Slashdot Mirror


Vibrating Controller Alert

mgibbs writes: "According to this article at the BBC, all those game consoles with vibrating controllers can be hazardous to your health. This would have been nice to know before all those hours killing The Flood in HALO; and here I thought all those pins and needles were from the exciting game play."

134 of 238 comments (clear)

  1. What next -- warning labels on Playboy? by InterruptDescriptorT · · Score: 5, Funny

    WARNING: The Surgeon General (in conjunction with Jocelyn Elders) has determined that masturbation, while an enjoying, normal and healthy activity, can cause carpal tunnel syndrome in practiced too frequently with the arm and wrist in a non-ergonomic position.

    Mark my words; I'll bet we see that someday...

    --
    Karma: Excellent Birds (mostly as a result of listening to Laurie Anderson)
    1. Re:What next -- warning labels on Playboy? by Dave_bsr · · Score: 1

      There was a story on Fark, i think it was, that a phone-sex operator got money because she did have carpal tunnel from repeated...work...related....never mind.

      --


      Who is this Anonymous Coward character, how does he post so much, and why is he always such a whore?
    2. Re:What next -- warning labels on Playboy? by !Xabbu · · Score: 2

      Not to mention the friction marks on your willy after masterbating 7 hours a day.

      --

      - Jimbob
    3. Re:What next -- warning labels on Playboy? by detritus. · · Score: 1

      I'm sure it will be followed by:

      WARNING: Masturbation with vibrating joysticks is not a safe alternate from using one's hand.

    4. Re:What next -- warning labels on Playboy? by Fishstick · · Score: 2

      Crippled masturbator sues and wins!

      When a Florida phone-sex worker developed carpal tunnel syndrome in each of her busy hands, she took the case to court. Now she gets her satisfaction from workers' compensation checks.


      ...and they say the american legal system doesn't work anymore!

      --

      There is much cruelty in the universe, John.
      Yeah, we seem to have the tour map.

    5. Re:What next -- warning labels on Playboy? by deano · · Score: 1

      Well, seriously speaking, I wonder what kind of long term damage vibrators could cause to... certain body parts...

      One more reason to hook up with one of those lonely geeks out there, I guess... Hint, hint...

      --
      http://www.shonenjump.com The world's most popular manga, now in English!
  2. I play... by DanThe1Man · · Score: 5, Funny

    theewse gammesss alll the ttimme anddd I'mmm ffine.

  3. 7 hours by Chacham · · Score: 1

    I remeber playing Defender on the Atari 2600 for quite a few hours. After a short while I could open my right hand. But it took a bit before anything besides my thumb could move on my left hand.

  4. Re:vibrating controllers by doooras · · Score: 1

    vibrating controller + rapid thumb movement = exercise. play enough, you might get ripped! (or fat from the dortios)

  5. 7 hours / day by ruvreve · · Score: 1

    You do anything other then sleep for seven hours a day and it is bound to have adverse effects. I'm sure quite a few people here have sat in a chair coding for seven hours and felt the pain afterwards.

    1. Re:7 hours / day by Peyna · · Score: 2

      Most people work for 8 hours a day. Assembly line workers do the same thing for 8 hours a day plus.

      --
      What?
    2. Re:7 hours / day by Moonshadow · · Score: 5, Insightful
      Most people work for 8 hours a day. Assembly line workers do the same thing for 8 hours a day plus

      And they come home aching at the end of the day. My girlfriend works in retail, and comes home frequently quite unwilling to stand if at all possible. The fact of the matter is, repeated activity (IE, not sleeping) for prolonged periods of time can have adverse effects.

      Heck, even sleeping can be hard on you. Anyone else ever made a transatlantic flight? The 7 hours in a seat (Even 1st class) is murder.

    3. Re:7 hours / day by MindStalker · · Score: 5, Funny

      repeated activity (IE
      Yes, repeated use of IE will cause pain.

    4. Re:7 hours / day by xonker · · Score: 4, Insightful

      Assembly line workers do the same thing for 8 hours a day plus.

      Yup, and I've got a wicked case of CTS to show for the three and a half years that I worked in a factory. I did the same job for more than a year because I was faster at my job than any one else on the line and my supervisor didn't want to rotate me. So, I spent 8 hours a day doing the same job -- not just in the same factory, mind you, doing the same repetitive motion -- for more than 12 months. Eventually I couldn't even sleep for more than a few hours without waking up due to the pain in my wrists and hands.

      Happily, I got out of there without having to have surgery or anything -- I know a few people who had surgery and never regained full strength in their hands. I did go through about a month of physical therapy and learned a few exercises to help relieve the strain. I can't use normal keyboards or laptop keyboards for any period of time without causing pain, though. I've stocked up on ergonomic keyboards just in case the models that I like go out of production. (The original M$ "Natural" keyboards rock. The new models suck -- one doesn't have normal arrow keys, the other is too clunky with all the extra function keys. The cordless Logitech ergo keyboards rock too...)

      Anyway, factories are required by OSHA to allow workers to rotate jobs or try to make sure that their jobs aren't going to cause RSI. I'm not sure it's 100% possible -- the human body was not designed to do repetitive tasks for 8 hours a day for years on end. But they're supposed to make an effort to prevent it.

      And kids, if your hands hurt because you've been playing video games too long then it's time to go read a f&*^%ing book. Pain is the first sign of RSI, and if you heed it you won't have serious problems. If you ignore it, you're in for a lot worse than hand cramps.

    5. Re:7 hours / day by mother_superius · · Score: 1

      7 hour flight across the Atlantic?
      More like 21.

    6. Re:7 hours / day by Peyna · · Score: 2

      They used to be required by OSHA, but all the RSI rules were repealed. UAW shops still enforce them, but they aren't required to.

      --
      What?
    7. Re:7 hours / day by Hadlock · · Score: 1

      gatwick -> DFW (london to dallas): 8 hours.

      dallas -> madrid (spain): 15 hours.

      the reason london -> dfw is shorter is due to the rotation of the earth. depends on how you go. gatwick to NYC would take ~ 6-7 hrs.

      --
      moox. for a new generation.
    8. Re:7 hours / day by ergo98 · · Score: 1

      I think you have your oceans screwed up. The Pacific is a bitch to cross, but the Atlantic isn't that bad really.

    9. Re:7 hours / day by Com2Kid · · Score: 2

      "And kids, if your hands hurt because you've been playing video games too long then it's time to go read a f&*^%ing book. Pain is the first sign of RSI, and if you heed it you won't have serious problems. If you ignore it, you're in for a lot worse than hand cramps."

      I ended up straining my eyes. . .

      8hr reading sessions == one BIIIIIG ass headache!

