Slashdot Mirror


Banana to be Sequenced

GodsMadClown writes "New Scientist reports that a global consortium plans to sequence the genetic code of a wild banana from east Asia. Because bananas are triploidal instead of diploidal, they are only able to reproduce asexually, which means that it adapts slower than organisms reproducing sexually. 'One rule of joining the consortium is that any invention developed through the project and protected [by patent] will be made available to smallholders through a royalty-free license,' says Emile Frison, director of the International Network for the Improvement of Banana and Plantain."

137 of 201 comments (clear)

  1. So how long until by MikeDX · · Score: 1

    New McDonalds Banana(tm) made from real(tm) Bananas! Hits our stores?

    1. Re:So how long until by Anonymous Coward · · Score: 1, Funny

      Hey, it can't be worse than the Mc Meat Patties (tm) made from **100% real patty**!!

  2. Bananas being sequenced... why? by phreak404 · · Score: 5, Informative

    The original story description was entirely non-coherent. So for anyone who actually cares, according to the article, bananas are being sequenced because the varieties favored by Western civilization are a nautral hybrid, and also happen to be sterile. This makes it impossible to crossbreed with Asian varieties that are more resistant to pests and diseases, hence, gene sequencing... all so that CostaRicans can use less pesticides, make more money from all of us banana loving Westerners.

    1. Re:Bananas being sequenced... why? by SlashdotLemming · · Score: 1

      Thank you.
      After reading the original, the only thought I pulled from it was that of a banana orgy.

    2. Re:Bananas being sequenced... why? by tjensor · · Score: 5, Informative

      There is very good reason for genetic research into Bananas. Almost all Banans eaten in the world are from a single species, which is almost sterile - note the lack of seeds in your lunchtime Banana. There are several diseases which, if they got into the main Banana growing parts of the world, could seriously threaten the very existence of the Banana. This would be devastating for many small, poor countries, as they not only rely on the Banana economically, but as a staple food as well. Check out this months New Scientist.

      --
      <fnord>OBEY</fnord>
    3. Re:Bananas being sequenced... why? by Ami+Ganguli · · Score: 1

      A small nit - most bananas eaten in the world don't come from a single species, it's the bananas exported to the West that come from a single species. That's still important, since that's were the money is.

      But I think this is interesting because some of the tastiest bananas I've eaten aren't exported. They aren't suitable for various reasons, including thin skins that don't deal well with being shipped around the world. If they could introduce some of those yummie genes into export bananas it would be great.

      --
      It is tempting, if the only tool you have is a hammer, to treat everything as if it were a nail. - Abraham Maslow
    4. Re:Bananas being sequenced... why? by dubstop · · Score: 3, Funny

      could seriously threaten the very existence of the Banana

      Cripes! I for one don't want to imagine a world without bananas. Let's just hope that there's enough time to push banana-based technology to a point where we no longer have to be afraid.

    5. Re:Bananas being sequenced... why? by videodriverguy · · Score: 2, Informative

      Reading the article, it appears that these diseases are already in the major growing areas. And also, contrary to a previous post, these diseases mutate to resist traditional remedies so fast that treatment (pesticides) is not an option. Therefore there is a real urgency to this research - if not completed, there seems to be a real chance that the banana as we know it will simply be extinct.

      A more important point is that although GM may well be a cure, it remains to be seen whether or not consumers would accept modified bananas.

    6. Re:Bananas being sequenced... why? by jez9999 · · Score: 1

      That could be interpreted in a different way... :-)

    7. Re:Bananas being sequenced... why? by mooZENDog · · Score: 1
      Because, apparently, they are the western world's favourite fruit. I heard this on the radio this morning, so it must be true :) (although they didn't mention that they were being sequenced in the story, only that they were heading for extinction).
      all so that CostaRicans can use less pesticides, make more money from all of us banana loving Westerners.
      Is this the 'free for small operations' bit of the article then? Surely that's a good thing though. Whether they're Costa Ricans or not shouldn't matter, should it? Perhaps I'm missing your point.
      --

      ---
      "An eye for an eye leaves the whole world blind" - Gandhi
    8. Re:Bananas being sequenced... why? by EvilAlien · · Score: 3, Funny

      s/Westerners/Monkeys/

      --
      perl -e 'print $i=pack(c5, (41*2), sqrt(7056), (unpack(c,H)-2), oct(115), 10)'
    9. Re:Bananas being sequenced... why? by secolactico · · Score: 2

      all so that CostaRicans can use less pesticides, make more money from all of us banana loving Westerners

      You mean CostaRicans aren't westerners??? Boy, my knowledge of geography must be *way* outdated.
      ;-) (smiley here for humor impaired moderators)

      --
      No sig
    10. Re:Bananas being sequenced... why? by ynohoo · · Score: 2, Informative

      Today's guardian has an article about these fungal diseases which threaten this staple of many poorer countries "Yes - in 10 years we may have no bananas" so this reseach comes not a moment to soon. Apparently some Honduran scientists peeled and sieved 400 tonnes of bananas to find just 15 seeds for breeding - and have come up with a fungus resistant variety which can be grown organically, so hopefully the GM route maybe a non-starter...

    11. Re:Bananas being sequenced... why? by EZmagz · · Score: 1
      There are several diseases which, if they got into the main Banana growing parts of the world, could seriously threaten the very existence of the Banana.

      This is a major problem when there is not enough diversification in a gene pool. Consider the cheetah. The cheetah has an incredibly small gene pool, due to massive inbreeding (amongst other things). Why is this bad? Because of the same reason that these bananas might be in trouble...if a disease comes along that the cheetah is particularly vulnerable to, then it's game over. Since there is no genetic variation within the species, every single cheetah would fall dead to the disease and they would quickly become extinct.

      I don't know about you guys, but I can live without cheetahs...but I need my bananas!!! Just some food for thought (pun intended, biatches).

      --

      "Hell hath no fury like a woman scorned for SEGA. ..."

