Slashdot Mirror
Fritz's Hit List
wwwssabbsdotcom was one of several to submit news stories about Ed Felten's latest venture: Fritz's Hit List, a list of electronic devices with some sort of digital storage and processing capabilities sufficient to qualify them "digital media devices" under Sen. Hollings' CBDTPA bill.
Christmas is coming....
I want all of these and more...
H&Ks Garf
Today on Fritz's Hit List: Big Mouth Billy Bass.
That's right, your favorite wall-hanging, singing, dancing, animatronic fish qualifies for regulation as a "digital media device" under the Hollings CBDTPA. If the CBDTPA passes, any new Billy Bass will have to incorporate government-approved copy protection technology.
Fight piracy -- regulate singing fish novelties!
I thought the CDBPABST was supposed to be a bad law. How can anything that aims to regulate the proliferation of Singing Billy Bass be evil?
I love you, Fritz Hollings!
The next Slashdot story will be ready soon, but subscribers can beat the rush and slashdot the links early!
Is Slashdot ever going to fix the American flag logo? Am I the only one that notices the mistake?
Fritz Hit List #8
Those voice-boxes for throat-cancer patients that enable them to speak with a deep voice will now need to protected with government approved anti-copright protection.
Fight Piracy = Regulate deep throating devices!
Tournament Management Online &
This is getting out of hand. When will it end? When we get forced back into the analog age again? I hope they realize that they're putting the United States 'behind the times' technologically speaking in the name of 'piracy prevention'. When's the last time you pirated MP3s or ISOs on a toy?
Job? I don't have time to get a job! Who will sit around and bitch about being broke and unemployed then?
I want to be Barbie. That bitch has everything.
Don't we WANT the Billy Big Mouth Bass to be regulated? I feel all conflicted now...
What EVER will I do?!
Though, I admit, I have no problems with them banning anything Barbie.
I'm glad I bought my Symphony already!
They'll have to pry it out of my cold, dead hands.
i must have been mistaken when i thought they had indefinetely tabled that shit.
Dont tell me its coming out in another reincarnation.
This
Natalie Portman.
Makes sense, if not in this light.
After all, imported robot pets are finding employment without green cards and taking rewarding pet jobs away from more expensive to maintain domestic alternatives.
You laugh now, but when that little robotic R2-D2 takes your waitressing job because he's willing to work for less than minimum wage, you'll change your tunes!
It's too bad that more of the public is clueless on measures such as this. Maybe if we portray the CBDTPA as an Government mandated tax for the entertainment industry on many common electronic goods. The DRM hardware cost is borne by anyone who uses computer or consumer electronics, but all it really protects is the entertainment industry. Contrast that to many other government regulations, which impose costs on businesses, but generally to help protect the public.
1) Make a list of electronic devices with some sort of digital storage and processing capabilities sufficient to qualify them "digital media devices" under Sen. Hollings' CBDTPA bill.
2) ???
3) PROFIT!!!
thats pritty sneakey, turning a register into a money making machine for the RIAA
They will have to PRY my trusty hp48 from my *cold* *dead* hands!
Looking for people to chat about multicopters, coding, music. skype: gtsiros
I looked at the RIAA's web site, and listened to all the soundbites from Jack Valenti, Sen. Hollings and Hilary Rosen, and I agree.
"Piracy is theft"
Downloading a song from the internet is every bit as bad as stealing a CD from a shop. I didn't realise this. I was stealing music all this time
Now then, if I had come across several CDs that I didn't own, and I knew who their owner was, I would take some efforts to return them.
Now, I have several gigabytes of stolen mp3s. I think I should return them to their rightful owner. To whom do I email them?
I wonder if this would make the list?
Creationists are a lot like zombies. Slow, but powerful and numerous. And they all want to eat our brains.
Machine: You had 3 messages. 1 Message deleted automatically since it has copyrighted material.
User: Oh no, Grandma again left a message with her radio on in the background.
I am sure this applies to Furby's as well...it will be nice to shut them things up.
http://www.bookforce.net
Is that when you consider the amount of idiotic lawsuits over laws that can be broadly interpreted... that some of these common devices might very well indeed end up under fire
Politicians seem to spend a lot of time patching up too-broad laws that don't meet their expectations, and an equal amount of time making silly new too-broad laws.