    10. Re:7 hours / day by streetlawyer · · Score: 2
      I did the same job for more than a year because I was faster at my job than any one else on the line and my supervisor didn't want to rotate me. So, I spent 8 hours a day doing the same job -- not just in the same factory, mind you, doing the same repetitive motion -- for more than 12 months. Eventually I couldn't even sleep for more than a few hours without waking up due to the pain in my wrists and hands.

      Why didn't you slow down a bit then you stupid cunt?

    11. Re:7 hours / day by RevDobbs · · Score: 1
      Most people work for 8 hours a day. Assembly line workers do the same thing for 8 hours a day plus.
      Ha ha no.

      With a copious amount of breaks, long lunches, and as unionized auto workers get to spend their last 15 minutes on the clock doing nothing, I highly doubt that any modern-day "worker" put in 5-6 hours of productivity, and that is certainly not continuous...

      ... and before I get bashed as being an 31337'est white-collar pig, I've known many engineers at Ford who were putting in much more time than the assembly line workers, yet the later brought home the bigger pay check...
    12. Re:7 hours / day by AA0 · · Score: 1

      I read books.... geez, games come with manuals you know.

  6. Yow by talonyx · · Score: 1

    Never mind what I read the first time I saw this headline!

    "In the event of a dildo, the company always refers to it as "a dildo", never "your dildo"". - fight club

    Anyways, I have been playing my beautiful Xbox for two months now and my wrists don't hurt.

  7. 7 hours a day? by !Xabbu · · Score: 5, Insightful

    If your child is spending 7 hours a day in front of a console I really think you need to work on your parenting skills. A TV isn't a baby sitter. Let them spend hours and hours staring blankly at a screen when they become old enough to know better.

    --

    - Jimbob
    1. Re:7 hours a day? by Tetrad69 · · Score: 2

      Not to mention that doing pratically ANYTHING seven hours a day is bad for your health. Repetitive stress disorders, and all that nonsense.

  8. Only one case? by nizo · · Score: 3, Insightful
    Thus spake the article:


    Doctors are calling for vibrating computer game controllers to carry health warnings after a teenager developed a painful condition known as hand-arm vibration syndrome.


    They are basing this freaking out on one single case??? Perhaps a study is in order, anyone want to get paid to play games all day? :-)

    1. Re:Only one case? by Trepalium · · Score: 1

      One single case which is likely to cause an avalanche of gold rush "victims" seeking to sue the company to get compensation for their "pain and misery". The same sort of thing that happened with Carpal Tunnel Syndrome and keyboards/mice. Such a litagious and corrupt society we live in....

      --
      I used up all my sick days, so I'm calling in dead.
    2. Re:Only one case? by nomadic · · Score: 2

      No, they're basing it on that one case plus a long history of similar cases in industry. If you handle a vibrating machine for long periods of time, you may run into problems, no matter if it's a jackhammer or a game controller.

    3. Re:Only one case? by Banjonardo · · Score: 1
      Exactamundo.

      Therefore, what's the big deal? So the kid got hurt from hours and hours of a particularly not health-helping activity. Well, since the same can be said of most anything like this, why are they freaking out on video games?

      I'll tell you why: it's cause that nintendo with the cutesy controller, and your nine-year old playing Diddy Kong Racing with a nifty rumble pack shouldn't fall over screaming. Yeah, it's an exaggeration of the facts. But this IS the media, and they WILL exaggerate.

      --

      -----

      Score 3? For what? Being wrong, at length? - smirkleton

    4. Re:Only one case? by kimihia · · Score: 1

      Check at your local Government's health and safety office dumbass.

      Have a look at the regulations for people whose environments include vibration and see what they have to go through. Look at truck / bus drivers and their seating requirements. Look at people who use jack hammers. Look at builders.

  9. Well.... by Carik · · Score: 2, Funny

    Perhaps this kid should have been doing other things than just playing video games. And maybe he should have been a bit more intelligent. Let's see:

    1) He spent SEVEN hours per day playing games. Apparently for upwards of two years. This seems to indicate psychological issues in addition to physical ones. This should have been a warning sign, and someone (his parents, maybe?) should have gotten him to go do something else occasionally.

    2) He waited TWO FULL YEARS before seeking medical help. If you've got a problem like that, I could see waiting a month; after all, it could just be a fluke. But two years?

    Sorry folks, the kid's an idiot, and his parents aren't paying enough attention to keep him from hurting himself, possibly permanently. Keep this in mind: stupidity can be harmful to your health.

    -Carik

  10. So what's new? by plugger · · Score: 1
    Among other injuries listed in the article

    ...central palmar blister on the inside of the hand.

    Does anyone else remember how the old Atari joystick's base would cause a blister in the left hand? In my case caused by too many hours playing their crappy Pacman clone.

    1. Re:So what's new? by gazuga · · Score: 1

      NES was more in my time (though I did have a 2600) but I couldn't help but laugh at

      "Injuries associated with the use of computers or their accessories include joystick digit"

      Is that the technical term for "Nintendo thumb"?

      --Gaz

      --
      "I turn away with fright and horror from the lamentable evil of functions which do not have derivatives."
  11. Same ol' story IE RSI by realxmp · · Score: 1

    This isn't really anything totally new. If you are playing video games for 7 hours a day you're pretty likely get RSI (often called Joystick thumb when talking about badly designed controllers) anyhow from just hitting the buttons, this vibration thing is just a bit extra. Most companies know about RSI now and have all these expensive chairs, keyboards etc to prevent this. Most importantly they HAVE REST BREAKS!!!

    Another thing to think about is all those people who use tools that vibrate all day (Jackhammers etc.) I think they should be far more worried than a little vibration from a joypad.

  12. Moderation by DarkZero · · Score: 5, Insightful

    Isn't doing ANYTHING for seven hours straight every single day hazardous to your health? This is more of a fact of life than a problem with video game systems.

    1. Re:Moderation by pangloss · · Score: 2, Insightful

      ah yes. and that explains the health of eight-hour work-a-day adults around the world, eh? ;)

      or those crazy teenagers who sleep for seven hours in a day?

    2. Re:Moderation by oyenstikker · · Score: 1

      oh. I'd better stop sleeping 7 hours a day. Maybe if i sleep in moderation i won't feel tired.

