The article they posted is literally the most ironic reason to rage quit and fork. The article talks about how strict codes of conduct hinder creative outlets and can damage a society by firing people like Isaac Newton for who they are.
I don't play WoW either, but I used to play it. It used to be a multi-million dollar market selling digital currency (in-game gold). Chinese gold farms popped up and made so much money doing it. Even Steve Bannon got involved with it. http://www.avclub.com/article/...
It's not seen as just a game to people like Steve Bannon. It was seen as an opportunity.
A broken clock happens to be right twice a day. I don't know nor care what your political affiliation is, or what you think mine is, but I'm more concerned with privacy and having things the government doesn't have its hands in. There's a lot of things I support the government(s) having their hand in, in terms of healthy civilization maintenance, but when is too much, too much?
Perhaps they should also monitor Blizzard's gold currency system for World of Warcraft too. Never know if those nerds are terrorists in Azeroth!
I get that things like digital currencies can be used to money launder and fund nefarious activity, but can anything be sacred anymore? What about the mining aspect? Is big brother going to monitor GPU usage too?
I used to work for an Aerospace Manufacturing plant, and their ERP system M1 wasn't cutting it. I developed a complete web-based portal system that interfaced directly with the SQL server to bring the data to life. I now sell my software I made to other businesses that use the M1 ERP system and customize it to their needs. I highly recommend that route. You won't be disappointed when you see your data come to life in an orderly fashion.
Really, the biggest change in Windows 8, is that I have to press the windows key when I login. Nothing else really changed in the OS for me. I still just hit win+r for the "Run" prompt, or click a shortcut in the number of places I've aggregated them that make much more sense than Win 7's start menu layout. I got Windows 8 because it was just $15 for a valid windows license.
I'm in full agreement that there's no reason to upgrade from windows 7 to windows 8. But if you get windows 8, it's not the end of the world (unless you're really married to the start menu). Or hell, if you really need the start menu, just go download it and install it. If you're on slashdot you should know how to do this. This askslashdot is kind of a no-brainer.
I think I remember now, why I marked you as a foe a long time ago. You have nothing insightful to say about anything. Nor do you have anything intelligent or constructive to add to any conversation. If you would of read my post, you would realize it's about electronic home-schooling and not "swishy gadgets" in the school system. Self-modded down for troll and fail.
That was a very insightful reply. ECOT in the beginning, from what we heard before my sister came in, was really in shambles. By the time my sister started though, it was her answer to dealing with bullies, lack of public education attention, and she could work on things at her pace. Every once in awhile, she did have some issues getting a hold of teachers, but they were bombarded for the longest time. She was really proud of herself, for being able to accomplish her work using ECOT though, and it really improved her self-esteem.
I do agree though, that it could be very situational to the child. ECOT worked for her, whereas it may not of, for your brother. I just wish I could of had ECOT when I was that age. I always found public education to be the most boring waste of time in the world. Never challenged, horrible environments, and hated all my peers.
You missed the entire point of ECOT all together, you didn't read how the vast majority of the time, the student is all on their own following the curriculum. Those with learning disabilities spend a little more time obviously with a teacher.
My sister, when she lived in Ohio, had a learning disability. It wasn't until my family discovered ECOT that she finally had the fighting chance to graduate. They sent her a locked down computer, and gave her all the help and support she needed over the phone for all her lessons. Electronic home-schooling should seriously be considered all over the United States.
So here's my geeky lore-in-games-loving side of this. Does this not have the feel of Anarchy Online's backstory? Those familiar with the lore, and the online book Prophet Without Honour, they used mosquitoes to implant a hidden activation-required virus, that ended up making billions sick, and die... as a hidden agenda, while pretending that the mosquitoes were fixed to help prevent the spread of this super virus... then finishing the rest of the world off in a nuclear bombardment... Look around page 89-91 for the plans for those blood suckers... http://www.anarchy-online.com/anarchy/frontend/files/CONTENT/download/documents/prophet_without_honour.pdf
When I upgraded, it really wasn't much of an upgrade, cause I had XP. I used their migration tool, then double checked to make sure I backed up the right things, then did the clean install of the RC, since XP isn't upgradable in the sense that vista is. It took me about 1 hour for the full install, then about an additional 1 to 1 1/2 hours for the migration. All in all, it was very simple, straight, and to the point. My system for this box is a 3.4 ghz 32-bit P4 with 2 Gigs of Ram, and I had over 75 gigs in the migration.
I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA
Right, it's ioke. And unfortunately for me, at 1:30am in the morning eastern time, the link is very much slashdotted, but would love to see the info on it... yay for checking slashdot in the morning when I wake up!
I'd say, if you already have experience programming, go with what you know. If it's web based, get something that has a larger screen. If it's Java, go with those that have a Java OS.
Slashdot Mirror
The article they posted is literally the most ironic reason to rage quit and fork. The article talks about how strict codes of conduct hinder creative outlets and can damage a society by firing people like Isaac Newton for who they are.
I don't play WoW either, but I used to play it. It used to be a multi-million dollar market selling digital currency (in-game gold). Chinese gold farms popped up and made so much money doing it. Even Steve Bannon got involved with it. http://www.avclub.com/article/... It's not seen as just a game to people like Steve Bannon. It was seen as an opportunity.
