Slashdot Mirror
Breakthrough In Human Genetics
Many readers have submitted this story about a breakthrough in our understanding of human DNA: in particular, how much variation can exist between peoples' genes and how genes are involved with certain diseases. "One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically.
They said their new version of the human genetic map, or 'book of life,' fills in many missing pages and chapters to explain how genes are involved in common diseases.
The Human Genome Project mapped the billions of letters that make up the human genetic code. Scientists later refined the map by looking for single variations called SNPs or single nucleotide polymorphisms.
The CNV map gives researchers a different way to look for genes linked to diseases by identifying gains, losses, and alterations in the genome."
One person's genetic code can be 10% different from another's, and chimps are 98% the same as humans.
No wonder so many of you can't spell.
Looking at the writeup from Nature. They clearly state that these results point to maybe a 0.5% difference among individuals, or 99.5% identical. That's 20X less variation than this crap article would have you believe. The actual research deals with CNV's = copy number variants. So for a given stretch of DNA, different people in a population might have that region duplicated or triplicated which does not really allow them to make anything different, but it might alter the levels of expression of those genes. As this DNA is found in multiple copies it had largely been believed to have a low number of genes, as is the case of most highly repeated DNA, but the researchers have evidence that these repeated domains do contain a large number of unique genes. In a short summary/analogy:
Some people are 8 feet tall.
Some people are 4 feet tall.
Therefore, people vary in height by 200%.
It's obvious to see the failed logic in that case, that's the same thing here, just because 10% might potentially be variable, that doesn't mean any single person even exists at each extreme.
i remember reading that humans and chimps are 98% the same
and previous to this announcement, all people were 99.9% the same
the implication here is that people are actually as low as 99% the same
which means one crazy ass inference:
it should be possible to find two people and a chimp such that and person A is equally different from the chimpanzee as he is from the person B
no way
intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
No, no, no, no, no... this is all just a misunderstanding of scientifical facts. You see, it's only the darker folks, whom we are 10% different from, that are 2% different from monkeys. The world was made this way intentionally, presumably by some Great, Omnipotent Designer... whatever you want to call him. I know this to be true because I learned it in a museum. In Kentucky. It was right next to the exhibit with humans and dinosaurs living together.
Honestly folks, get it together already.
If there is so much variation between humans, how does this impact future genetic therapies? Wouldn't we need to map each person's genome, then study the impact of disease on each of the genes, to understand what gene therapies would work best for an individual? This article seems to suggest that the everyday "We've found the gene that causes " claims are only true for a subset of the population.
Crack - Free with every butt and set of boobs
"One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically." It doesn't call it into question at all. The simple matter is that how you define "different" and measure the percentages makes a big difference. The human genome is ~3 billion base pairs. You can have a singe nucleotide change in a gene of say 5000 base pairs. When you compare a given gene between individuals, do you count the whole gene as being entirely different? Or do you say that it is 99.98% (4999/5000) the same?
Dude, I have no idea what you are bitching about. 1. Gene expression is one of the most active areas of research, pharmacagenomics is actively being researched. Have you even heard of Gleevec? Cures people with a specific mutation? 2. It is WAY easier/cheaper/more standard to measure gene expression than to sequence them. 3. How tensegrity plays into signal transduction / gene expression is still unknown. 4. The ECM is an active area of research and drug targets for cancerand clotting. ....And if you say tenesgrity, or porosity again, I shall be forced to apply sufficent pressure to your crainial area as to force it to rupture.
Soft matter people..... just want to bitch.
Does anyone know what stance our major religions have on DNA? For example, how should a true Christian receive this news?
I know it's not entirely on topic, but seeing that the bible describes humans as flesh and blood and as one, it would be interesting to see what this up-to-ten-percent-difference would put science against religious belief.
Full Tilt
My brother is explained...
"Everyone on the earth is unique, ..."
except this one guy
Physics is like sex: sure, it may give some practical results, but that's not why we do it.
That 10% is way off. There is on average a variable base (across all people) every 300 bases. So by my calculations, people are at least 1 - 1/300 = 99.7% similar. Not everyone can be different everywhere so that gets us back in the 99.9% territory. The copy number variation map has not changed those numbers that much...