      --
      The masses are the crack whores of religion.
    3. Re:Moderation by sporty · · Score: 2

      Thus the old adage (s?), "You keep doing that and you'll go blind." :)

      --

      -
      ping -f 255.255.255.255 # if only

    4. Re:Moderation by halo8 · · Score: 1

      I like in the bottom of ther artical where they mention "Each game comes with health guidance stating people should take a break of about 15 minutes during each hour of play. "

      so.. how dose that help me when im 'whacking off'?
      that means each session only really lasts for 45 minutes.. hardly enuff for it to be worthwhile

      --
      The More Knowledge you have the Luckier you Get- J.R. Ewing
    5. Re:Moderation by sam_handelman · · Score: 2

      Like steering wheels, computer keyboards and exercise routines, engineering - this sort of engineering goes by various names that obscure its real nature - principles could be applied to make the video game controller less or non-harmful to use for seven hours a day. There may very well be a minor problem with the controllers themselves causing carpal tunnel, which should be studied, and if it is a problem, serious pressure needs to be brought to bear on the videogame industry to redesign the controllers, or to spend some of their massive profits to educate the public.

      I seriously doubt that the vibration function has anything to do with it; it is more mild than what is experienced in those vibrating chairs, and they're safe. This BBC article is lazy, slipshod, sensationalist journalism reporting the ramblings of a lazy, incompetent, statistically ignorant medical doctor. They're proposing requiring warning labels (which I support generally, but they become meaningless if they're on everything) based on a single anecdote, a study with N = 1! It gives careful doctors with legimiate concerns and solid data a bad reputation when jerks like him are handed a soap box by the media.

      --
      The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
    6. Re:Moderation by canadian_right · · Score: 1
      What kind of parents let a kid play video games seven hours a day!

      The world does not need more stupid regulations and warnings because a small percenage of people are complete idiots.

      --
      Anarchists never rule
    7. Re:Moderation by ergo98 · · Score: 1

      There's actually something to that: Several studies have shown that several brief sleeps throughout the day are more effective that one long slumber. Of course this doesn't work that well in the workplace: "Hey Mary do you mind if I hop in there with you?"

    8. Re:Moderation by DarkZero · · Score: 2

      Playing a video game for seven hours or more in a single day is something every Final Fantasy fan has experienced the day after the game comes out. It isn't really a problem in most cases, as it's usual something that gamers only do once every one or two months. The real problem here was that the kid was doing it EVERY DAY, SEVEN DAYS A WEEK, which is unfathomable even for gaming "addicts".

    9. Re:Moderation by DarkZero · · Score: 2

      I thought of the "eight hour work day" reply when I posted. I figured most people would realize that there's a HUGE difference between an employee working for eight hours and a gamer playing a video game for seven hours. For one thing, there's the amount of work being put into those hours. An employee tries to, on average, minimize the amount of work that they're doing, take as many bathroom breaks as possible, etc. An employee also usually gets a half hour to an hour to break for lunch, as well as two days off every week. Now let's look at the gamer, using what we know about gamers and what we know about this kid. Gamers don't intentionally dawdle and "slack off" while gaming. They'll sit there at the game for the entire seven hours playing almost nonstop, with the only breaks being quick two minute bathroom breaks before running back to the game. They also usually don't break for lunch, either. And most importantly, this kid didn't seem to be taking days off, like the two days off that most employees get. He was playing "seven hours a day", and probably every day. Working eight hours per day is much less stressful to the physical appendage (in this case, the fingers, hand, and wrists) being used during the work than gaming for seven hours is. Gaming has less breaks, more determination put into it, and in this kid's case, a lack of the two days off per week that an employee usually has at their job.

    10. Re:Moderation by DarkZero · · Score: 2

      I'm sorry, this should have been spaced: I thought of the "eight hour work day" reply when I posted. I figured most people would realize that there's a HUGE difference between an employee working for eight hours and a gamer playing a video game for seven hours. For one thing, there's the amount of work being put into those hours. An employee tries to, on average, minimize the amount of work that they're doing, take as many bathroom breaks as possible, etc. An employee also usually gets a half hour to an hour to break for lunch, as well as two days off every week. Now let's look at the gamer, using what we know about gamers and what we know about this kid. Gamers don't intentionally dawdle and "slack off" while gaming. They'll sit there at the game for the entire seven hours playing almost nonstop, with the only breaks being quick two minute bathroom breaks before running back to the game. They also usually don't break for lunch, either. And most importantly, this kid didn't seem to be taking days off, like the two days off that most employees get. He was playing "seven hours a day", and probably every day. Working eight hours per day is much less stressful to the physical appendage (in this case, the fingers, hand, and wrists) being used during the work than gaming for seven hours is. Gaming has less breaks, more determination put into it, and in this kid's case, a lack of the two days off per week that an employee usually has at their job.

    11. Re:Moderation by pangloss · · Score: 1

      and i thought of your reply when i posted ;)
      and besides you asked: "Isn't doing ANYTHING for seven hours straight every single day hazardous to your health?"

      sleep is still a valid counterexample :P

      i also believe there are probably professional athletes, musicians, dancers, writers, etc. who all practice their respective crafts for seven hours a day, every day and are in good health.

    12. Re:Moderation by The+Raven · · Score: 1

      No, it should have been previewed... both times.

      --
      "I will trust Google to 'do no evil' until the founders no longer run it." Hello Alphabet.
  13. Hazardous! by ZaBu911 · · Score: 2, Funny

    Oh no!

    I guess I shouldn't jack off with the controller anymore.

    1. Re:Hazardous! by buckeyeguy · · Score: 1
      Don't look at it that way... think of it as a full body joystick... ;)

      (oh I can feel the karma draining away on this one...)

      --
      I'd have a personalized plate on my car, but "toxic bachelor" won't fit into 7 letters.
    2. Re:Hazardous! by Banjonardo · · Score: 2, Funny
      Hey, the rumble pack was cool! I remember when smash brothers would make it rumble non-stop. (pausing the game would end it.)

      Think I paused?

      --

      -----

      Score 3? For what? Being wrong, at length? - smirkleton

    3. Re:Hazardous! by longbottle · · Score: 1

      You laugh... I was playing Quake 3 Arena with a friend... let's just say that now she _really_ loves my Dreamcast. True story, I swear.

      --
      I don't suffer from insanity. I enjoy every minute of it!
  14. I use slashdot 7 hours a day by shepd · · Score: 1

    What RSI problems do I have?

    --
    If you could be told what you can see or read, then it follows that you could be told what to say or think - BoC
  15. Problems by slashdot.org · · Score: 1

    Reading this:
    Dr John Sallis, who treated the boy at Liverpool's Alder Hey Hospital, said: "It was quite clear this boy had major problems.

    After reading this:

    The 15-year-old boy spent seven hours a day playing computer games (emphasis mine)

    I'd say, yes, but the problem with his hands is only the beginning. ;o)

  16. The lawyers already smell blood... by va_willy · · Score: 1, Troll
    During the heydey of the dot-com "revolution," my employer and several others in the Valley supplied their employees with shiny new computers equipped with the latest in gaming hardware. Amongst the GeForce3's, 21 inch "perfectly flat" displays, and Windows 98 licenses, there were - you guessed it - vibrating controllers. Which are now apparently being deemed a health hazard.

