Slashdot Mirror


Your Genome Scanned While You Wait

dotc writes "A Wired reporter has his DNA scanned for disease predispositions. While we all knew this was coming soon, it's still a little strange to read the first-person account."

132 of 261 comments (clear)

  1. Job Discrimination by MCMLXXVI · · Score: 5, Funny

    When will we have to make sure we leave no testable samples of DNA when going in for an interview?
    More importantly when we go on dates? :)

    1. Re:Job Discrimination by Anonymous Coward · · Score: 5, Funny

      Funny, on dates, that is usually what I'm trying to leave behind.

    2. Re:Job Discrimination by davejenkins · · Score: 4, Funny

      Uma Thurman can test my DNA anytime she wants to.

    3. Re:Job Discrimination by Zeebs · · Score: 2, Interesting

      I always thought the purpose of a date was genetic sampling. I mean you get the look, the smell(which hopefully isn't too powerfully covered), and through a kiss perhaps a little taste. :) All of which are susposed to help you determine if mating with this person would produce fit offspring. Obviously if it would then you will be attracted to this person.
      I managed to dig up some stuff on it for anyone interested, my recolection is dim anyway.
      Try The Single Chromosome's Guide To Dating
      Or the Google Text Conversion

      --

      Happy Noodle Boy says "F###ing doughnut! Mock me? You fried cyclops!!"
    4. Re:Job Discrimination by gosand · · Score: 3, Funny
      When will we have to make sure we leave no testable samples of DNA when going in for an interview?

      When I first read this, I thought it said "testicle samples". Which was funny, but then made the next line even funnier...

      More importantly when we go on dates? :)

      --

      My beliefs do not require that you agree with them.

  2. Gattica by Hayzeus · · Score: 5, Funny

    ...is just a few years away. On the upside, GE should render those "add three inches..." spams pretty much obsolete for my grandchildren.

    1. Re:Gattica by efatapo · · Score: 5, Informative

      Normally I wouldn't correct spelling. But it's "GATTACA". Get it? Guanine, Adenosine, Thymine, Cytosine. Those are the nucleotides that make up DNA. There's a reason for the name. Just thought I'd point that out.

    2. Re:Gattica by f97tosc · · Score: 5, Insightful

      Well, actually it is quite some ways, they have to go from checking to manipulation.

      Gattica was an intresting movie, but there were a lot of things that did not make sense. For one thing, the genetic tests were omnipresent - they alone determined what job you would get and whom you would date. They even had to take genetic tests to get into work every day, and the company would search through its facilities to make sure that nobody with inferior genes was present.

      On the other hand, the main character did not have 'improved' genes, and so he had to falsify his identity to get a job. However, he appeared to be just as competent as all the other people where he worked, perhaps more so. Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?

      A different scenario is that genetic manipulation really does make people smarter and more competent. But then this could probably be identified through normal tests and interviews.

      I don't know which scenario is scarier.

      Tor

    3. Re:Gattica by Anonymous Coward · · Score: 5, Insightful

      "Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?"

      For much the same reason why corporations go to great lengths to exclude people without a 'good' education. They're social thought of as being superior people, even if they aren't. That was the gist of the movie.

    4. Re:Gattica by Triv · · Score: 5, Interesting
      Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?

      Gee, I don't know - wonder why some people thing black people are inferior just because they're black (or green, or gay or whatever). That's what prejudice is - basing a judgement of someone on something arbitrary rather than experience, education level, etc.

      There was a great episode of "This American Life" called Them that talks about this, particularly the last story.

      From the show's description of this last story:
      Act III: Newfies. Reporter Chris Brookes had always thought the story was a joke. During World War II, a black sailor from the U.S. washed up nearly dead onshore in Newfoundland, and the white nurses -- never having seen a black man -- thought he was covered in oil and tried to scrub him clean. But when Brookes finally tracked the sailor down, decades later, it turned the whole thing was true. And the sailor said that sort of treatment was a lot nicer than what he'd been used to at the hands of whites down south. Brookes tells the incredible story of the sailor, Lanier Phillips, and how his experience in Newfoundland changed his life.


      Grab it. Give a listen. :)

      Triv
    5. Re:Gattica by Telastyn · · Score: 2

      It wasn't that they were using genetic testing to keep 'inferior' people out, the genetic testing is an identification method, like retina scans and the such.

    6. Re:Gattica by Daniel+Dvorkin · · Score: 2

      It's an acronym, kinda. The point is that the letters in the title are G, A, T, and C. There are no nucleotides whose names start with I. (At least not in DNA; I suppose it would be possible to have a helical nucleic acid that incorporated isoleucine, but it doesn't happen in nature.)

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    7. Re:Gattica by NeoSkandranon · · Score: 2

      Probably because not having a "good" education may actually keep you from being able to do a job well. Imagine that.

      --
      If you can't see the value in jet powered ants you should turn in your nerd card. - Dunbal (464142)
    8. Re:Gattica by jimmyCarter · · Score: 2, Insightful

      Think beyond the job skills scenario a little -- if a corporation had the blueprints to the DNA of every employee and discovered that one of the employees had a predisposition to lung cancer, would it be wise to spend money on training and associated other job costs for said employee?

      The question was would it be wise, not would it be immoral.

      --

      -- jimmycarter
    9. Re:Gattica by yakovlev · · Score: 2, Interesting

      The theory is that it's a percentages game. If 80% of people with "superior" genes are capable and 80% of people wih "inferior" genes are incapable, then it makes sense statistically to do gene screening. Sure, there are people who don't fit the mold, but it would probably be more accurate than interviews.

      However, there would be so many exceptions that for 20% of the population with "inferior" genes it would be useless discrimination, which is what the movie portrays.

    10. Re:Gattica by gpinzone · · Score: 2

      Actually, the genetically enhanced people were more physically fit, smarter, etc. The problem is that it became the only indicator used. The world became a place where EVERYONE was smart, strong, etc. How do you select an applicant for a job when they're all 10s in every catagory?

      It was about discrimination against people who probably WOULD be qualified, but didn't have the same opportunity based on their genes.

    11. Re:Gattica by 0x0d0a · · Score: 2

      why would corporations go though great lengths to exclude people with inferior genes, if these are not real indicators of performance

      They wouldn't. Gattaca was designed to be a shock-and-alarm film, scaring people with new technology ("I'll be screwed over because of my *genes*!"). Companies are quite dilligent on crunching the numbers on this -- this is why insurance companies can even exist.

      On the other hand, if this *was* a real indicator of performance *in general*, the single person who's an exception to the rule could certainly be screwed over. The company isn't willing to hire because the evidence available says that the guy isn't going to be a good employee...but the same thing happens today, based on other data.

      Frankly, I think that the "scariness" of genetic engineering and genetic testing has been way overblown, but...

    12. Re:Gattica by one9nine · · Score: 4, Funny

      If your going to play the role of the obnoxious know-it-all slashdot poster, at least get it right. It's adenine, not adenosine.

    13. Re:Gattica by Daniel+Dvorkin · · Score: 2

      Couldn't you form an isoleuc-[whatever suffix] nucleotide? Aaargh. I can't remember now.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    14. Re:Gattica by Shenkerian · · Score: 5, Funny

      If you're going to play the role of the obnoxious holier-than-thou slashdot poster bitch-slapping the know-it-all slashdot poster, at least get it right. It's you're, not your.

      --
      You tell me how "whilst" differs from "while," and I'll stop calling you a pretentious jackass.
    15. Re:Gattica by SiliconEntity · · Score: 2

      Gattaca is in part an allegory about racism. The genetic "invalids" were treated like blacks and other minorities have been in the past. By making the victims of discrimination be people like us, the film lets us see things from the perspective of the oppressed class.

    16. Re:Gattica by jafuser · · Score: 2
      1. It's not a matter of boolean on or off, it's a grey scale. You want to only use the people who are most likely to do the best job. There may be people who are able to do a great job who do not fit the profile, but it is not "efficient" to try every person out first to see if a rare exception exists.
      2. If I recall correctly (I only saw the movie once), the main character actually was not fit for the job, as I seem to recall he was having a very hard time on the treadmill, while the other "genetically legitimate" characters in the same room seemed to be handling the excercise fine. But since it's been a while since I saw the movie, it could be that he was not able to handle it due to some other circumstance.
      --
      Please consider making an automatic monthly recurring donation to the EFF
  3. WHAT? Body scans?! by gpinzone · · Score: 4, Funny

    You mean I've been collecting Jude Law's blood and urine samples all these years for nothing?!

