I believe that TiVa use a form of linux as their base operating system. Do not most linuces have an IDE limit? That is, is not there a maximum storage amount (say, around 180GB) that most linuces can recognize?
I want to say that this was brought up on the AVSFora a while back, when the new Maxtor 100GB drives came out.
----
Proud owner of a 160GB / 193 hour TiVo. Yep, over a week straight on any channel, if I were to want that.
A lot of people who upgrade their PVR / TiVo keep the spare / original drive around instead of putting it into a computer. If something happens to the drive(s) that you hacked with, you always have a suitable backup on hand.
The people who read/mod the AVSForums are very big on backups... good group.
ATOMIK (Alphabetically Tuned and Optimized Mobile Interface Keyboard) is an IBM invention, that replaces the Palm-ish keyboard with a sticker showing a non-QWERTY keyboard, and updates the input handling driver.
Neat stuff, really... it has a rough sorting of the alphabet from A->Z going from upper left to lower right, and puts the more-frequently used characters in a more central location.
You can get a pdf of the keyboardand the driver from them here.
I wonder if this would force stores to provide refunds for each instance of the CD brought in w/o a receipt... if so, then people could make some $ by surfing the price differences... buy them online for 6$, then returning them at the mall store for $12 sorta thing...
I would disagree about the MBA. While I agree that you should not "run off and get one," I think that being formally exposed to the business side of your business is essential.
Take a look at some of the local and (hopefully) leading colleges in your area. I have found that for geeks moving into business, it is not so much *where* you got your MBA, but the feact that you have one. There are a lot of new and interesting fields in which to get an MBA... I got mine in "internet technology and management," kind of a combination of project management, MIS, and technical (OS / Compiler / System Architecture) classes.
Most of all, have fun if you do decide to go back to school. As a geek, you will definitely have a leg up on most people enter B-school. Depending upon the program, a large portion of them just came from undergrad business school, and took only calculus I or II if any. Have fun doing the first derivatives in your head and saying the answer. Have fun in finance courses... most of them are simple statistics / expected value.
The best part about moving from more of a technical role into more of a business / architecture role is your ability to act as a translator. Having one foot in both areas makes you most valuable : if you are one of the few people that can translate business geek, then you are in a key role.
Let's see... for only $800, I can further upgarde my TiVo from 160GB (2x80GB) and 193 hours to over 400 hours! At highest quality, I would only have about 200 hours... at lowest quality, I could record a single TV channel for over two weeks and 3 days straight! Woohoo!
I think that his other book is more to the point...
From Amazon.com:
"The American political situation takes a disturbing turn as the President, Congress, and Supreme Court are obliterated when a Japanese terrorist lands a 747 on the Capitol."
I believe that the IBM group is just off Wall Street, in an old Lotus bldg. They are part of a multimedia group with whom I used to work. I earnestly hope that they are all AOK.
I beg to differ... it would be an extremely insecure situation for a majot highway to go through an army base. NYS Rte 3 skirts it on the south, NYS Rte 11 to the north, and Interstate Rte 81 is several miles east. Only Rte 29 (Planck Road) goes through.
Have family in Watertown... neighbors of parents who work on base. Locked up tight... all soldiers are recalled-need picture ID to get on base, and even then "non-essential" people are being turned away.
I believe that all bases are at Delta. Damn.
This is the first day of a whole new way of looking at things.
It appears that there were two (count 'em 2!!!) US "spy planes" that were shot down over Iraq this morning. The second plane was downed at 8:12 AM NYC time...
I wonder if someone re-wired an ALS tower... or at the very least, this shows us the power that Aircraft Controllers have over our lives when we are airborne.
Didn't this appear yesterday in rec.humor funny? I think so, at least partially, right here. And, of course, if it made it to rhf, then, well, it was surely some place else first.
--
STOP VOTER FRAUD! Unless, of course, a Democrat benefits.
Slashdot Mirror
I believe that TiVa use a form of linux as their base operating system. Do not most linuces have an IDE limit? That is, is not there a maximum storage amount (say, around 180GB) that most linuces can recognize?
I want to say that this was brought up on the AVSFora a while back, when the new Maxtor 100GB drives came out.
----
Proud owner of a 160GB / 193 hour TiVo. Yep, over a week straight on any channel, if I were to want that.
A lot of people who upgrade their PVR / TiVo keep the spare / original drive around instead of putting it into a computer. If something happens to the drive(s) that you hacked with, you always have a suitable backup on hand.
The people who read/mod the AVSForums are very big on backups... good group.
Um, isn't that the whole basis of our money system? People valuing litle pieces of paper with writing on them? DoH!
ATOMIK (Alphabetically Tuned and Optimized Mobile Interface Keyboard) is an IBM invention, that replaces the Palm-ish keyboard with a sticker showing a non-QWERTY keyboard, and updates the input handling driver.
It can be found here.
Neat stuff, really... it has a rough sorting of the alphabet from A->Z going from upper left to lower right, and puts the more-frequently used characters in a more central location.
