All I'm saying is that society will need to decide in a rational way. Not in an emotional one.
You might be right about some of your concerns. Just like you are right about Oppenheimer, it was the people who decided this was for the benefit of mankind (it was the military, mostly). And it has it good and bad sides. In this case the good sides (including using it as a weapon) were decided to be more important than the bad ones (can't think of any right now).
"We should not play God" is a completely wrong, misplaced, argument. First, I don't believe in God, other than it being an instrument that is used by smart people to repress the more gullible ones. Any argument involving God is not taken seriously by me. That does not mean I don't respect people who want to believe. IOW, I respect people, but not their believes.
Second, mankind will have to learn how to deal with powerful technologies like this anyway. Denying their existence is not the solution. Banning technology because of its potential dangers is not going to work. Not now not ever. I will do everything to convince anyone of the truth of this very important observation.
Sorry about the (not intended) flaming. I just a have a strong opinion. I fully understand the technological stuff behind all this, since I am a scientists in this field.
Sjeesh, the government should interfere with you, so that at least you would take some time to form a real opinion. You don't even know what you're talking about. Brr, it looks scary. I don't understand it. It must be stopped.
Time will tell that this is for the benefit of mankind, and your opinion will be in history books. Alongside ideas that the earth is flat, and that steam engines hurt the economy. And then there is always: you can use a knife to cut bread or to kill someone.
Yeah right. Not if you have no choice but using a USB ADSL modem, unless you want to patch & recompile the kernel, go through 20 outdated mini-howto's.
I tried it, lost a lot of time and this only resulted in my having personal vendetta with the Suse marketeers, who package and document the ftp distribution.
Other option. The old non-free software way: anyone interested in mirroring some ISOs for Suse 8.2? P2P maybe?
I am a very busy, but I absolutely need the latest Linux desktop stuff (KDE 3.1 rulez). I go and mirror an archive or two from Suse. It won't install, not even several hours of Googling, tweaking installation script files, re-arranging partitions and file systems. I give up. I know that in theory it could be done, but they make it very confusing on purpose (and it changes every version).
Now they are a company and need to make money. So far so good. However, it is not me who will buy the boxed set of CDs. It is way too expensive, when I know that in a couple of weeks I absolutely need to play with a new kernel, KDE 3.2, GNOME 2.something. Which renders my boxed distro worthless, without investing in getting intimately familiar with all the dependencies of glibc, bonobo and whatever.
I would buy the boxed set, if they would allow me to download (in ISO format), Suse version 8.2 - 10 for example. I would even pay for that. Does this exist?
In the meantime I am running Mandrake 9.1RC1 at work, and it sort of works very well. Productivity is up (mainly because I use a lot of terminals to connect to big iron). I haven't booted windows in more than two weeks. That is a record for me, a MS outlook/office slave for the last 10 years. Will certainly install 9.1 final when it comes out.
It must be true, the Linux desktop experience (tm) is coming.
Indeed, sometimes a single basepair change is incompatible with life. However, biological systems have many safety features. Most of the time, the system can handle errors. Sometimes, people that can not see, will develop better hearing, or blocking a part of a metabolic pathway, will activate or increase the activity of another part to compensate. In biology, there are many feedback loops, and everything is regulated at every step along the way. The result is a complex system that is quite stable. Of course, if you hit the right switch the system will go offline.
However, I don't see how this insight will lead to a better way of programming. Unless, maybe through sophisticated evolutionary / genetic programming techniques. I see many problems with rational design of stable complex systems like life or 10 million+ lines of code. Sorry Dave, you know I can't do that.
I'm sure someone came up with this idea already. But these spammers have lists of E-mail adresses, mostly coming from automatic E-mail harvesters.
If everyone put a couple of pages with a few hundred thousand fake E-mail adresses (automatically generated) wouldn't that make these lists less valuable.
It would increase the amount of spam at first, but given enough fake adresses, it would come down in the end. It's a number game, to put someone who "owns" 1 million real E-mail adresses out of business, you would need to post some 100 million fake ones for him to harvest. That is no more than 2.5 Gb of HTML and some coordinated effort.
I work in a bioinformatics company (Boston, MA & Paris, France) and what we do is diverse. From text processing, statistics, graphs, string comparison, database management, data integration, data visualization and more.
We hire people with various skills. All people, including the biologist (or bioanalist, people that generate and analyze biological data with the tools we make), require a thorough understanding of *nix.
