Slashdot Mirror


Gene Therapy Cures "Bubble Boy"

bofh31337 writes "NewScientist is reporting that Welsh boy Rhys Evans has been cured of the fatal severe combined immunodeficiency ("bubble boy") disease. The medical team, lead by Adrian Thrasher, was able to take the stem cells that give rise to immune cells from his bone marrow and add a normal copy of the gene to the stem cell using a retro virus. Seven months after treatment, Rhys was cured."

235 of 362 comments (clear)

  1. Guess I was wrong! by tcd004 · · Score: 3, Funny

    I thought he was cured by scientology!

    VISA's cure for celebrity shoplifters...

    tcd004

  2. Can they... by The+Wooden+Badger · · Score: 1

    Now can they just make me seven feet tall so I can play pro basketball?

    --
    Heroscape, it's like legos combined with anachronistic wargames.
    1. Re:Can they... by An+Onerous+Coward · · Score: 1

      Of course they can. Unfortunately, they can also make everyone else seven feet tall, and when that happens, the hoop is going up to twelve feet. I guarantee it.

      Ask for nine feet tall, and extend your career by a couple of years.

      --

      You want the truthiness? You can't handle the truthiness!

  3. Great! by h4l0 · · Score: 1

    Im really happy that they were able to cure "bubble boy". hopefully this means that other oppritunities to cure people with "Gene Therapy"

    --
    Avoid The Rush, Start Thinking NOW!
    --
    Any Spelling Or Gramatical Errors In This Post Are There On Purpose.
    1. Re:Great! by Boronx · · Score: 1
      When are they going to cure Saturday Night Fever?

      And to those A55holes who set the 20 second minimum time to post: There are people in this world that can type faster than you.

  4. No cure by DeadBugs · · Score: 5, Funny

    Sadly there is no cure for the people who got sick after seeing the movie "Bubble Boy"

    --
    http://www.kubuntu.org/
  5. a little too late by Anonymous Coward · · Score: 1, Funny

    It's too bad they couldn't cure the guy before that god awful movie was made.

  6. Perhaps now... by funkbrain · · Score: 5, Funny

    ...science can answer the Moors/Moops riddle which has plauged mankind since the dark ages!

  7. Question by Da+Masta · · Score: 5, Interesting

    The potential power of stem cell research is clearly evident in this case. My question, not to troll, is whether this type of research could have been possible/allowed in the US. AFAIK, the laws in the states allow a restrictive amount of stem cell research -- would this have been enough for similar treatment here?

    1. Re:Question by glwtta · · Score: 5, Informative

      The laws don't restrict the research itself, they restict the number of cell lines available for research. So yeah, it would've been possible in the US, provided the scientists could get their hands on the stem cells.

      --
      sic transit gloria mundi
    2. Re:Question by ageitgey · · Score: 5, Informative

      The US has laws limiting embryonic stem cell research. They don't care if use use cells from yourself (as they did with the 'bubble boy'). The issue is whether or not more break-throughs of this type could be made faster by using stem cells from all the frozen embroyos laying around (which are basically big clumps of stem cell :)

      --
      Uninnovate - Only the finest in engineering.
    3. Re:Question by ksuMacGyver · · Score: 1

      Quote: "To treat the boys, the Great Ormond Street team took the stem cells that give rise to immune cells from the two boys' bone marrow."

      That's not outlawed in the US...

      --

      Ad Majorem Dei Gloriam

      Interested in AI? MACR
    4. Re:Question by nathanm · · Score: 5, Informative
      The laws don't restrict the research itself, they restict the number of cell lines available for research.
      They don't actually restrict the number of stem cell lines, they merely limit government funding to the existing lines. Anyone could start new lines with private funding.

      Also, the policy only refers to embryonic stem cells. The bubble boys were cured with their own stem cells.
    5. Re:Question by lost_it · · Score: 1
      "To treat the boys, the Great Ormond Street team took the stem cells that give rise to immune cells from the two boys' bone marrow." [emphasis added]

      Please read the story. This would be perfectly fine with the current regulations in the US. This cure has nothing to do with embryonic stem cells; the stem cells came from the boys' bone marrow. Current US regulations only restrict embryonic (as in, "taken from an embryo") stem cells.