:(){
1 million monkeys randomly typing typewriters = 1 shakespeare manuscript created
monkeys and humans 98% the same, and this new genetic analysis indicates human up to 10% different, or, only 90% the same
therefore, 98%-90% = 8% difference in monkey versus human random shakespeare manuscript creation
8% of 1 million is 8,000
therefore, 8,000 more monkeys than humans are required to produce one shakespeare manuscript
it's a scientific fact folks
(as well as all other "facts" gleaned from this 10% number in the article)
intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
Wow. That link took an interesting scientific report and then added a stupendous amount of stupidity. Here's the original source: http://www.pnas.org/cgi/content/abstract/172510699 v1
Here's why scientists believe two ape chromosome pairs fused into one human chromosome pair (which your link claims is ridiculous without any explanation): http://www.gate.net/~rwms/hum_ape_chrom.html
"The common ancestry scenario presents two predictions. Since the chromosomes were apparently joined end to end, and the ends of chromosomes (called the telomere ) have a distinctive structure from the rest of the chromosome, there may be evidence of this structure in the middle of human chromosome 2 where the fusion apparently occurred. Also, since both of the chromosomes that hypothetically were fused had a centromere (the distinctive central part of the chromosome), we should see some evidence of two centromeres."
Read the rest of the document to see how these two predictions made by the theory of common ancestry turned out to be correct.
It depends on what, exactly, you are comparing. If you pick out a human gene and its chimp counterpart, and line up the sequenes, you find they are about 99.8% identical at the nucleotide level (and often 100% identical when you look at the encoded amino acids). These regions are presumably under selective pressure. If you do the same for corresponding non-gene sequences, ones which are not under selective pressure, you find they are 98.6% identical. However, now that the two genomes are essentially complete, we know that there are some large-scale duplication and deletion events, as well as variations in mobile elements, that make the overall identity between the two genomes somewhat less than the 98-99% identity between homolgous sequenes. So 95%, 98.6%, or 99.8% - all are correct answers in the correct context.
(IIABioinformaticist)
doesn't mean anything unless it's 10% of the genome that's actually expressed, or if it is creates a functionally different protein. Working on the assumption that we do actually evolve, then we'd need to have sections of DNA that can alter without having an immediate effect - like a scribble pad where stuff could just be doodled.
So how is parent Offtopic?
Because it's a creationist site whose tagline is "Upholding the authority of the bible from the very first verse." While the source generally shouldn't be taken into consideration when considering the argument, in this case it's similar to asking the KKK for informed research on black people.
Want to improve your Karma? Instead of "Post Anonymously", try the "Post Humously" option.
OK, according to the Chromosome FAQs:e /posters/chromosome/faqs.shtml
http://www.ornl.gov/sci/techresources/Human_Genom
The X chromosome comprises ~5% of the genome while the Y chromosome is ~1%. Since women are XX and men are XY, men and women differ by ~6%.
If chimps are only 2% different from men, then men are more closely related to chimps than women. QED
Even if two genomes are 100% the same, that doesn't mean that the products of each will be the same.
Why? Gene expression can differ depending on environmental factors.
As a simple analogy, your DNA = a cookbook. While many recipies are cooked automatically by the systems in your body, other recipies are cooked or not cooked depending on the environment in which the organism finds itself.
I haven't read a good article on gene expression, really. Various mechanisms are alluded to in the literature, but it seems to be unclear how gene expression is or is not triggered. More specifically, researchers seem to know that this particular mechanism turns a given gene on or off, but how that mechanism is triggered is unknown (or not the focus of the article/research).
Also, I'd guess that environmental gene expression stars in the womb - that the fetus gets clues to the external environment from the nutrients and chemicals coming from the mother and adjusts itself accordingly. You could test that by somehow getting ahold of some in-vitro twins and implanting them at different times, I guess? But there probably still would be too many variables.
http://news.independent.co.uk/world/science_techno logy/article2007490.ece
This piece gets a few of the key facts correct where reuters went wrong, such as the already-mentioned "10% vs 10x" difference between individuals. It's a great read!
gtagcgtagatagctctagctagcttaggagcttagaggcgcttagatcg cgatcga
Humans have escaped the phenomenon of Natural Selection, for the most part.
All of us who wear glasses? We should have been culled. All these people developing diabetes from eating too much sugar? Selected against. Asthma? You get the picture.