    Some of my former co-workers with whom I have kept in touch have been consulting lawyers in the area in the hopes of "demonstrating" that the vibrating controllers and other ergonomic no-nos committed in our workplace are grounds for getting some quick cash through the legal system. Because of the very nature of this sort of damage - that it is very difficult to prove whether or not somebody is feeling pain in their arm - they believe that it will be an open-and-shut case and that most companies will want to settle quickly to avoid further damage to stock prices and profits.

    I don't wholehartedly condone this sort of behavior, but some companies have such an atrocious employee relations record that they almost deserve the misery...

    will

  17. In all seriousness, by ZaBu911 · · Score: 1

    like most things in the news today, this is complete bullshit. Blaming the companies for this kid's problem is not the solution. It's his OWN damn fault. He has MAJOR problems. Seven hours or more is HIS risk. Too much of a good thing can be a bad thing.

    Recently, there was a post on penny-arcade that addressed a certain story: a kid accidentally shot his brother while re-enacting a scene from time crisis 2. Not the games fault, more like "stupid parents raise stupid kids."

    What kind of moron would keep his gun accessable to his kid?

  18. Crap by PureRain · · Score: 2, Insightful

    I think this is a little more than just the vibration. What about, for example, people who mow lawns for a living - that's a shitload more vibration than a measly little 2v DC motor with a off-centre lead weight. Not only that, but think of all the guys in the 'old days' operating vibrating machinery.
    I think that it's the whole concept of keeping his hands wrapped in the same position all day, using only the same muscles that caused it. Think of the stress on his eyes, staring at a TV all day. It's nothing but a wakeup notice that he should get a life.

  19. Vibrating controllers...oooooooohhhh by AndyChrist · · Score: 1

    Oh, yeah, it vibrates...feels like I'm really in the game.

    No, wait, no it doesn't. Not unless the game involves riding a bicycle over railroad ties, or jamming a vibrator in somewhere.

    They were a dumb idea from the start.

  20. From the article... by CaptainSuperBoy · · Score: 2, Redundant

    Injuries associated with the use of computers or their accessories include joystick digit, mouse elbow and central palmar blister on the inside of the hand.

    Joystick digit? Mouse elbow? This stuff is hilarious! How about CTRL-ALT-DEL-overextended-finger?

  21. same feeling as orbital buffer? by crystalplague · · Score: 1

    when i wax our cars or boats, i use the little orbital buffer we have. after a while, I get this stinging sensation in my forearms and hands. is this anything like what this syndrome is? if so, i feel sorry for the kid because its uncomfortable as hell. i guess thats what you get for playing games 7 hours a day.

    1. Re:same feeling as orbital buffer? by Mulletroll · · Score: 1

      I get the same thing if I have to use vibrating tool like a hydraulic chisel or needle gun for too long. It is very irritating, but only lasts for a while.

      This kid must be an extra sensitive case.

  22. Some links by soulcuttr · · Score: 3, Interesting
    I've been hearing about this sort of thing the last week or so in the news. Though with the amount my game-junkie friends and I play games you'd think it would have hit us by now. Anyway, here's a couple of other links to similar stories. But then if I know my health experts, and I think I do (cough...eggs...cough), next year they'll tell us how vibrating controllers are good for us.
  23. Weird phrasing...yet another example by AndyChrist · · Score: 1

    I think this is another example, albeit a not terribly important one, of how journalists try to report on too many different things while only knowing anything about a pitifully few.

    "Sony, which manufactures the top-selling Playstation games, said it had never received any feedback or complaints about hand-arm vibration syndrome after 61 million sales world-wide of Playstations I and II.

    It stressed that there was occasional, but no constant vibration during either game."

    Either game? Either british usage is a little different in this respect, or whoever was summarizing Sony's position doesn't own either one.

  24. Seven hours isn't much by gad_zuki! · · Score: 3, Informative

    I'm not a gamer, but when I was a teenager living in the suburbs playing videogames took most of my time because of the lack of anything else going on. Yes, I did my homework and all that fun stuff, but when you're a teenager (a the person in the article is) you've got free time coming out the ass.

    I don't think its a sign of bad parenting to let your kids do something they enjoy. Sure videogames are truly a time waster but finishing that RPG on my Master System or whatever was fun and rewarding.

    1. Re:Seven hours isn't much by junkster191 · · Score: 1

      Hmm, got to figure out if I'm jealous of your teenagerhood or if I hate it. When I was a teenager in the burbs I never had free time to play video games- classes easily resulted in 6 to 8 hours of homework every night, and somehow I managed to become a semi-professional snowboarder to boot. Would less time coding and more time playing have been a good thing? Who knows...

    2. Re:Seven hours isn't much by nohonor · · Score: 1

      "Idle hands are the devils playthings."

    3. Re:Seven hours isn't much by uhmmmm · · Score: 1
      when you're a teenager (a the person in the article is) you've got free time coming out the ass.

      hmm ... as a teenager, I must be constipated, as I'm running dangerously low on free time.

    4. Re:Seven hours isn't much by futuresheep · · Score: 1

      When I was a teenager, we had no Video Games, yet we still managed to find plenty of things to do. Like go outside.

    5. Re:Seven hours isn't much by Greg's+Trolling+Acct · · Score: 1

      Speaking of.

      What time is it when the big hand is between the seven and the eight, and the little hand is on the nine?

      It's 7:45 .

      See you later, kids!

    6. Re:Seven hours isn't much by Broccolist · · Score: 1

      I've never understood why people think "going outside" somehow makes you into a better person (health benefits aside). Playing ball or whatever is far less intellectually stimulating than most video games. I'm open to your point of view, but can you point me to any studies showing that playing outside is better for a child than video games?

    7. Re:Seven hours isn't much by elmegil · · Score: 2

      There's a lot more to life than being 'intellectually stimulated'. Playing outside exercises ALL of the body, including your brain (it doesn't take book learnin but it definitely takes smarts to play ball and win; even just wandering through the woods exposes you to a lot of reality that helps you know more about the world). Seems to me this is common sense, and doesn't need a scientific study any more than the recent "Smog causes Athsma" silliness.

      --
      7 November 2006: The day Americans realized corruption and incompetence weren't addressing 11 September 2001
    8. Re:Seven hours isn't much by Gaijinator · · Score: 1

      > Playing ball or whatever is far less intellectually stimulating than most video games.

      I'll try to remember that the next time I play Quake III.