      I'm not saying that this makes the current regulations right, I'm just saying that this particular cure has nothing to do with embryonic stem cells.

    6. Re:Question by swankypimp · · Score: 1

      There have been a number of studies on alternative sources of stem cells, like those in umbilical cord blood and bone marrow, that have shown more promising results than tests with embryonic cells. Unfortunately, they have been underreported by the mainstream press, who for the most part politically favors ebryonic stem cell research (ESCR). This summer and fall there were a series of insightful articles on the topic on the National Review's web site. One such article is here: http://www.nationalreview.com/comment/comment-smit h012802.shtml For others, go to nationalreview.com and search for "stem cell."

      --

      --All your stolen base are belong to Rickey Henderson
    7. Re:Question by glwtta · · Score: 2

      That is true, however the effect is still that the overall number of (embryonic) cell lines is smaller, which was my point ;)

      --
      sic transit gloria mundi
    8. Re:Question by pedro · · Score: 1

      I feel compelled to point out that the term 'embryonic' when it refers to stem cells is a huge misnomer.
      The cells in question are obtained (IIRC) from a blastocyst, or a pre-zygote state of the fertilised cell. This is about as far, developmentally, from an embryo (with differentiated tissues) as a zygote is from the final Star Child in 2001.
      A blastocyst is just a clump of cells. A pile of lumber at a building site. Not a house yet. Nobody's even close to having moved in, spirit-wise.
      You're not 'destroying a life' at that point. There's no sentient life there!
      Fetuses.. well, that's a different story..

      --
      Brak: What's THAT?
      Thundercleese: A light switch.. of TOTAL DEVASTATION!
    9. Re:Question by WowTIP · · Score: 2, Informative

      Anyone could start new lines with private funding.

      Afaik that is not true. Bush banned the development of new embryonic stem cells ~6 months ago. The congress is even discussing a ban on importing embryonic stem cells.

      Sure, they could always try to get new lines from adult stem cells, but those attemps has so far not been very successful.

      --

      --

      "I'm surfin the dead zone
      In the twilight, unknown"
    10. Re:Question by WowTIP · · Score: 1

      Oh, so we should not trust the usual scientific press in this case? Instead we should trust "America's premiere conservative website"?

      --

      --

      "I'm surfin the dead zone
      In the twilight, unknown"
    11. Re:Question by nathanm · · Score: 2
      Bush banned the development of new embryonic stem cells ~6 months ago.
      No, all he did was block them from federal government funding. You could still use private funds, or even state or local government funds to start a new line. However, state & local governments don't spend much, if anything, on scientific research.

      There are plenty of billionaires that could fund the research though, but none that are serious about fighting disease. Bill Gates only donates money when Microsoft is getting bad press. If Ted Turner, Warren Buffet, or he were diagnosed with some terminal disease, all of a sudden there would be more funds than scientists knew what to do with.
    12. Re:Question by swankypimp · · Score: 1
      Oh, so we should not trust the usual scientific press in this case? Instead we should trust "America's premiere conservative website"?

      I'm not suggesting that at all; what I am suggesting is that the press (e.g. the New York Times, CNN, etc.) underreport studies like this because it goes against their support of embryonic stem cell research. While have been a number of promising studies on adult stem cells published in the scientific press, the general public doesn't hear about them from traditional media outlets.

      --

      --All your stolen base are belong to Rickey Henderson
    13. Re:Question by WowTIP · · Score: 1

      I might be misinformed, but, didn't he just shut down the federal government funding of resaerch on embryonic stem cells and made it illegal to produce new lines completely?

      Not that it is signicicant to this article, since they obviously have been using adult stem cells in this case, but anyway. If you are really sure that it is still legal to produce embryonic stem cells and have some links to confirm it, please post them (no sarcasm intended). Because then most swedish scientific news has got the meaning of the US laws wrong. :)

      --

      --

      "I'm surfin the dead zone
      In the twilight, unknown"
    14. Re:Question by nathanm · · Score: 2
      I might be misinformed, but, didn't he just shut down the federal government funding of resaerch on embryonic stem cells and made it illegal to produce new lines completely?
      The President's ability to make anything illegal is extremely limited. He just runs the executive branch of the federal government. New laws can only be created by the Congress, and are either signed or vetoed by the President. Congress can override his veto with a 2/3 majority vote. Some policies are delegated to the executive branch to regulate.