Computer science skills that we are particulary interested in are string matching, graph theory, statistical algorithms, super computing (software that run with 1000s of threads). This is all in C and C++.
We work with (real) computers from every vendor (IBM, Sun, SGI, Compaq,...) and also have Linux clusters. We have good sys admins and custom web application developers. RDBMS and OODBMS knowledge is a pro. Web scripting, like perl and PHP, is a must.
All, people that work here are either computer scientist with an interest in biology or the other way around. Bioinformatics is a lot of fun, but the market is difficult right now (still troubled by the internet bubble investment hype - some big, well funded companies went down).
We get about 20 resumes per week, most of them applying for a bioanalist position. We have enough of those. We do not get many serious CS applications (finding people with some experience or specific skills is difficult), but when we do we seriously look at them.
Check out epinions. They review a sony video recorder and come up with this list:
Brands are listed starting from the most reliable (best) to least reliable (worst):
1. Panasonic - produced by Matsushita Electric 2. Quasar - also produced by Matsushita Electric 3. Samsung 4. Sanyo 5. Toshiba 6. Sharp 7. ProScan 8. GE 9. Hitachi 10. Philips 11. RCA 12. JVC 13. Symphonic 14. Emerson 15. SONY - isn't it too low for a "leader"? 16. Optimus (Radio Shack) 17. Mitsubishi 18. Zenith 19. Series LXI (Sears) 20. Fisher
What are the scientific chances of two lifeforms forming and evolving, with identical genetic processes?
A number somewhere close to 100%. After four billion years of evolution, organism changed / varied everything you can possible imagine. However, there is not a single organism that has changed the way DNA encodes genetic information, except for some very minor chemical modifications (the fifth base was made up by the X-file producers).
How big is the change that if two independent cultures develop their own computer starting from the transistor, they would both use a binary system to store data?
DNA has got a lot of things going for it: chemical building blocks are readily available, the structure is stable, it does have self-organizing and self-catalytic properties (in the form of RNA that is) and if every organism uses the same code it allows horizontal transfer (from one species to another) of genetic material.
I would not be surprised if life on other planets would use exactly the same DNA as we do.
Yes typically groceries and renting a flat is twice as expensive in London as it is in Paris. These games are twice as cheap in London. Perceived compensation 2x143 =286 million euros!
I fight with my wife every night. We have one box. I want to run Linux and play with cool os stuff.
She wants to watch stupid TV series in some proprietary windows media format. When I told her to put another box in the living room, she wanted a Mac. Now come on, is that reason to break up or what?
Well then please oh please do NOT move to Linux. We like our choice.. stick to what's made for you.
I have been using so many different forms of *nix for such a long time. Just recently I did a two month long technical computation on a 1024 CPU SGI machine, using software I helped design (written in C, using emacs if you must know). Hell, I even gave *nix courses to windows javascriptkiddies like you.
And since you appear to be a big fan of conformity
You make to many presumptions. You don't understand the difference between software that gets a job done, and fifteen projects in development beta version 0.02, that all do the same - that all lack the same. Just because I think that is not good, doesn't make me a MS fanboy. It sometimes forces me to use MS software to get my work done, yes. All you see, is that using Linux makes you something special. A very sad story, you are.
Some words of advice: get some self respect, listen what other people have to say and grow up, Linux fanboy.
Slashdot Mirror
All I'm saying is that society will need to decide in a rational way. Not in an emotional one.
You might be right about some of your concerns. Just like you are right about Oppenheimer, it was the people who decided this was for the benefit of mankind (it was the military, mostly). And it has it good and bad sides. In this case the good sides (including using it as a weapon) were decided to be more important than the bad ones (can't think of any right now).
"We should not play God" is a completely wrong, misplaced, argument. First, I don't believe in God, other than it being an instrument that is used by smart people to repress the more gullible ones. Any argument involving God is not taken seriously by me. That does not mean I don't respect people who want to believe. IOW, I respect people, but not their believes.
Second, mankind will have to learn how to deal with powerful technologies like this anyway. Denying their existence is not the solution. Banning technology because of its potential dangers is not going to work. Not now not ever. I will do everything to convince anyone of the truth of this very important observation.
Sorry about the (not intended) flaming. I just a have a strong opinion. I fully understand the technological stuff behind all this, since I am a scientists in this field.
Sjeesh, the government should interfere with you, so that at least
you would take some time to form a real opinion.