  4. The next news article by Drunken+Coward · · Score: 5, Insightful

    And of course, the next news article will be that HMO's have begun rejecting medical procedures based on the predisposition for certain diseases of certain genomes.

    --
    Have you been stalked by Seth today?
    1. Re:The next news article by foolish · · Score: 5, Interesting

      Since they've already done this for every other type of testing result in the past, that's hardly a suprise right?

      'Oh you might have a heart problem sometime in the future, even though you're treating the issues and being proactive, I'm sorry, we're going to have to increase your premium 400%'

      IIRC, UC-Berkeley employees ended up suing some of the HMOs because they were unfairly rejecting African Americans because they carried a higher risk for high blood pressure, sickle cell, etc.

      Nevermind the issues for the whole 'expression of the predisposition' and how accurate these readings are at this time.

      Diagnostics, the double/triple edged sword. Wheee!

    2. Re:The next news article by Oculus+Habent · · Score: 2

      I think that you could fairly make a case that until the entire genome is reasonably understood and we have a huge database of data from which to calculate percentages, genetic indicators alone are not enough proof for rejection.

      The really interesting future learning could come from massive data stores with thousands of people's genomes, family histories, and health records all being compared to more quickly isolate the functions of various SNPs.

      --
      That what was all this school was for... to teach us how to solve our own problems. -- janeowit
    3. Re:The next news article by gpinzone · · Score: 4, Interesting

      On the flip side, why should I pay higher Insurance rates for your heart attack? The whole idea of insurance is to guard against the unknown. It ceases to be a useful model of healthcare reimbursement when the ability to predict health problems becomes a reality.

      Let's not hang onto an old business model of a lottery system for healthcare and come up with a new paradigm that's more fair to all.

    4. Re:The next news article by back_pages · · Score: 2
      The point of group insurance is to ameliorate the costs of any individual's costs among the entire group. This system works best when we all pay the same amount, therefore we all get the same amount of unknown, future protection.

      Exceptions to this often exist when an individual has behavior that increases his likelihood of high costs. Motorcycle stunt riders, lifetime smokers, and lion tamers should expect to pay more, since their behavior places them at higher risk of burdensome medical costs.

      If we assess these high fees based on a person's identity, for example, skin color or genome content, it is no different than saying that "black people are likely to commit crimes, so round them up first when looking for a suspect." While you might actually catch a lot of criminals this way, it is hardly ethical or just.

      In health insurance, unlike policing the citizenry, if you raise fees based on a person's identity rather than their behavior, they are likely to quit participating in the system, which decreases the combined financial pool, which increases the burden on you to pay for your medical costs. As long as a person can say, "If I quit smoking, I'll save money," they're far more likely to cough up the cash.

      Group health care is a very interesting and finnicky instance of philosophy and economics. There are many things you cannot do in health care that is perfectly permissible in other areas due to the artificial communism that makes health care work.

    5. Re:The next news article by gpinzone · · Score: 2

      Being the selfish human being that I am, I'd say that you should pay for it all. Since I can't force you to do that, I'll have to comprimise and find a way that's fair to everyone. (Aw shucks!)

    6. Re:The next news article by Ouroboro · · Score: 2

      On the flip side, why should I pay higher Insurance rates for your heart attack?

      OK, but what's to say you're not the one harboring the genetic predisposition for a heart attack. What are you going to do with your crushing medical bills after you have that heart attack? Especially since you are uninsured because your insurance company dropped you when they found out about your predisposition. Or even worse, imagine how loudly you will be whining about not being able to get proper health care because you can't afford the bills.

      I personaly would rather pay marginally higher premiums if it would mean that fewer people would be left without medical care. Why? Because even though I am healthy, and don't really need the safety net of insurance, there is the very real possibility that my situation would change and I will be able to experience things from the other side of the fence.

      --
      When I want your opinion I will beat it out of you.
    7. Re:The next news article by bm_luethke · · Score: 2, Insightful

      you pay for me heart attack because I will pay for you diabetes (or whatever problem you have). Health care isn't for the unknown, its for the god awfull expensive. Even though health care costs more than it really should it is still a very expensive proposition.

      Take for example medical isotopes. Where I work produces some of them (along with californium and other fun stuff). Not only are there only a handfull places in the world capable of producing them but the power need of the reactor is the size of a small town. We pool our money together for stuff such as that - much as we pay taxes for common things that we can not individually afford but need.

      In fact if you can accuratly predict medical problems the system makes even more sense as you could accuratly predict costs and therefore produce a more fair costs spread. It could also be abused much more easily: your too expensive so let us let you die. That is where govt regulations make sense - make sure costs dont run unfairly high (as your demand curve is basically straight up and down - suppliers can charge what they wish) and make sure no one falls under the cracks.

      The problem with todays health care system in the US (can't say about other countries, I don't know) is that th regulations are there about falling through the craks but not really enforcing sane costs. So a drug, including r&d, production, etc , that costs 2 dollars a pill will cost 50 dollars a pill: insurance or the govt will pay for it so charge what you want. (govt will pick up your bill after you go broke, the laws only propose that you get medicine - nothing else).

      --
      ------- Sorry about the spelling, I suffer from two problems. Dyslexia makes it difficult to spell well, lazy makes it
    8. Re:The next news article by Bartmoss · · Score: 2

      Paying for someone else's problem is the ENTIRE idea of an insurance. You accept a small financial loss to guard against the risk of a huge one. Everybody pools the small amounts together so that the few who do get unlucky are covered.

      I surely hope that any "low risk patients" who'd have to pay less actually also get less treatment when they do have a heart attack (to use your example). Afterall, they did not pay for it.
      And before you use this comparison: Genetic makeup and bungee jumping (for instance) are not the same. While both does not mean that you will actually come to harm, the later is a lifestyle choice. It's a risk you willingly take, so you have to pay a higher premium for the added risk.

      Discrimination based on genetic make-up is the high-tech version of racism. You cannot choose your color of skin (Michael Jackson being the exception that proves the rule) just as you cannot pick your genetic sequences.

  5. This isn't as good as it sounds by Anonymous Coward · · Score: 3, Insightful

    1) People will take predispositions too seriously. People with 'bad' genes will think they're doomed and live like it. People without any 'bad' genes will think they're bulletproof and live like it.
    2) This won't just be used for diseases. You may remember in the movie Gattica there was one of these devices being used for personality analisis. How long before (even if made illegal) employers feed this information in about employees? People run their date's information through a computer to try and predict compatibility?

    1. Re:This isn't as good as it sounds by calbanese · · Score: 2, Funny

      Somehow I doubt any employer would be allowed to request a DNA sample before offering you a job or benefits.

      Once the secret army of ashcroft deploys all the black helicopters in an effort to infiltrate the new world...oh wait, wrong site.

    2. Re:This isn't as good as it sounds by micromoog · · Score: 2

      Not right now. But all it takes is one significant event to create enough temporary hysteria to pass anything through Congress.

    3. Re:This isn't as good as it sounds by DEBEDb · · Score: 3, Funny
      Yes, but I believe they have to disclose what they intend to do with it.


      Some companies bottle it...

      --

      Considered harmful.
  6. What we all knew... by norcal · · Score: 2, Insightful

    ...was that this was coming. The question now are, when and will people accept this as a moral practice, or reject it as something unethical.

  7. But by vasah20 · · Score: 3, Funny

    ... we all earned from Bart in episode 2F20 (The conclusion to "Maggie Shot Mr. Burns") that no court would ever accept DNA evidence!

  8. This is very premature technology by Adam+Rightmann · · Score: 3, Insightful

    Sure, you can find a few statistical correlations between a few very dangerous diseases and genetic markers, but as the story points out, they still don't know enough to say for certain that a person will get breast cancer at age 47 1/2, or have a heart attack at 53 while climbing 3 flights of stairs.

    We don't know enough about the genetic code yet (whether we should even try to learn it is another debate, you need only look at how Western Society has been damaged by the results of invetigating the poor fertility of yam-eating Mexican Indians) to do more than rough guesses that are about as accurate as asking about your families medical history.

    If you want to live longer, eat right, exercise and don't smoke. I'm sure our Pope will soon ban this useless exercise, anyhow.

    --
    A. Rightmann
    1. Re:This is very premature technology by zeoslap · · Score: 5, Insightful

      First off he's not my pope. Secondly it's far from useless, understanding who we are has been a driving force for positive change through the ages, lets not kid ourselves into thinking that knowledge is a bad thing...