      If you are really sure that it is still legal to produce embryonic stem cells and have some links to confirm it, please post them (no sarcasm intended). Because then most swedish scientific news has got the meaning of the US laws wrong. :)
      Here's the new stem cell policy, straight from the horse's mouth. Most media have an agenda & report only the news they want to be made known & in a manner that suits their agenda. That's why I take anything the mainstream media has to say with a grain of salt.
    15. Re:Question by SkyLeach · · Score: 2

      "The bubble boys were cured with their own stem cells."

      It looks like you are only half-right. They added complete genes for immune system production to the stem cells. Where did they get those genes?

      I really want to know where they got the retro virus too. :)

      --
      My $0.02 will always be worth more than your â0.02, so :-p
    16. Re:Question by javatips · · Score: 1
      I really want to know where they got the retro virus too.

      They got it in the 60's.

    17. Re:Question by eam · · Score: 1

      Damn free love. It's a wonder there aren't more people with that virus.

    18. Re:Question by Boronx · · Score: 1
      It's rather that the ultra conservative press doesn't bother with the many reports that there in many areas adult stem cells are deficient when compared to fetal stem cells.

      Readers of such liberal papers as the Wall Street Journal (sarcasm) would know about this, while those who think that National Review is about as much journalistic integrity as they can stand may not.

    19. Re:Question by totopo · · Score: 1

      You are misinformed on the topic. They did not use embryonic stem cells, but stem cells from the boy's own bown marrow. There is no restricition on funding for research in this area in the United States, and no, embryonic stem cell research would not contribute to this cure. Don't blame Bush for being a luddite when you yourself don't know all the details.

    20. Re:Question by GreyPoopon · · Score: 1
      Where did they get those genes?

      I know I'm late on posting to this, but I would suspect that they could have obtained the necessary genes from healthy adult cells. Although I'm certainly no expert in this matter....

      --

      GreyPoopon
      --
      Why is it I can write insightful comments but can't come up with a clever signature?

    21. Re:Question by styopa · · Score: 2

      By executive order he prevented federally funding new lines. He did not prevent the creation of new lines, just restricted their funding to the private sector. Congress has stem cell research and theraputic cloning on their agenda for this year.

      Also, in theory, someone who creates a new line can request, through proper channels, for funding and still get it IF Congress decides that they should get the funding (remember that Congress is the one who holds the check book so to speak). Executive orders are not law of the land, only guidelines to follow.

      What did happen roughly six months ago was the beginning of the departure of good bio researchers from the US to the UK. I remember that there was one article posted on slashdot about a Stanford research who left because of President Bush's Executive order knowing that it would harm his researching potential. I wouldn't be surprised if we lose a lot more if we restrict the research even more.

      --
      Disclamer - Opinion of Person
    22. Re:Question by styopa · · Score: 2

      I think a more important question is, have the Executive orders restricting research and funding caused enough good researchers working on stem cells, embryonic or not, to leave the US and go to the UK, or parts of the EU, where there are less restrictions? Thereby causing the US to fall behind in the tech needed to be able to do this?

      Although the biggest complaint is from embryonic stem cells, Congress is going to be discussing that and theraputic cloning soon. If they ban that it is only a hop skip and a jump away from banning research like this which uses genetic modification. I know a few biologist who are worried about this and are thinking of leaving the country. Is our government causing a brain drain?