    12. Re:Bananas being sequenced... why? by Bicoid · · Score: 1

      There are more banana-cheetah similarities, I believe...
      Cheetahs: yellow, have black spots, are experiencing problems due to low genetic diversity, don't have seeds

      Bananas: yellow, may have black spots when very ripe, may experience problems due to low genetic diversity, don't have seeds

      The real research question is not about sequencing the banana or the cheetah. I think we need to start researching whether cheetahs can be peeled and eaten for a tasty snack.

      --
      If not all sentients are human, couldn't it be possible that not all humans are sentient either?
    13. Re:Bananas being sequenced... why? by Uart · · Score: 1

      Hey imagine what internet porn would be like without the bannana... I mean, they'd be limited to cucumbers and coke bottles, and thats just not fun.

      OK, Mod me down, but you know that somebody had to say it....

      --

      Opinionated Law Student Strikes Again!
    14. Re:Bananas being sequenced... why? by Door-opening+Fascist · · Score: 1

      This BBC article gives a much better answer to the problem faced by banna growers: Bananas could split for good

      The gist of the article is, without genetic modifications, bannas might go extinct within the decade.

    15. Re:Bananas being sequenced... why? by Noksagt · · Score: 1

      So it isn't to finally make bananas that can get you high?

    16. Re:Bananas being sequenced... why? by matrix29 · · Score: 1

      There are more banana-cheetah similarities, I believe...
      Cheetahs: yellow, have black spots, are experiencing problems due to low genetic diversity, don't have seeds

      Bananas: yellow, may have black spots when very ripe, may experience problems due to low genetic diversity, don't have seeds

      The real research question is not about sequencing the banana or the cheetah. I think we need to start researching whether cheetahs can be peeled and eaten for a tasty snack.


      Heck, I would be happy with cheetahs that don't go spotty and then turn a sticky black shade if I leave them on the shelf for a week. At least they still retain their super-cheesy flavor thanks to all of those cheese-flavored sprinkles despite being stale inside.

      --
      "Face it, a nation that maintains a 72% approval rating on George W. Bush is a nation with a very loose grip on reality.
    17. Re:Bananas being sequenced... why? by bobbv · · Score: 1
      The Guardian has a story explaining the problem.


      The summary: "Two fungal diseases, Panama disease and black Sigatoka, are cutting a swath through banana plantations, just as blight once devastated potato crops. But unlike the potato, and other crops where disease-resistant strains can be bred by conventional means, making a fungus-free variety of the banana is extraordinarily difficult."

    18. Re:Bananas being sequenced... why? by Forgotten · · Score: 1

      ... all so that CostaRicans can use less pesticides, make more money from all of us banana loving Westerners

      Actually, it's more about securing the food supply in places where, if bananas succumbed to disease, millions of people would starve (most bananas aren't for fat Westerners, but for skinny Africans). This is in fact more-or-less guaranteed the way things stand now, and it'll make the Irish potato famine look like mild dyspepsia if it happens.

      Normally I'm pretty dead-set against GM foods, but in the specific case of organisms that can't reproduce on their own (so you're not unleashing such a potential frankenfruit on the world) it might be ok. When the GM organism can and will run amuck in the real world, that's a different story.

      Since the usual cash incentive is less pronounced here I'd also expect there to be less danger of this just creating a different monoculture problem. There are more likely to be smaller, more divergent approaches. But it's also likely to take longer, and there's probably a bit of a time limit.

      The BBC has more on the subject.

      After this maybe we can start to tackle the apple problem (currently the #1 fruit for pesticide use, similarly because of massive monoculture).

    19. Re:Bananas being sequenced... why? by Repton · · Score: 1

      You mean CostaRicans aren't westerners???

      Well, when you consider that we're ``westerners'', despite the fact that we're ~174 degrees east of the Greenwich meridian ...
      --
      Repton.
      They say that only an experienced wizard can do the tengu shuffle.
  3. "...the International Network..." by tooloftheoligarchy · · Score: 3, Funny

    "...for the Improvement of Banana and Plantain?!"

    And here I was worrying that the world was in trouble. Now I can sleep at night.

    1. Re:"...the International Network..." by ahoehn · · Score: 1

      While I'm all for bananas, they're taisty, have any of you ever eaten a plantain? I'm living in Belize at the moment and most every day I get offered some form of fried or boiled plantains. They're so decietful. Disguiseing themselves as a harmless tasty banana, and then like Emeril, BAM, they tastes like chalky pulp.

      Maybe the research could improve the banana and destroy the plantain?

      --
      Mod my comments down. It'll be fun.
    2. Re:"...the International Network..." by Dirtside · · Score: 1

      That's nothing. Near where I live (West Hollywood) we have both the International Yogurt Company and the California Wool Bureau. Both buildings are obvious CIA fronts, as nobody ever goes in or out and they've been there for over 20 years.

      --
      "Destroy science and religion. Science would re-emerge exactly the same; but not religion." - Penn Jillette, paraphrased
  4. His parents must be proud... by httpamphibio.us · · Score: 1

    I'm sure when his parents see long time friends they proudly announce that their wonderful son/daughter is director of the International Network for the Improvement of the Banana and Plantain...

    I wonder how I can get on the board of directors...

    --
    sig.
  5. Duh! by Dark+Lord+Seth · · Score: 3, Funny
    they are only able to reproduce asexually

    Of course they reproduce asexually, who has ever seen two bananas humping eachother?

    1. Re:Duh! by Longjmp · · Score: 1

      Hm. Obviously you've never seen how they grow.
      Seems like they're having a lot of fun. Including S&M...

      --
      There are fewer illiterates than people who can't read.
    2. Re:Duh! by OldStash · · Score: 1

      who has ever seen two bananas humping eachother?

      Seemingly one person thinks they have, but I believe they are mistaken.

