Slashdot Mirror

Cocaine and methamphetamine have very few physical withdrawl symptoms.

"Cocaine withdrawal often has no visible physical symptoms like the vomiting and shaking that accompanies the withdrawal from heroin or alcohol."

http://www.nlm.nih.gov/medlineplus/ency/article/00 0947.htm

You are mostly right about benzodiazepines, withdrawl doesn't directly cause death. However in severe cases seizures can happen, and complications (e.g. falling, choking) could cause death. It is also very difficult to overdose on benzodiazepines alone. This is because they do not directly agonize the GABA receptor, but instead enhance the response to an agonist. Taking them with alcohol or other downers of course eliminates this margin of safety.

LSD is non addictive, and physiologically non toxic. Adverse psychological happen on the order of 1 in 1000, almost exclusively happening to those with prior psychological problems. (see Nichols Pharmacol Ther. 2004 Feb;101(2):131-81

Opiates, while being addictive a physiologically benign. That is, a person addicted to pharmaceutically pure heroin can lead a healthy life and even a successful career. With measured doses it is very difficult to accidentally overdose on opiates. Overdose deaths happen due to adverse reactions to adulterants or unusually potent batches, or a relapsed addict not accounting for a decrease in tolerance.

The story of Dr. William Halsted is informative. He was one of the founders of Johns Hopkins university, and discovered the local anesthetic properties of cocaine. Unfortunately in doing so he became addicted to injected cocaine and his life was seemingly ruined. Until he went to a rehab clinic in the carribean, where instead of quitting he switched to morphine. He went on to have a brilliant career as a surgeon, no one knowing of his morphine addiction until after his death.

That's not saying that they're not crazy, but whatevery the situation is, if an entire family has been impacted, it's not normal.

No national or international regulatory agency has classified MTBE as a human carcinogen, and the available genotoxicity data suggest that MTBE is not mutagenic. Also, the International Agency for Research on Cancer (IRAC) stated (11/00) that MTBE is not classifiable as a human carcinogen. The weight of evidence suggests that ingestion of water containing MTBE below, or close to the taste threshold, is unlikely to result in adverse health effects.

When considering toxic effects, it is useful to note that free phase MTBE has been used to treat gall stones both in the UK and the US for a number of years (Schoenfield and Marks 1993). During the treatment, a tube is inserted into the gallbladder through which the MTBE is delivered. The MTBE dissolves much of the fat content of the stone causing it to disintegrate. A review of the effects of this method of treatment on 761 patients in 21 centers across Europe found no toxic effects from MTBE in any of the patients (Hellstern et al. 1998).

[2]

Further, to say there haven't been studies on humans is to not be aware of them. Several have been done, and not just in the US[3]. Indeed, the study I assume you refer to above ("carcinogenic effects") are not replicable to humans[4].

The idea that becuase you can smell it or taste it it is doing damage is not upheld by science, and not just in the case of MTBE. There are many substances that are detectable by smell or taste at levels that are orders of magnitude lower than any adverse or detectable health effects.

However, do not construe this as me being in favor of MTBE; I am not. I'd much rather oxygenation of gasoline be done via ethanol; I consider it a far better combination. It is, in fact, what my family uses (The Suburban runs E85, the Vette runs E10). I argue these points only to cut through the hysteria around MTBE. Hyperbole and wild claims about it don't do anybody any good. And I'm certainly not a fan of the EPA.

I've even followed the money trail. Who has the most to benefit by the public thinking MTBE is some nasty horrible thing? Cleanup crews, filter companies (I've seen some claim that over 50% of water in the US has toxic levels of it!), and politicians. I could argue the ethanol industry has a monetary interest in MTBE being banned, and they would. Yet I don't find them pushing the notions that MTBE is lethal or damaging at the lowest of levels, that it's in half the water supply, etc..

Regarding phytoremediation this link should be a good start for further research:
http://www.soil-health.org.nz/pastissues/novdec03/ cropping.htm

It is quite fascinating, IMO.

Cheers

1: http://ehp.niehs.nih.gov/docs/1995/103-5/correspon dence.html
2: http://www.aehsmag.com/issues/2001/spring/myths.ht m
3: http://www.efoa.org/mtbe/partie

http://stemcells.nih.gov/index.asp It has a very good executive summary on stem cells and some good references. A good introductory text book on developmental biology will also be helpful for understanding the basics. I don't know of one offhand since it's been a while but you should be able to google and find what introductory courses use these days.