      --
      Disclamer - Opinion of Person
    23. Re:Question by lukesl · · Score: 1

      The US has laws limiting embryonic stem cell research. They don't care if use use cells from yourself

      This is one of the many misconceptions regarding this technology that is perpetuated to bias the public against it. One of the general strategies is to take cells from yourself and de-differentiate them, then do your gene therapy in a dish and re-introduce the cells. This gets around many of the problems of gene therapy because introducing genes into cells in a dish is easy, but introducing them into cells in a living human has rarely been done successfully. The problem is that opponents of this technology prefer to think of the process of de-differentiating your cells as cloning an army of little single-celled people since those cells from your arm could theoretically grow into humans, IF they were implanted into a human uterus under the right conditions. So cells from yourself actually ARE embryonic stem cells in certain cases. We don't have to use this strategy in all cases; SCID is an easy target for gene therapy as diseases go. It was first cured using gene therapy about two years ago in France. Funny how little press the successes of gene therapy get compared to the failures. However, any gene therapy of this type for any disease other than the SCIDs will require either breaking US laws regarding embryonic stem cells or the development of new technologies to circumvent this limitation. Of course, this is irrelevant because neither of these things will happen. Scientists in other countries (including recently-relocated American scientists) will simply beat us to it.

    24. Re:Question by susano_otter · · Score: 2
      Nobody's even close to having moved in, spirit-wise.

      Excellent! I was wondering when they'd get around to proving the existence of the "soul", and here you're telling me they've already gotten as far as an estimate of when, exactly, "ensoulment" occurs! This is great news! I'd like to learn more; what's your source?

      --

      Any sufficiently well-organized community is indistinguishable from Government.

    25. Re:Question by pedro · · Score: 2

      what's your source?
      My faith and my intuition, asshole.
      A non existent neural system, inherently insufficient to support a set of 'soul' processes, isn't a Being. It hasn't been issued a certificate of 'Beingness' yet by the Big Guy in the Sky.
      You, personally, could clone a cell from anywhere on your body, and if it grew to majority, (much less, actually) I would regard it as a full-blown Human, worthy of all the respect you or I would demand.
      That organism would possess 'the program'; the initial program load From God that makes us that which we are.
      A blastocyst is a 'potential' Potential human.. a far cry from becoming one.

      --
      Brak: What's THAT?
      Thundercleese: A light switch.. of TOTAL DEVASTATION!
    26. Re:Question by WowTIP · · Score: 1

      Yes, you seem to be right and I seem to be wrong. My mistake but not entirely my fault. I blame the swedish press. :)

      --

      --

      "I'm surfin the dead zone
      In the twilight, unknown"
    27. Re:Question by WowTIP · · Score: 1

      What did happen roughly six months ago was the beginning...

      Yes, according to some science press, american scientist have been very interrested in the 10 - 20 stem cell lines here in sweden that have been developed according to the "bush rules". Apperently, some scientists are considering moving their research here and some of them will fund projects at swedish universities. Bad for america, good for us.

      --

      --

      "I'm surfin the dead zone
      In the twilight, unknown"
  8. More coverage... by abhinavnath · · Score: 5, Informative
    --
    My other sig is also a .Porsche
    1. Re:More coverage... by red_gnom · · Score: 4, Informative
    2. Re:More coverage... by seanellis · · Score: 1

      It is nice to know that the Daily Mail has this as front page news, with a positive spin.

      This is, of course, entirely consistent with their centre page spread a few months ago stating in no uncertain terms that genetic modification would lead to the extinction of humanity by the year 2200. (I kid you not.)

      The Daily Mail: Journalism With Integrity. Not.

    3. Re:More coverage... by GregWebb · · Score: 1

      Some days, calling the Daily Mail journalism is stretching the point a little. I mean, they could get awards for original fiction...

      I remember an episode of I'm Sorry I Haven't A Clue a while ago, when they were doing a round of famous resignation letters that might have been.

      Jeremy Hardy: Editor of the Daily Mail, "I've been thinking."

      ;-)

      --

      Greg

      (Inside a nuclear plant)
      Aaaarrrggh! Run! The canary has mutated!

  9. In a related story... by cosmicg · · Score: 3, Funny

    Paul Simon has announced a full recall of his "Graceland" CD...

    --
    Cache Rules Everything Around Me
  10. Playing God? by Bowfinger · · Score: 2, Insightful
    Part of me is terrified at the potential for creating unimaginable horrors; the other part is completely in awe of the amazing things science can do. We're moving closer and closer to playing God. I pray we're up to the responsibility.

    Truly awesome.

    1. Re:Playing God? by Anonymous Coward · · Score: 1, Funny

      Yeah well, god is a lazy bum.. about time somebody replaced him.