    3. Re:Duh! by Ruliz+Galaxor · · Score: 1
      Of course they reproduce asexually, who has ever seen two bananas humping eachother?
      No, but I've seen some girls using them for pleasure.
      Or maybe I'm just watching the wrong chans...
  6. I misunderstood.. by TheRIAAMustDie · · Score: 1

    Thought it had something to do with a song or band called Banana being sequenced (i.e. recreated in MIDI) haha

    --

    Don't think that a small group of dedicated individuals can't change the world. it's the only thing that ever has.
  7. Opensourced banana by watzinaneihm · · Score: 2, Funny

    'One rule of joining the consortium is that any invention developed through the project and protected [by patent] will be made available to smallholders through a royalty-free license,' says Emile Frison, director of the International Network for the Improvement of Banana and Plantain"
    Is that GPL or BSD ?

    --
    .ACMD setaloiv siht gnidaeR
    1. Re:Opensourced banana by AlecC · · Score: 3, Funny

      General Plantain Licence or Banana Source Disclosure?

      --
      Consciousness is an illusion caused by an excess of self consciousness.
    2. Re:Opensourced banana by FrostedWheat · · Score: 1

      Is that GPL or BSD ?

      Mmmm.. Ogg Banana...

    3. Re:Opensourced banana by Kaz+Riprock · · Score: 1

      Open-sourced banana on the web.

      There is no mention as to whether it is GPL or BSD.

      --
      Mordor...a magical, mythical land where women are more rare than dragons--but where every man would rather find a dragon
  8. Doom and gloom in the world of nanas by Scorchio · · Score: 5, Funny

    When my alarm clock went off this morning, BBC Radio 1 news was in full soothsayer mode, foretelling how bananas will be wiped out by disease in ten years if nothing is done. Horrified, I hit snooze.

    According to a trivia game I was playing the other day, the banana is a herb, not fruit. Go figure.

    1. Re:Doom and gloom in the world of nanas by Solitary+Angel · · Score: 5, Interesting

      Actually the banana plant is the worlds largest herb... the banana is still fruit ;) And they cross breed bananas all the time. You can buy Apple Bananas which are smaller, fatter and sweeter... Ahh the knowledge I have gained from having a dad who sells bananas :)

      --
      SA
    2. Re:Doom and gloom in the world of nanas by Anonymous Coward · · Score: 5, Informative

      Banana -
      (Musa sapientum) Technically speaking, the banana is a herb due to the
      fact it is part of the flower made by the female plant. Botanically speaking,
      it's a berry, due to the fact it's a fruit that developes from a plant ovary and
      has little seeds.

    3. Re:Doom and gloom in the world of nanas by Max+Romantschuk · · Score: 1

      How exactly are bananas cross bred? Triploid individuals can ce created by breeding diploid and tetraploid variants, that much I know.

      So is a fertile variant use to produce these cross-bred variants, or what?

      Triploid fruit make sense, since being sterile they produce no seeds, which is all fine and dandy for us. Lots of species can be made triploid (seedless watermelons anyone?), but not all can survive without human intervention, as far as I know.

      --
      .: Max Romantschuk :: http://max.romantschuk.fi/
    4. Re:Doom and gloom in the world of nanas by anshil · · Score: 1

      Can anybody explain what diploid, Triploid, and tetraploid actually means? (I know 2- 3- and 4, but anything else?)

      --

      --
      Karma 50, and all I got was this lousy T-Shirt.
    5. Re:Doom and gloom in the world of nanas by jez9999 · · Score: 1

      Apple bananas? Sounds like they're trying to make a banana that looks like someone's crotch.

    6. Re:Doom and gloom in the world of nanas by Max+Romantschuk · · Score: 2, Informative

      N-ploid means N sets of chromosomes. Humans are diploid, having two sets. The general term is polyploid for three or more sets of chromosomes. See link for more info (in English).

      --
      .: Max Romantschuk :: http://max.romantschuk.fi/
    7. Re:Doom and gloom in the world of nanas by Omni-Cognate · · Score: 2, Interesting
      He's not wrong, you know. The BBC reckons banans may become extinct.

      Of course, if they sequence the genome, they may in the future be able to create a much safer, if rather boring, version of Jurassic Park, where we can all "see this astonishing 20th-century fruit(/herb) restored to to life in it's natural environment!!"

      --

      "The Milliard Gargantubrain? A mere abacus - mention it not."

    8. Re:Doom and gloom in the world of nanas by Solitary+Angel · · Score: 1

      Okay, turns out that Apple Bananas was a bad example, they are a naturally occuring type, but I'm pretty sure that there were many cross varieties available...as to how its done... I don't have a clue sorry :)

      --
      SA
    9. Re:Doom and gloom in the world of nanas by Asprin · · Score: 1


      For those of you who are wondering what a "ploid" is, here's an FAQ on the subject.

      Wow, the internet r0cks! It's chock-full of useful information. It only took me 12 seconds to find that with Google(TM)!








      Yes, that was a joke.....
      No, it really wasn't funny.
      No, I haven't had coffee yet.
      Yes, I *am* sorry I bothered, but I couldn't resist the whole 'ploids' thing. What I can't figure out is how Frito-Lay got ahold of a word from genetics as a boxtop currency. Maybe it just sounds funny... ploids, ploids, ploids.... Yeah, that has to be it.
      No, I don't work for Frito-Lay.
      Yes, I hate myself now.

      --
      "Lawyers are for sucks."
      - Doug McKenzie
    10. Re:Doom and gloom in the world of nanas by neiljt · · Score: 1

      You'll be asking us to believe they grow on trees next.

    11. Re:Doom and gloom in the world of nanas by Some+Dumbass... · · Score: 1

      Technically speaking, the banana is a herb due to the fact it is part of the flower made by the female plant. Botanically speaking, it's a berry, due to the fact it's a fruit that developes from a plant ovary and has little seeds.

      Sheesh, it already sounds like a genetics experiment gone bad. And now they're going to sequence it and mess with its genes? What next, bananas which are tubers?