So now I won't be able to download PleaseForTheLoveOfGodGoToSleep.mp3? Thanks alot.
Trying is the first step towards failure.
You can take my music, and you can hack my computer, but leave my Big Mouth Billy Bass out of this!
If brevity is the soul of wit, then how does one explain Twitter?
That's right, your favorite wall-hanging, singing, dancing, animatronic fish qualifies for regulation as a "digital media device" under the Hollings CBDTPA. If the CBDTPA passes, any new Billy Bass will have to incorporate government-approved copy protection technology.
Well this just goes to prove that there's a bright side to every dark law.
I have no special gift, I am only passionately curious. --Albert Einstein
Maybe this will make consumers more aware of all the silly crap this allows.
Maybe, but I doubt it.
Take me to the river, put me in the water....thanks for getting that stuck in my head!
*growl*
Sent from your iPad.
this is funny yeah eerily scary. i mean on the upside they could finally make furbees and billy the bass too expensive for everyone to buy.
.... make that CONTINUE to rape the consumer.
.... err supporters of this bill has an ad on an article that is firmly against the bill .......
on the other hand they could just rape the consumer
and tell me i am not the only one who got the micro$oft ad.
funny how one of the biggest rapi^W^W^W
"Two things are infinite: the universe and human stupidity; and I'm not sure about the the universe." --Albert Einstein
Just to let people know not to click this if you're at work. I should have thought of it before doing so... but I didn't. Luckily nobody was looking at my screen.
(X-rated link)
I'll click it again when I get home - phorm
Ok, so many of these items seem ridiculous when you consider them to be potential "digital piracy" devices. But what if the CBDPBPDBPPTA (whatever) does pass?
Can't you imagine the Slashdot headlines?
Store audio files with Barbie
from the we're-very-desperate-now dept.
Digital Music Lover writes: "Now that the CPTBPTPBTPBA has passed, mainstream digital music recording has come to a complete halt. Music lovers now have to pay every time they want to listen to a recording on their Fritz/Palladium enabled PC's, and they can't record that music for later use. However, some clever hackers in Germany figured out a way around this problem. They modified a 'Barbie talking cash register' with some custom DSP chips and an Ethernet interface. Now instead of ringing up the price of a loaf of bread, Barbie plays the latest Metallica recording instead!
It is my hope and prayer that we never get to this point. But if the Pigopolists do prevail, I can definitely see the hacker community desperately trying to store digital music any way they can.
Tired of FB/Google censorship? Visit UNCENSORED!
Read this closely. These are the fundamental assumptions made by Hollings -
At the same time, millions of law abiding consumers find little reason to spend discretionary dollars on consumer electronics products whose value depends on their ability to receive, display and copy high quality digital content like popular movies, music, and video games. Accordingly, only early adopters have purchased high definition television sets or broadband Internet access, as these products remain priced too high for the average consumer. The facts are clear in this regard. Only two million Americans have purchased HDTV sets. As for broadband, rural and underserved areas aside, there is not an availability problem. There is a demand problem. Roughly 85% of Americans are offered broadband in the marketplace but only 10-12% have signed up. The fact is that most Americans are averse to paying $50 a month for faster access to email, or $2000 for a fancy HDTV set that plays analog movies. But if more high-quality content were available, consumer interest would likely increase.
Where are they getting these figures?
I am me...I think
I knew there was something devilishly illegal about my 4 year old son's Rescue Heroes toys - the ones that use a digital chip embedded into the backs of the toys to play back some voice clips. These obviously illegal digital playback devices are a menace to society and it's up to us law-abiding, upstanding citizens to destroy this threat to freedom....
If hollywood is truely threatened by these harmless playthings, then maybe they should go out of business.
Ron Gage - Westland, MI
Felten's list gives the impression that it's the crazy interpretations of CBDTPA we have to fear.
But the real problem is that CBDTPA is a crazy bill to begin with. You can't fix something like this by giving back the singing fish. If every single one of Felten's examples were exempted from the bill, what's left would be no less outrageous.
First they first came for the Billy Bass and I didn't speak up because I hated Billy Bass.
Then they came for the Spam and I didn't speak up because I hated Spam.
They came for the browser mods that pop up ads depending on my site visits, and I didn't speak up because I hated Gator.
Then they came for my TiVo, and they had to pry it out of my cold, dead hand.