I'm going to start off with an ad-hominem, because it's just too good to pass up: Judging from your abuse of lower case letters, when you get drunk, you come here and post on slashdot. Here's a nice summary of 41 scientific studies! But it's from the NIH, so they obviously don't know what they're talking about.

I'm in favour of legalising marijuana, but you live in fantasy land if you think it's harmless. It's full of carcinogens ( like pretty much anything else you burn, really ), and the American Heart Association presented a study ( non journal though, so whatever ) during their March 2000 conference that said it represented a fivefold risk factor for cardiac arrest in the first hour after use for older users ( about twice the risk entailed by sex for sedentary individuals ). These are not the only medical questions surrounding cannabis at the moment, some bad, some good. Don't make the mistake of dishonestly portraying it as 'safer than sugar doughnuts' ( as one particularly retarded pothead has attempted to do in my presence. )

The DPP study showed that exercise and diet were two critical ways to prevent diabetes. As it is, Type II diabetes is being seen in children, when a generation ago it was a disease of older people.

Diabetes can be controlled, but it is still a life-threatening illness. I made the mistake of thinking that I was "too old to run." I became a diabetic as a result of that stupidity.

This shoe may be a form of "pinhead responsibility," but pinhead responsibility is better than no responsibility whatsoever. If it enables parents to control TV and exercise in their children, then it will be useful.

Is it a weak solution to the problem? Certainly. Can it be hacked by the child? More than likely. But at least it's a start. It sure beats kidney failure, heart disease, blindness, stroke, impotence, and death. It certainly beats the cost of all those little kids spending their lives as diabetics.

Heck, it beats having to pass up deserts. Unless you are a diabetic, you have no idea how this disease sucks.

Does it run Linux? I'm sure someone will find a way, and it might even improve the system!

I suppose there is an important placebo effect as well...

RTFA. They gave a placebo for a control group.

Gingko Biloba and such things...all quack medicine...

"Quack medicine" better decribes what managed care dishes out than it describes the clinical use of traditional medicinal herbs.

If you're interested in the scientific and reductionist research into herbal preparations rather than spouting FUD, I suggest you search PubMed.

for hypochlorous acid, it is

An oxyacid of chlorine (HClO) containing monovalent chlorine that acts as an oxidizing or reducing agent.

(from PubChem); and sodium hypochlorite is just bleach; when dissolved the chlorite ions will form acidic solution; so HClO+NaOCl=bleach in water, which is a common disinfectant but would probably be a bad idea to drink.

Unless the 2nd guy ordered his H2O2 straight up, it is unlikely to kill him, but man, will it give you stomach gas!

ghostlibrary writes "Even while NIH is getting new ethics regs, patientINFORM is being evangelized as a way for ordinary citizens to look up experimental treatment online, in essence circumventing their doctor, and the FDA long ago the tacitly approved this. /. debated Wikis in hospital. RSI fans track risky or untested procedures from the Typing Injury FAQ and Health-Hack covers IT-related self-help medicine. Laser-eye stuff is now mainstream and doesn't need a check beyond google. Any other sites out there for those willing to dictate their own medical course? Does this mean Internet users will become test subjects moreso than the usual college students and elderly?"

ghostlibrary writes "People who are interested in obtaining information about experimental treatments for health conditions can turn to a new web site called patientINFORM, which is being evangelized by a collective of publishers and medical groups. This site is controversial because it in effect allows patients to circumvent their doctors in the search for unconventional and unapproved therapies. While the FDA has tacitly approved this kind of information service in the past, the NIH is about to issue new regs covering the conflicts of interest this kind of service raises. This site joins other sites that disseminate information about risky or untested procedures, such as the Typing Injury FAQ, which covers RSI (repetitive strain injuries) or Health-Hack, which covers IT-related self-help medicine. Laser-eye stuff is now mainstream and doesn't need a check beyond google, and past Slashdot articles have even discussed the advisability of using wikis in hospitals.

Are there other sites out there for those willing to dictate their own medical course? Does this mean Internet users are joining the usual college students and elderly as experimental subjects for untested therapies?"