    2. Re:Playing God? by Slash+Veteran · · Score: 1
      We're moving closer and closer to playing God. I pray we're up to the responsibility.

      Rest assured, we're not. Good intentions pave the...

      Not that I say we should stop. It's not in our nature. Just sit back and wait for the mind boggling dilemmas that are certainly to come.

    3. Re:Playing God? by flynt · · Score: 5, Insightful

      Why is it that no matter what things humans do to the earth (good or bad), the ONLY time we're "playing God" is when we fiddle with genes. Very arbitrary criterion if you ask me. Did not God create the trees and the animals? Why when we destroy or create these things then are we not "playing God". It seems a bit illogical to me.

    4. Re:Playing God? by truesaer · · Score: 2

      Are we really playing god in any new way? Sure there is a lot of power in genetic treatments, but transplants, antibiotics, and other major medical advances were also amazing leaps at the time. Its taking so long to develop these new treatments that I think we'll get it right.

    5. Re:Playing God? by Paradise+Pete · · Score: 1

      We're going to do it anyway, and since we've only a handful of generations until the computers get smarter than we are it doesn't make a whole lot of difference.

    6. Re:Playing God? by nathanh · · Score: 2
      Part of me is terrified at the potential for creating unimaginable horrors; the other part is completely in awe of the amazing things science can do. We're moving closer and closer to playing God. I pray we're up to the responsibility.

      If humans can do it, then it's hardly inspiring enough to be "playing God".

    7. Re:Playing God? by bani · · Score: 5, Insightful

      When vaccination was discovered, the religious community spoke out against vaccination on the same grounds -- that dying of smallpox was "god's will" and that vaccination was "playing god".

      The claim is as stupid today as it was then.

    8. Re:Playing God? by theNeophile · · Score: 1
      Yeah well, god is a lazy bum.. about time somebody replaced him.

      Someone mod this +1 Inciteful

    9. Re:Playing God? by morie · · Score: 2

      In my opinion, having a death penalty is closer to playing God than gene therapy, since you accomplish a transition (living-dead) that only GOd was traditionally allowed to make, while genetherapy does not change your state (when you're alive, you're alive, when you're dead, you're dead).

      --
      Sig (appended to the end of comments I post, 54 chars)
    10. Re:Playing God? by grammar+fascist · · Score: 2

      When vaccination was discovered, the religious community spoke out against vaccination on the same grounds...

      A nitpick, but an important one: saying "the religious community" is like saying "the Slashdot community."

      My religion did nothing of the sort that you describe. I'm sure the majority of the rest of them didn't either. Unfortunately, as with any perceived demographic, it's the most extreme kind that appoint themselves to speak and act for the rest of us.

      --
      I got my Linux laptop at System76.
    11. Re:Playing God? by shren · · Score: 2

      Did not God create the trees and the animals?

      Nope. Unless you care to prove it?

      --
      Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
    12. Re:Playing God? by Chanc_Gorkon · · Score: 4, Insightful

      God gives us everything. At least that's what I belive. If god does not want us to know something, he won't let us. That's my opinion. So long as any gene research does not result in a death or crippling some one or for the sake of better boobs, I think it's ok in my opinion. I personally would have loved some of this stuff to be found out years ago because now I may have a grandma to talk to and her talk back instead of visiting someone who can just listen to me. I am not sure what she had, but what I do know is it messed her brain up and she's almost not like grandma. All of her mental functions are ok, it's just that she doesn't have much control of her muscles. It started as a flayling of hands....for a time they thought it might have been Parkinsons, but it wasn't. Now you have to be careful how close you get to her sometimes cuz she could accidently slap ya. Not funny and she doesn't mean to do it, but if they had figured out how to fix this in time, she'd be mostly normal (even if she's old). I want to WALK with my grandma and have fun with her like I did when I was a kid/teenager. My son will only know his great grandma as some old lady in a bed. If any religious zealot wants to keep this from people who truely need it, then to heck with em! How many years more of Michael J Fox's acting would we have if they could reverse his parkinsons? I think it's right as long as we are fixing something. Doing genetic alterations in the womb is something that should not be done and also gene alterations just for better looking kids is a bad thing too. Genetic alteration to fix something that could hurt someone all of their life, well, I feel a bit different about that cuz if this stuff would have happened sooner, I would probably still have a vibrant grandma instead of a invalid grandma.