[With apologies to Pastor Martin Niemoller]
Actually, I think this hit list is totally stupid. Half the things on that list wouldn't fall under the law.
Sometimes it's best to just let stupid people be stupid.
Setting: Beachside club with a GNU on the turntables and Tux dancing along with other animals
Music: Parliament's Aqua Boogie
Events
Tux is dancing on the dancefloor having a good time, when a Windows flag flies in and attacks him
Tux squaks (if you've ever heard Aqua Boogie, there's a sqwaking bird, which would be synced to this)
The Windows flag chases tux down the beach into an ocean of 1s and 0s Pouring into the ocean is a pipe marked "OC48" which is gushing data in the form of binary
The Windows Flag drowns as the song hits the "I can't take water" line
Tux tramples the flag, squaks again and flies back to the club
Fade to black screen with a catchy Linux Slogan displayed
Hmm... US government puts out bill to require anything digital to have copy protection on it... cost for digital equipment goes up.
Last month, US government drives legislation to force all TVs' to have digital tuners installed, including all TVs' manufactured in the US, and all being shipped via the US. Cost for TVs' and consumer electronics goes up.
US government also tables legislation requiring all television networks to convert to digital within 5 years. All existing TVs' and VCRs' will be obsolete. Cost to consumers goes up.
Result: In 5 years, all televisions and VCRs are digital, copy-protected, and controlled. Government gets to dole out the new "digital" channels to whomever meets their standards.... or should that be 'ideals'?
Earlier in the year (and the year before, and the year before) the US government threatens to put stricter regulations on the Internet, including what you can do, what you can read, and where you can read it. Stocks of net-filtering software go up, ad banners start to reduce fees paid because of declining revenue, free-speech sites and those not funded by a corporation start going away.
Earlier this year, US government tries to force libraries to filter the websites available on their public computers. US government also successfully forces schools to filter content. Those who do the filtering? Corporations who use their own judgement to determine if a site should be filtered or not.
DMCA serves as pretense to shut down P2P networks, mp3/warez websites, Instant Messangers with file sharing capabilities (it's coming, just you watch) etc.
"THE WAR ON TERRORISM" (tm) serves as pretense to search anyone, anywhere, even from outside the country.
US government arrests people that it invites into the country (the two russian credit card hackers and the FBI) or those that haven't even done anything to the US (Skylarov ((SP?)))
You know, I saw a sig that said "Canada: It's like being in the loft above a really great party". I don't know about you, but I'm starting to think that not all the noise from the party downstairs is good.
And, on a different note, as IANAL (sorry, everytime I see that I read I-anal. I just can't write it with a straight face), what happens if I come down to visit with my Sony minidisc player? Do I get arrested for having non-conforming hardware? Technically, this could extend to anything with a memory, including a watch, a car, a phone.... sound worrisome?
You know, I started this post out noting increased costs... then I got to noting the decreased liberties... then I started thinking "Yanno? If I were slightly more paranoid, I'd almost think that the US government is trying to discourage free speech and push internet and technology access up to the higher tax brackets, where they have more control, while removing these tools for freedom from the 'unwashed masses'. But that would be a bad thought, and I'm double-plus good!"
And, if you think I'm kidding, take any of the paragraphs up above and look in slashdot archives... they all came from here.
"If you don't think, you're letting the terrorists win!"
If I knew the wedgies I gave you back in 6th grade would have resulted in this . . . I might have taken a moments pause.
Because, of course, you're the resident expert on the law. Perhaps some concrete citations of WHY you believe they wouldn't fall under the law might help boost your credibility....
7 November 2006: The day Americans realized corruption and incompetence weren't addressing 11 September 2001
Nope, no sig
Those greeting cards that let you record a personal greeting to be played back to the recipient when they open the card.
"Sorry mom, I wanted to get you a personalized greeting card but the DRM chip added $25 to the cost of the card."
They aren't being banned, they're just going to have copy protection technology built in. Which means they will be more expensive. Which means instead of getting some socks, a drill, some books and a Billy Bass for Christmas, you're just going to get a Billy Bass.
-aiabx
Just this guy, you know?
Pity poor greeting card companies. Their five dollar recordable birthday cards are gonna get a lot more expensive. That means your red box budget will go up as well.