Every person already has access to National Library of Medicine's PubMed system that enables them to identify all research publications. And everyone already has access to the National Library of Medicine's ClinicalTrials.gov database. Given the hodgepodge of advice and crappola appearing all over the Web encouraging people to eat untested substances, drink urine, shoot up just about everything in order to cure themselves, please tell me why anyone would be opposed to access to information carefully organized, peer-reviewed research and publications. You must remember that, until the Internet showed up, most medical libraries were closed to the public, and often even to nurses, and all information of any consequence had to come via a doctor. Their role as the guardians of knowledge is eroding as people are encouraged to assume a more active role in their own health decision making. If you have a problem with this, well, you can still just go to your doctor. But some of us might want a few alternatives.

Self replicating in what sense?

In the Sun-Y or Eckland sense. In fact, one leading abiogenesis theory is known as "RNA world" - the idea that the earliest forms of life were simple self replicating RNA. Even that is a somewhat arbitrary boundary, of course. I lean more toward the "scaffolding" theories - that early life was little like it is today, but simply progressive buildup on top of earlier structures that simply encourated the production and aggregation of chemicals "similar" to themselves, and that cooperative hypercycles formed among these.

Self replicating in what sense?

In the Sun-Y or Eckland sense. In fact, one leading abiogenesis theory is known as "RNA world" - the idea that the earliest forms of life were simple self replicating RNA. Even that is a somewhat arbitrary boundary, of course. I lean more toward the "scaffolding" theories - that early life was little like it is today, but simply progressive buildup on top of earlier structures that simply encourated the production and aggregation of chemicals "similar" to themselves, and that cooperative hypercycles formed among these.

In the US, the National Institutes of Health recently announced that NIH-funded researchers will now be required to submit final copies of their published manuscripts to PubMed Central providing free access. For folks in the health sciences, this will have a substantial impact (and journals will adjust their copyright rules to permit it if they want to get submissions from folks successful enough to get NIH funding.)

In the US, the National Institutes of Health recently announced that NIH-funded researchers will now be required to submit final copies of their published manuscripts to PubMed Central providing free access. For folks in the health sciences, this will have a substantial impact (and journals will adjust their copyright rules to permit it if they want to get submissions from folks successful enough to get NIH funding.)

In the US, the National Institutes of Health recently announced that NIH-funded researchers will now be required to submit final copies of their published manuscripts to PubMed Central providing free access. For folks in the health sciences, this will have a substantial impact (and journals will adjust their copyright rules to permit it if they want to get submissions from folks successful enough to get NIH funding.)

Nice straw man. I'm not asserting anything about good/bad, and it so happens I'm not arguing my personal values either. I'm making a claim about what I think is the objective reality of the opinion people (Americans) have of the LDS church; that a lot of people find (or found) those current and former practices of the LDS church extreme or offensive, in contradiction to the post to which I responded. Because it's a claim about objective reality, it's subject to verification (if someone wants to do the work). I've backed my assertion with external references to some evidence that supports my claim. If you've got evidence that polygamy is "acceptable" in the U.S., let's see it. ("acceptable" means "tolerated by at least a big plurality of the Americans.) Evidence might persuade me that I'm wrong about what I think a lot of Americans think about polygamy.

...just because Frist is pandering...

That's exactly my point! Senator Frist is trying to link gay marriage to polygamy (and other things with high negatives in U.S. culture) because polygamy has much higher negatives among the general populace than does gay marriage.
QED.
The observation of Senator Frist's action is not based on what you or I think about either polygamy or gay marriage or their relationship or lack thereof, it's an observation of what a leading politician thinks will work to sway opinion to his side on the issue.

It seems that what I'm trying to communicate just isn't "coming in". I'm *not* trying to change anyone's personal opinion of any LDS doctrine or former doctrine, pro or con, nor am I trying to characterize those practices. I'm trying to express my sense of what the general sentiment of my fellow Americans is towards certain practices or former practices that Americans generally found to be extreme or offensive.

To give you some practice, here are some other similarly structured statements that I think are also true.

