another psychological response that people have is that once they invest into something, they are more likely to stick with that something (and argue for that something) no matter how bad it is. So, it may be that someone spends $2000 on a new Mac, they have high expectations, they take it home and don't really like using it. However, they can't admit that because that means they made a bad decision. Hence...Macs are always awesome.
I know it sounds stupid. I thought so too until I read through the studies and performed some of my own in my work.
Never underestimate the power of someone to convince themselves of something if they don't want to be wrong or stupid.
If I follow the judge's logic, then anybody looking at me on the street has created an unauthorized copy of me on their retina. They even have the gall to create additional unauthorized copies in other brain areas.
Well, if you look anything like the typical Slashdotter, trust me, nobody is making unauthorized copies of you in their brain.
I mean, Blizzard doesn't announce games untill they are good and ready... they don't need years of buzz.
Blizzard doesn't need to create buzz because they are so good at what they do, the buzz generates itself.
This is a position *every* company wants to be in. But, very few have it. The only way you get there is by constantly delivering good results, and (in the case of certain Blizzard games), chopping out the stuff that is going to be crap.
Unfortunately, egos and people on power trips don't typically like to let this happen. It makes them look bad. Meh.
Blizzard's success is not because they push back release dates so they can put more/promised content in. It's so they can put QUALITY content in.
Quality is (practically) the only thing that matters in all of this. If Warhammer is released earlier, with less content, but that content is amazing...then they will still have relative success. (Maybe not as successful as WoW, but Blizzard has a huge following.)
I am completely sick of hearing about this thing. everyfarkingwhere you turn it's 'iphone-iphone-iphone' arghhhh. of course I might be singing a different tune if...
Don't you mean you might be singing a different iTune?
I think that the papers/media were wrong to invade this individual's privacy over nothing other than rumor/fantasy. So what if the girl put it up on her social networking site?
This is not a question of privacy. If you post something to a publically accessible place (AKA - no expectation of privacy, such as your bank's website) on the Internet, it's now public. Same as if you stood on a street corner and yelled out personal information - it's now public.
And, what, pray tell does "come of age" mean, exactly? 18? Bulls*it. A 15-year old teenager knows exactly what he or she is doing when they post the crap that that woman's daughter posted.
Additionally, even if she was an excellent parent, her daughter could have easily posted that at a friend's house, at school or from her cell phone. You can be a good parent, but you can't monitor your kids 24/7.
The daughter should be held responsible in this case. "Kids" need to learn to take responsibility for their actions because if they don't figure that out now, they never will.
I think a lot of people here wanted to believe he was innocent, perhaps because of the open source connection
Heh, I'll probably be modded as Flamebait for this, but...whatever.
I agree with you. The OSS connection, I think, is what made people think he was innocent. If this had been a story about Bill Gates or some other closed source proponent, I wonder if people's reactions would still have been the same on this site.
If a subject or lesson cannot (or does not) keep every child in the classroom entertained, no matter how diverse the population, then the teacher is faulted.
Well, of course. Didn't you read it in your contract? Section 5A, Paragraph C.
Section 5A: (C) All teachers shall maintain the roles of: disciplinarian, nurse, psychiatrist, janitor, entertainer and, oh yeah, teacher.*
*Sub 1: Basically, you're going to be a parent for all of your students. Good luck. You're going to need it.
Side Note: I wanted to be a teacher at one point. They don't pay the teachers of our nation nearly enough money to deal with all that crap.
As a yahoo user, I feel strangely threatened. I can't explain it, but it"s like a bad ex-girlfriend who just can't accept no for an answer.
You're on Slashdot. Don't even pretend you know what the world girlfriend means. And especially don't pretend you know what it means to actually break up one!
Don't know if you saw this. Office 2007 has a "Save as PDF" plugin that you can download for free of Microsoft's Office website. Check it out here: Save as PDF
[woman showing her new engagement ring to her friends] Friend 1: Well, he did pick out a nice diamond. It's a shame, about the band, though... Friend 2: Yeah. I agree. Choosing a platinum ring over zinc...how cheap. New Fiancee::-(
Slashdot Mirror
It's pointless arguing with an Apple fan online, they will always argue they're right.
It's pointless arguing with anybody online, they will always argue they're right.
Fixed that for you.
If it's all marketing then why does Apple have the highest consumer satisfaction rates in the entire industry?
If their products were crap, or even equivalent, consumers would not speak so highly of them, for so long after their purchases.
So you would think. But, a couple things play against that.
1. Customers *expect* that an Apple will be a different experience than, say, a Windows machine. As a result, they're expectations are already geared towards, "This is going to be a good experience." As a result, they are more likely to have a good experience.
2. Face it - Apple products are expensive. Another psychological response that people have is that once they invest into something, they are more likely to stick with that something (and argue for that something) no matter how bad it is. So, it may be that someone spends $2000 on a new Mac, they have high expectations, they take it home and don't really like using it. However, they can't admit that because that means they made a bad decision. Hence...Macs are always awesome.
I know it sounds stupid. I thought so too until I read through the studies and performed some of my own in my work.
Never underestimate the power of someone to convince themselves of something if they don't want to be wrong or stupid.
If I follow the judge's logic, then anybody looking at me on the street has created an unauthorized copy of me on their retina. They even have the gall to create additional unauthorized copies in other brain areas.