Of course, Hallmark's cost/profit margins are probably higher than the RIAA's.. how much does a $2.99 greeting card cost to manufacture?
W
-------------------
This is my SIG. There are many like it, but this one is mine.
Please.
The Kruger Dunning explains most post on
I agree that Billy Bass generally deserves to die a slow painful death with a spoon (because it'll hurt more), but check out this example of an awesome use of the annoying contraptions. An Art Car that some friends of friends of mine put together. It's amazing what one can do with an old Volvo and a bunch of Billy Bass (and its relatives).
Check out The Sashimi Tabernacle Choir.
Easy: 9/11 did nothing to right the wrongs that the US did and continues doing. If anything, the US are even more fucked up now, all in the name of "fighting terrorism", of course.
Do you know this for a fact? Are you indeed that wise to know that laws won't be abused in this way?
The more important question is: Do law-makers like Fritz Hollings KNOW about the repercussions of what they do?
only five posts and Barbie is hard down
All this means is that software and hardware development move out of the US, and what we get will be the dumbed down versions that companies think people will buy in the US despite the added expense and reduced functionality incorporating DRM will mean. However, this isn't a big deal because in a post-CBDTPA economy, those of us who stick around will be too busy looking for work to buy toys... and new computers and too broke to afford them.
Why are the vendors still playing "deer in the headlights" about this? Do they figure it's cheaper to move out of the US than fight?
Why hasn't a real PAC been put together by the high-tech rank and file to save our jobs? (hint: GeekPAC is a joke, a "political organization" that can't put together a decent website together isn't going to rise up and take Congress back)
Note that the industries affected are 10x the size of Hollywood in terms of income. So why is the tail wagging the dog?
Tech Public Policy stuff
My new Microwave has quite a few nifty features. It even plays a cool *DING* when my dinner is done. I'm sure there is enough computing power, and potential storage space that I could make a digital pictuer pop up, or at least play the new Nirvana MP3.
"This must be a Thursday, I never could get the hang of Thursdays."
Actually, I think this hit list is totally stupid. Half the things on that list wouldn't fall under the law.
Yep, that what the Greeks said when they banned Internet Gambling, or was that gaming?
Never understimate the "law" of unintended consequences.
Reported contributions list
Top 3 Industries (PACs and Individuals):
1 Lawyers/Law Firms $1,463,550
2 Communications & Electronics $698,958
PAC Contributors:
Walt Disney Co $6,000
AOL Time Warner $5,083
National Assn of Broadcasters $5,000
Comcast Corp $2,500
Motion Picture Assn of America $3,000
ASCAP $1,000
Cablevision Systems $1,000
Charter Communications $1,000
Sony Pictures Entertainment $1,000
Universal Studios $1,000
Viacom Inc $2,000
3 Financial & Investment $404,349
Additional PAC contributions here.
Personal Finances are here.
Others who sit on the Commerce, Science, and Transportation Committee.
If you think he's bad, check out Boxer.
notice how almost every message moderated above 3 in this thread is "Funny" - that probably says something... I'm too lazy to figure out what, though.
sic transit gloria mundi
[I'm British, so this proposed law doesn't affect me as much as many /.ers, but the British government is usually pretty good at copying any stupid laws they can find.]
/. readers) have a problem with chain letters. But in these cases would the means justify the ends? Does anyone have any other ideas?
/.ers, but the British government is usually pretty good at copying any stupid laws they can find. Where America leads we follow like sheep, and digital rights are a global issue]
Almost everyone I've told about Palladium, DRM, software patents, Microsofts latest EULA clauses etc. has been astounded & disgusted. The problem is that it takes a huge number of people to speak out, but it is almost impossible to widely disseminate the truth about these initiatives, because most people obtain their information & opinions from the mainstream media (ie those who have the most to gain). Web sites don't work because they have to be found & the majority of people just won't be looking or have their web content spoon fed to them through portals like AOL & MSN who clearly have a vested interest in these matters.
How can we spread the word? The only idea I can think of right now is a well worded email chain letter - unfortunately I (and I would guess most
[BTW I'm British, so this proposed law doesn't affect me as much as many
"Linux is a serious competitor"
- Steve Ballmer, Chief Executive Microsoft Corp.