• In 1860, a great many Southerners supported slavery, or politicians who did so.
• Now, most people in the U.S. thinks slavery is reprehensible
• People were hanged in the American colonies for preaching a different variety of Christianity than was approved by the local government.
• Until the attack on Pearl Harbor, many Americans favored isolationism and opposed U.S. involvment in World War II.
• Most voters preferred Al Gore for president in the 2000 presidential election.
• Some Jehovah's Witnesses refuse blood transfusions for religious reasons, even when it may save a life.
• There seems to be a correlation between fear of death and unwillingness to be an organ donor.
• Most Americans don't consider horses to be food animals.
• During the American Revolution, some colonial leaders thought that the British were using germ warefare against them.

The Eastern Branch also has unique genetic info.

There is distinct evidence that the NORTHERN species is the oldest and that the whole group moved south NOT north.

All the evidence shows that the closest common ancestor between the western and easter branches is the northern group which does not have all the genetic information that exists in the the two southern branches. Actually the Western and Eastern groups have genetic info that is not represented ANYWHERE else in the salamander family.

The only hybridization that could have created this is if a totaly different species also moved south with the northern species and then interbred and died out. That is certainly a possibility however there is NO evidence that this species ever existed. Therefore it is far MORE likly that this is a case of evolution rather than a mysterious case of all the salamanders of a specific group that EVER lived getting teleported away leaving no evidence at all.

I have no information of a Korean salamander however there is no evidence that salamanders have crossed the pacific before man brought them and this ring species existed before man came to the new world.

I suggest you check out an intor genetics book. That will give you a much better understanding of the differences between hybridization and evolution. Or if you already have a background I suggest doing a pubmed search for Ring Species. I found what looks like an interesting article. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd= Retrieve&db=pubmed&dopt=Abstract&list_uids=1566201 1

Please let me know if there is anything else you are not clear on.

There's nothing inherently evil about drug companies making lots of money. In an ironic sort of way, this may actually increase funding in comparison to treatments that could truly be called "cures".

In some ways, this approach is safer than gene therapy for cancer. Since you don't tinker with the cell's DNA, the iRNA treatment can be stopped if you start accidentally supressing critical RNA. Modifying DNA is permanent.

More links:

Paris Noise Level Map

Decibel noise levels

You didn't even bother to properly read the 1st link I gave. If you did you would have seen:

"Further categorization of diets showed that, in comparison with regular meat eaters, mortality from ischemic heart disease was 20% lower in occasional meat eaters, 34% lower in people who ate fish but not meat, 34% lower in lactoovovegetarians, and 26% lower in vegans. There were no significant differences between vegetarians and nonvegetarians in mortality from cerebrovascular disease, stomach cancer, colorectal cancer, lung cancer, breast cancer, prostate cancer, or all other causes combined."

The 2nd link I gave claims there were blood pressure benefits (amongst other benefits).

And there are other links like the German study on vegetarians which appears to deal with mortality as a whole, it concludes:

"Both the duration of vegetarianism and the vegetarian status (strict versus moderate) showed a moderate effect on all cause and cancer mortality. A longer duration of vegetarianism (> or = 20 years) was associated with a lower risk, pointing to a real protective effect of this lifestyle. A lower risk of death among moderate vegetarians suggests that sound nutritional planning may be more important than absolute avoidance of meat."

See the last sentence.

I give more weight to studies done by the "Division of Epidemiology, German Cancer Research Centre, Heidelberg." and "Imperial Cancer Research Fund, Cancer Epidemiology Unit, Oxford, United Kingdom. key@icrf.icnet.uk" than stuff some of these kooky websites[1] on nutrition claim.

[1] There are many of these around, and the USDA views on nutrition is just as useless and even more suspect - given it's not the FDA, but the Dept of _Agriculture_. Go figure.

Uh, the first link I gave doesn't support your claim. Just read the excerpt I posted. Fish and lacto-ovo vegetarians do 34% better than regular meat eaters. Whereas vegans "only" do 26% better.
(of course that's only for heart disease - the 2nd link is wrt blood pressure).

I regard your second link as a poor quality source. Lots of stating of various facts, glued together with opinion. There is a gap between the various facts given and the author's claim "But, I believe these advantages are in spite of the fish, rather than because of the fish".

Whereas, the studies I cite have the mortality and health indications directly in the results.