Running with the idea that there is a higher power that created the world, I would say that Natural Selection is the method that higher power uses to figure out what works. But now with health care and a strong sense of altruism, errors in the genetic code are propagating throughout our species and wrecking havoc. In other words, we're playing god by saving lives that should have been selected against and allowing them to pass on their flawed genes.
I also contend that if we were created by a higher power, and that higher power enabled us with the ability to modify our genetic code, then it is our right (nay, our duty) to do so; otherwise, we would lack this ability. I believe that we should selectively erase genes which cause a predisposition to things like Down Syndrome or diabetes or cancer, etc. This would effectively select against all detrimental mutations.
This could also be the limit of Natural Selection as it tends toward infinitely fast; beneficial mutations in one human (for instance, the HIV resistance that elite supressors have) could be propagated throughout the species' genetic code in a single generation.
Perhaps I should leave you with an example, one that even a Christian might be able to tolerate. Imagine a future where you and your s/o collect your eggs and screen them for genetic defects, like Down Syndrome. Once a viable egg has been found (and you don't have to look up what the hair color or eye color will be, you could just leave that to fate), start screening some sperm. Produce a viable fetus which will grow up to be healthy.
Now imagine that you were one of those people who didn't do that for your kid. And now your kid is born with a gene that means they're 80% likely to die from some horrible disease by the age of 30. If I were that kid, I would be pissed at my parents for not choosing the screening option.
:(){
Example of a 10% different human.
Beware: In C++, your friends can see your privates!
Very true.
Whenever I hear people talk about how we're "99% like a chimp", "45% like a fern", "76% like a catfish", etc. I just point out that we are not DNA. DNA is just the intruction manual on how to make us.
A more accurate analogy would be that the user manuals for a chimp and a human are 99% similar. Considering that the first 950,000 of 1,000,000 pages are about basic body structure, chemicals, etc, that's hardly surprising.
I would argue that for many people 70% of the brain is air.
Yes, I'm left. You have a problem with that?
If we think that natural selection just means survival of the strongest or fittest, then the humankind should have died a long a go. For almost its entire history humankind has been dinner in dishes of predators. If you put a human and a lion one against another, the lion wins. The key in success of man has been group work, working together to achieve common goals: hunting, defending against predators etc.. In this backdrop having a bad eyesight or asthma doesn't matter so much, individuals with these negative attributes could still specialise on some other talent form. And keeping in mind that there has always been more individuals wanting to join a successful group than there has been inner need in that group, has kept the competition going on and 'natural' selection has taken it's care.
;)
If we look at our current society where almost every baby is been saved and poor people have more children than rich, it could look like there is no natural selection going on, and thus one could think that degeneration of human genetic code is going on. I don't think that this is the case. It could be the case if there would be strong social barriers between different classes of society, but now there isn't, and people can mix and match on their own basis, selecting the most suitable partner for them. Also one variable to consider is that humans have developed very much information regarding how to live life and how groups should work, and thus the race is also going on in a cultural front. If we look a child, he/she gets very much cultural information from the beginning that influence ones later success in life. All in all I think that we are running in the right direction.
On a different note, I also applaud genetic screening for defects, but only on clear cases like the mentioned Down syndrome. Screening something like the 'criminal' or 'gay' gene, would not yield success and if used in a large scale would lead to a shift in society: there has to be enough aggressive people and people liking to dress pink
Survey research tool for commercial and scientific use
From the article in the Independent referenced elsewhere in this thread:
o logy/article2007490.ece
http://news.independent.co.uk/world/science_techn
"The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect."
In short, this research supports the notion that race is a useful and scientifically supported concept. Indeed, virtually all new data coming in on human genetic differences go against the fashionable yet not-very-well-supported notion that "race does not exist". How strange.
OK. If you take that the Bible is a compendium, or codex, of books then the Bible as we know it is about 1800 years old. However some of the books, I only know about Isaiah were written substantially before Christs life. Isaiah is believed by Christians / Jews to contain many prophecies about Jesus / The Messiah and was written IIRC about 500 years BC.
Informative?
Cheers.
PS: http://en.wikipedia.org/wiki/Dating_the_Bible gives an estimate of 1500 years BC for the Pentateuch (first 5 books of Old Testament).