As an EE student, I have to say that I love this idea! If this bill ever passed, it would make my job VERY hard. Just consider the following example:
Sure it may be easy to compute fourier transforms (or whatever) in realtime for a 44KHz singal, checking for some sort of watermark, but what about high bitrate systems? A 96KHz 24bit 6 channel stream of audio amounts to 13.8 Mbits/sec of data. A computer to check all that data in for copyright infringement in realtime is going to be pretty expensive. What if all I'm asking is a digital delay box for that data? All I'd nomrally need inside the box is some RAM and something to read and write to that RAM. Now that all of a sudden, I need to do real computation on that data the cost of my device would skyrocket. It might suddenly become cheaper to get 1ms of delay, by using 100' of wire than by doing it in the digital domain!
What about Digital Storage Oscilloscopes? Does a 1GHz DSO have to check all that data (A ton of data, even if it doesn't caputre at that rate continuously) before letting me download it to a PC? I could easily hook that oscilloscope up to the output of a protected device and caputure the signal.
What about FPGAs? Are they goiung to be regulated devices? Right now one could co nnect one to the coax SPDIF out on their DVD Player and program it to run an FIR filter to remove the watermark. It would be pretty much impossible to make it so that I couldn't program it to filter a watermark and still have it be a useful device.
Last week, I had a pretty interesting discussion with on eof the professors for a DSP course I'm taking, just talking about all the stupid thing that hollywood was tried to get pused through. They actually tried to get a law passed so that your audio device would not copy music if it contained a certain frequency! Not even a combination of frequerncies, but one single frequency! A single distorted guitar, would probably be enough to set that off!
Hopefully certain companies (TI for instance makes audio ICs, and DSP chips, but doesn't own a record label.) understand how much this law would increase their costs and get it killed, fast.
Life is too short to proofread.
Even so, they can have my DNA Polymerase when they extract it from my cold, dead fingers (and arms, blood, liver, etc.)
Sig:Why copyright isn't a fundamental human right
--
Power to the Peaceful
Do you have a link about the $70M for price fixing, sounds like a story I'd like to read.
Life is too short to proofread.
I think of Junkie XL's tune "Future In Computer Hell." Can't take all the Disney money with you, old man.
On the lighter side, this sort of thing will make life harder on the consumer... right? Well, the way I see it, I'll never be out of a job. I'll be answering stupid questions all hours of the day, fixing some sort of DRM problems. Hey man, Windows is good for that, so why not (insert devilish bill in congress)?
I don't think that list included the telephone. I could play music over it, and someone on the other end could record it. I'll bet Fritz wants to ban phones now.
How ya like dat?
It strikes me that most of the arguments against the CDBTPA I see posted on /. are purely logistical in nature. They run along the lines of, "If this is passed, such and such(billy bass) would be illegal, now wouldn't that be stupid." or, "If you implement this in devices, it will have these bad consequences(can't film kids in front of coke machine, etc)."
./ers still wouldn't like it.
I've yet to see a really good argument that attacks the basis for the CDBTPA, rather than just saying why it won't work. And yet I get the impression that even if it was implemented in a non-intrusive, practical manner,
So why not argue against the ideals behind the bill? Rather than just saying it's a bad bill?
Or, if the actual ideas behind the the CDBTPA are sound, why not try to find a good way to implement it?
What's in a Sig?
-an old saw, but still true.
Or, if you prefer the Atlas Shrugged side of things, these laws are just passed to make sure everyone is a lawbreaker.
I'm seriously starting to think about it, especially if shit like this passes. Now, where should I go?
-IOVAR Web Dev Platform
Note that all of the devices mentioned on the site were digital. The telephone is analog.
Fritz was and is a fucking idiot.
I see Fritz's organization is very technically capable and definitely able to produce sound legislation in this arena. I mean, check out this message. http://hollings.senate.gov/email.html It only takes them weeks to upgrade their email servers! How'd they do that! Old Fritz himself must be pouring over the sendmail man pages as you read this. I guess I'll have to phone in my rant...
Wrong? What's wrong about keeping another couple of thousand American civilians from being killed?
between digital media devices and guns.
After all, guns have decent, law abiding uses like hunting, self defense, target shooting, collectables, and such.
Clearly digital media devices also have many law abiding uses.
Guns also have illegal uses, and let's face it, those illegal uses are FAR worse than any illegal uses of digital media devices. At least abuse of digital devices doesn't kill.