    2. Re:This is very premature technology by f97tosc · · Score: 3, Informative

      Sure, you can find a few statistical correlations between a few very dangerous diseases and genetic markers, but as the story points out, they still don't know enough to say for certain that a person will get breast cancer at age 47 1/2, or have a heart attack at 53 while climbing 3 flights of stairs.

      And they never will, because the cancer is very dependent on certain random events (incorrect cell duplications), and heart attacks on diet and amount of exercise.

      Tor

    3. Re:This is very premature technology by iabervon · · Score: 2

      We'll never be able to predict that sort of thing from genetics, because environment matters a lot more than genetics. It's just that genetics matters some, and it's relatively easy to research accurately. At most, genetics is going to tell you what you're likely to die of if you do nothing to change it, and it could be useful in telling you which ways it would be wise to shift your risk factors. It's probably good to know whether you have to worry about malaria or having anemic children, for instance.

      For that matter, there are enough diseases that are easy to treat if caught early but otherwise deadly that it's hard to check for all of them all the time. It's useful to be able to say that a certain person has to worry more about breast cancer than other things, and check for that more frequently.

  9. Venter by Anonymous Coward · · Score: 3, Informative

    I read that J. Craig Venter (owner of Celera, who beat the HUGO project to sequence the human genome) sells the opportunity to have your own genome sequenced for 500,000$

    1. Re:Venter by genomancer · · Score: 4, Informative

      What Celera/Ventner are selling for .5M is having your genome SEQUENCED, not scanned. The former is a base-pair level map of your entire genome. The latter is checking certain windows to see if they contain a known, small, problem causing mutation, (as well as some large checks for rearrangements and such).

      It's sort of the difference between reverse compiling the entire suorce code for an app (hard), and checking certain locations for passwords/corruption/etc.

      G

      Ps: Celera's map didn't really beat HUGO, they're both totally incomplete, with tons of errors known and unknown.

    2. Re:Venter by 0x0d0a · · Score: 2

      reverse compiling

      Commonly known as decompiling.

      BTW, Java is a language very well suited to decompilation, if you want to take a look at automated decompilers.

  10. Genescope by tsa · · Score: 2

    How far into the future is the Genescope from Michael Cordy's books, a device that, among other things, can show a real life image of someone constructed from his/her DNA?

    --

    -- Cheers!

    1. Re:Genescope by Gorm+the+DBA · · Score: 5, Funny
      Not all that close, when you consider that DNA knows nothing about what's happened to you since birth in terms of did you lose an eye in a tragic carrot eating accident, or do you have a scar on your left forearm from that attack by the killer monkeys, or anything else that is nurture over nature.

  11. Soon to be overheard... by azadrozny · · Score: 3, Funny

    ... on school playgrounds everywhere:
    "My genome is better than your genome!"

  12. My Genes by conduit4 · · Score: 2, Funny

    My jeans get scaned everytime I walk down the street and the ladys check out my ass.

  13. Wow... by KenCrandall · · Score: 5, Insightful

    Did anyone other than me just get *TOTALLY* creeped-out by that article? Not the Gattica references, although the social implications are staggering (i.e. the Philip-Morris quote), but more of the feeling that knowing all the things about my body that *could* go wrong, and trying to treat them in advance is just something that we don't understand the ramifications of entirely?

    1. Re:Wow... by jafuser · · Score: 2
      The problem is, they need to gather lots of information quickly, before many people start to know what their dispositions are. Once a large portion of the population go to their corner drug store and spend $25 to know their genetic predispositions, they will mostly all start behaving differently to avoid those potential diseses. This would certianly throw off the numbers, especially for preventable diseases.

      An important aspect of this research a chaotic reaction, probably not much unlike the stock market. I can imagine a highly preventable disease would even have skewed statistics to the point of being reversed...

      For example, you have two groups. Group A is predisposed to heart attacks. Group B is not. Group A leads a heart-healthy lifestyle, and beats the statistics by a large margin.

      Group B on the other hand, have found out that they are not as susceptible to heart attacks, so they continue eating their triple-bacon-cheeseburgers three times a week, and keel over at 45 of heart disease.

      Now the statistics are reversed. Now things get crazy. So it's important to stop gathering new information once a large portion of the population becomes aware of their genetic predispositions.

      --
      Please consider making an automatic monthly recurring donation to the EFF
  14. Genetic predispositioning... by UnidentifiedCoward · · Score: 5, Insightful

    is *NOT* the same as actually being diseased/sick. Just because you carry a ressive trait for diabetes or heart disease does not mean that you will suffer from either. I already know I am "predisposed to heartdisease and diabetes", my grandfather had it. I do not need a DNA scan to tell me.

    You tell some people they are predispositioned for heart disease and they are going to think it is a death warrant. Even though it is only a chance, people will throw money at it in attempt to do something about it. More importantly this will spawn a whole new branch of medicine where you sell drugs/therapy to healthy people. We are already starting to see that practice today, look at the logic behind pepcid/ac, the heartburn medication you take over the counter *before* you have heartburn.

    Just my two cents.

    1. Re:Genetic predispositioning... by bhsx · · Score: 3, Interesting

      While I agree with you to some extent, what if your grandfather brought about his own diseased heart? You would not have a predisposition to it from him (although you might from other members of your family tree that never actually suffered heart disease). You might be fooling yourself into thinking that not smoking and drinking lots of anticarcinogens is helping you, not knowing that your great-great-great-grandma had a hell of an alcoholism/adictivism kick in her gene pool that drinking all that red wine is plugging into.
      Just a thought.

      --
      put the what in the where?
    2. Re:Genetic predispositioning... by HiThere · · Score: 2

      Always remember, your father, or your grandfather, etc., might not be who you think it is. This makes family traits tracing a bit chancy. And I'm not even considering adoptees who were never told.

      One needs to worry about this when sifting the data, but for a population the errors can be corrected for (as noise in the signal). For an individual... a test is likely to be more accurate, if you know what you're testing for.

      --

      I think we've pushed this "anyone can grow up to be president" thing too far.
  15. Needs to review his genetics by sacremon · · Score: 5, Interesting

    "For instance, you might have a CG that makes you susceptible to diabetes, and I might have a CC, which makes it far less likely I will get this disease."

    CC is not an allowed base pairing. It could be GC, AT or TA instead, but CC would be recognized as a defect and repaired.

    --
    If you can't beat them, embrace and extend them.
    1. Re:Needs to review his genetics by Dambiel · · Score: 4, Informative

      he's talking about single strand bases, not pairing

      say you have:
      TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CG CTTGAACCT

      and I have:
      TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CC CTTGAACCT

      we each have a paired strand that would match them, but the CG/CC difference could still change susceptibility to a disease

    2. Re:Needs to review his genetics by Daniel+Dvorkin · · Score: 2

      That might be what he meant, but the way the article was written, it certainly sounded like he thought the CC might be a base pair. Would have been better if he hadn't used one good base pair (CG) and one bad one (CC) in the example.

      And yes, I know a lot of people will see this as a nitpick, but damn it, this stuff is important.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    3. Re:Needs to review his genetics by gorilla · · Score: 2

      Of course he should be using triplets, not pairs. Two bases on their own are meaningless,3 bases mean a particular amino acid (or stop). Going from CGA to CCA would result in a alanine being replaced by a glycine. Going from GCG to GCC would result in arginine either way, so would be harmless.

  16. What Turing and DNA have in common by PhysicsScholar · · Score: 2, Interesting

    All this talk about DNA had me thinking not only about mapping the human genome, but the very processes through which other organisms replicated and pass-on this DNA "code" to their very existance.

    Every hour, each E. coli bacterium multiplies by producing a copy of its DNA and then splitting into two daughter bacteria. Each is identical to its parent.

    But, when protein diffusion is combined with the binding and release of proteins from the cell membrane, oscillating patterns in E. Coli occur.

    Well, "Who cares?" you think to yourself.

    However, it's actually fascinating because this is almost identical to the Turing model reaction-diffusion equations that you read about in your biology class(es); behind every set of zebra stripes or leopard spots lies this Turing model.

    --

    Department of Physics and Atmospheric Science, Dalhousie University, Halifax, N.S., Canada, B3H 3J5
  17. One page by Klerck · · Score: 5, Informative
  18. Implications... by jaredcoleman · · Score: 3, Interesting

    DNA scanning will fan the flames of the fetus rights debate, as parents desire to alter the DNA of unborn children.

  19. Re:WHAT? Body scans?! by unicron · · Score: 3, Funny

    If you had bothered to test them you would've seen he was mecha.

