Slashdot Mirror


User: Squeeonline

Squeeonline's activity in the archive.

Stories
0
Comments
114
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 114

  1. Re:What does it mean to be human? on A Vision For a World Free of CAPTCHAs · · Score: 1

    So what does it mean to be human?

    Born of a human mother. Take that, mister data!

    So if you replace the mothers placenta with a machine that is linked to her brain so the rights chemicals are transfered, are you still human when you are born?

    If you replace that mothers mind with a computer because it will do things right, are you still human when you are born?

    The same argument applies to biochemistry. At what point does a group of self replicating molecules constitute life? At what ratio of silicon:organic flesh is considered still human.

  2. Re:Inc. China on Germany Institutes Censorship Infrastructure · · Score: 1

    But it's being done for your /protection/. The state is protecting its citizens from the dangers on the internet like Free Speech and other dangerous ideas :-/

  3. Re:Let me be the first one to ask it ... on Pirate Bay Trial Ends In Jail Sentences · · Score: 1, Troll

    Nothing gives me rights. They are just there. If I dont like what I have pirated, I delete it eventually. If I like it, and I have money, I try and buy it.

    Call it a "try before you buy" thing. quite often the 30second samples of poor quality are not enough to judge whether the CD is worth buying.

  4. Re:Let me be the first one to ask it ... on Pirate Bay Trial Ends In Jail Sentences · · Score: 0

    I get money in trickels. Xmas, Birthdays. I'm not earning. When I get money, I'll buy one or two albums at a time. I have a list of what I want to buy next.

  5. Re:Let me be the first one to ask it ... on Pirate Bay Trial Ends In Jail Sentences · · Score: 1, Interesting

    Paying for it requires money and usually a credit card. Currently I have neither. When I get the money, I buy some of the content. I judge whether something is worth the money that I would be paying for it. i.e. 20â for a CD that is only OK, is not worth it, but an absolutely epic one, it is.

  6. Re:Let me be the first one to ask it ... on Pirate Bay Trial Ends In Jail Sentences · · Score: 1, Insightful

    I'd say download even more. Download stuff you dont even want, just to show all the record companies that prosecuting people doesnt work and will in fact make things worse for them.

    I have personally downloaded more stuff in the last 2 weeks than in the last year. Found a goldmine of good music. The CDs arent available in my country, so until i have the money to ship them I pirate them.

  7. Re:Perfect editorial! on Spotify Releases a Linux-Only Client Library · · Score: 0

    Yeah there's a joke in there somewhere about the quality of their library but I just cant find it.

  8. Problem on Obamas Give Queen Elizabeth an iPod · · Score: 0

    Just wait til the RIAA get wind of this pre-loaded content, even if it was given as a "gift".

  9. Re:Is Alcohol Killing Our Planet? on Is Alcohol Killing Our Planet? · · Score: 0, Redundant

    Ah alcohol, the cause of and solution to all of life's problems!

  10. Re:Video on Battlestar Galactica Hosted At the UN · · Score: 0

    We are the Knights that say Ni!

    Ni ni ni ni!!!!

  11. Re:The cure for Slashdot! on Addicting Mice To Light · · Score: 0

    Not sure if this is a nerdy reference, or a reference to Mr Fritzl in Austria.. Clever either way!

    I award you one internets!

  12. Re:Firefox is a stinking pile of garbage on 2.0 Beta Chrome On Windows, Chromium On Linux · · Score: 0

    I use ubuntu 8.10. I dont have to restart, but sometimes I do. I only have a laptop, so I find myself restarting quite a bit anyway.

  13. Re:Firefox is a stinking pile of garbage on 2.0 Beta Chrome On Windows, Chromium On Linux · · Score: 0

    "I too have to restart it every couple of days or it ooms my machine. " Oh come on, that's hardly a problem. I restart my FF3 every hour or two to keep it top shape. Its the same as restarting your computer/laptop every day to clear out shite that builds up.

  14. Re:It doesn't matter for me on ISS To Become Second Brightest-Object In the Sky · · Score: 0

    What worries me most is that these new massive solar panels should be ABSORBING light. i.e. no light reflected - nothing seen. Why am I wrong?

  15. Re:CCCCCAGCAAGCCCA on DNA-Radio, Tune In To Your Chromosomes · · Score: 0

    Nitrogenous base solo, AGTCAGTGCAGCACCCAGAGTGACGACGATGGTGTTTTTTTGAGTG

    If this makes it to the end of something, i want my royalties! *edit: Damn the "too many caps" filter. This was really cool!

  16. Re:Wow on Solar Panels Reach $1 a Watt · · Score: 0

    Sorry, living in a cold country (Ireland), we dont have AC, or even the need for it.

  17. Re:Wow on Solar Panels Reach $1 a Watt · · Score: 0

    Southern hemisphere? Otherwise how is your bill higher in the summer?

  18. Re: Send in teH baErz on How To Keep Rats From Eating My Cables? · · Score: 1

    Q. But what can we do to get rid of the cats when they overrun the 'campus?

    A. We'll throw in a dog to chase them out

    Q. But what about when the dog gets comfy behind the computers and gets fed by all the public, how will you get rid of him and the doggy friends that will follow?

    A. Easy! We'll send in a bear to scare off the dogs.

    Q. oookkkkaaayyy, but what about the bears?

    A. Oh thats the real beauty of the plan. We invite hunters in to track and kill the bear. This also attracts customers! Win win.

  19. Re:They should have surveyed on A Quantitative Study of How Memes Spread · · Score: 1

    In Soviet Russia, memes favour me!

  20. Re:They should have surveyed on A Quantitative Study of How Memes Spread · · Score: 1

    Yeah I have to go after the old Memes to get my mod points back after making some very bad comments.

  21. Re:Technically it's an STI on A Quantitative Study of How Memes Spread · · Score: 1

    No, we doctors are calling them STI's now because infection is more accurate a word than "disease". Not everyone who is infected manifests the symptoms (the disease), but they are still infected.

    But when men get the disease/infection, it's 10 times worse.

    And this is coming from a guy. When we are down, we are out!

  22. Re:Out of my peripheral vision on A Quantitative Study of How Memes Spread · · Score: 1

    The word memes looks alot like herpes. I've learned alot from this article, like not to skim the slashdot headlines.

    No chance of one of those ever being spread on by /.ers. *ducks*

  23. Re:So facebook spreads disease. on A Quantitative Study of How Memes Spread · · Score: 2, Funny

    All you needed to do was to mediate to regain your mana.

    Or mutter some badly pronounced Latin then eat some chocolate. Seems to work in Harry Potter books. And books are never wrong.

  24. Re:They should have surveyed on A Quantitative Study of How Memes Spread · · Score: 5, Funny

    In Soviet Russia memes spread you!

    Apologies. I'll get my coat.

  25. Re:First collision on Satellites Collide In Orbit · · Score: 1, Insightful

    "Each satellite weighed well over 1,000 pounds."

    I think you should be safe, because in space they don't weight anything - no gravity. However they do have a mass.
     
    /pedantic_tenancies