Therefore, if Fritz is to get his way, there is a clear parallel to place 'access restraint' devices in every marketed gun. Enlist the NRA to help fight our battle.
I know this is silly. But I'm not sure I know what's wrong with the reasoning, at least until I get to the prior paragraph.
In a much more meaningful sense...
I work in the electronics field. My employer has had rounds of layoffs in the past year, as have others. Our state has been badly hurt. IMHO the stuff Hollings is trying to push through will hurt the tech industry, badly. One of my Senators (Leahy) has been in Hollywood's pocket in the past. He needs to understand that this will hurt our state if this nonsense gets put into law.
I wish I knew what was the most effective way to communicate. In the past, I guess the phone has gotten the most specific response, even better than a letter delivered directly to his office in town.
The living have better things to do than to continue hating the dead.
I kurt pulling a tupac?
Which means instead of getting some socks, a drill, some books and a Billy Bass for Christmas, you're just going to get a Billy Bass.
You poor guy. That's not a DRM issue. You need to swap out your friends/relatives for a new set that will give you the socks, drill, and books instead. ;)
My cellphone looks digital enough to me.
I'm not sure if that's funny or revolting. And I'm surprised the site isn't /.'ed - just slow. Any idea how many batteries it takes to get that Volvo to "sing"?
I think this hit list is totally stupid. Half the things on that list wouldn't fall under the law.
Too bad your -1 wrong post also gets +1 funny.
Everything on that list IS covered.
Perhaps they changed the language, but last time I checked they specified "interactive digital device" and defined it. As far as I could tell the definition would also have covered a tinker toy.
So yes, it is totally stupid. Not the list, but the law that prompted the list. 100% brain-dead stupid. From a US Senator. Oh joy.
-
- - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
The actual part of the bill that is being attacked here is down in the definitions:
(3) DIGITAL MEDIA DEVICE. -- The term "digital media device" means any hardware or software that --
(A) reproduces copyrighted works in digital form;
(B) converts copyrighted works in digital form into a form whereby the images and sounds are visible or audible; or
(C) retrieves or accesses copyrighted works in digital form and transfers or makes available for transfer such works to hardware or software described in subparagraph (B).
As I highlighted, B is the offending line. Consider - those buttons that are sewn into stuffed animals that play music when pressed? Those match the definition in (B).
But this is not the only technical offender. A digital camera can easily be in violation (see part (A) of the definition, then take a picture of a billboard). More significantly, the Internet itself is probably a definition (C) product - certainly, a modem, LAN card, or disk drive is (load a document, or display a web site).
Unfortunately, this definition is, at heart, flawed - way too broad, and way too inclusive.
We are the Music Makers, and We are the Dreamers of Dreams...
No, mod parent's parent up. It's got nothing to do with 9/11. It has to do with Enron, Qwest, Tyco, and business icons with feet of clay like Jack Welch. It's about the CEO's golden parachutes and the workers' worthless retirement accounts and dashed dreams.
You know, the party behind DMCA.
Yeah, I know this is /. and we can't let facts get in the way of our bashing of Ashcroft.
The advertisements are part of a series called "Campaign for Freedom", they are funded by the The Advertising Council.
The ads are a continuation of the Ad Council's September 11th PSAs.
From the Ad Council's September 11th page:
On September 11th, America was shattered by acts of terrorism. Our nation, our citizens, and the belief system upon which our country was founded were shaken.
The Ad Council returned to its wartime footing, developing messages that would help Americans remain strong throughout the war on terrorism, just as it had during World War II. Public service messages to help the country respond and recover from the attacks were also developed. The first PSA began running just 10 days after the attacks.
Early PSAs like "I am an American" celebrated the country's extraordinary diversity and reminded people of the values that make America so unique. Other early PSAs included Laura Bush encouraging parents to talk to their kids, and others emphasizing tolerance and the importance of going on with our lives by "Living Brave."
A short time later, the Ad Council announced its "Campaign for Freedom," an initiative developed on behalf of the entire advertising industry. This important campaign was designed to inform, involve, and inspire Americans to participate in activities that will strengthen our nation and help support the war on terrorism.