You can get a pdf of the keyboardand the driver from them here.
I agree totally... if we could similarly stack people like this, imagine what could get done...
6,480 women could have a baby in an hour!
388,800 women could have a baby in a miunte!
23,328,000 women could have a baby in a second!
Now, while I doubt I could handle all of those women, I would certainly be willing to try...
As a man, I would like to be on record as considering the WOMAN-hours wasted...
I wonder if this would force stores to provide refunds for each instance of the CD brought in w/o a receipt... if so, then people could make some $ by surfing the price differences... buy them online for 6$, then returning them at the mall store for $12 sorta thing...
"And just why did you buy 1000 copyprotected CDs?
--Ask yourself... WWJD?
I would disagree about the MBA. While I agree that you should not "run off and get one," I think that being formally exposed to the business side of your business is essential.
Take a look at some of the local and (hopefully) leading colleges in your area. I have found that for geeks moving into business, it is not so much *where* you got your MBA, but the feact that you have one. There are a lot of new and interesting fields in which to get an MBA... I got mine in "internet technology and management," kind of a combination of project management, MIS, and technical (OS / Compiler / System Architecture) classes.
Most of all, have fun if you do decide to go back to school. As a geek, you will definitely have a leg up on most people enter B-school. Depending upon the program, a large portion of them just came from undergrad business school, and took only calculus I or II if any. Have fun doing the first derivatives in your head and saying the answer. Have fun in finance courses... most of them are simple statistics / expected value.
The best part about moving from more of a technical role into more of a business / architecture role is your ability to act as a translator. Having one foot in both areas makes you most valuable : if you are one of the few people that can translate business geek, then you are in a key role.
Hope that this helps.
Let's see... for only $800, I can further upgarde my TiVo from 160GB (2x80GB) and 193 hours to over 400 hours! At highest quality, I would only have about 200 hours... at lowest quality, I could record a single TV channel for over two weeks and 3 days straight! Woohoo!
I think that his other book is more to the point...
From Amazon.com:
"The American political situation takes a disturbing turn as the President, Congress, and Supreme Court are obliterated when a Japanese terrorist lands a 747 on the Capitol."
I hope that this is not life imitating art...
I believe that the IBM group is just off Wall Street, in an old Lotus bldg. They are part of a multimedia group with whom I used to work. I earnestly hope that they are all AOK.
I beg to differ... it would be an extremely insecure situation for a majot highway to go through an army base. NYS Rte 3 skirts it on the south, NYS Rte 11 to the north, and Interstate Rte 81 is several miles east. Only Rte 29 (Planck Road) goes through.
w n% 2Ftwn-map_results&uid=u5i0w2x2l8b9t5vd%3Atn9w8296t &SNVData=3mad3-g.fy%2528wrnqf1_%2529z85d0y%253bpq% 257cs9z%2Cp7%253b8aq.hqu%253b%2528_P%2517MM%2514JQ %2514W%253aL%2516%253dub0uu%2528%2511E%253arxhz8s% 253d%253dtshuas%253d0%2Chtb5m%2528lsr7dc%253bwh%25 7c2%2524hgv%2528l3iedgv%25245l1t%253b8&pcat=&aphot o=0&MAP_AB_LABELS=&WORK=&mouse_mode=center&map.x=1 31&map.y=318
Hope this helps.
http://www.mapquest.com/cgi-bin/ia_find?link=bt
Have family in Watertown... neighbors of parents who work on base. Locked up tight... all soldiers are recalled-need picture ID to get on base, and even then "non-essential" people are being turned away.
I believe that all bases are at Delta. Damn.
This is the first day of a whole new way of looking at things.
Just make sure you give blood to the Red Cross.
... in Northern New York is locked down tight. No one in, no one out. Damn.
You are one lucky bastard.
Let's hope that the current TV News figures of 10,000 PER TOWER are lower, because of guys like this guy.
Give a little thanks, ok?
It appears that there were two (count 'em 2!!!) US "spy planes" that were shot down over Iraq this morning. The second plane was downed at 8:12 AM NYC time...
a st /newsid_1537000/1537128.stm
Double doh.
http://news.bbc.co.uk/hi/english/world/middle_e
I wonder if someone re-wired an ALS tower... or at the very least, this shows us the power that Aircraft Controllers have over our lives when we are airborne.
Yikes. Most scary.
A friend of mine (ok, my ex-wife!) is a genetic engineer... her sig file read:
c gc
c ga
a tc
a gg
c gc
c ga
a tc
a gg
c gc
c ga
a tc
a gg
Jane Doe
Office: 770.555.1212
Mobile: 770.555.1213
DNA Seq :
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
...
You get the idea.
---
WWJD! WWJD! WWJD!
I think so, at least partially, right here. And, of course, if it made it to rhf, then, well, it was surely some place else first.
--
STOP VOTER FRAUD! Unless, of course, a Democrat benefits.