You don't even know what you're talking about. Brr, it looks scary.
I don't understand it. It must be stopped.
Time will tell that this is for the benefit of mankind, and your opinion
will be in history books. Alongside ideas that the earth is flat, and
that steam engines hurt the economy.
And then there is always: you can use a knife to cut bread or to kill someone.
Please spare us this nonsense panick reaction.
Yeah right. Not if you have no choice but using a USB ADSL modem, unless you want to patch & recompile the kernel, go through 20 outdated mini-howto's.
I tried it, lost a lot of time and this only resulted in my having personal vendetta with the Suse marketeers, who package and document the ftp distribution.
Other option. The old non-free software way: anyone interested in mirroring some ISOs for Suse 8.2? P2P maybe?
Exactly, my point!
I am a very busy, but I absolutely need the latest Linux desktop stuff (KDE 3.1 rulez). I go and mirror an archive or two from Suse. It won't install, not even several hours of Googling, tweaking installation script files, re-arranging partitions and file systems. I give up. I know that in theory it could be done, but they make it very confusing on purpose (and it changes every version).
Now they are a company and need to make money. So far so good. However, it is not me who will buy the boxed set of CDs. It is way too expensive, when I know that in a couple of weeks I absolutely need to play with a new kernel, KDE 3.2, GNOME 2.something. Which renders my boxed distro worthless, without investing in getting intimately familiar with all the dependencies of glibc, bonobo and whatever.
I would buy the boxed set, if they would allow me to download (in ISO format), Suse version 8.2 - 10 for example. I would even pay for that. Does this exist?
In the meantime I am running Mandrake 9.1RC1 at work, and it sort of works very well. Productivity is up (mainly because I use a lot of terminals to connect to big iron). I haven't booted windows in more than two weeks. That is a record for me, a MS outlook/office slave for the last 10 years. Will certainly install 9.1 final when it comes out.
It must be true, the Linux desktop experience (tm) is coming.
No, but it does come with DRM. This will prevent you from playing tunes on your guitar that have been copyrighted.
Indeed, sometimes a single basepair change is incompatible with life. However, biological systems have many safety features. Most of the time, the system can handle errors. Sometimes, people that can not see, will develop better hearing, or blocking a part of a metabolic pathway, will activate or increase the activity of another part to compensate. In biology, there are many feedback loops, and everything is regulated at every step along the way. The result is a complex system that is quite stable. Of course, if you hit the right switch the system will go offline.
However, I don't see how this insight will lead to a better way of programming. Unless, maybe through sophisticated evolutionary / genetic programming techniques. I see many problems with rational design of stable complex systems like life or 10 million+ lines of code. Sorry Dave, you know I can't do that.
Better question yet, at which star system shall we start the third foundation? Harry Seldon would have been excited!
42
Thanks for the reply, I looked into it. Interesting +N.
I'm sure someone came up with this idea already. But these spammers have lists of E-mail adresses, mostly coming from automatic E-mail harvesters.
If everyone put a couple of pages with a few hundred thousand fake E-mail adresses (automatically generated) wouldn't that make these lists less valuable.
It would increase the amount of spam at first, but given enough fake adresses, it would come down in the end. It's a number game, to put someone who "owns" 1 million real E-mail adresses out of business, you would need to post some 100 million fake ones for him to harvest. That is no more than 2.5 Gb of HTML and some coordinated effort.
mmmm...
on my new laptop. My collegue received 9 Mandrake installation CDs for free because last time he donated and ordered stuff from their website.
I think I will visit the Redhat site, to see how big their ISO's are.
I work in a bioinformatics company (Boston, MA & Paris, France) and what we do is diverse. From text processing, statistics, graphs, string comparison, database management, data integration, data visualization and more.
...) and also have Linux clusters. We have good sys admins and custom web application developers. RDBMS and OODBMS knowledge is a pro. Web scripting, like perl and PHP, is a must.
We hire people with various skills. All people, including the biologist (or bioanalist, people that generate and analyze biological data with the tools we make), require a thorough understanding of *nix.
Computer science skills that we are particulary interested in are string matching, graph theory, statistical algorithms, super computing (software that run with 1000s of threads). This is all in C and C++.
We work with (real) computers from every vendor (IBM, Sun, SGI, Compaq,
All, people that work here are either computer scientist with an interest in biology or the other way around. Bioinformatics is a lot of fun, but the market is difficult right now (still troubled by the internet bubble investment hype - some big, well funded companies went down).