From the Ad Council's "Campaign for Freedom" page:
Developed following the tragedies of September 11th, the Ad Council's Campaign for Freedom is an unprecedented volunteer effort from the advertising industry. The initiative is designed to assist Americans during the war on terrorism through the development of timely and relevant PSAs. This first round of PSAs has been created to celebrate our nation's freedom and remind Americans about the importance of freedom and the need to protect it for future generations. According to research, Americans are looking for messages that will inform, involve and inspire them during the war on terrorism. This inspirational campaign is advertising's gift to America. All of the ads conclude with the powerful tagline, "Freedom. Appreciate it. Cherish it. Protect it."
Happy Fun Ball is for external use only.
Fingers - a digit-al device sometimes used to play music, tap music, whistle music, and snap music. And sometimes, more often than not a digital birdie is used for processing. Fight piracy - regulate fingers!
Beer is reality.
He painted a unicorn in outer space. I'm askin' ya, what's it breathin'?
My PBX phone here at work is pretty digital.
Being a member of the wonderful state of South Carolina, I hear a little more about Fritz than the average American. For the most part, I view him as just another old representative of our state who has antiquated views and really shouldn't be messing around with technology laws, but I found out that he actually did do some good things a few months ago in that sector. Bill S. 2201 was a compromise between him and two other senators about the "opt-in/opt-out" debate. I was very pleased to see that Fritz supported "opt-in" methods for advertising, but the other two senators were against him, afraid that big business would lose out, I guess. The bill determined, I believe, that "sensitive" information would have to be "opted-in" in order for companies to distribute it or something like that, but non-essential info was "opt-out." The bill also gave us the right to sue companies for leaking our information and to see what information those companies actually have about us. Although it didn't do nearly the stuff that I think most of us would like to see done against spammers and pop-up providers, it was one of the first steps we've seen towards regulating stuff on the Internet. Unfortunately, I see that he's followed that up with a bill as stupid as this one. I'm hoping it doesn't pass, as is nearly everyone else, I think.
Actually, I wasn't going to mention this, because I haven't checked my facts, but since you approach the topic....
I'm under the impression that under the Constitution one right/reason/responsibility to own guns is the overthrow of a tyrannical government. I seem to remember a line that if the government becomes tyrannical, it is our responsibility to "throw it off."
I don't have time at the moment to find the reference, so I'm not putting it in my regular thread. But it does appear in line with shooting tax collectors.
The living have better things to do than to continue hating the dead.
Fritz Hit List #8
:]
Those voice-boxes for throat-cancer patients that enable them to speak with a deep voice will now need to protected with government approved anti-copright protection.
>>>>>
I thought that Deep Throat worked for the government & was a high-ranking official at that. Maybe he'll be kind enough to help us kill this crazy thing before it drives up the cost of his voicebox...
That guy's really screwed...
Code, Hardware, stuff like that.
Let the yanks legislate themselves back into the dark ages. It's their punishment for fostering the notions that greed, selfishness and arrogance are enviable traits. Oh yeah, and you don't have the authority to police the rest of the fucking World either. Piss off back to your fucking colonies...
2) stick tongue out
3) close lips lightly over tongue
4) exhale
Eternity: will that be smoking, or non-smoking? I Corinthians 6:9-10
...a tax for the porn entertainment industry.
I've said it before, and I'll say it again: The quickest way to solidify public support against this sort of legislation is to make sure people know that it will benefit the porn industry.
That the porn industry is only a small part of the total entertainment industry is a mere detail. The important point is that if enough people believe that this legislation is for the benefit of the porn industry -- and they will if enough of us tell our family & friends that's what it's really all about -- it will die in committee.
When do they realize that they can never ever stop something from being copied again when in the first place it was copied legally for distribution. This can only happen when Britney Spears can come to my home and sing to me after making sure I don't have any recording device.
Your land line telephone isn't digital, Sparky. Hollings trusts the phone company (whose digital switches multiplex the analog phone signals together for transmissino). He just doesn't trust YOU.
Your Sprint mobile phone is, however, and would arguably fall under the law.
Why yes, I AM a rocket scientist!
[The Democratic Party was] the party behind DMCA.
It wasn't just the DeMoCrAts; the DMCA had bipartisan support. Heck, it was passed by voice vote, which means it didn't even have enough opposition to bring the bill to a real vote.
we can't let facts get in the way of our bashing of Ashcroft.
The problem with USA copyright law isn't entirely AG John Ashcroft's. It's what the courts did to Richard Ashcroft of the band The Verve.