      --

      Gorkman

    13. Re:Playing God? by shren · · Score: 2

      Yes but slander is a legal offense most places in the modern world, and in legal courts, something can be interpreted as libelous if you say something about somebody and can't prove that it's true. That's a vast oversimplification of libel issues, but the ramifications hold - if you accuse God of existing you better be able to prove it, or he might sue.

      --
      Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
    14. Re:Playing God? by Genom · · Score: 2

      if you accuse God of existing you better be able to prove it, or he might sue.

      The same with accusing him of not existing ;P

      So, the only reasonable, legal course of action then, is to say "I can neither confirm or deny the existance of your Supreme Being, at least until he/she/it comes down and has a cup of coffee with me". =)

    15. Re:Playing God? by shren · · Score: 2

      Sounds good to me. I'll even pay for the coffee.

      --
      Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
    16. Re:Playing God? by Defiler · · Score: 1

      "God gives us everything. At least that's what I belive. If god does not want us to know something, he won't let us."

      "Doing genetic alterations in the womb is something that should not be done and also gene alterations just for better looking kids is a bad thing too."

      If we can do it, then clearly God has allowed us to. I thought it was God's job to draw the line. He's told you that retroviral gene therapy is OK, as long as it happens after birth? That's pretty specific for the big guy upstairs. According to your stated belief system, anything that is technically possible is automatically blessed by God. I guess those German gas-chamber technicians were doing God's work.

    17. Re:Playing God? by donfede · · Score: 1

      >When vaccination was discovered, the religious
      >community spoke out against vaccination on the same
      >grounds -- that dying of smallpox was "god's will"
      >and that vaccination was "playing god".

      Fortunately Darwin took care of that group of people.

      donfede

    18. Re:Playing God? by Boronx · · Score: 1
      Because Man created god in his image.

      *Flamebait!?!?* This oft repeated one liner is the best, shortest illumination of World History.

    19. Re:Playing God? by viking099 · · Score: 2

      " I guess those German gas-chamber technicians were doing God's work."
      uhm... That is one of the most ignorant and inflammatory comments I've seen from someone in a long time.
      God has no control over what Man decides to pervert or bastardize.
      One of Man's greatest blessings and curses is the near-limitless imagination.
      Part of Gods gift to us was the ability to choose what to do with our lives. Those Germans chose to turn their God given gifts to evil, which resulted in the heartless slaughter of millions of people.

      But never think that just because something CAN be done (gas chambers that look like shower rooms) it SHOULD be done.
      To bring it back on topic, if Man devises a way that can be used to cure the maladies of millions, that is good. If it is used as such, then that also is good, and the work of God. But a perversion of that method (say, to give everyone in the world an advanced form of Parkinson's) is evil, and a work of Satan.
      But in either case, is the tool good or evil, or is it the Man or Men wielding the tool that are good or evil?
      Think about that.

    20. Re:Playing God? by Chanc_Gorkon · · Score: 2

      I was going to reply to that reply to my post, but you answered it much better then I would. No where in my post did I say that if something is technically possible, that it should be done. It's technically possible to do alot of things, but noone said that it was right. One example I have is using gene therapy to change your face or your genetic makeup to make you more appealing to females. That's just wrong. Curing a disease is one thing, changing your DNA to have a better looking nose or to give someone a disease is another. God gives us great power. He expects us to use it for good, not evil. Weapons can be a good example of this. If someone uses a weapon to kill an innocent, then, that's bad. If someone uses a weapon to defend themself, or to get rid of evil (like Bin Laden), then that's also good, but god still cries for both. God loves you if your a beliver or a non-beliver. He even cries when a evil person dies. I know it's hard to belive, but that's the truth.

      --

      Gorkman

  11. Good News... by mrgaribaldi · · Score: 3, Insightful

    Indeed this is good news however genetic manipulation is not something to be taken lightly. While at the moment this child has been cured what are the side effects of such a treatment later in life? What is to say that this won't spawn some new disease that affects the rest of use.