Well, if you look anything like the typical Slashdotter, trust me, nobody is making unauthorized copies of you in their brain.
Ahhh...but in this discussion, first post has never been so appropriate.
Yeah, you know what else iHate because iSee stories about it everyday on Slashdot? Linux!
iMean, Jesus H Christ, enough already!
Fixed your post for your. This is an Apple thread. Please post in the appropriate format in the future.
Thank you!
I mean, Blizzard doesn't announce games untill they are good and ready... they don't need years of buzz.
Blizzard doesn't need to create buzz because they are so good at what they do, the buzz generates itself.
This is a position *every* company wants to be in. But, very few have it. The only way you get there is by constantly delivering good results, and (in the case of certain Blizzard games), chopping out the stuff that is going to be crap.
Unfortunately, egos and people on power trips don't typically like to let this happen. It makes them look bad. Meh.
Exactly.
Blizzard's success is not because they push back release dates so they can put more/promised content in. It's so they can put QUALITY content in.
Quality is (practically) the only thing that matters in all of this. If Warhammer is released earlier, with less content, but that content is amazing...then they will still have relative success. (Maybe not as successful as WoW, but Blizzard has a huge following.)
I am completely sick of hearing about this thing. everyfarkingwhere you turn it's 'iphone-iphone-iphone' arghhhh. of course I might be singing a different tune if ...
Don't you mean you might be singing a different iTune?
I think that the papers/media were wrong to invade this individual's privacy over nothing other than rumor/fantasy. So what if the girl put it up on her social networking site?
This is not a question of privacy. If you post something to a publically accessible place (AKA - no expectation of privacy, such as your bank's website) on the Internet, it's now public. Same as if you stood on a street corner and yelled out personal information - it's now public.
And, what, pray tell does "come of age" mean, exactly? 18? Bulls*it. A 15-year old teenager knows exactly what he or she is doing when they post the crap that that woman's daughter posted.
Additionally, even if she was an excellent parent, her daughter could have easily posted that at a friend's house, at school or from her cell phone. You can be a good parent, but you can't monitor your kids 24/7.
The daughter should be held responsible in this case. "Kids" need to learn to take responsibility for their actions because if they don't figure that out now, they never will.
The Very Worst Uses of Windows
At all.
Heh. The type of graffiti that will be put on these sites should be good. I can see it now...
Title: Bill Gates Genome
ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG
Title: Linus Torvalds Genome
ATTATATACGYAYOPENSOURCETAGCCGCGATCG
Title: Cowboy Neal Genome
ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT
I think a lot of people here wanted to believe he was innocent, perhaps because of the open source connection
Heh, I'll probably be modded as Flamebait for this, but...whatever.
I agree with you. The OSS connection, I think, is what made people think he was innocent. If this had been a story about Bill Gates or some other closed source proponent, I wonder if people's reactions would still have been the same on this site.
I don't care who the person is being punished. The prosecution is coming at this from a crazy angle AND setting an extremely bad precedent.
Stupid, stupid, stupid.
If a subject or lesson cannot (or does not) keep every child in the classroom entertained, no matter how diverse the population, then the teacher is faulted.
Well, of course. Didn't you read it in your contract? Section 5A, Paragraph C.
Section 5A: (C) All teachers shall maintain the roles of: disciplinarian, nurse, psychiatrist, janitor, entertainer and, oh yeah, teacher.*
*Sub 1: Basically, you're going to be a parent for all of your students. Good luck. You're going to need it.
Side Note: I wanted to be a teacher at one point. They don't pay the teachers of our nation nearly enough money to deal with all that crap.
Well I'm sure glad that I don't go to school now. Back in my day, my English teacher learned me grammar good!
As a yahoo user, I feel strangely threatened. I can't explain it, but it"s like a bad ex-girlfriend who just can't accept no for an answer.
You're on Slashdot. Don't even pretend you know what the world girlfriend means. And especially don't pretend you know what it means to actually break up one!
However, this will mainly effect the gaming industry.
I don't typically harp on grammar, but effect vs. affect is the one thing I remember from English class in high school...so...
In this case, "effect" means "brought about." So, you're saying that computing power will bring about the gaming industry.
Try "affect" which means influence.
And other things like compiling software may or may not see much of an improvement depending upon the design of the source.
Heck. You may actually get to see Gentoo finish compiling in your lifetime!
I sell my old tech to my parents all the time. I like to teach them the value of money.
Wow, that's a heck of a list. Makes me sad that one of their brands is Harmonix. I love Frequency and Amplitude.
Don't know if you saw this. Office 2007 has a "Save as PDF" plugin that you can download for free of Microsoft's Office website. Check it out here: Save as PDF
Ooo...this is a fun game...
[woman showing her new engagement ring to her friends] :-(
Friend 1: Well, he did pick out a nice diamond. It's a shame, about the band, though...
Friend 2: Yeah. I agree. Choosing a platinum ring over zinc...how cheap.
New Fiancee:
No, I'm afraid it is you who is being short-sighted here, and it's only out of politeness that I don't use a different word.
I know I'm a bit offtopic, but isn't this statement akin to, "You know, I don't mean to be rude BUT...[insert rude comment here]."
You're not being very polite by saying you're being polite and the implying that you have something much worse to say.
QQ dominates the IM market in China.
Funny. QQ also dominates many of the Blizzard WoW forums as well.