We get about 20 resumes per week, most of them applying for a bioanalist position. We have enough of those. We do not get many serious CS applications (finding people with some experience or specific skills is difficult), but when we do we seriously look at them.
So go ahead and check us out (shameless plug).
Check out
epinions. They review a sony video recorder and come up with this list:
Brands are listed starting from the most reliable (best) to least reliable (worst):
1. Panasonic - produced by Matsushita Electric
2. Quasar - also produced by Matsushita Electric
3. Samsung
4. Sanyo
5. Toshiba
6. Sharp
7. ProScan
8. GE
9. Hitachi
10. Philips
11. RCA
12. JVC
13. Symphonic
14. Emerson
15. SONY - isn't it too low for a "leader"?
16. Optimus (Radio Shack)
17. Mitsubishi
18. Zenith
19. Series LXI (Sears)
20. Fisher
We, as consumers, by buying the cheapest, lowest-quality stuff out there, are responsible for this.
/. guys please make up your mind? Now I will have to bring back my $199 walmart PC.
Sjeesh, can you
Well, what do you know? Maybe after all this time, it is time to buy a new floppy drive :)
bacteria don't have chromosomes... they have a circular strand of DNA
commonly referred to, by biologists, as a chromosome. They can also have smaller circular chromosomes in addition, also called plasmids.
What are the scientific chances of two lifeforms forming and evolving, with identical genetic processes?
A number somewhere close to 100%. After four billion years of evolution, organism changed / varied everything you can possible imagine. However, there is not a single organism that has changed the way DNA encodes genetic information, except for some very minor chemical modifications (the fifth base was made up by the X-file producers).
How big is the change that if two independent cultures develop their own computer starting from the transistor, they would both use a binary system to store data?
DNA has got a lot of things going for it: chemical building blocks are readily available, the structure is stable, it does have self-organizing and self-catalytic properties (in the form of RNA that is) and if every organism uses the same code it allows horizontal transfer (from one species to another) of genetic material.
I would not be surprised if life on other planets would use exactly the same DNA as we do.
Yes typically groceries and renting a flat is twice as expensive in London as it is in Paris. These games are twice as cheap in London. Perceived compensation 2x143 =286 million euros!
I fight with my wife every night. We have one box. I want to run Linux and play with cool os stuff.
She wants to watch stupid TV series in some proprietary windows media format. When I told her to put another box in the living room, she wanted a Mac. Now come on, is that reason to break up or what?
Well then please oh please do NOT move to Linux. We like our choice.. stick to what's made for you.
I have been using so many different forms of *nix for such a long time. Just recently I did a two month long technical computation on a 1024 CPU SGI machine, using software I helped design (written in C, using emacs if you must know). Hell, I even gave *nix courses to windows javascriptkiddies like you.
And since you appear to be a big fan of conformity
You make to many presumptions. You don't understand the difference between software that gets a job done, and fifteen projects in development beta version 0.02, that all do the same - that all lack the same. Just because I think that is not good, doesn't make me a MS fanboy. It sometimes forces me to use MS software to get my work done, yes. All you see, is that using Linux makes you something special. A very sad story, you are.
Some words of advice: get some self respect, listen what other people have to say and grow up, Linux fanboy.
Yeah, I don't understand. In the end they both produce pretty
pictures of modelled objects, right?
I, like most people that would like to switch to a Linux desktop
but can't, don't need choice. We need something that works.
Dividing attention is not going to help is. However, I do understand
why it satisfies developers and software architecture techno-freaks.
If you just want to play, go ahead. If you want total world
domination, choice just reared its ugly head one more time.
I did a BLAST comparison of your chromosome 1 with a large database of known sequences on the NCBI website, and this is the best hit:
>gi|19848325|gb|AC021755.9| Download subject sequence spanning the HSP Homo sapiens chromosome 15 clone RP11-521C20 map 15q15, complete
sequence
Length = 161794
Score = 44.1 bits (22), Expect = 0.15
Identities = 22/22 (100%)
Query: 402 tggtggatggtctggtctgatg 423
||||||||||||||||||||||
Sbjct: 80217 tggtggatggtctggtctgatg 80238
Sorry about that.
My PrtScn key has been defective ever since I tried to copy a DVD at 60 frames per second.
Would it be possible to use hand gestures through a web cam? That would be easier and more fun than using a mouse.
Just think about sticking out your middle finger and have someone mod down as a troll.