      --
      "For success, it is essential you have Thunderball Fists." "I can have such a thing?" "That's right. Thunderball Fists."
    9. Re:Seven hours isn't much by Golias · · Score: 1
      Playing ball or whatever is far less intellectually stimulating than most video games.

      Actually, there is a tremendous ammount of intellectual stimulation to the game of baseball, if you take the time to actually understand the game.

      The problem that most bookish types have with the game is that they were probably stuck on the bench or hidden in right field because their athletic prowess was far behind their peers. Since people far less smart than them had far more success during their early childhood, the bias is towards assuming that sports are for thick-skulled brutes.

      I suggest you pick up a copy of Leonard Koppett's 1967 book "The Thinking Fan's Guide To Baseball" to get a glimpse of what I am talking about. It's a little dated, but it's a very good start.

      --

      Information wants to be anthropomorphized.

    10. Re:Seven hours isn't much by !Xabbu · · Score: 2

      In this day and age of obesity and general unfitness of north america's children I think we need to spend more time getting our kids out to the park or into a sports league of some sort to keep them healthy. Our kids are getting fat spending their time staring blankly at the computer screens all day.. I know.. I'm one of those kids! I spent hours as a kid watching TV, playing video games and futzing on the computer. It was great.. I came home at 3:30.. watched after school cartoons until mom made dinner at 5:30. Went back to it after... maybe did a little homework then hopped on the computer for the rest of the night... EVERY DAY. I'm not saying my parents where bad parents, far from it, but had they spent more time forcing me into trying better things for me I think I would lead less of a seditary lifestyle today. Something that I am deasperately trying to get away from these days.

      Jim

      --

      - Jimbob
  25. One datapoint isn't valid statistical inference. by Kaz+Kylheku · · Score: 2

    There is no statistically valid reason to conclude that the boy's condition is caused by the use of a vibrating game controller. That boy is a sample of one. Of course the idiotic media love to dig up the slightest piece of bad news and blow it out of proportion.

    What you need is random sampling of many game players to see whether there is a statistical correlation between use of a vibrating controller and the health symptoms related to vibration. And of course, even given a correlation, you have not determined cause-and-effect; when two findings are correlated, they could have some hidden common cause.

  26. Where did he find 7 hours a day to play?! by thesolo · · Score: 1

    I don't know about this kid, but when I was 15, I was in school and most certainly did not have 7 hours a day in which to play video games! (And if I did have 7 hours a day of free time, my mom, despite being a single mother who works full time, would make sure that I wasn't spending that time parked in front of the TV.)

    It seems to me that parental boundaries could have solved this before it got to this point.

  27. and women? by drik00 · · Score: 1
    Millions of women using vibrating "pleasure devices" is much more of a broad (no pun intended) experiment, and they dont seem to be having any problems (other than the regular women ones)

    --
    Beer, now there's a temporary solution -- Homer Jay S.
  28. Does this mean by Metrollica · · Score: 1

    Does this mean Apple will have to stop selling their iBrator?

    --



    --Metrollica
  29. "Major Problems" by sourcehunter · · Score: 3, Insightful
    Dr John Sallis, who treated the boy at Liverpool's Alder Hey Hospital, said: "It was quite clear this boy had major problems."

    Major problems include: PLAYING VIDEO GAMES SEVEN HOURS PER DAY!

    --

    quis custodiet ipsos custodes - Juvenal
    1. Re:"Major Problems" by loraksus · · Score: 2

      I fail to see the problem (although I am recently divorced and unemployed)
      (I love the smell of satire in the morning)

      --
      1q2w3e4r5t6y7u8i9o0pqawsedrftgthyjukilo;p'azsxdcfv gbhnjmk,l.;/
  30. Poor Gameplay? by mikeboone · · Score: 1

    Don't these controllers vibrate when you crash your car, or get shot, or do something else that you shouldn't have?

    Seems to me that if you didn't suck at the game, the vibration injuries would not be a problem. One the other hand, you could look at the injury being better than being in a real car crash or being shot!

  31. Evolution by russianspy · · Score: 1

    This is getting more and more disturbing. I know I probably get modded down for this, but do we REALLY need to save people from themselves? Why bother?
    Playing video games for 7 hours/day caused a problem. I say the problem was there before that. What's next? A label on coffee saying that drinking more than 8 liters will probably kill you? If you're interested, it's about 18 liters for WATER.

    I think that we can proove the existence of evolution now (It is still technically a theory). We can see what happens to human race right now. We no longer need to fight for food, survival. We, as a species, live a sheltered life. More than that - we are now forced to protect people from THEMSELVES!

    Right now I am ashamed to be human.

    1. Re:Evolution by NeuroManson · · Score: 1

      Sure they do... Those labels, you see, aren't to ensure that the lowest forms of life survive, but to ensure they (eg: lawyers) don't prosper...

      --
      Just because you can mod me down, doesn't mean you're right. Shoes for industry!
  32. I do believe that Nintendo already packages such a warning. It is in that booklet that no one reads.

    1. Re:N64 by NeuroManson · · Score: 2

      You mean the one where they say to take a break every hour or so? Yeah, I didn't read it either...

      --
      Just because you can mod me down, doesn't mean you're right. Shoes for industry!
  33. Serious medical condition by YouAreFatMan · · Score: 2
    This story reminds me of the summer I spent working for a lawn-mowing company and my fingers tingled all the time from the vibration. It can get really bad -- the British Health and Safety Executive has a document which describes hand-arm vibration injury, which normally affects stonemasons and people who operate vibrating machinery all day. The say that if you're getting more vibration than the equivalent of four hours of lawnmower action, you should be concerned about your health.

    I think we've passed the point where product liability ends individual responsibility takes over. Perhaps they should have a warning label because little Johnny spends so much time on his PS2 that he doesn't eat properly, and that's bad for his health as well.

    --
    Robotiq.com is heavily tested on animals
  34. Some controllers worse than others by kisrael · · Score: 2

    I noticed that the rattle on the GameCube seemed a little wimpy. (And had read that it was more significant a factor on the XBox, and put to good use in "Halo"). I wouldn't be terribly surprised if it was a bit of a deliberate ergonomic decision on Nintendo's part. (Or maybe it just ties in to have a relatively smaller controller anyway.)

    --
    SO YOU'RE GOING TO DIE: The Comic for Dealing with Death
    1. Re:Some controllers worse than others by Tofuhead · · Score: 2

      I always suspected that this was one of the reasons Sega's Dreamcast Jump Pack was so much weaker than the third-party vibrators. That, plus the fact that overly-strong vibrations can be too much of a distraction. You have to HOLD these things, after all.

      < tofuhead >

      --
      It is still the dark of night.
  35. Re:vibrating controllers by sheol · · Score: 1

    how is this redundant? i said it first....