    I fear the use of technology that we do not understand.

    Apologies if I sound alarmist.

    1. Re:Good News... by The+Wooden+Badger · · Score: 1

      AFAIK we understand this 'technology', in basic form at least. Because our understanding is basic, and also that we probably aren't seeing the whole picture of genetic sequencing and associated protein synthesis, it seems like a cowboy territory. We know a lot about what's going on in molecular biology and genetics, but there is so much that we don't know and that we just plain can't observe. I'd go on but I couldn't stay awake during my molecular biology classes when I was taking them.

      --
      Heroscape, it's like legos combined with anachronistic wargames.
    2. Re:Good News... by dragons_flight · · Score: 2

      Maybe that should say that you fear the use of technology that you don't understand.

      The risks and complexities of delivering genes that every non-"Bubble Boy" person has anyway isn't high on the list of scientific achievements. That they did so only to marrow precursor cells is sensible since they are the only ones that need express the genes and it's easier to target specfic cell groups than the entire body. The surprising part would have been if all the technology worked as advertised and he wasn't cured.

      There are reasons to worry about genetic manipulation, but there is no reason to cry about a new plague in a situation that is well understood, and which any reasonable geneticist would tell you is very low risk. GM foods are far higher risk, and none of those have yet had an effect even approaching that caused by the transplantation of species into environments where they have no competitors.

    3. Re:Good News... by DarkEdgeX · · Score: 2

      Don't apologize, I share your fear regarding potential side effects of such treatments and experiments. I'm all for medical (and scientific) advances, I just hope that in doing so we aren't in fact dooming ourselves to some mass death. (A very good example of something being changed such that it was 'too good' is the recent revelations regarding asthma-- I saw it on CNN I believe, but doctors and scientists believe that some cases of asthma may in fact be due to young children growing up in much more sterile environments. Because the lungs and other internal organs related to breathing aren't exposed to the same level or variety of contaminants, they can't cope with such things once the children start spending more time out in the natural air (it doesn't help that kids also exert a lot of energy, and tend to breathe more during physical activities outside).). That example wasn't related to any one scientific advancement, but it does show that not all things science teaches us is always correct.

      --
      All I know about Bush is I had a good job when Clinton was president.
    4. Re:Good News... by tomstdenis · · Score: 1

      Tell that to Madamme Currie [sp?].

      Someone always pays for scientific acheivements. We learn through ERRORS not "just knowing".

      As for "effects later in life". Yeah, he's going to live about as normal life as anyone else probably. But you can't shy away from technology just because its new.

      What should be cautioned are the motives. Like in the 50s/60s when they were testing all the pesticides just for profit. See to me they are throwing science out the window just to make a buck. Here in this case the goal is to cure a disease and save a life [even temporarily]. Sure the doctors will get press but I have to imagine their motivation is a succesful treatment which is in the interest of the boy in question.

      Tom

      --
      Someday, I'll have a real sig.
    5. Re:Good News... by mrgaribaldi · · Score: 1

      "I fear the use of technology that we do not understand."

      By this I meant that the manipulation of genetic information is a dangerous art at best. There are so many things that we don't understand about our genetic material. I am in favor of developing the best technological solutions to our problems. But after a while in IT I've become overly use to the issues that occur later down the road when we don't have enought information to procede.

    6. Re:Good News... by Starcub · · Score: 1
      ...GM foods are far higher risk, and none of those have yet had an effect even approaching that caused by the transplantation of species into environments where they have no competitors.
      Not exactly true:
      http://www.psrast.org/insects.htm
      http://www.sciam.com/1999/0899issue/0899techbus1.h tml
    7. Re:Good News... by Starcub · · Score: 1
      Someone always pays for scientific acheivements. We learn through ERRORS not "just knowing".
      Learning through error is not acceptable in the case of applied genetics. The reasons should be obvious: We don't know more than we do, and the consequences of incorrectly messing with our genetic makeup may not be realized until major extensive damage has been done. Who knows how pervasive (perhaps as a result of generational development) the problems will be. Even if we could quantify and isolate the problem, correcting it would still require knowledge that might be a loooong time coming.