The first link you gave is better. It's a shame that the seas are so contaminated and I don't dispute that. So I suppose in modern times, eating lots of fish isn't such a good idea anymore.

That said there was another study in Germany that showed nonstrict vegetarians did better than strict vegetarians.

e.g. "A lower risk of death among moderate vegetarians suggests that sound nutritional planning may be more important than absolute avoidance of meat."

So far the evidence seems that less meat is good, but total avoidance of meat (strict vegetarianism) isn't as healthy.

Here you go.

"in comparison with regular meat eaters, mortality from ischemic heart disease was 20% lower in occasional meat eaters, 34% lower in people who ate fish but not meat, 34% lower in lactoovovegetarians, and 26% lower in vegans"

Another study done in Africa.

Conclusion: allowing/having fish (and/or eggs) in your diet is healthier than being a strict vegetarian or vegan.

Sure you can claim the vegans weren't eating the best vegan food which may be true. But it's a lot easier to just eat eggs/fish from time to time instead of strictly avoiding them.

There are many other studies that fish is good for humans : e.g. for brains of growing children/for pregnant women - good for the babies.

My point remains: eating fish is a good thing for humans. Popular claims that humans are supposed to vegetarians are misguided. You can survive on a vegetarian diet, but you are more likely to thrive if you have some fish. Whereas stuff like red meat is more likely to kill you prematurely.

You may choose to refrain from eating fish for other reasons, but it's good for health (unless it's contaminated with mercury, other heavy metals or PCBs :( ).

p.s. I'm a tad surprised the lacto/ovo vegetarians did so well. Good news to me, I'm an omnivore that likes eggs and fish. Also a tad surprised about freshwater fish being good (always thought open-water sea fish is much better - could be true here - given the polluted rivers in my country, and the probably poor regulation of fish farms ).

Here you go.

"in comparison with regular meat eaters, mortality from ischemic heart disease was 20% lower in occasional meat eaters, 34% lower in people who ate fish but not meat, 34% lower in lactoovovegetarians, and 26% lower in vegans"

Another study done in Africa.

Conclusion: allowing/having fish (and/or eggs) in your diet is healthier than being a strict vegetarian or vegan.

Sure you can claim the vegans weren't eating the best vegan food which may be true. But it's a lot easier to just eat eggs/fish from time to time instead of strictly avoiding them.

There are many other studies that fish is good for humans : e.g. for brains of growing children/for pregnant women - good for the babies.

My point remains: eating fish is a good thing for humans. Popular claims that humans are supposed to vegetarians are misguided. You can survive on a vegetarian diet, but you are more likely to thrive if you have some fish. Whereas stuff like red meat is more likely to kill you prematurely.

You may choose to refrain from eating fish for other reasons, but it's good for health (unless it's contaminated with mercury, other heavy metals or PCBs :( ).

p.s. I'm a tad surprised the lacto/ovo vegetarians did so well. Good news to me, I'm an omnivore that likes eggs and fish. Also a tad surprised about freshwater fish being good (always thought open-water sea fish is much better - could be true here - given the polluted rivers in my country, and the probably poor regulation of fish farms ).

The use of microwave transmission of power has been the most controversial item concerning SPS development, but the incineration of anything which strays into the beam's path is an extreme misconception. The beam's most intense section (the center) is far below the lethal levels of concentration even for an exposure which has been prolonged indefinitely. Furthermore, the possibility of exposure to the intense center of the beam can easily be controlled on the ground and an airplane flying through the beam surrounds its passengers with a protective layer of metal, which will intercept the microwaves. Over 95% of the beam will fall on the rectenna. The remaining microwaves will be dispersed to low concentrations well within standards currently imposed upon microwave emissions around the world.

4) Learn that screwing somebody you just met in a bar just might have a negative effect on the rest of your life

Sex, however, is generally believed to be normal, even if our society tends to demonize it. For example, the odds are pretty good that your parents have had it at least once.

(forget the fact more than 1/4 have genital warts and that it is not prevented by condoms

there is no cure, and it can cause a woman to be infertile).