  36. Note to fuckhead moderators: by dimator · · Score: 2, Troll

    The parent post is in fact funny. To the dumb shit who moderated it as a troll: do you know what the hell a troll is? Jesus.

    --
    python -c "x='python -c %sx=%s; print x%%(chr(34),repr(x),chr(34))%s'; print x%(chr(34),repr(x),chr(34))"
    1. Re:Note to fuckhead moderators: by Anonymous Coward · · Score: 2, Funny

      do you know what the hell a troll is? Jesus.


      Are you trying to say that Jesus is a troll?

  37. Wait a minute... by koganuts · · Score: 1
    With all due respect, mods, why was it when I submitted this story yesterday, it got rejected?
    2002-02-01 22:52:45 Doctors Say Rumble Controllers Should Carry a Warn (articles,games) (rejected)
    Like others, I find the fact that the kid was playing videogames for up to seven hours a day more disturbing!
    1. Re:Wait a minute... by Mahy · · Score: 1
      This has happened to me at least twice. I think they just have a random number generator that randomly selects articles to accept. :)

      More seriously, I guess it isn't surprising that when you have multiple editors all with the same domain of responsibility, this is bound to happen fairly often. It is annoying though.

    2. Re: Wait a minute... by koganuts · · Score: 1

      It's extremely annoying. I've submitted numerous news articles in the past to Slashdot that get rejected, only to see them (submitted by someone else) appear a day later. I've also seen news articles on Yahoo! News, et al, and have chosen not to submit them to Slashdot, thinking they wouldn't get approved, and sure enough, they do. I just can't win. I wish there was more consistency between the mods. =P

  38. Only if you use M$ products... by gatesh8r · · Score: 1

    Do you get the CTRL-ALT-DEL-overextended-finger. Otherwise you so get the ps x strained eye on UNIX systems with an impulse to type kill -9.

    --
    Karma whorin' since 1999
  39. Re:your brain by Broccolist · · Score: 1
    No it didn't. The only thing they showed was "it was found that the computer game only stimulated activity in the parts of the brain associated with vision and movement."

    Whereas doing arithmetic stimulated the parts of the brain involved in math. Gosh, what a surprise! And what does this stunning result show about the effect of games on antisocial behavior? Nothing.

    The best part of the article is when he recommends that children play outside instead. Gee, I wonder what part of the brain that will stimulate? Vision and movement, perhaps?

  40. RE: "staring blankly at a screen" by primenerd · · Score: 1

    I agree, if parents let their children derive enjoyment from staring at CRT screens, they may become computer scientists or some other type of undesireable ;-)

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  41. A Short Story.. by _aa_ · · Score: 1

    Once upon a time there was a young boy. The boy loved to spend his days and nights in front of a television playing video games. His favorite game was "Shaky Jim's Chainsaw Simulator". A game that very accuratly replicated the events that the modern lumberjack encounters. Even down to a violently vibrating controller.

    One day, as the boy was playing his favorite game, the Ghost of Christmas Future paid him a visit. "Ugh", the ghost said as he pointed to a newspaper. The headline read, "YOUNG BOY GROWS OLDER, HANDS ARE GOOFY BECAUSE OF VIBRATION CONTROLLERS, PANIC SWEEPS CITY". This struck fear into the boy's heart. The ghost then gave the boy a new controller.

    The new controller used drugs and electro-shock to simulate real-life encounters in video games. Before his eyes, the young boy saw the newspaper headline change to read, "YOUNG BOY GROWS OLDER, HANDS ARE LOOKIN' GOOD, PANIC SWEEPS CITY".

  42. FUD for thought... by kko · · Score: 1

    First Punxsutawney Phil (it's groundhog day!), then the techs (it's backend day!), then MS (it's clean code day!), then the robots (it's judgement day!), and now this...
    What's next?
    Studies have shown live organisms are statistically more prone to dying than other organisms

    Jack sez: "on a long enough time frame, the survival rate drops to zero."

    --
    No, seriously, I just come here for the articles.
  43. Hard on the wrists? by wildsurf · · Score: 1

    What about the degenerative effect on the brain? Cranial Tunnelvision Syndrome...

    --
    Weeks of coding saves hours of planning.
  44. Don't you people get laid or anything?!? by AndroSyn · · Score: 1

    If you are spending in excess of 7 hours per day playing video games, you seriously are not going to find a girlfriend or anything. I think its safe to say most girls are not into the sort of guy who spends that much time playing video games. Go outside, get some fresh air, try to find a girlfriend or something. Life is just a little too short to spend most of it playing video games.

    1. Re:Don't you people get laid or anything?!? by cheezehead · · Score: 1

      Life is just a little too short to spend most of it playing video games.

      Bollocks. It's called recreation. Some people watch football, or soap operas, or go fishing, or whatever. And I'm going to play Civilization as soon as my computer is done ripping my legally bought audio CD.

      --

      MSN 8: Now Microsoft even has bugs in their ad campaigns.

  45. Vibrating controllers annoying by amaiman · · Score: 1

    I've always found the vibrating controllers annoying, and always turn off the feature in the games that I play. Sure, the novelty was great at first, but your hands feel weird when you leave it going for too long.

  46. British Reporting? by cheese_wallet · · Score: 2, Funny

    Has it struck anyone else here, reading slashdot, that the british papers have entirely become the equivelent of the American National Enquirer. I.E. Useless?

    1. Re:British Reporting? by Gumshoe · · Score: 3, Interesting

      If by uselss you mean, simply and non-sensationally reporting a statement made by a genuine and otherwise respected doctor, and a contrary statement by Sony; then yes I agree, British newspapers are useless. Although, I always thought that's what newspapers were supposed to do. I.E. keep their opinions to themselves - after all that's what we're here for.... In this case, it is the doctor himself who is being senstational. I suspect he's never seen or used a vibrating controller. If he had, he would realise that these things are no more dangerous than a purring cat. "Vibratory White Finger" is usually experienced by roadworkers and miners, not minors.

  47. When Do The Lawsuits Come In? by NeuroManson · · Score: 2

    Especially in any arcade that has the 'Addams Family Generator' game, which has some pretty wicked vibrations...

    --
    Just because you can mod me down, doesn't mean you're right. Shoes for industry!
  48. Sony: safety you can count on. by Inoshiro · · Score: 3, Funny

    "Sony, which manufactures the top-selling Playstation games, said it had never received any feedback or complaints about hand-arm vibration syndrome after 61 million sales world-wide of Playstations I and II.

    It stressed that there was occasional, but no constant vibration during either game.
    "

    Thanks, Sony, I'm glad knowing that your two games, the Playstation 1 and Playstation 2, are the safest games I can own. Where is my Dreamcast copy of Playstation 2? I see the kids in the picture enjoying it!