    12. Re:Doom and gloom in the world of nanas by elakazal · · Score: 1

      Most banana breeding (as far as I know, which I must admit is not very far) is done with diploid and tetraploid cultivars, which are fertile. Cross a diploid and tetraploid, you get a triploid. Strikes me as an annoying crop to breed.

      Some crosses can in fact be made between triploid and diploids, with the offspring as tetraploids, but I'm still trying to figure out what's going on there. Any guesses?

    13. Re:Doom and gloom in the world of nanas by Bicoid · · Score: 1

      Yeah...here goes. The triploid gamete is 2n, being effectively diploid. The offspring is a hybrid, so the chromosomes don't entirely pair up, so the chromosomes from the 1n gamete duplicate themselves and pair up with their duplicates. It's really 2n, but because you have 4 sets of chromosomes, they still call it tetraploid.

      --
      If not all sentients are human, couldn't it be possible that not all humans are sentient either?
    14. Re:Doom and gloom in the world of nanas by pyrros · · Score: 1

      You can buy Apple Bananas which are smaller, fatter and sweeter...

      Let me guess, they are called iBananas and instead of yellow, they come in white.

    15. Re:Doom and gloom in the world of nanas by elakazal · · Score: 1

      That's kind of what I was guessing, basically a lucky shuffling of the poor triploids chromosomes resulting in something 2n that works.

      That's what you're saying, right, not that the triploid always produces diploid gametes, right?

    16. Re:Doom and gloom in the world of nanas by Bicoid · · Score: 1

      No, when a triploid (3n) organism produces 1n gametes, the offspring is simply 2n. When the triploid (3n) organism produced 2n gametes, the chromosomes from the diploid parent so you get 2(1n)+2n=4n. The chromosomes are, of course, not homologous, so really it's a 2n organism with n=(twice the normal haploid number) but because it has a diploid (2n) component of the chromosomes from each parent, it's considered tetraploid (4n)

      --
      If not all sentients are human, couldn't it be possible that not all humans are sentient either?
    17. Re:Doom and gloom in the world of nanas by elakazal · · Score: 1

      But how are we getting the 1n gametes in the first place from a triploid?

  9. The problem of asexually reproducing crops by axolotl_farmer · · Score: 5, Informative

    The kind of bananas the we buy in our stores are triploid hybrids. This means that they are sterile and produce no seeds. They are reproduced from cuttings of the creeping underground stem, the 'banana trees' are actually upshoot from this.

    They downside is that all cuttings are genetically identical, so if a new disease or pest comes along, ALL commercial bananas are threatened. With other crops, crossbreeding with other strains can improve the resistance to the pests.

    Introducing resistance genes in commercial bananas can only be done by genetic engineering. Remember that there are still wild sexually reproducing bananas out there, so maybe we will be eating hybrids of other species in the future.

    1. Re:The problem of asexually reproducing crops by BrainInAJar · · Score: 1

      "there are still wild sexually reproducing bananas out there"

      Now you've gone and done it... As if furries weren't bad enough, soon there's gonna be banana porn out there...

    2. Re:The problem of asexually reproducing crops by anshil · · Score: 1

      I recently bought banana seeds. Does this mean the plant I will get will not grow eatable bananas? (well it will take 2 decades anyway or so, if it survives that long). Or does this work like apples, or oranges, where a base tree is created by seet, and then branches of the target sort is cropped on it (you get a genetically different branch on a tree)? But I don't think this will work on a palme, will it?

      --

      --
      Karma 50, and all I got was this lousy T-Shirt.
    3. Re:The problem of asexually reproducing crops by OldStash · · Score: 5, Funny

      Remember that there are still wild sexually reproducing bananas out there

      You wouldn't have a link to their site, would you?

    4. Re:The problem of asexually reproducing crops by MikeDX · · Score: 1

      maybe we will be eating hybrids of other species in the future.

      Ohh I hope so! Cross bred cowpig for that breakfast treat, or turkeychicken for sunday lunch!

    5. Re:The problem of asexually reproducing crops by FleaPlus · · Score: 1

      > Does this mean the plant I will get will not grow eatable bananas?

      It means that the seed came from a single parent, rather than two. This is potentially bad b/c the seed is genetically the same as it's single parent, potentially leading to problems with disease resistance.

      But yes, it will grow into an edible banana.

    6. Re:The problem of asexually reproducing crops by FleaPlus · · Score: 1

      Doh... I just read the parent's parent, and now I'm not so sure about my answer. My apologies.

    7. Re:The problem of asexually reproducing crops by Lt+Razak · · Score: 1

      I'm hoping for Bunnickens that will lay those tasty Cadbury eggs year round.

    8. Re:The problem of asexually reproducing crops by elakazal · · Score: 1

      No, it just means it won't grow into a commercial cultivar. Because banana isn't really a tree, I doubt you could really graft anything on it anyway...well, you might be able to, but you certainly wouldn't want to.

      The bananas should be edible, but they could be something unappeal or have seeds. Where did you buy the seeds? Did they mention what sort of plant it should be?

    9. Re:The problem of asexually reproducing crops by UnclePaeng · · Score: 1

      You wouldn't have a link to their site, would you?

      Here you go. And apparently, they always cum in pairs.

  10. Licensing? by Anonymous Coward · · Score: 1, Insightful

    Royalty-free, sure. But what about the up-front fee? Oh, prohibitive? Thank you.

  11. I'm confused by hdparm · · Score: 2, Insightful
    Because bananas are triploidal instead of diploidal, they are only able to reproduce asexually, which means that it adapts slower than organisms reproducing sexually.

    Is there any other plant in the world that reproduces sexually?

    1. Re:I'm confused by Hairy+Fop · · Score: 4, Informative

      Any plants with flowers are examples of sexual reproduction in plants. The pollen of one flower being transferred to the stamen of another by insects is an example of sexual reproduction.

      Genes are combined from two different sets to produce a single gene set and a new seed (now that's sexual).