    --
    Finally, math books without any of that base 6 crap in them.
  20. Geography by mccalli · · Score: 3, Interesting
    I do like the section where he finds he's genetically similar to the geneticist testing him....

    We check a map of Britain on his wall, and sure enough, the Sykes family's homeland of Yorkshire is less than 200 miles south of Perth.

    Err...Britain's not really that all that big. 200 miles is considered a fair distance here. I'm from Yorkshire originally, and there's no way I would have considered Perth to be close.

    I've sinced moved further south. It's 160 miles between where I came from (Sheffield in Yorkshire) and where I moved to (Marlow in Buckinghamshire). That too is considered a fair hop, although travelling that distance is something I'm completely used to now. But some of my friends in Yorkshire thing it's a long way to go.

    All a difference of scale, really.

    Cheers,
    Ian

    1. Re:Geography by Gruneun · · Score: 5, Funny

      200 miles is considered a fair distance here.

      My guess is that most of the readers here would willingly walk that distance if it meant getting laid.

    2. Re:Geography by The_Shadows · · Score: 3, Funny

      200 miles is considered a fair distance here.

      My guess is that most of the readers here
      would willingly walk that distance if it
      meant getting laid.


      Well, I would walk 500 miles, and I would walk 500 more just to be the man who walked a thousand miles to fall down at her door.

  21. Hmm by Rogerborg · · Score: 5, Insightful

    I wonder how long before we hear: Only those with something to hide would refuse to be screened. Using encryption (for example) just pisses off government, but there's nobody with deep pockets brib^H^H^H^H lobbying them to ban it. But insuring sickly people costs insurers big money. How much would it cost them to buy laws to make screening mandatory, or at least to allow them (all of them) to insist on it if you want a policy? At the least, I expect to see policy rises for those who refuse a screening, on the basis that only those with something to hide...

    --
    If you were blocking sigs, you wouldn't have to read this.
    1. Re:Hmm by msheppard · · Score: 5, Insightful

      Flip side: What if I get screened, show up super-clean, and want to pay less for health insurance? Shouldn't I be allowed to contract with an insurance company that only insures those that are screened?

      What are insurance companies allowed to discriminate on:
      Age? Yes.
      Sex? Yes.
      Smoker? Yes.
      Race? No.
      Relegion? No.
      Occupation? Yes.
      Licensed Private Pilot? Yes.
      Credit Raiting? Yes.
      Bungee Jumper? Yes.
      Genetic Predisposition? Maybe!

      In the end it's all numbers. If the numbers show people who wear blue shirts are more likely to get sick than those wearing red shirts... the insurance company should charge more to those in blue shirts. If you don't like this, go find another insurance company. It's legit to setup an insurance company that charges everyone excatly the same. If you're a 21 yr old smoker who flies ultralights, this might be the best bet for you. But if you're in perfect health and are extra careful with your self and have no predisposition, who are we to refuse this person the oppertunity to pay less. It's all gambling and knowing the odds changes the deal.

      M@

      --
      Krispy Cream is people
    2. Re:Hmm by Peyna · · Score: 2

      I kinda wonder about the race one, since some races of people are more susceptible to certain diseases and thus a higher risk in some categories.

      --
      What?
    3. Re:Hmm by Kombat · · Score: 2
      Insuring sickly people costs insurers big money.


      No it doesn't, it costs consumers (i.e., us) big money. In case you hadn't noticed, the insurance companies are making some quite nice profits, despite having to pay out now and then.

      What the whole "insurance" argument comes down to is, we need to ask ourself if the current private-sector insurance "lottery" is the way we want to keep the industry running. That is, right now, they're insuring us based on the estimate that some of us will get heart disease, but there's no way to tell who, so they spread the cost around over everyone insured. Those who live healthy are really paying for those who know they're a big risk, and only signed up for insurance for free money.

      Now personally, I'm Canadian, so I believe that it should be the job of the government to take care of those citizens who, through no fault of their own, inherited the Cystic Fibrosis gene or whatever. But under the current model, people basically expect free money from the insurance companies. Well, sorry, but there's no such thing as "free money." That money is coming out of the pockets of all the healthy people who will pay far more in than they'll ever get out.

      --
      Like woodworking? Build your own picture frames.
    4. Re:Hmm by runlvl0 · · Score: 3, Funny


      If the numbers show people who wear blue shirts are more likely to get sick than those wearing red shirts...

      I always thought that it was the ones in the red shirts who died first.

      --

      Carthago delenda est!
    5. Re:Hmm by msheppard · · Score: 2

      Much easier to measure a persons race then family history. Piece of cake to lie about family history too.

      If I ran an insurance company, and found that people born in the winter we're more likely to get sick, I'd charge them more.

      It's all numbers... only question is which numbers you decide to use.

      College education seems to be a very popular one these days.

      M@

      --
      Krispy Cream is people
    6. Re:Hmm by JoeBuck · · Score: 5, Insightful

      OK, let's say that the insurance companies can get prediction based on both genetics and lifestyle to the point where the money you pay them almost always exceeds the money they pay out for your health care, barring accidents, and even for accidents their lifestyle data gives them good insight into your probability of being hurt.

      This would mean that, for the majority, insurance would become vastly more expensive, to the point where it would become unaffordable. The government would have to pick it up, and effectively tax the healthy to help pay. The alternative is just to leave more and more people with no insurance at all, which will quickly drop the US life expectancy down to third world levels. So you just wind up killing the concept of private insurance altogether. This might be a good thing.

      Also notice that in countries with a single-payer system, good genetic screening is much less of a problem. Since the government system is going to pay to treat everyone anyway, knowing in advance who's susceptible to what diseases might actually reduce costs, by focusing the right treatment on the right people. So it might well be that it is this "Gattaca" stuff that finally kills the broken US health insurance system.

    7. Re:Hmm by Yokaze · · Score: 3, Insightful

      > If you don't like this, go find another insurance company.

      Such a insurance company would cost much more and would make it inhibitable for lesser fortunate people to afford such luxury.

      In a purely capitalistic society this would seem approriate.
      But, at least to me, it seems unethical.
      Why is it unethical to discriminate on basis of genetics?

      To a similar reason, why it is unethical to discriminate on the basis on race, place of birth, zodiac sign.

      First, the mantra "correlation is not cause" applies here to some extend, too. "You are black, so you will live shorter." is an example. In contrast, smokeing is unhealthy. That is a proven fact and not just a statistical correlation, like the decrease of the population of storks and a correlating decrease of the birthrate. Similar is currently true for genetic screenin.
      As explained in the article, you may well have a predisposition in one gene for a certain malice, but it is far from known, how this may affect your life, as the same person may have some unknown genes, which compensate the predisposition.

      Second, and more importantly: You can't choose your genetic make-up, where you're born and when.
      Willingly punishing someone for such things is unethical.
      At least according to my moral codex, which is the result of my upbringing. Maybe yours differ, but I thought the civilised world agreed upon this.

      --
      "Between strong and weak, between rich and poor [...], it is freedom which oppresses and the law which sets free"
    8. Re:Hmm by jafuser · · Score: 2

      You make a good point. I was thinking about this as I read the article. If genetic knowlege becomes widespread, the private insurance industry is going to consumed by their own greed.

      --
      Please consider making an automatic monthly recurring donation to the EFF
    9. Re:Hmm by Fig,+formerly+A.C. · · Score: 2
      That money is coming out of the pockets of all the healthy people who will pay far more in than they'll ever get out

      And how is that any different from the government hiking taxes to take care of the sickly people? Like you said, there's no such thing as "free money".

      --
      Murphy was an optimist.
    10. Re:Hmm by jafuser · · Score: 2
      I agree with the parent post. I see private insurance as the following business model:

      • We estimate spending X dollars for insurance claims this year.
      • In order to cover our raw business expenses, we need Y dollars.
      • In order to meet our shareholders expectations, we need Z dollars
      • For bonuses, severances, and stock options, we need W dollars
      • So we will charge our average customer (weighted amounts depending on risk conditions): P1 = (X + Y + Z + W)/number of customers

      Now a government has no shareholders, bonuses, stock options, nor does it have any incentive for making a profit, so it would be a little different:

      • We estimate spending A dollars for insurance claims this year.
      • In order to cover our raw business expenses, we need B dollars.
      • Tax things which are potentially unhealthy (tobacco, alcohol, fast food, sports events (to cover injuries)), put all of this together and call it T.
      • So we will charge *ALL* of our citizens P2 = (A + B - T)/number of citizens.
      I guarantee you that P1 will not only be substantially more than P2, but P1 will also incur much more hassle and run-around in making a claim than P2.
      --
      Please consider making an automatic monthly recurring donation to the EFF
    11. Re:Hmm by ErikZ · · Score: 2

      If that's the case. Then what's to prevent the government from inisting that you go though a clinic to reproduce?