    The research in this article (one extreme case among millions leading to warnings) is astounding. Then again, they do have "WARNING: HOT" on coffee nowadays. Have to protect the public from themselves :-/

    --
    --
    Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
    1. Re:Sony: safety you can count on. by rtaylor · · Score: 2

      Yeah, well.. Turn off the coffee pot and it still says WARNING: HOT. It should have a warning for COLD as well because nothing is worse than cold coffee.

      --
      Rod Taylor
    2. Re:Sony: safety you can count on. by JWhitlock · · Score: 2
      The research in this article (one extreme case among millions leading to warnings) is astounding. Then again, they do have "WARNING: HOT" on coffee nowadays. Have to protect the public from themselves :-/

      McDonald's probably has the best litigation strategy of any company I've ever seen. Even though McDonald's was clearly wrong in the coffee cases in the early 90's, and had to settle out of court for a undisclosed sum, they successfully spun that the litigants were idiots that need "WARNING: HOT" labelled on the side of their cups, destracting everyone from the facts of the case.

      If you want to know the real story of the McDonald's coffee case, here's a web site that has the details . I have to admit, it changed my mind about the case.

    3. Re:Sony: safety you can count on. by Inoshiro · · Score: 2

      That is very interesting. A few years back, there was a native lady who tried to sue McD's for burning coffee. The local media never reported anything about the temperature.

      The people I know all assumed they settled to keep the people involved in the situations quiet (so as not to scare off other potiential customers). I never considered that they'd make them seen like less trustworthy knowledge providers too (*)

      *: people tend to be neutral about information they learn from other people, unless they respect them (more likely to trust information) or don't respect (less likely to trust). Trust metrics are neat things :)

      --
      --
      Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
  49. Note to BBC News: a console is not a game. by JamieF · · Score: 1

    >Sony, which manufactures the top-selling Playstation games, said it had never received any feedback or
    >complaints about hand-arm vibration syndrome after 61 million sales world-wide of Playstations I and II.
    >
    >It stressed that there was occasional, but no constant vibration during either game.

    Dude, like, I was playing a mean game of PlayStation II all night. I can't wait to see how it ends.

  50. Acid Test by adamjone · · Score: 2

    I think the acid test in this case is to ask the question "If a warning label were placed on the product, would it have prevented the injury?" In this case, I believe it is a resounding NO. The kid had a serious gaming addiction. A warning in the Playstation documentation, assuming he read it, would not have prevented this kid from sitting in front of the tube and playing for hours on end.

  51. The doctor's advise... by NOT-2-QUICK · · Score: 1

    "Dr Sallis is advising children to exercise caution and moderation when using these vibrating games."

    If properly disected and put into the appropriate context, I believe the good doctor has two excellent pieces of advise here for two drastically different segments of the population...

    First, we have the excellent suggestion of "[A]dvising children to exercise..." I believe this recommendation to be spot-on in the case of all children - but especially applicable in this specific scenario. Any individual (child or otherwise) whom invests seven hours a day playing video games DEFINITELY needs some exercise. Hey kid, drop the joystick and the twinky. Ya know that bright light outside, it is called the sun...go outdoors and see what it looks like!!!

    The second golden nugget of advise contained within the noted quote is for women. "[E]xercise caution and moderation when using these vibrating games"...this, of course, is in reference to what my wife likes to call "BOB" - her battery operated boyfriend. I have never personally seen the device (nor do I want to...), but this may be good advise for her during my extended business trips. For god sakes, I would hate to have her chip a tooth!!! :-)

    --
    Beer is proof that God loves us and wants us to be happy. -- Benjamin Franklin
  52. The remedy... by jpellino · · Score: 2

    Dope-slap the parents AND the kid.
    And get a christless life.
    Two years of pain from an ELECTIVE activity?
    I suggest a sublethal category for the Darwin awards. Oxymoronic, but necessary.
    Only saving grace is that this slob will likely never be given the occasion to reproduce.

    --
    "Win treats sysadmins better than users. Mac treats users better than sysadmins. Linux treats everyone like sysadmins."
  53. Dreamcast in Picture by The+Pi-Guy · · Score: 1

    Hmm, the picture has nothing to do with the article. The DC's controllers don't have the PuruPuru/Jump/Rumble pack in 'em, and the only ergo problem I see is the way they are seated. I'd break my neck like that. TV's too small, too, they're gonna kill their eyes.

    LOL.
    --joshua

  54. This kid has "RSD"? by klui · · Score: 1

    I'm not a doctor, but my copy of Repetitive Strain Injury by Pascarelli and Quilter describes what this kid has as probably "RSD." RSD is more serious than symptoms such as tingling, numbness, discomfort, and pain mostly related to carpel tunnel syndrome, tendonitis, and so forth.

    Once you have RSD, your nerves are damaged; and they either don't heal or heal very, very, very slowly--taking much longer than tendons and ligaments. With soft tissue injuries, it is a prolonged road to recovery in the first place because these tissues are being used all the time. Imagine if the kid has a runny nose, and he has to use his hands to blow/wipe his nose. I have "only" RSI and sometimes, with a lot of hours on the computer, even opening doors is painful to my wrists.

    Symptoms of RSI should not be ignored; people who suffer from RSI, including myself, often feel stupid for ignoring the initial warning signs their body sends. Unfortunately, this isn't a case of "no pain, no gain." Even seasoned trainers say "train with your mind, not with your ego." I'm pretty sure this kid no longer feels invincible. What a bad wake-up call.

  55. Damn those BBC censors by cswiii · · Score: 2

    The 15-year-old boy spent seven hours a day playing computer games and particularly enjoyed those using the vibration mode on the control device.

    The BBC editors seemed to have left this tidbit out:

    'The boy, known only to the media as 'Cowpoke Neal', is said to be the younger sibling of a well-known online personality. It is unknown whether or not the family member suffers from the same condition.'

  56. Well, duh by SkewlD00d · · Score: 1

    Anything that vibrates against your body, with enough intensity will definitely desensitize the nerves in the area. How do you think back-massagers work? =)

    --
    The biggest trick the devil pulled was letting lawyers become politicians so they can write the laws.
  57. Mod away by Elflord1999 · · Score: 1

    Funny, I had this rejected yesterday...same story. This also happened with my first submission...I send it and days later it appears under someone else's name. Anyway...I'll enjoy my negative karma. Peace.

    1. Re:Mod away by ergo98 · · Score: 1

      Different "editors" respond to stories very differently. On top of that often an accepted submission sits on the queue for up to a couple of weeks, so nothing says that this story wasn't submitted a week ago.