A broken clock happens to be right twice a day. I don't know nor care what your political affiliation is, or what you think mine is, but I'm more concerned with privacy and having things the government doesn't have its hands in. There's a lot of things I support the government(s) having their hand in, in terms of healthy civilization maintenance, but when is too much, too much? Perhaps they should also monitor Blizzard's gold currency system for World of Warcraft too. Never know if those nerds are terrorists in Azeroth!
I get that things like digital currencies can be used to money launder and fund nefarious activity, but can anything be sacred anymore? What about the mining aspect? Is big brother going to monitor GPU usage too?
I used to work for an Aerospace Manufacturing plant, and their ERP system M1 wasn't cutting it. I developed a complete web-based portal system that interfaced directly with the SQL server to bring the data to life. I now sell my software I made to other businesses that use the M1 ERP system and customize it to their needs. I highly recommend that route. You won't be disappointed when you see your data come to life in an orderly fashion.
I never do.
Really, the biggest change in Windows 8, is that I have to press the windows key when I login. Nothing else really changed in the OS for me. I still just hit win+r for the "Run" prompt, or click a shortcut in the number of places I've aggregated them that make much more sense than Win 7's start menu layout. I got Windows 8 because it was just $15 for a valid windows license.
I'm in full agreement that there's no reason to upgrade from windows 7 to windows 8. But if you get windows 8, it's not the end of the world (unless you're really married to the start menu). Or hell, if you really need the start menu, just go download it and install it. If you're on slashdot you should know how to do this. This askslashdot is kind of a no-brainer.
I think I remember now, why I marked you as a foe a long time ago. You have nothing insightful to say about anything. Nor do you have anything intelligent or constructive to add to any conversation. If you would of read my post, you would realize it's about electronic home-schooling and not "swishy gadgets" in the school system. Self-modded down for troll and fail.
That was a very insightful reply. ECOT in the beginning, from what we heard before my sister came in, was really in shambles. By the time my sister started though, it was her answer to dealing with bullies, lack of public education attention, and she could work on things at her pace. Every once in awhile, she did have some issues getting a hold of teachers, but they were bombarded for the longest time. She was really proud of herself, for being able to accomplish her work using ECOT though, and it really improved her self-esteem.
I do agree though, that it could be very situational to the child. ECOT worked for her, whereas it may not of, for your brother. I just wish I could of had ECOT when I was that age. I always found public education to be the most boring waste of time in the world. Never challenged, horrible environments, and hated all my peers.
You missed the entire point of ECOT all together, you didn't read how the vast majority of the time, the student is all on their own following the curriculum. Those with learning disabilities spend a little more time obviously with a teacher.
Then you need to look at ECOT.
My sister, when she lived in Ohio, had a learning disability. It wasn't until my family discovered ECOT that she finally had the fighting chance to graduate. They sent her a locked down computer, and gave her all the help and support she needed over the phone for all her lessons. Electronic home-schooling should seriously be considered all over the United States.
So here's my geeky lore-in-games-loving side of this. Does this not have the feel of Anarchy Online's backstory? Those familiar with the lore, and the online book Prophet Without Honour, they used mosquitoes to implant a hidden activation-required virus, that ended up making billions sick, and die... as a hidden agenda, while pretending that the mosquitoes were fixed to help prevent the spread of this super virus... then finishing the rest of the world off in a nuclear bombardment... Look around page 89-91 for the plans for those blood suckers... http://www.anarchy-online.com/anarchy/frontend/files/CONTENT/download/documents/prophet_without_honour.pdf
My work here is done...
When I upgraded, it really wasn't much of an upgrade, cause I had XP. I used their migration tool, then double checked to make sure I backed up the right things, then did the clean install of the RC, since XP isn't upgradable in the sense that vista is. It took me about 1 hour for the full install, then about an additional 1 to 1 1/2 hours for the migration. All in all, it was very simple, straight, and to the point. My system for this box is a 3.4 ghz 32-bit P4 with 2 Gigs of Ram, and I had over 75 gigs in the migration.
You sir, have just earned yourself a gold star, and a friend mark on Slashdot.
It's about time.. Though it does seem like a lick and a prayer, it may open some eyes.
1. Steal underpants 2. Go to space, steal that jap dudes underpants 3. Profit!
Nope. New department, which is Department for Cannibal Relations.
I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA
Never said only :P But I'm not touching that topic with a ten foot pole.. for all I know they coul.... [CONNECTION LOST]
Considering how outrageously corrupt the government is in the world of 24, there's no doubt in my mind a CIP replacement will be found.
...Wildfires are pretty tough out there, so why not use this method?
Correct link by the way: http://www.cosmosmagazine.com/news/2514/major-study-proves-cloud-seeding-effective
Right, it's ioke. And unfortunately for me, at 1:30am in the morning eastern time, the link is very much slashdotted, but would love to see the info on it... yay for checking slashdot in the morning when I wake up!
No it's like Battletoads
I'd go for the old detective games, like Under a killing moon. Or go for puzzle games, like myst.
I'd say, if you already have experience programming, go with what you know. If it's web based, get something that has a larger screen. If it's Java, go with those that have a Java OS.
Mmmmm.. yeah... did you get that memo? We are putting all cover sheets on the sexual harassment forms from now on...