      So they can go though the genes of a fertized egg and only give back the ones that don't have any problems?

      After all, it will save you a TON of money in the long run.

      --
      Democrats or Republicans. They are both taking us to the same place and they are not afraid of us anymore.
    12. Re:Hmm by HiThere · · Score: 2

      Sorry. The smoking argument is definitely a statistical argument. It's a pretty good statistical argument, but only pretty good. You can't definitely say ahead of time that smoking will have a bad effect on *this* person. Perhaps genetic testing would allow you to say that. But even so, it would never be sufficient.

      To take an extreme example, the cigarette which the man in front of a firing squad smokes might delay his execution enough for a pardon to reach him. In his case, smoking extended his life, and (likely) not for any measly couple of years.

      --

      I think we've pushed this "anyone can grow up to be president" thing too far.
    13. Re:Hmm by Yokaze · · Score: 2

      > You can't definitely say ahead of time that smoking will have a bad effect on *this* person

      The poisonous effects of various substances in tobacco have been reproduced in laboratory experiments.
      So you can say what effect smoking will have on a certain person. The maximum life-span of the very same person is shortened by smokeing. That the this person can die earlier for a different reason is another thing.

      > To take an extreme example [...]

      In what ways would the life be prolonged in contrast to, let's say, eating the final meal?

      Furthermore, his life-time was not extended by smoking, but it was threatened to be shortened even further by the firing squad.

      --
      "Between strong and weak, between rich and poor [...], it is freedom which oppresses and the law which sets free"
    14. Re:Hmm by deblau · · Score: 2
      The alternative is just to leave more and more people with no insurance at all, which will quickly drop the US life expectancy down to third world levels.

      I love logic like this. Getting sick doesn't kill you, apparently, but lack of insurance will reduce your lifespan. Man, you need a good cup of coffee or something, and I need to breathe before I laugh myself to death. Oh wait, I can't die, I have insurance.

      Actually, what I think you meant to say was, "Americans are idiots when it comes to money, and are too stupid to realize that you come out ahead if you just put your insurance premiums under the mattress instead of writing a check every month". If they ended up paying you more than you paid them, they wouldn't be in business, now would they?

      --
      This post expresses my opinion, not that of my employer. And yes, IAAL.
  22. Am I sharing again? by sam_handelman · · Score: 5, Interesting

    DNA is the book of life. It's also the book of death.

    Hard science journalism at it's best. Sheesh.

    This, I'm told, is the first time a healthy human has ever been screened for the full gamut of genetic-disease markers.

    Yeah, RIGHT. Imagine that lab meeting: Guys, I have a plan, we've never done this before, so lets invite in a journalist and see if we can humiliate ourselves.

    Braun, 46, is both jovial and German.

    Yes, Homer, Germany is the land of chocolate.

    These disease-causing SNPs are fueling a biotech bonanza; the hope is that after finding them, the discoverers can design wonder drugs.

    The hope of many of these bottom feeders is that they can identify an SNP and exert some intellectual property over it to horn in on whomever actually can find a treatment. Anyone want me to deliver another manifesto on the evil of this approach?

    Alright - let's talk genetic diversity.
    As Braun explains it, somewhere in the past, an isolated human community lived in an area where the food was poor in iron. Those who developed a mutation that stores high levels of iron survived, and those who didn't became anemic and died, failing to reproduce.

    Good point! This is reason number one NOT to reduce the genetic diversity of the human race. All of these alleles floating around the population - which may become increasingly rare as there is selective pressure against them, and may even cause considerable suffering or death to some of those who carry them - should not be removed from our collective gene pool, at least not without considerable discussion. Why? Because WE MAY NEED THEM. A monoculture (were all organisms have the same genes) is not sustainable in a biological sense.

    This is also one of the great tragedies of our times - sub-saharan africa contains only a fraction of the human population, but it contains over a third (depending on how you measure it) of human genetic diversity. The region of the world being devastated by AIDS may contain any number of alleles which our decsendents may need in the population in order to face the challenges of the future, whatever they may be.

    "Ja, that's my favorite," says Braun, himself a smoker. "I wonder what Philip Morris would pay for that."

    Note that this gene doesn't make it safe to smoke - smoking still causes heart disease and so forth in these people. Still, a treatment to clone this gene into your lungs could make billions, no (clone as in move DNA around)?

    These genetic modification treatments may not be such a good idea, either. You all remember in 1999 when a research subject at Penn died from a liver treatment (search for "liver")? The upshot is - anything that delivers genes into a person can, and sooner or later will, go out of control and do things you don't expect. Killing the subject is the most likely, but frankly least frightening, of these possibilities. The real threat - and my colleagues in biotech like to play this down but I am not at all convinced by their arguments - is that vectors for DNA delivery into humans could go wild and become contagious.

    Of course, I'm opposed to animal organ transplantation for fear of introducing new human pathogens, so maybe I'm just a naysayer.

    --
    The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
    1. Re:Am I sharing again? by Nintendork · · Score: 2
      "Good point! This is reason number one NOT to reduce the genetic diversity of the human race. All of these alleles floating around the population - which may become increasingly rare as there is selective pressure against them, and may even cause considerable suffering or death to some of those who carry them - should not be removed from our collective gene pool, at least not without considerable discussion. Why? Because WE MAY NEED THEM. A monoculture (were all organisms have the same genes) is not sustainable in a biological sense."

      Have you read Greg Bear's book, Darwins Radio? The whole book is about evolution and a lot of it contemplates these types of circumstances.

    2. Re:Am I sharing again? by efatapo · · Score: 2, Informative

      This is a long but ridiculous comment. Have you ever heard of a retrovirus? It's a method for incorporating RNA into the human genome. Oh, imagine that. And it's natural. And it hasn't plagued the human race and killed us all? Or, God forbid, "go wild". This happens to bacteria all the time. This is why bacteria are able to become resistant to antibiotics.

      And could you please elaborate on how animal organ transplants would introduce new human pathogens?

  23. Tomorrow's slashdot post: by dubstop · · Score: 2, Funny

    Wired reporter first to be refused any form of medical or life insurance due to his stupidity in paying to find out that he's too risky to insure.

  24. Y Chromosome and Surnames by yelligsc · · Score: 2, Interesting

    I found this particularly interresting and disturbing.


    The fact that Sykes and I are members of the same extended family is just a bizarre coincidence, but it points to applications beyond simple genealogy. "I've been approached by the police to use my surnames data to match up with DNA from an unknown suspect found at a crime scene," says Sykes. Distinctive genetic markers can be found at the roots of many family trees. "This is possible, to narrow down a pool of suspects to a few likely surnames. But it's not nearly ready yet."


    It had never occured to me that Y chromosome passes along from father to son would be almost identical, following surnames as they are passed on as well. It seems obvious, thinking about it however.

    Im not sure I like the idea of possibly being hauled in for questioning because some messed-up branch of my lineage decided to go rob a liquor store to pay off his bookie. Of course, my family blood is too good to worry about such things!

    Scott.

    1. Re:Y Chromosome and Surnames by KernelHappy · · Score: 2

      How long will it be before this database is used by spam mailers to target people with the genetic defect that makes them suceptable to late night infomercial advertising?

      --
      -- Button up, your ignorance is showing
  25. Diseases by name_already_in_use · · Score: 2, Interesting

    So if your particulat genome sequence reveals a tendency to contract a particular disease I guess the main thing your going to be worried about is if it curable in the event that you DO actually get it, right (or of any long-tern after effects)? This could be inteesting for some reasons: 1) If you know you have a high chance of catching an uncurable disease perhaps we will end up with hugh scores of people all devoting their lives to curing that disease. Medical teams of potentially diseased doctors looking for the cure to a disease they don't yet have...weird. 2) By sequencing more and more genes a huge amount of data can be gathered revealing those diseases which are becoming more common and greater research put into those areas. Just a few thoughts :-)

    --


    Rake Free + Mac Poker: CardCrusade
  26. My DNA test.. by grub · · Score: 5, Funny


    .. The last time I was at my physician he wanted a blood sample, a semen sample, a urine sample and a stool sample.

    So I gave him my underwear.