You could meet a woman in church (or pick some other place for finding wholesome, God fearing women), get to know her for a few months, fall in love, and finally have sex and then get genital warts from her -- she may not even realize that she has it. And then you learn that she's only 17, get arrested, go to prison, and when you're released you get labeled as a sex offender and have to wear a GPS tracker for the rest of your life. Which may not be very long, as some vigilante finds out that there's a sex offender living in his neighborhood on the Intraweb, and he breaks in and kills you in your sleep. (Hopefully they'll take the GPS tracker off before they bury you.)

And genital warts aren't the worst thing you can get, and not the only thing that cant' be cured. And you can also get them without even having sex (kissing could pass them from mouth to mouth.)

Nobody said life was fair. But in theory, our legal system ought to be, and treating `sex offenders' like we do, making them register, tracking their movements, especially when their crimes are stupid things like `public urination' (it varies from state to state, but some do treat that as full fledged `sex offenders'), when we don't do similar things for people convicted of murder, assault and battery, armed robbery, etc. is about as far from `fair' as you can get

But all the politicians have to do is play the `think about the children' card, and everybody involved seems to stop thinking and start jerking their knees instead ...

This means that all signs of evolution also will be signs of intelligent design, simply because evolution is a form of intelligence.

Example 1: human eye. The nerves are connected to the photoreceptors from the outside - the blind spot is where they go through the retina. An engineer would obviously connect them from the outside.

Example 2: Flatfish. An engineer designing a flat fish would probably come up with something resembling a stingray - straight spine plus symmetrical ribs on both sides. The flatfish is totally unlike this - strangely twisted, it ( "undergoes a metamorphosis that involves the migration of one eye across the top of the head to a position adjacent to the non-migrating eye on the right lateral side" It probably reflects the way it evolved from some kind of "non-flat" fish that had to lay on its side to hide from predators.

Good guess, but only part of that sequence is actually in the human genome, in chromosome 20 (with one error):
Query: 103 catcagctactatgtagctacgatc 127
Sbjct: 84163 catcagctactttgtagctacgatc 84187
The quality of match is rated at E=0.65, which means that you would expect to find a match this good by chance 65% of the time. (E value will change slightly if you search different databases.)
Try searching for the sequence yourself here under Nucleotide-nucleotide BLAST (blastn)

If you want to see the real thing, you can browse one version of the "real" human genome here. If you click on the blue chromosome 1, and then "Download/View Sequence/Evidence", then "display", you can see the repeating "telomere" sequence at the beginning of chromosome 1.

Good guess, but only part of that sequence is actually in the human genome, in chromosome 20 (with one error):
Query: 103 catcagctactatgtagctacgatc 127
Sbjct: 84163 catcagctactttgtagctacgatc 84187
The quality of match is rated at E=0.65, which means that you would expect to find a match this good by chance 65% of the time. (E value will change slightly if you search different databases.)
Try searching for the sequence yourself here under Nucleotide-nucleotide BLAST (blastn)

If you want to see the real thing, you can browse one version of the "real" human genome here. If you click on the blue chromosome 1, and then "Download/View Sequence/Evidence", then "display", you can see the repeating "telomere" sequence at the beginning of chromosome 1.

except for http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd= Retrieve&db=PubMed&list_uids=10772599&dopt=Citatio n

and

http://scholar.google.com/url?sa=U&q=http://www.sc iencemag.org/cgi/content/full/276/5321/1967%3Fck%3 Dnck

and

http://scholar.google.com/url?sa=U&q=http://www.nc bi.nlm.nih.gov/entrez/query.fcgi%3Fcmd%3DRetrieve% 26db%3Dpubmed%26list_uids%3D8606480%26dopt%3DCitat ion

and

http://scholar.google.com/url?sa=U&q=http://www.nc bi.nlm.nih.gov/entrez/query.fcgi%3Fcmd%3DRetrieve% 26db%3DPubMed%26list_uids%3D8811260%26dopt%3DCitat ion

for example

There is a family of genes called the septins the gene symbols for these are SEPT1 SEPT2 to SEPT11 which gets converted to dates. Some Accession numbers get converted to floating point. here is a link to the paper

I have had horrible luck linking into PubMed, but here goes:
Homosexuality[MESH] (brain OR genetic)

Sure, that's pretty common in some fields (Biotech, for example). But 300+ authors? 3000? How many authors would you say the Linux kernel has?

Biotech ain't got nothing on particle physics (My count yielded 600 authors on this paper (or "study").)