    2. Re:I'm confused by 20_ooodbye · · Score: 5, Informative

      There seems to be a bit of confusion caused by the terms diploid and triploid.
      These terms refer to the number of sets of chromosomes each cell of an organism carries. Diploid is like us with 2 sets triploid is predictably 3 sets. Having 3 sets of chroromsomes is no problem untill you have to half the chrosomme number in making gametes (sperms, egg, pollen etc) A triploid organism can't make viable gametes, so is sterile.

      Not all Bananas are triploid though, we reproduce triploid ones because not bothering with reproduction they are more vigorous in there growth and wont make seeds. Seedless watermelons are triploid and there are even (engineered) triploid carp, used to clear weed from lakes etc but denied the chance to reproduce and start a population

    3. Re:I'm confused by lederhosen · · Score: 1

      Allmost... Bananas do have flowers, but they
      are defect and hence can not reproduce sexualy.

      Bannanas are reproduced by taking the small
      plants comming up from the main plant i.e.
      they are cloned. The only changes that occure
      is therefore by mutations.

    4. Re:I'm confused by kaens · · Score: 1

      most plants reproduce sexually

    5. Re:I'm confused by sbeitzel · · Score: 1

      You mean besides marijuana, hops, and avocados (in which the plant is either male or female)? Or any other flowering plant (in which both "male" gametes and "female" zygotes are produced)?

      --
      Oh, go on, check out my job.
  12. Asian banana or the western? by watzinaneihm · · Score: 1

    They say they will sequence wild bananas first (rather than the kind we eat) so that the relevant choromosomes/genes/whatever else can be put in the edible varieties to make them resistant to disease etc.
    Now to put them in the edible varieties , shouldnt they also be sequenced?
    Also can't they put in the genes which make the Western bananas taste good into the wild ones? The fact that they grow in the wild should make it easier to grow, right?
    Is suppose the banana scientists have thought of all that ....
    Well,atleast the genes being open to all redefines the term banana re-public.....

    --
    .ACMD setaloiv siht gnidaeR
    1. Re:Asian banana or the western? by Palinor · · Score: 1

      Wild bananas have seeds in the fruit, which is why the only bananas we eat are sterile hybrids.

  13. INIBAP by kryps · · Score: 1

    "the International Network for the Improvement of Banana and Plantain.".

    Observe the birth of a new acronym! ;-)

  14. its both by Anonymous Coward · · Score: 2, Interesting


    The Banana is a strange thing cos its both, a banana (the yellow thing you peel and eat) is undoubtedly a fruit (containing the seeds of the plant), though since commercially grown banana plants are sterile, the seeds are reduced to little specks.
    However, the banana plant, though it is called a 'banana-tree' in popular usage, is technically regarded as a herbaceous plant (or `herb'), not a tree, because the stem does not contain true woody tissue.

  15. banana in your pocket by Stanley+Feinbaum · · Score: 4, Funny

    Hey Emile Frison, is that a banana in your pocket or are you just the director of the International Network for the Improvement of Banana and Plantain?

    --

    Stanley Feinbaum, professional journalist and master debater! God bless the USA!

  16. funny, i was *just* reading about this by lingqi · · Score: 2, Informative
    here on SciAm they have some cool stuff about this in general.

    on the other hand - I have to wonder, while interesting how does this article fit in slashdot?

    --

    My life in the land of the rising sun.

    1. Re:funny, i was *just* reading about this by Stuart+Gibson · · Score: 1

      We obviously need an in depth survey - Do nerds like bananas? If so, this is news stuff that matters for nerds.

      Goblin

      --
      It's all fun and games until a 200' robot dinosaur shows up and trashes Neo-Tokyo... Again
    2. Re:funny, i was *just* reading about this by whovian · · Score: 1

      Maybe nerds are triploid?

      --
      To-do List: Receive telemarketing call during a tornado warning. Check.
    3. Re:funny, i was *just* reading about this by whovian · · Score: 1

      (afterthought)
      It explains (a) why nerds don't get some and (b) why nerds therefore do not reproduce (ahem) sexually.
      (/afterthought)

      --
      To-do List: Receive telemarketing call during a tornado warning. Check.
  17. This is bad for the MPAA by martin-boundary · · Score: 3, Funny

    Once they find and patent the banana's "funny" gene, slapstick comedy movie production prices will go through the roof...

  18. Fruit! ...so to speak. by c.emmertfoster · · Score: 2, Funny

    There's evidently an australian children's show called "Bananas in Pajamas," which has some rather nightmarish homoerotic(?) overtones.

    I'm rather relieved that my Google search for "bananas pajamas porn" returned no results.

    --
    We can neither love nor pity nor forgive. If you make a slip in handling us you die!
    1. Re:Fruit! ...so to speak. by blancolioni · · Score: 4, Funny

      There's evidently an australian children's show called "Bananas in Pajamas," which has some rather nightmarish [angelfire.com] homoerotic(?) overtones.


      You're not kidding; in fact the theme song goes "Bananas in pajamas are coming down the stairs."

      Powerful fruit indeed.

    2. Re:Fruit! ...so to speak. by spaceyhackerlady · · Score: 1
      There's evidently an australian children's show called "Bananas in Pajamas...

      I always thought the Teletubbies were the gay heartthrobs. Oh well. The Bananas hang out with teddy bears, for what it's worth.

      ...laura

  19. hupp! by pahpabut · · Score: 1

    "Banana To Get Sentenced" I read..
    Be it wrong as it may, but somehow it felt right.

  20. pictures? by Anonymous Coward · · Score: 1, Funny

    ... bananas.. sexually...

    I think I have a picture of that somewhere.

  21. true by peterpi · · Score: 1

    Scorchio's not kidding; I heard it on the radio too.

  22. Bananas could be threatened by PGillingwater · · Score: 1

    According to The Sun, BANANAS could vanish from supermarkets because a vicious disease is wiping them out.

    The fungus, Sigatoka, is devastating plants in Africa.

    And experts say it threatens to spread to all edible varieties of the fruit, killing them within ten years.