"The only strange thing I see in your post is that people of mixed ancestors aren't cited. So I guess in your world people don't mix at all and can be precisely determined what they are."
No, but it can be determined very accurately if people have recent (broadly speaking) ancestry in a particular part of the world.
"Do you live in Nazi Germany, 1940?"
Ah, the Hitler thing. How original.
"If they do mix, how "the research" identifies them?"
Using non-binary designations, probably. It's like colors - there is no discrete line where one color becomes another, yet people rarely go around proclaiming that "colors do not exist". Racial designations is a matter of utility and economy of information.
When it comes to "tagging" however, the old racial classificiations remain remarkably efficient - I.e. if you compare how people self-identify with their genetic makeup, a computer will usually sort them into their own self-classified category with a high degree of precision. Certain fashionable ethnic identifiers are far less effective than racial ones, however, I.e. "hispanic".
"My guess is that a lot of people in here or in science have a bias towards a racially segregated society, where people don't mix, just like the US and european countries."
Ah yes, scientists are all racists - that must be it. Interestingly, this kind of exchange is rather typical, I.e:
Scientists: "We have lots of new cool genetic data!"
Lewontinites: "Hitler! Racism! Hitler! Racism!"
etc. etc.
Now imagine that you were one of those people who didn't do that for your kid. And now your kid is born with a gene that means they're 80% likely to die from some horrible disease by the age of 30. If I were that kid, I would be pissed at my parents for not choosing the screening option.
So in your perfect world, Stephen Hawking (ALS), Issac Newton (Epilepsy) and Albert Einstien (Aspergers Syndrome) would never be born? Do you believe genetically "flawed" individuals have nothing to contribute to society?
Support Right To Repair Legislation.
1. I am not an american and do not live in the US.
/ racial-data.htm
2. "That means absolutely nothing. How much recent is?"
Did you read the article I linked regarding the Hapmap? You can very accurately pinpoint ancestry by looking at a person's genome. This will, as the article points out, help forensic science, etc. a great deal.
3. "Without precise definitions and evidence backing it all, this "idea" is nothing more than wishful-thinking."
Again, did you read the article I linked regarding the subject of this entire post? It's not as if this is new, by the way - see for instance, from last year: "RACIAL GROUPINGS MATCH GENETIC PROFILES, STANFORD STUDY FINDS"
http://mednews.stanford.edu/releases/2005/january
4. "Do you anything about the world? Do you think this race centric view like in the US is the predominant everywhere? Do you think "black" in the US is the same as "black" in Africa or anywhere else?"
No, not entirely, of course - all designations and symbols used by human beings are non-discrete to some degree. Just as one can claim that "there are no races", one can claim that "there are no tables" or that "there are no knives". Reality is, in essence, one big mess that humans then try to make some sense out of using designations and symbols applied to different observed structures - it's in our nature to do so.
As the research above makes clear, however, the concept of "race" is not useless, as it can provide information even at a very high level of abstraction, I.e. "black", "white", etc. Thus, I believe it is a mistake to discount the concept of race - usefulness and the ability to convey information is after all the acid test for whether a concept is valid or not.
"What? If they self-identify didn't they provide the data previously? How sorting records would be difficult to a computer!?"
The computer does not use their self-identification, only their genetic profile. Only after the computer have sorted the subjects by genome is self-identification used to compare genetics to self-identification. See the link above.
"Nonsense. Hispanic is a marketing definition created in the US for americans, used to select meals by the number, to be able to deal with the latin american diversity. It's not used anywhere else!"
That was precicely my point.
100% of these comparative studies are highly speculative. Take into account: 10% of the DNA codes for proteins (this DNA was sequenced in HUGO on which most comparative studies were based) 90% was named junk-DNA, but isn't really. It is now recognized that it is functional in the sense that it regulates the expression of other genes. This DNA can differ a lot more among individuals and species. The functions of 'junk'-DNA are only partially known, but it is clear that in addition to some proteins (expressed by the 10% DNA) 'junk' DNA is responsible for differences among cell types. Every cell expresses it's own subset of genes (produces it's own set of proteins, has it's own function). Since we barely know which cell expresses what genes, how can we even try to compare among species? It is the same as stating galaxy X is 90% the same as galaxy Y. What do these comparative studies want to prove anyway? If 90% of the bibles have the same content, tell me about religious people.