    [rimshot]

    --
    Trolling is a art,
  27. We're doomed! by kenp2002 · · Score: 2

    I can see it now, insurance companies will have manditory blood tests and then map out your DNA. IF you have a high chance of anything then there will be a premium hike. The world of Gattica becomes a reality, now people like the KKK can use this to further their cause! I see a great rift in society where couples planning to be married will try to get DNA info on their spouse to make sure they're not inferior. I see a new form of elitism coming about where the new aristocracy will be of a genetic elite and those who are inferior will be weeded out through poverty, disease, and depression. They will develop gene therapy that can "Clean" your DNA and make you an elite but it will cost millions, a legacy to leave your children. Then while working yout 80 hours a week popping soma you will go visit quaint villages of non-elites and marvel at their simple ways....

    Behold the Fordian Society of Huxley's "Brave New World" written in the 30s he warned of this day. Now it's finally here...

    It's the end of the world as we know it, but I don't feel fine... not at all...

    --
    -=[ Who Is John Galt? ]=-
    1. Re:We're doomed! by interstellar_donkey · · Score: 2

      now people like the KKK can use this to further their cause!

      Doubtful. If anything it'll take those folks down a notch. The article touches on the fact that we all have some sort of mixed ancestry; "We are all mutts".

      What happens when the KKK weirdos discover they have (which in all likelyhood they do) have Aferican or *gasp* Jewish ancestry?

      More likely the danger would be in non-minority people discovering faint genetic traces of minority blood lines and abusing that fact to gain special privlidges they otherwise wouldn't be able to receive (or deserve).

      On another note, you have to wonder about what the insurance companies would do about this. On the one hand, it seems likely they would raise premiums on those with genomes with a higher predisposition towards certian deseases. On the other hand, one could assume that in the interests of profits insurance companies would push for cheaper gene thearpy to remove potentially dangerous mutations before they lead to expensive medical positions.

      I could easily see a day where insurance companies encourage (or perhaps even mandate) an analysis of DNA shortly after conception and modify the geneitics of the new life while it's still just a few cells. The logic is simple: Spend $5k to remove defects to save $100k in 40 years.

      It could be very scary, or it could be very benificial. Now is the time to watch the lawmakers very, very carefully.

      --
      The Internet is generally stupid
    2. Re:We're doomed! by HedRat · · Score: 2, Funny

      And on the opposite side of the spectrum, how long before Palm/DNA Readers start pedalling their wares?

      Customer: "How much?"
      Mystic: "Twenty Dollars."
      C: "Okay."
      M: "Opennnn..." (swabs inside of cheek).
      M: "Hmmm, I see G-A-C-C-G..., oh my..."
      C: "What?"
      M: "The strands are a little twisted but it looks
      like you'll be bludgeoned to death with a canned
      ham by an angry motorist in a grocery store parking lot....but it's starting to get cloudy."
      C: "Here's $500 dollars...what do you see now?"
      M: "There's the problem, that last G is really a C!! NOW I see you in a passionate embrace with Charlize Theron."

    3. Re:We're doomed! by interstellar_donkey · · Score: 2

      Which special privledges do these minority blood lines deserve in the first place?


      There is an argument that states that due to historical abuse (racism, access to educational resources etc.) of certian minority groups, their ancestors alive today have been placed into an economic situation which keeps them in a cycle of ignorent poverty. Afermative action programs were put in place by Nixon et. al. with the hopes that it would make it easier for the intellegent to escape that cycle.

      Maybe this will sweep out a lot of that BS.

      Weather that really works or not is certinatly up to debate. Just as the article mentioned the blond haired blue eyed surfer discovering Hawaiian ancestry from study of DNA to be eligable for a grant, I would assume this would start happining all over the place.

      My personal hope is, with the development of genetic tracing of ancestry, we will begin to 'sweep out the BS' that cyclical poverty is universal in this day and age. Personal, legal and institutional racial discrimination are, if not gone already, on their last legs. If we begin to show a blind eye towards ethnicity, perhaps the rare rose born in the trailor of poor white trash has the same chance as the Aferican American boy born in the ghetto.

      --
      The Internet is generally stupid
  28. Re:Geography - drifting off topic by victim · · Score: 2

    I am always surprised at the distance distortion that occurs in areas of high population density. I live in the middle of the United States (< 60 miles from the population centroid) and don't think twice about driving 500 miles to my vacation cabin. (Too d*mn hot where I live in the summer. Got to go north.)

    I have had friends who live in Manhattan that consider 15 miles to be "far" and 200 miles to be an extraordinary distance to travel.

    I wonder if people's definition of far is better correlated to "number of people passed" than "distance"?

    Any slashdot readers from the Australian outback want to tell us what they think "far" is?

  29. My take on this by Anixamander · · Score: 4, Insightful

    While screening is an ominous first step, prenatal screening and gene therapy are where this gets really frightening. For starters, as with any cutting edge medical technology, this will be expensive. Therefore, those who would "improve" the dna of their offspring will be the elites. As they branch out from diseases to other areas...intelligence, looks, etc., the line between the rich and the poor will only grow wider. And here in the U.S., minorities represent a greater percentage of the poor than their overall numbers, meaning any growing divide between rich and poor will also widen the racial divide. Unless society comes up with some good answers, the spells big time social problems for the future.

    --
    Do not taunt Happy Fun Ball(TM)
  30. About the Author by Nintendork · · Score: 3, Informative

    I did a google search on the author's name and found his page. This guy's got quite an impressive list of books and articles. http://literati.net/Duncan/

  31. It was so much easier.. by grub · · Score: 5, Funny


    .. back in my granddad's day when you could just discriminate based on skin colour. Now you have to be a damn scientist to hate people.

    Yes, I'm joking!

    --
    Trolling is a art,
    1. Re:It was so much easier.. by HiThere · · Score: 2

      Interesting you should mention that...
      There was some research done on a group called, I think, the cohens who were all supposed to be the descendants of Moses' brother Aaron in unbroken male line. Seems like most of them share the same Y chromosome. I seem to remember that it was around 60%. Enough, anyway, to test some theories about the way mutations accumulate.

      --

      I think we've pushed this "anyone can grow up to be president" thing too far.
  32. father/children by lovebyte · · Score: 2

    Yet I will be able to glimpse some of the internal programming bequeathed to me by evolution, and that I, in turn, have bequeathed to my children ...
    or not. These types of genetic checks have interesting side-effects, such as finding out that your father is not who you think he was! I read somewhere that this was the case in about 25% of cases. The future will bring us lots of fun!

    --

    I'll do it for cheesy poofs.

  33. I woudn't worry too much about it by abhikhurana · · Score: 2, Interesting

    I wont worry too much about it... no CEO wud like to admit that all the employees working under him are smarter than him :-)
    Anyway, there are many companies even now who don't recruit the brightest people. The reason, the brighter they are, the more likely they are to switch jobs. I kid you not but many companies have this policy, or used to do in dotcom era.
    Besides, if you have too many smart people working at the same place, I think that wud create mayhem...just think of the arguments these guys can have...
    So I will say guys, rest assured...we are safe :-)

  34. Re:WHAT? Body scans?! by ReadParse · · Score: 2

    I am TERRIBLY sorry. I'm a moderator and I intended ot moderate this up (Funny), but it appears that my mouse let me down and I actually selected the next option down, which is "Overrated", so I moderated the guy down.

    I did NOT mean to. My apologies for not being more careful.

    RP

  35. Why is everyone so negative? by f97tosc · · Score: 4, Insightful

    With the risk of getting a flamebait mod, perhaps it is worth pointing out that the technology is not all bad.

    So it is creepy to get a genetic test, but also it can be quite useful. If you have predisposition for an illness then you are much better off knowing it in advance so that you can test frequently and adapt your behavior (e.g., diet).

    And of course, if you still don't like it, you don't have to.

    Now somebody will predict that insurance companies will force everyone to do the test, I'll save you the trouble and reply right away. The scenario is unlikely, because there are quite a few legal limitations on what these companies can and cannot ask for - and the majority of registered voters are very sceptical.

    But even if it did happen, would it necessarily be so bad? Widespread testing would make the total, and therefore the average, cost of insurance lower. This is because it is easier and cheaper to treat illnesses at an early stage. Certainly those with certain predispositions would get a higher premium, but would not even that be preferable over paying a standard premium and then getting an illness that could have been averted by frequent tests and say the right diet? One could also think of taxes and subsidies supporting those that got higher premiums. Since the total medical costs would go down, it is at least theoretically possible to come up with a system where everyone is better off.