    --
    Paul Gillingwater
    MBA, CISSP, CISM
  23. no royalties? by magarity · · Score: 2, Funny

    'One rule of joining the consortium is that any invention developed through the project and protected [by patent] will be made available to smallholders through a royalty-free license,'

    Do they know to beware clever ideas put forward by the biochemists from the Rambus contingent?

  24. banana? by lobsterturd · · Score: 1

    So they think they own the genome for a particular banana.

  25. Knock Knock by devnullkac · · Score: 5, Funny

    Now we can finally update that tired knock-knock joke:

    Knock, Knock!
    Who's there?
    GCACCAATGCACCTGAAGCTCAGCTTAA...
    GCACCAATG CACCTGAAGCTCAGCTTAA... who?
    Knock, Knock!
    Who's there?
    GCACCAATGCACCTGAAGCTCAGCTTAA...
    GCACCAATG CACCTGAAGCTCAGCTTAA... who?
    Knock, Knock!
    Who's there?
    GCACCAATGCACCTGAAGCTCAGCTTAA...
    GCACCAATG CACCTGAAGCTCAGCTTAA... who?
    Knock, Knock!
    Who's there?
    Orange.
    Orange who?
    Orange you glad I didn't say GCACCAATGCACCTGAAGCTCAGCTTAA... again?
    --
    What do you mean they cut the power? How can they cut the power, man? They're animals!
    1. Re:Knock Knock by insanecarbonbasedlif · · Score: 1

      Now we can finally update that tired knock-knock joke:

      Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...
      GCACCAATGCACCTGAAGCTCAGCTTAA... who?
      Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...
      GCACCAATGCACCTGAAGCTCAGCTTAA... who?
      Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...
      GCACCAATGCACCTGAAGCTCAGCTTAA... who?
      Knock, Knock!
      Who's there?
      Orange.
      Orange who?
      Orange you glad I didn't say
      GCACCAATGCACCTGAAGCTCAGCTTAA... again?

      Not to nitpick... well, ok, to nitpick, I think it would actually go something more like this(missing part in bold:

      Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...
      GCACCAATGCACCTGAAGCTCAGCTTAA... who?
      GCACCAATGCACCTGAAGCTCAGCTTAA Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...

      We need to be vigilant with our intellectual history :)

      cheers.

      --
      Just because I doubt myself does not mean I find your position compelling.
  26. Re:Duh!: Warning SOT comment by t0qer · · Score: 1, Funny

    Since this is the funny thread. My SOT (Slightly off topic) comment will be banana related... I sing this all the time at karaoke. Imagine that. It will in the very least put a smile on your face.

    There's a fruit store on our street
    It's run by a Greek.
    And he keeps good things to eat
    But you should hear him speak!

    When you ask him anything, he never answers "no".
    He just "yes"es you to death,
    And as he takes your dough, he tells you...

    "Yes! We have no bananas
    We have no bananas today!!
    We have string beans and onions, cabBAges and scallions
    And all kinds of fruit and say
    We have an old fashioned toMAHto
    A Long Island poTAHto, but

    Yes! We have no bananas
    We have no bananas today!"

    Business got so good for him that he wrote home today,
    "Send me Pete and Nick and Jim; I need help right away."
    When he got them in the store, there was fun, you bet.
    Someone asked for "sparrow grass"
    and then the whole quartet
    All answered:

    "Yes, we have no bananas
    We have-a no bananas today.
    Just try those coconuts
    Those wall-nuts and doughnuts
    There ain't many nuts like they.
    We'll sell you two kinds of red herring,
    Dark brown, and ball-bearing.
    But yes, we have no bananas
    We have no bananas today."

  27. What? Bananas have their own network? by Luxury+P.+Yacht · · Score: 1
    ...the International Network for the Improvement of Banana and Plantain

    Not to be confused with:
    • National Association for the Advancement of Oranges
    • Society for the Prevention of Cruelty to Kumquats
    • Foundation for a Better Blueberry
    • Organization of Anthropomorphic Carrots
    and the little known:
    • Consortium of Fruit Hacking Doodz
    --
    Bush should have died, not Reagan -- Morrissey
    Morrissey rides a cockhorse -- The Warlock Pinchers
  28. Shouldn't this be in the humor section? by the+gnat · · Score: 1

    Seems like anyone looking to draw attention to their organism of choice simply announces a new genome project. You'd think they'd wait to see how useful the human sequence is first- after all, many millions more dollars are being spent researching and analyzing that, and it's still taking a while for people to produce anything useful from it. It's a valuable reference, but I doubt banana research is as intensive and sophisticated as research in human genetics. (Just a hunch.)

    In other news, the National Organization for the Reform of Marijuana Laws announced plans to sequence the Cannabis sativa genome. A group spokesman said, "We're hoping this project will lead to. . . um. . . shit, I think I ate my notes."

  29. What about strawberries? by Cokelee · · Score: 1, Informative

    Bananas:

    1. Clone
    2. Insert DNA
    3. ???
    4. Profit!

    Seriously, most strawberries are quadriploidal (4N), by design. They are larger this way, what about research in this direction? I'd be much angrier if there were no strawberries!

    1. Re:What about strawberries? by Kadagan+AU · · Score: 1

      I say research them both and cross breed. Then you can have all that is strawberry banana all from one plant. Mmm.... peeling a strawberry-banana and eating it for breatfast. Imagine cutting THAT into a bowl of cherios in the morning! ~Kadagan

      --
      This space for rent, inquire within.
  30. Abrosial Wild bananas by Zukix · · Score: 3, Interesting

    What crazy westerner decided that everyone prefers the typical banana? I happily munched wild bananas while trekking in Northern Thailand and goddam they're like a different fruit. Unimaginably sweet, fragrant...amazing - like nectar. Not the bland lumps sold in UK supermarkets. They are small (offending western male self-perception) and probably don't travel well so thank-you evil corporations for 'deciding' that we prefer this genetically weak alternative so they can make a buck. I hope they DO die out and we 'stuck' with REAL bananas. Zu.