      BTW: Mentioning that you'll get modded down doesn't act as some sort of negative karma force field (though it works in inverse: Claim that you'll be modded down can get you karma points if you're making an "alternative" statement, at least as far as Slashdot is concerned). There should be a -1 : Mentioned getting modded down mod category.

  58. Can you post at base 3 these days? by ergo98 · · Score: 1

    You post currently has a score of 2, but there's a single mod on it of -1 Troll : Is it a discontinuity thing with Slash? Just seems weird, unless you can post starting at 3 somehow.

    1. Re:Can you post at base 3 these days? by stfrn · · Score: 1

      Holy modding batman! he's right, check for yourself, one mod, for troll and its still at 2. maybe some automatic thing?

      --
      "It'll be like stealing candy from a baby... why, that look like a lark!" - Mr. Burns.
    2. Re:Can you post at base 3 these days? by joekool · · Score: 1

      check your user pages--do you have it set up for +1 to comments moderated funny?

      --

      Slackware: old school feel, new school gear.
  59. One wonders by Kanasta · · Score: 2

    If he has 7hrs a day free to play games, that's like he has enough time to sleep eat and play games. Maybe shower every 2nd day?

    I wonder what the parents were doing every day not noticing maybe he should spend some time doing something else.

  60. Yeah by geek · · Score: 1

    I didn't think so when I was a teenager, as a result, I am now blind!

  61. "HALO"? You mean you bought a Borg Box? by NeuroPulse · · Score: 1

    "HALO"? You mean you bought a Borg Box?

    "This would have been nice to know before all those hours killing The Flood in HALO."

  62. N64 by Traicovn · · Score: 2

    Alright... time for a class action suite against nintendo's game cube then. That thing comes with controllers that have built-in rumble packs...

    --

    [Something witty and intelligent should have appeared here.]
    {Traicovn}
  63. Seven hours by t_allardyce · · Score: 2

    They said 'seven hours' as though it was an excessive amount of time.. i spent more than that on just one game some days. The first time i turned on the vibrator (PS2) i started feeling funny after a few hours of gaming - my grip felt weak, and i sometimes had pins & needles. Now i'm turning it off for everything. Now atleast i know my theory was right. Maybe i should get out more... But i can't beat police down with a baseball bat and then pump them full of lead in real life.. :(

    --
    This comment does not represent the views or opinions of the user.
  64. Playing computer games? by MrSeb · · Score: 1

    Do they really KNOW he was playing games for all 7 hours? Maybe he just hit puberty and was trying to blow his own trumpet, choke the chicken, strangle the monkey...

  65. Re:In all seriousness by ZaBu911 · · Score: 1

    http://www.penny-arcade.com/view.php3?date=2001-12 -03

  66. 6 hours of doa2 causes headaches by picoears · · Score: 1

    I played doa2 on ps2 for 6 hours with 2 friends to determine if the match number would go from 99 to 0 or to 100. We got headaches, and we were switching off everytime someone lost. Of course, my hands feel fine. (and it does go to 100)

  67. You know what this is really about... by Trogre · · Score: 1

    This is a transparent attempt by the gaming industry to bring media attention to another poorly-selling product.

    Whenever an article appears about "concern over product X", unless the concern is valid (which in this case it certainly is not, since anyone playing games for 7 hours straight forfeits all health and safety boundaries) then product X gets free advertising. Good publicity, bad publicity, it's still publicity.

    And guess what, it worked! We're all talking about them here, and they are in the front of a lot of peoples' minds now.

    Take for example the case of IBM's "Peace Love and Linux" spraypainting campaign. If they weren't caught and taken to court over it, then one city would know about the campaign. Now the world knows about it.

    This is Marketing for the '00s

    .
    .

    --
    "Nine times out of ten, starting a fire is not the best way to solve the problem." - my wife
  68. Vibrations can be REAL bad... by cr0sh · · Score: 2

    How bad? Let me tell a small story...

    In October 2000, I helped set up a demo of a pulsejet engine given by Mark Pauline and Co (of SRL) - the demo was to show off the pulsejet, which was of a valveless design, and could thus run for a long period of time, and didn't have parts that would wear out (unlike typical pulsejet engines, which use a spring metal valve system).

    Anyhow, this engine was loud - actually, that doesn't do justice to how loud the engine was - it was bone-shaking loud. When it was running, it was like your entire body - bones and tissue, all - was buzzing with its energy - which, it was!!!

    Mark only ran the engine for a few minutes each time, when he was tuning it, or demoing it. He told us (the crew who was helping set up for the demo, which was meant to presage the Ultraviolence show in Phoenix, which never happened because the SFFD contacted the PFD, and...) a story about pulsejets, and why you never want to let one run for a long time, and be around it...

    He said he worked on one engine a while back, and ran it for a long time, all the time making adjustments, etc - tuning the engine, basically. He said he ran it for 30 minutes to an hour, and then when he shut it down, he felt numb all over - something like having your entire body being "asleep" (imagine the prickly pins all over your body). He layed down to rest, thinking it was all temporary - eventually the prickly sensation went away - but what came afterward was much, MUCH worse - his nerves were hypersensitised.

    Simply moving, or small noises, or puffs of air on his skin, would cause intense waves of pain. He said the condition lasted for a couple of days, then went away. Needless to say, he doesn't run his engines for long times any more.

    I thought it was an interesting story. Could a vibrating game controller cause the same reaction? I doubt it, but they can't be good for you if left vibrating for long periods (and unless the motor was stuck on, why would that occur?)...

    --
    Reason is the Path to God - Anon
  69. Only in America.. by Fastolfe · · Score: 2

    This is one of my long-standing rants: the need for America to constantly cater to the stupid and incompetant. Our judicial system has a very low definition of "common sense", which is what allows us to sue over hot coffee that we bought, sue because we decide to play vibration-enhanced games for 50% of our waking day and our hands start to go numb, etc. It's totally ridiculous. I think it's retarded that everywhere I look there are 50 stupid stickers and warning labels telling me not to ingest plastic bags, avoid sticking metal things into electrical outlets, not to drink household cleaners, etc.

    If you ask me, a gene pool is improved by allowing people to do the things only they are stupid enough to do. We definitely need to jack up the definition of "common sense" in our legal system to something a bit more common sense.

    1. Re:Only in America.. by Rude+Turnip · · Score: 1

      Hear, hear! I'm a firm believer that stupidity should be punished and that the punishment should be painful. ie...my dog once fell off the bed after horsing around and was limping for a day or two. (Naturally, we took him to the vet and found nothing was broken.) Now he knows not to be a clutz.

      If that had been an American adult, the Serta people would have been sued for not having bumpers built-into their matresses.