    Tor

    1. Re:Why is everyone so negative? by Matey-O · · Score: 2

      Agreed on all points.

      Anybody remember how their grandparents (or parents if they're 70-ish or older) handled things like refrigerators and in house electricity?

      My grandparents would unplug their TV every night so that the electricity wouldn't 'leak out'.

      --
      "Draco dormiens nunquam titillandus."
    2. Re:Why is everyone so negative? by jafuser · · Score: 2

      "Majority rule only works if you're also considering individual rights. Because you can't have five wolves and one sheep voting on what to have for supper." --Larry Flynt

      --
      Please consider making an automatic monthly recurring donation to the EFF
  36. Re:This is not fair use... by DjMd · · Score: 2, Insightful

    What?!? The article was sited, quoted and unaltered? Why is this illegal?

    --
    DJMD - The fourth man - Planetary
  37. Genetic immunity to HIV? by shren · · Score: 2

    From the article:

    The SNPs keep rolling past, revealing more mutations, including a type-2 diabetes susceptibility, which tells me I may want to steer clear of junk food. More bad news: I don't have a SNP called CCR5 that prevents me from acquiring HIV, nor one that seems to shield smokers from lung cancer. "Ja, that's my favorite," says Braun, himself a smoker. "I wonder what Philip Morris would pay for that."

    Hearing about CCR5 was the only thing in this article that blew my socks off. Genetic immunity to HIV? Wow.

    Google hits a lot of things when doing a search for CCR5. The most approachable is here.

    --
    Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
    1. Re:Genetic immunity to HIV? by runlvl0 · · Score: 3, Funny

      What is a CCR5 "defect"?

      A defect normally implies that the system has gone array, however, in some cases defects or simply modifications from the normal genetic code, are helpful. In this case the defective CCR-5 genes contain a 32-base pair (bp) deletion. This deletion causes a shift in the reading frame which results in a severely truncated protein which is unable to reach the cell surface. With this defect AIDS progression is slowed, allowing someone to survive longer. Thus, in this case the defect is actually protective.



      So, it's a buffer overflow exploit, then?
      --

      Carthago delenda est!
  38. Tracing Ancestors by tomzyk · · Score: 2, Interesting

    If they can trace most people back to 7 or 8 specific females that lived 20,000 or 45,000 years ago, is it possible to do the same with males? I got the impression from reading the article (4th page) that there is basically NO difference in the Y chromasome between a father and son (except for the given mutation or two that always may occur).

    --
    Karma: NaN
  39. Moderation: Was Re:WHAT? Body scans?! by SomeoneGotMyNick · · Score: 2

    Doesn't posting on the same article that you've recently moderated 'throw away' your moderation? You can't moderate and post on the same article (tends to allow bias).

    The moderation you made may have been removed simply by posting. The moderator guidelines don't specifically mention that action, but I thought I experienced it in the past.

    1. Re:Moderation: Was Re:WHAT? Body scans?! by ReadParse · · Score: 2

      Good point. You're probably right. If not, it's a bug.

      Thanks,
      John

  40. Dr. Mephesto, take a note by bsd-mon · · Score: 2, Funny

    Braun, 46, is both jovial and German

    OMG, I didn't think that was possible! What will genetics bring us next?!?

    --
    To read makes our speaking English good. - X. Harris
  41. Re:Gattaca by Frank+T.+Lofaro+Jr. · · Score: 2

    It all depends on the type of corporations we have.

    Gov't isn't the big threat. It is a threat mostly when it is being a hired bully for the corps.

    If a "Gattaca" future becomes a reality, it will be the corporations, not the gov't, pushing for it and implementing it.

    It doesn't matter if the gov't doesn't oppress you but no one will hire you, you'll starve anyway.

    --
    Just because it CAN be done, doesn't mean it should!
  42. Smokers rejoyce! by DCram · · Score: 5, Funny

    my fave quote from the article.
    "One gene seems to shield smokers from lung cancer. 'That's my favorite,' says the doctor, a smoker. 'I wonder what Philip Morris would pay for that.'"
    Ah yes.. now I can blisfully tell myself that yes I must have this gene and therfore my smoking is A.O.K

    Huzzah!

    --
    If I were only smart enough to accomplish the things I dream about.. Or maybe too dumb to care.
  43. Re:This is not fair use... by Peter+T+Ermit · · Score: 2

    It's illegal because it's a violation of copyright law. "Fair use" describes the conditions when you're able to reproduce a work without the permission of the author. Mr. Coward was right when he says that the posting doesn't fall under fair use... a section of the article would probably be fair use, but the whole thing is a no-no.

  44. Bottlenecks by sam_handelman · · Score: 2

    I am talking about suppressing evolution. The human race going extinct would be evolution. I am talking about making sure that the resources (genetic resources) are available to make sure that the human race can undergo another sort of evolution if our survival depends on it. The population of the Andean Condor fell to, what, a dozen individuals IIRC? Even if the alleles among the rest of the species really made them less fit for the present circumstance (which I doubt,) the genetic homogeneity among the survivors makes the long term survival of the species very doubtful. This is a genetic bottleneck. Having it happen to our species is very, very bad.

    Someone else raised the possibility that I want to keep suffering people around as a genetic bank for the human race - that was not my intent. What I mean is that we should eliminate an allele from the population only after serious thought, and only if therapeutics fail, since we simply do not know (and cannot predict) which genes may be helpful to our descendents.

    When those who are vulnerable to AIDS have died, there will be many alleles - which have nothing to do with AIDS - lost to the human race as a whole. Those alleles might have saved the human race - or some population of humans on some distant planet we colonised - from dying out under some other circumstance, or might have been linked to some other trait, important for some reason of which we have no inkling.

    It is true that in order for the alleles in africa to be helpful to my descendents, I would need shared offspring, somewhere along the line, with a present day African. Since I am talking about a rather long timescale - millennia, at least - I view that as entirely likely. This reveals my multicultural social bias, I am sure; I am mixed Ashkinasi (Jew) and Cherokhee (American Indian.) If you asked my ancestors 1,000 years ago in the Baltics and the present-day SE US if they thought they'd share a great^40 grandchild, I think it would have looked pretty unlikely.

    --
    The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
    1. Re:Bottlenecks by jafuser · · Score: 2
      Let's not forget that as science advances, we'll get to know exactly what gene sequences do for various things, and we'll be able to respond to them even more quickly. If a disease comes along which can't be stopped naturally due to us removing certian (formerly harmful) alleles from the gene pool, we just use the same technology we used to remove the allele to re-insert the allele and reverse the problem.

      In some cases, it may be impossible to eliminiate all diseases for a certian gene. For example, it may come down to whether you will die of some heart condition or a digestive disorder; well, then perhaps your parents get to choose which allele you are given.

      In the long term, I doubt this will matter, as anyone with enough hope and imagination would predict that our exponential technology growth would probably grant our descendents some form of technological immortaility in the distant future, and would be accomplished completely without a genetic system.

      *shrug*

      --
      Please consider making an automatic monthly recurring donation to the EFF
  45. The good news is... by frank_adrian314159 · · Score: 2
    ... that your genome is like the climate. And, luckily, there are few climates where humans (perhaps with proper adaptive equipment) cannot live long, happy, and productive lives. What you actually do with that "climate" gives you your own personal weather system that may obviate everything that the climate allows you.

    In short, it's both nature and nurture. Try to be good to yourself...

    Oh yeah, eat your goddam veggies, too, ya little bastards.

    --
    That is all.
  46. Ramifications and Slashdot by 0x0d0a · · Score: 2

    just something that we don't understand the ramifications of entirely?

    Hell, do you understand the ramifications of posting to Slashdot entirely, particularly with a link to your homepage? The Wayback Machine and Google (and soon other places) are archiving what you're writing...you may well be building up an indelible record that future employers will *always* look at before considering you.

    Uncertainty is part of life. If it wasn't...well, we'd have a much less interesting time.

    1. Re:Ramifications and Slashdot by 0x0d0a · · Score: 2

      That's why we all use anonymous handles here.

      Ah, but if you look at the original post...the poster uses his real name, posts to a web page with a username that's his real name *and* contains all his personal information.

      This is *despite* the fact that one of the most prominent bits on his page says "Important information! Email Privacy - Protect your identity on the internet. Use the strongest encryption..."

  47. To respond briefly by sam_handelman · · Score: 2

    Not only have I heard of retroviruses, I have studied them. A retrovirus to be used as a vector for cloning into humans would have to be engineered to avoid tripping any immune system alarms. That's playing with fire.