    1. Re:Abrosial Wild bananas by gorilla · · Score: 1

      UK supermarkets, indeed all supermarkets, are there to sell bland lumps. Doesn't matter what the product, it's got to be sanitized and regularized to make shopping in June the same as shopping in December.

  31. ObDiskworld(tm) reference by Doctor+Hu · · Score: 1
    "I know how to spell bananana, I just don't know when to stop." (approximately)
    ISTR this was first attributed to Granny Weatherwax or Nanny Ogg, but has turned up from time to time in other contexts. Thanks Pterry.

    Oh, it's not that kind of sequencing? Sorry, my bad.

  32. super-banana by Alien+Being · · Score: 2, Funny

    You fall down just looking at it.

  33. Here is the proper sequence by CaptainSuperBoy · · Score: 3, Funny

    Dish > Banana > Ice cream > Chocolate syrup > Whipped cream > Sprinkles > Cherries > Spoon

    mmmmm...

    1. Re:Here is the proper sequence by Lemmeoutada+Collecti · · Score: 1

      Hey now! Bananas may be asexual, but don't forget the nuts!

      --

      You can have it fast, accurate, or pretty. Pick any 2.
  34. The things you learn about bananas by esme · · Score: 4, Funny
    Who would have thought that one of the most phallic foods was sterile and asexual?

    -Esme

  35. Triploidy \neq Asexual reproduction by MoobY · · Score: 5, Interesting

    It is not simply true that triploidal plants and animals have to replicate asexual. Cultivated bananas indeed do have 3 chromosomes of each of the 11 different chromosomes available. During meiosis, when two possible parent plants are creating gametes (think of sperm and eggs) by splitting cells with 3 chromosomes of each type into cells with either 1 or 2 of the 3 chromomes.

    In the next step, such gametes need to be fertilized, i.e., 2 cells, just like a sperm cell and egg cell, need to be fertilized and merged together. If this results in a cell with 3 chromosomes of each chromosome type, a new banana child can grow from this. But since gametes contain 1 or 2 of each type of chromosome, and they have 11 such types, there is only a 1/2^11 change that this sexual reproduction is succesful.

    Note that this only applies to the cultivated banana, as we know it from the super market. And you've probably never eaten a banana with pits in it. Bananas with pits exist, but there's only one in about 2048. These bananas can be used to create new banana trees, and they're different from their not-succesful bananas in that they are a lot smaller, and not edible, if compared to common cultivated bananas.

    --
    --- Sigmentation Fault - Comments Dumped
    1. Re:Triploidy \neq Asexual reproduction by MoobY · · Score: 1

      That should be "seeds", not "pits". Probably my dutch influence there.

      --
      --- Sigmentation Fault - Comments Dumped
  36. The Amazing Thing About Slashdot... by Kadagan+AU · · Score: 1, Funny

    You mention bananas and all the 'intersting' people come out.

    --
    This space for rent, inquire within.
  37. "Banana" sequencing? by pamar · · Score: 1

    What about the insidious banana problem?

  38. What will we do if it went extinct? by Rik+Sweeney · · Score: 4, Funny

    I think I'd go mad.

    Bananas even.

  39. Problems with banana by Ed+Avis · · Score: 1

    Scientists tried before to sequence banana, but they didn't know when to stop.

    --
    -- Ed Avis ed@membled.com
  40. triploidal bananas by DirkDaring · · Score: 1

    'triploidal bananas' would make an excellent name for a rock band.

  41. Apples too by johnlenin1 · · Score: 2, Interesting

    In his book, The Botany of Desire , Michael Pollan devotes a chapter to the apple and discusses at some length a similar problem. Apple trees are grown from cuttings from older trees already known to produce tasty apples. (The seeds in any given apple are all completely genetically different from the apple they came from and will not produce a tree of similarly-tasty fruit.)

    Almost all the apple varieties we consume here in the States (Delicious, Gala, Fuji, and several other I can't remember) can trace their genes back to one tree from the 1800s. Whole industries are based upon this rather homogenous crop, and disease could be devasting. The current answer is heavy spraying of pesticides. Diversification of profitable appple varieties would be better though.

    Some of the pages from this apple chapter can be read online at Amazon (but not the most interesting ones, of course).

    1. Re:Apples too by elakazal · · Score: 1

      The problem with genetic diversity in apples and virtually all other fruit is that until the industry is devastated by something, there's little immediate financial incentive to do it. We have a very set idea of what qualifies as an apple, and it consists of a very, very small part of the apple genome. So any kind of interspecific cross is going to look unappealing to consumers for several generations before it starts looking like the apples we buy now. The problem is that a generation in terms of apple breeding is at VERY least five years, and that doesn't leave you much time to evaluate anything...a more workable bare minimum would be more along the lines of 10 years. So if it takes four generations to get back to something acceptable, that's 40 years. Most apple breeder programs don't have funding sources that will tolerate killing time for an entire career. Like everything else, they want results. So mostly people keep mucking around with different permutations of the existing stuff.

      Transgenics offer an opportunity to speed up the process, but the backlash in fruit has the potential to be significantly more than highly processed crops like cereals...

  42. Bananas Face Extinction by way2slo · · Score: 2, Interesting
    I just read an article on how the rate of banana crop failures from pests and disease are at a current rate that they may be gone in ten years if nothing can be done to stop it. Genitically engineering more resistant bananas is one option.

    I can't imagine a world without bananas.

  43. Why not develop organic farming? by kfarley · · Score: 1

    This will help developing nations farm healthier food while stop them from using the U.S.'s banned pesticides. Plus, GMO foods suck. If we can't even handle the y2k switch, what the hell are we doing hacking the universes most dense code? I don't trust Genetic Engineers to safely mess with anything; let's get operating systems and apps working right first.

    --
    "But the dreams came on in the Japanese night like livewire voodoo..." - William Gibson I'm a signature virus. Please c
    1. Re:Why not develop organic farming? by elakazal · · Score: 1

      The third world did organic farming for years. A lot of it still does. It was called subsistence farming.