Ok, here's my best shot. Thanks to the National Institute of Environmental Health Sciences for the lyrics and karaoke music.

Big Adobe went to town
Riding with great worry
"Microsoft might buy our foes
Goodness let us hurry"

Big Adobe, buy them out
Big Adobe dandy
Mind the lawsuits and the FUD
And with your cash be handy

Macromedia went to the web
With great Flash and vigour
Then Adobe said to them:
"We ownz you, start to quiver"

Big Adobe, buy them out
Get yourself a trophy
Buy a business out of fear
And call it Macradobe

All you geeks and all you nerds
Reading this here story
Remember what the Parent said
And call it Macradobe

So this is probably not some new huge breakthrough in anything like superconductivity, but a refinement of a well-known phenomenon.

Yeah, like Shrinky Dinks this'll be a hit with the mail-order or discount store crowd before you know it.

People tend to forget what cyanoacrylate's first purpose was.

And your statement microscopic examination in critical reading should be applied a bit more sparingly is almost exactly what is wrong with science, that combined with Harpaz's commentary on why scientists are so conservative (in their science, not in the politics). Another interesting tidbit is his commentary on popular science (both books and news media) that take advantage of 'effectively lying by implication'.

Additionally, here are some papers by a Y Harpaz found on pubmed (which he doesn't like, apparently):
---Direct observation of better hydration at the N terminus of an alpha-helix with glycine rather than alanine as the N-cap residue.
---Many of the immunoglobulin superfamily domains in cell adhesion molecules and surface receptors belong to a new structural set which is close to that containing variable domains.
---Volume changes on protein folding.

Not that I'm saying I agree with everything Harpaz says...but I don't think he should immediately be written off as a crackpot. Quite a few of his points seem valid.

And your statement microscopic examination in critical reading should be applied a bit more sparingly is almost exactly what is wrong with science, that combined with Harpaz's commentary on why scientists are so conservative (in their science, not in the politics). Another interesting tidbit is his commentary on popular science (both books and news media) that take advantage of 'effectively lying by implication'.

Additionally, here are some papers by a Y Harpaz found on pubmed (which he doesn't like, apparently):
---Direct observation of better hydration at the N terminus of an alpha-helix with glycine rather than alanine as the N-cap residue.
---Many of the immunoglobulin superfamily domains in cell adhesion molecules and surface receptors belong to a new structural set which is close to that containing variable domains.
---Volume changes on protein folding.

Not that I'm saying I agree with everything Harpaz says...but I don't think he should immediately be written off as a crackpot. Quite a few of his points seem valid.

And your statement microscopic examination in critical reading should be applied a bit more sparingly is almost exactly what is wrong with science, that combined with Harpaz's commentary on why scientists are so conservative (in their science, not in the politics). Another interesting tidbit is his commentary on popular science (both books and news media) that take advantage of 'effectively lying by implication'.

Additionally, here are some papers by a Y Harpaz found on pubmed (which he doesn't like, apparently):
---Direct observation of better hydration at the N terminus of an alpha-helix with glycine rather than alanine as the N-cap residue.
---Many of the immunoglobulin superfamily domains in cell adhesion molecules and surface receptors belong to a new structural set which is close to that containing variable domains.
---Volume changes on protein folding.

Not that I'm saying I agree with everything Harpaz says...but I don't think he should immediately be written off as a crackpot. Quite a few of his points seem valid.

Your hands that is. After a stint in an ICU with one of my kids, the first line of defense for infection control is as simple as hand washing. You wash your hands a lot in the ICU:

- When you arrive
- Before you touch a patient or equipment
- After you touch a patient or equipment
- When you leave

The meds in the ICU also follow Universal Precautions to the letter. The keyboards and just about everything else may be dirty, but if you wash before/after touching just about anything along with using gloves and other protection, you'll greatly lower the chances of transmission.

Also, It couldn't hurt to change the keyboards once a month and burn the dirty ones with the other biohazards.

In this case, the Zinc Finger Nuclease is simply used to cut the defective DNA to initiate the homologous recombination process. If you had bothered to read the abstract you would understand that they are also providing an "an extrachromosomal DNA donor" (I would suspect on a plasmid) as the source for the corrected DNA sequence.