    HIV is generally agreed to have hopped from a monkey as a result of a bite. An animal organ - particularly when placed in an individual taking immunosuppressent drugs - might pose the same threat.

    --
    The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
  48. Re:This is not fair use... by mark-t · · Score: 2
    You evidently haven't actually read the section on "fair use" in the copyright act. What he did was, in fact, completely legal. There is a very large allowance for newspaper and magazine articles to be quoted in accordance with fair use, even in entirety, so long as the article does not contain any proprietary work, which this article does not (if it did, then written permission would need to be obtained).

    This sort of thing happens all the time in academia... it's perfectly legal and in accordance with fair use. Just beacuse slashdot doesn't happen to be an educational institution doesn't mean that the article's duplication doesn't further education.

  49. Re:This is not fair use... by Peter+T+Ermit · · Score: 2
    Thanks for your condescension. I've read the fair-use section (107 of the copyright act)... have you?

    There are four criteria determining whether something is fair use. First is the purpose -- commercial or non-profit educational. (There *are* differences between Slashdot and a university.) Second is the nature of the work. Third is the amount of quoted material (copying the whole article is less likely to be fair use than quoting a section.) Fourth is the competition for the market of the original publisher -- and Slashdot has a great overlap with Wired's audience, and fewer people will visit Wired's website because of this posting on Slashdot. Fair use can be pretty fuzzy sometimes, but not in this case.

  50. this is not accurate, it is a prediction. by QuantumRiff · · Score: 2

    I think that this might benefit people in that knowing what they are predisposed to might encourage them to live a healthier life, it is a "might be" kind of test. Its like saying that "sometime in the next 55 years, your going to get into a serious car accident" You'll sweat it for a bit, then start driving normaly again. It might happen, it might not, but you'll still drive your huge ass soccer mom SUV to work everyday...

    --

    What are we going to do tonight Brain?
  51. One more thing. by Peter+T+Ermit · · Score: 2

    It's written by Wired's author; Wired paid for the rights to publish. It's either their intellectual property or the author's, depending on the agreement between them. So this is a proprietary work, not public domain.

  52. It's all about resources and greed... by alchemist68 · · Score: 2, Insightful

    Everytime I read about genetic testing and the possible repercussions from it (job discrimination, social discrimination, insurance discrimination, law discrimination), the idea resonates of obtaining resources and greed. Even though we humans tend to think of ourselves as civilized beings, we are just as savage as the animals we watch on National Geographic Television and the Discovery Channel. Our society is built upon genetic and social connectedness, i.e., birds of a feather flock together. The little camps or groups of people arise from genetic similarities which are expressed as behavior or abilities. People with certain genes will have some abilities, whether they are exceptional use of language, abstract thinking, exceptional physical endurance and motor control (athletes), deviant thinking and behavior (criminals tend to congregate in prisons) will tend to socialize with one another. It's up to the individuals with these genes to utilize what evolution and natural selection provided them to obtain resources necessary to ensure survivability of their genes. Just as the law makers, insurance industry, private industry, and educational system (Ivy League, public, and private schools) would like to have access to this information, it's almost like watching the Lions and Hyienas fighting over the injured gazelle. Law makers want to protect the people or industry to get re-elected. The insurance industry wants to limit insurance to diseased people to increase profits (they're cheating at the game of CHANCE and RISK). Private industry wants more efficient people (education/abilities) to increase profits. Schools only want the best, most successful students to increase their stature and graduation rate. Everyone wants to flex their intellectual and economic muscles with this issue to GAIN RESOURCES that help their organization or cause: GREED!

    Let's face it folks, this is a central fact of biology and chemistry: Molecules are competing for energy to sustain the transition state for metabolism and reproduction to continue. It doesn't matter that the needs are currently met, "more" is always sought "just in case" (random events) the energy isn't available in the future. "More" is always sought to prevent foreign genes from being over expressed which might lead lead to native gene extinction.

    I never thought much about the significance of an electron being promoted to an excited state in an antibonding orbital until I read this article.

    Gosh, it's fun being a chemist.

  53. heh by ErikZ · · Score: 2


    I can see the prenatal testing now.

    "Well Mrs. Smith, according to the genetic screening, your daughter will grow up to have an enormous rack."

    --
    Democrats or Republicans. They are both taking us to the same place and they are not afraid of us anymore.
  54. Re:Non-exclusive genes and common traits. by jafuser · · Score: 2
    Genes work chaotically within the body, so like you said, changing one attribute almost certianly will always change several others, even if they are subtle.

    Your body is basically grown as a biological fractal... That's why something like 98% of all base pairs are the same in humans. That 98% probably describes the things that make us all similiar (placement and purpose of organs, the humanoid form, general cell structure and function).

    If our DNA had to contain explicit instructions about the placement of every molecule in our body, it'd take the same amount of matter to encode that information =)

    --
    Please consider making an automatic monthly recurring donation to the EFF
  55. other people's dna by trb · · Score: 2
    I gave a few cells, swabbed from inside my cheek, to a team of geneticists

    Cells swabbed from inside your cheek are not always such a good idea.

  56. Try not to be too stupid by Gerry+Gleason · · Score: 2
    I use my real name, but I'm not that worried about employers looking at my comments. I've always liked the idea that you should:

    Live never to be embarassed about anything said about you

    Probably a bit mangled, but it's from Richard Bach's

    • Illusions
    . He has all this little quotes attributed to "The Messia's Handbook" that was given to him in the story. The way I take that is that you however you choose to present yourself in the world, don't worry too much about how others take it. Your always going to be misinterpreted, sometimes maliciously, but if you worry about it too much, you won't be very authentic. OTOH, if your being deliberately stupid, maybe you'd better hide your identity.

    I kind of wish I could go back and re-read some of my very old participation in netnews groups. Ok, so maybe it proves I wasted more time than I should have posting at work, but I have enough slack to cover a bit of that ;-). Some of this is probably archived on dusty tapes, but I don't think the on-line archives go back that far (I'm most interested in '83+ timeframe).

    You can take it a lot of other ways too, like don't let that boyfriend have any naked pictures of you unless you won't be embarassed when they show up all over the internet.

    Ok, so this is off-topic, but someone else started it. The idea of mapping your genome defects is only bad if the information is badly used. I don't think our social systems are really ready for this yet, particularly since the interpretation of the information isn't very advanced. The article is pretty clear about the limitations, but there are a lot of stupid people who will be frightened by the knowledge (of themselves, like the author of the article), or worse will use it to discriminate even though it is provably imperfect.

  57. My sense of humor... by Gruneun · · Score: 2

    What was even more funny to me than the original joke was that someone moderated this "Informative"

    I don't know if I should laugh or cry.

  58. Is it called superstition? by geoswan · · Score: 2
    On the other hand, the main character did not have 'improved' genes, and so he had to falsify his identity to get a job. However, he appeared to be just as competent as all the other people where he worked, perhaps more so. Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?

    I think there is a modern conceit that we are wiser than people in the past. We look at their strange beliefs, and they are obviously strange. We still believe in "progress".

    Look at the strange beliefs of the past. Experts thought blood-letting would purge your body of bad humours. Experts thought flagellation would purge your soul of sin. Experts though you could measure a person's talents and character traits by fondling the bumps on your head. Experts thought masturbation would drive you insane.

    Set the time machine forward a couple of generations, my prediction is that our generation will be seen as possessing just as many goofy foibles as past generations.

    I know it is just a movie, but look at films like " Back to the Future ", and look at how they portray the modern visitor as innately wiser and more insightful than they guys from the past.

  59. More on Lanier Phillips by geoswan · · Score: 2

    According to this link the ship was the USS Truxton. Here is a link to a radio show about Lanier Phillips.

  60. Re:More on Lanier Phillips by Triv · · Score: 2

    The radio story you linked to is the same one as was replayed on This American Life. Chris Brookes writes for both NPR and the CBC.

    The most touching part of the story was his experience in Jacksonville, FL years later. He was trying to get to the Naval Air Station and stopped in an army base (in full uniform) to grab something to eat. He walked into the cafeteria and saw tables and tables of German and Italian prisoners of war. All he wanted to know was where a black guy could get some food (they usually had a separate window for 'em back then), but as soon as he opened the door he was slammed to the floor by a Jacksonville cop, who put his foot on Lanier's throat and pulled his gun. He yelled at Lanier for walking into the room of white people. White...Nazi...P.O.W.s got better treatment than a black US Soldier, more than ready to die for his country.

    Sometimes...sometimes this country sickens and revolts me.

    Triv