  44. Re: triploid hybrids? No problem by elakazal · · Score: 1

    I thought of this too, but not many crops like ploidy numbers that high, and relatively few can be produced commercially like that (strawberries being the notable exception). So, assuming you're getting it to grow, which I would guess is unlikely for 12n at least, and you breed them, you're then faced with the problem of knocking the ploidy back down to something that will be survive.

    I could be way off on bananas...not my area of expertise, but it seems unlikely. I'm still not entirely clear of what's going on with bananas.

  45. Yes Banana's have DNA! by hellfire · · Score: 1

    This is OT but I had to say. The following is a conversation I had with a cow-orker while showing him this article.

    Me: "Hey, look they are going to sequence the DNA of a Banana."
    Him: "Bananas have DNA?"

    Pardon me while I cleanse the gene pool (no pun intended).

    --

    "All great wisdom is contained in .signature files"

  46. Bananas? by blair1q · · Score: 1

    That's nuts.

  47. Ximian? by joshsnow · · Score: 1

    Are monkeys (as natural babana consumers) being sequenced too?
    If so, how does this affect Ximian?

  48. more info by Kallahar · · Score: 1

    more info at this site

    heh heh

    Travis

    1. Re:more info by Kallahar · · Score: 1

      ah crap, I meant this site. I should have hit preview!

  49. News? Say Headlines! by joshsnow · · Score: 1

    There is no news on Radio 1 - it's all breathlessly delivered headlines. If they spend to long (more than half a minute) reading these headlines , a voice screams "the music mo-foo-koo put da music onnnnn!"

  50. The banna that fell off the truck by JDizzy · · Score: 1

    And when that rouge banna asextually spawns roots in my back yard, do I require a license for the genetic patents?

    --
    It isn't a lie if you belive it.
  51. Good Job by JW555 · · Score: 1

    We won't have any bananas in 10 years!

    'Scientists warn today that the world's favourite fruit could be extinct within 10 years because it is unable to fight off a rampaging plague of pests and disease'

    Defenceless banana will be extinct in 10 years

  52. On a more serious note... by The+Creator · · Score: 1

    If bananas don't reproduce sexually, then why do they produce fruit?

    --

    FRA: STFU GTFO
    1. Re:On a more serious note... by glenebob · · Score: 1

      IANABB (I am not a banana botanist) but...

      Because they use seeds. The fruit provides nourishment to the seedlings, and helps the seeds spread (animal eats fruit, walks around, craps, bananas grow in new place). It has nothing to do with sex. Get your mind out of the gutter.

    2. Re:On a more serious note... by jtev · · Score: 1

      Um, I'm sorry, You seem to have yourself confused with someone clever. plants that reproduce SEXUALY have seeds or spores. Bannana's don't reproduce sexualy, so they don't have seeds. it's kinda like seedless grapes, At one point in time they reproduced sexualy, but now the seeds are non-viable, so they can't reproduce. because the seeds are non-viable they also don't grow significantly. This also means that since they reproduce by asexual means they evolve faster (yeah realy) but are less resistant to disease and parasites (the real reason for sexual reproduction)

      --
      That which is done from love exists beyond good and evil
  53. Misread by The+G+Man · · Score: 1

    Man, for a second there I read "Banana to be Sentenced", and wondered what exactly it did to be featured on /.

    --

    Quoth the zombie, braaaaaaaains
  54. Heavy on the Pesticides, Fungicides, etc by FFFish · · Score: 1

    I didn't realize that bananas were so heavily dosed with poisons.

    I don't think I want to eat them any more. They can't be healthy for me.

    --

    --
    Don't like it? Respond with words, not karma.
  55. What I Learned from this Article by serutan · · Score: 1

    1. Banana plants are propagated from shoots taken from another banana plant.
    2. Bananas are by far the most heavily sprayed crop in the world.
    3. "Wild banana" would probably make a great name for a band.

  56. Geez, get your mind out of the gutter by zrk · · Score: 1

    Sometimes, a banana is just a banana.

    (Yes the original version of the comment referred to cigars. so?)

  57. Article is REALLY old by WeekendKruzr · · Score: 1
    I am utterly STUNNED that this went through an entire page of comments before anybody bothered to look at the date at the top of the article: The 18th of July 2001 Good grief Charlie Brown!!

    Solid work by the Slashdot Editors, as always. ;-)

  58. DNA Of Banana by Alan+Holman · · Score: 1

    I thought the headline had something to do with Banana Chan, but I am the only person who would think that.

  59. Banana sequenced long ago by YeOldeGnurd · · Score: 1
    ... on The Banana Splits show.

    Surely anyone here over the age of thirty-five remembers the theme song:

    One banana, two banana, three banana, four
    Four bananas make a bunch and so do many more
    Over hill and highway the banana buggies go
    Comin' to bring you the Banana Split show

    --
    ...Nothing interesting here. Just move along...
  60. The real concern a decease like chestnut blight. by lukme · · Score: 1

    Do you see many american chestnuts tree on the east cost today?

    Just consider, chestnut trees were considered junk wood - there are entire barns made of chestnut. I have a desk made by an apprentice that I believe is chestnut. The wood matches the chestnut in my sister's house.

    Now consider bananas, if a decease like blight hit them, we probably would not be able to buy banana in the store.

  61. Peanuts Too! by ShavenYak · · Score: 1

    I hope someone as at least keeping a watchful eye on peanut populations. It would sure suck to save bananas from extinction, but still wind up unable to make PB&B sandwiches.

    --

    Hey kids, there's only 5 days left 'til Yak Shaving Day!
  62. Followup:Stop wasting time. by mcbridematt · · Score: 1

    After hearing a bit more on this topic (sorry, my doctor told me not to each a lot of bananas), aplogies to any Scientists offended by my comments (No bananas were hurt in the process of writing my comment). Ok, you can study it so you can make something to kill off fungus, but what about those people who only eat organic food?.