So this process *need not* be error prone. Of course they are obviously looking at a number of cells after the fact to determine the fraction of cells in which the process was successful. If one did this with stem cells (which seems to be where they are going) and put them back into the body then one would indeed be able to correct SCID or sickle cell anemia. Diseases that are present in adults in specific cell types such as cystic fibrosis or muscular dystrophy are going to be a bit trickier.

Too bad they didn't add a control of soot containing asbestos. So they could see what asbestos does in the same amount of time.

Inflammatory reactions to asbestos are already known. See for example this study

Digitalis medicines are used to improve the strength and efficiency of the heart, or to control the rate and rhythm of the heartbeat. This leads to better blood circulation and reduced swelling of hands and ankles in patients with heart problems. From the NIH

Sera

Full Disclosure: I'm a Senior Associate with the Institute for Molecular Manufacturing http://imm.org/.

I have to say that this article seriously misses the mark.

Recombinant DNA research self-regulation has been in place for 30 years now, and it has worked very well to prevent "Andromeda Strain" style accidents. The most recent full overhaul was in 1994:

http://www4.od.nih.gov/oba/rac/guidelines/guidelin es.html

There are people who are holding debates about similar regulation for molecular nanotechnology already: The National Nanotechnology Initiative http://www.nano.gov/, The Foresight Institute http://foresight.org/, The International Council on Nanotechnology http://icon.rice.edu/, and many others, including the IMM. The intent of these organizations is to establish guidelines for developement of nanotechnology, and to explore applications.

Here is the first set of guidelines which have been established:

http://imm.org/guidelines/current.html

I fully expect that this will be updated, as the technologies involved become more capable.

A good analysis of the actual societal implications is available from NNI here:

http://www.nano.gov/html/facts/society.html

Don't blow things out of proportion until they are actually implemented; the amount of regulation of any technology has historically always been as much or even much more than was necessary at the time.

-- Terry

> How would the cost of this change compare with Y2K?

Next to nothing. All the work has already been done to accomodate Summer Time changes worldwide:

ftp://elsie.nci.nih.gov/pub/

Almost every *ix flavor already does the right thing. Change a data file and you're done

Gimme a break folks and do your science.

By now we should have had multiple nuclear wars

The worst case scenario was "nuclear winter" which implied one game only.

would have extreme shortages of food

Developing Countries ...

# 815 million people are undernourished
# 1.2 billion people live on less than $1/day
# 153 million children under age 5 are underweight
* 11 million children under age 5 die every year, over half of hunger-related causes
# 1 in 6 people is hungry
# 1 in 4 people lacks safe drinking water

would be all dying from pollution

Europe's children dying from pollution

would no thave enough oxygen to breathe

Decreased oxygen content in the atmosphere--an ecological disaster imperceptibly sneaking up?

Gimme a break folks and do your science.

Well.

CC.

TMS has probably reached the limits of its usage as of right now. There is no way to penetrate more than a few centimeters into the skull.

The devices I've seen are pretty crude; basically just big loops of wire on a handle. It seems to me that there must be ways of focusing magnetic fields deeper within the skull.

Also, will someone PLEASE tell me how the HELL sony plans on converting their "ultrasound" into electrical energy in the brain? Because the last time I heard, only the ear recognizes mechanical vibrations of the air!


If you are recording from neurons electrically, you certainly see electrical events if you disturb them mechanically. There are stretch gated ion channels, and some neurotransmitter receptors also have mechanical sensitivity. See, for example this paper on NMDA receptors

If you are implying that there is little or no funding of telomerase research in the US, you are very wrong. A quick search of CRISP shows almost 900 grants in the last 5 years with telomerase in the title. A number of efforts to inhibit telomerase are either starting or just about to start clinical trials. The work described here, although interesting and potentially valuable, is no where near clinical trial and hence it is more than a little bit premature to consider it a major breakthough.

It sounds like you are assuming their press release is telling the whole story. If you think this is the first group to demonstrate in vitro inhibition of tumor cell growth via telomerase inhibition, you are very mistaken. See PubMed Not only are there many other efforts to inhibit telomerase, but a number of these other efforts have produced compounds that will enter clinical trials soon. This approach is a very long way from clinical trials.