Will I retire or break 10K?
Now how do you get from this to Barbie? She's not making copyrighted works audible, other than her own recorded voice!
And why has no one pointed out that the bill fails to say anything about what the security standards are required to do?
Actually DNA is already encrypted. DNA is not allowed out of the nucleus of the cell and is incapable of making proteins by itself, it's a protected format. The information contained in the DNA has to be transcribed into RNA which is allowed into the cellular cytoplasm where it is translated into proteins by a ribosome. This process requires several proteins and enzymes. Copying DNA with DNA polymerase is like copying an encrypted file, it is useless untill it is converted into a "hackable" format and decrypted.
There are hundreds of amazing parallels between biological and digital information... after all it's just data.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
If i copyright my body, does that mean that when i'm getting a CAT scan, that the machine wont work becuase it's trying to digitally repilicate a copyrighted work?
"Good night, good work, sleep well, I'll most likely kill you in the morning." - Dread Pirate Roberts
...stating that IF this bill is passed, the movie and music industries MUST release all of their materials for use over these "unused/unwanted technologies" with the ability to record them for later LEGAL "Fair Use" exercising. Or something to that effect, that would lock them into it *and if they refused, say, oh, the bill gets automatically repealed or something*
There are 4 boxes to use in the defense of liberty: soap, ballot, jury, ammo. Use in that order. Starting now.
By itself it doesn't have a lot of bite, but combine it with two other laws, the DMCA and UCITA, to form building blocks of a much larger system. Couldn't this decoupled decentralized system effectively transfer government powers to corporations.
Users would become citizens.
Citizens pay taxes (subscriptions) to services (software).
Only those who are licensed and bonded are authorized to provide services (software).
Only those who are licensed and bonded are authorized to innovate. Violators will be caught by the Thought Police.
Networks become overlapping virtual countries, states, territories. wonder which company is headed by the digital hitler, and who do they burn in the recycle bin?
GPL is represented as the evil threatening Communism.
Spreads the idea abstience from using open source software is the only effective means of protection from HIV, which causes AIDS.
but most of all, it only really means
Corporations realize their #1 commodity is humans, and assumes it's rightful role of a surrogant mother.
Welcome to the matrix.
ok maybe i'm just rambling paranonid thoughts...i certainly hope so!
mindrape
I don't think that list included the telephone.
What telephone ?? There is no telephone in the list.
But there is however a digital ansvering machine.
The fact that in the name of to keeping those "couple of thousand Americans" from being killed you are killing tens or hundreds of thousands of innocent people (well, they are guilty of persistantly not being American..) and creating whole generations of people who will quite gladly give their lives just to make you hurt.
Holy Zarquon's singing fish!!!
I bought this house and you know I'm boss
Ain't no h'aint gonna run me off
If you use ISDN rather than POTS then your telephone is digital. So most (company) PBXs would also fall under the law.
Seriously, has anyone had any experience with visiting family/friends and seeing one of those tacky pieces of crap? What did you say/do? Grab it and throw it out the window/in the trash, or try and reason with them?
(begin quote)
Your land line telephone isn't digital...
(end quote)
True, but if you have a digital cell phone, then you have a digital circuit to send music over (eg. Sprint) and therefore, would be regulated.
-RB
"One man can change the world with a bullet in the right place."
- Mick Travis, "If..."
That you for proving the original poster's point that people have absolutely no clue what the law says.
Again, Fritz trusts corporations. He just doesn't trust YOU.
Why yes, I AM a rocket scientist!
If you click on this it tells you more about the contruction of the thing. Revolting? Really? I think it's awesome! You really should see this thing in the flesh, it's amazing what they've done. And to answer your question, I quote from the site:
"At best estimate, at least 19,000 feet of wire is in the control system. Most of it goes into the car body where it is twisted into bundles of increasing size as it makes it's way to the trunk. The trunk contains the driver circuitry, a 12 volt battery for the stereo, and a 6 volt deep discharge golf cart battery capable of delivering 75 amps for over 3 hours. If all motors on all fish were operated simultaneously the peak draw would be roughly 250 to 300 amps. The wiring is protected by partitioning and multiple in-line fuses, and a large circuit breaker panel in the driver's compartment allows instant shutdown. Isolation is maintained from the automotive electronics."