      An important question to ask is: Would you be willing to undergo the necessary risks and restrictions given that you knew the state of the technology and possible consequences? In the case of the "bubble boy", they decided it was. However, as one of the doctors pointed out, they really can't say they have cured the boy until many years have passed.

      Honestly I'm not sure I wouldn't have made the same decision as this boy's parents if it were my child that was afflicted. However, there should be recognition of responsibility towards society at large regarding the possible consequences. I'm assuming this would mean some sort of isolation but I would need to know a lot more about the technology than I do now to determine the details.

      Can you consider this "playing God"? I don't know, perhaps motive is involved in that respect, but I suspect time will tell.
    8. Re:Good News... by tomstdenis · · Score: 1

      The only way to learn is through error though. There is no other way. You make a guess, back it up with precedence and experiment. There is absolutely no other way to learn new things.

      I agree caution should be taken [based on knowledge of previous failures!] but blindly labeling a science as bad because god tells you so is just plain stupid.

      As for the treatment. How do you know that the open heart surgery they perform on you will actually work in the long run? Maybe the technique as we know it is flawed and they are jepardizing the lifes of others?

      All fields have the unknown element. Space travel for example, has alot of risk and tons of dangers but look at the advances we have gotten?

      Tom

      --
      Someday, I'll have a real sig.
    9. Re:Good News... by Starcub · · Score: 1
      The only way to learn is through error though. There is no other way. You make a guess, back it up with precedence and experiment. There is absolutely no other way to learn new things.
      That's not true, there are many things we can learn simply through observation. Normally these are simple things, like the rules of classical physics for example. However, they can be complex as well. For example, I believe Einstein figured out relativity without ever having proof, only later was it validated. This is just a general observation; the extent of it's applicability to genetics I cannot say but certainly it applies to some degree.

      I agree caution should be taken [based on knowledge of previous failures!] but blindly labeling a science as bad because god tells you so is just plain stupid.
      Of course I'm playing Monday morning quarterback here, but those previous failures are something we probably could have figured would happen anyway. In this case I'll liken the scientist/biologist/corporate researcher/whatever to a child who gets a new game and before completing the instructions, jumps into play only to find out they are missing something. Not smart, and in this case I question the motives and character of those who do these things. BTW, I doubt God ever told anyone science was bad and I never said anything to support that.

      As for your comments on caution based on previous failures (which in this case there is ample evidence of in animal cloning), I completely agree, and this is why I feel this work is so detrimental. Cloning a human is unlike heart surgery in many ways. What is the purpose? What are the risks? I can think of no good reason to clone a person and plenty of good reasons not to.
    10. Re:Good News... by Starcub · · Score: 1

      Oops! That last paragraph where I used cloning as an example was probably unfair as the issues are slightly different and a lot more obvious than genetic research. I was involved in another discussion elsewhere and my mind drifted, sorry. In the case of genetic manipulation my prime concerns arise from problems experienced in GM crops and in insects, as well as what I've read about the nature of genetic research.

  12. For those of you who saw "Kenny Dies"... by Munelight · · Score: 2, Funny

    Well, so then, if the stem cells are placed next to a Shakey's Pizza, they would become another Shakey's Pizza! And you'd have your own Shakey's Pizza where you didn't have to charge yourself to eat!

  13. my experience by azosx · · Score: 2, Informative
    I wrote a paper this last semester in college on embryonic stem cell research. The possibilities in this field of research are endless. It's certainly not suprising to me this discovory occured in Europe. It's unfortunate the position the United States has taken towards stem cell research. It's pretty much closed to door and made the possibility of discoveries such as this very unlikely here in the U.S.

    www.nih.gov/news/stemcell/index.htm has the latest information about what's taking place in the U.S. in regards to stem cell research. It's a great resource for anyone wanting to learn more about this amazing new science.

    1. Re:my experience by Anonymous Coward · · Score: 2, Interesting

      They took this guy's stem cells from his own body. Not from some embryo. There are no laws against this in the U.S. What they did was the almost the same thing as how people are treated for Hodgkins disease every day. In simplified form: 1) Extract bone marrow (and thus, stem cells) from patient, 2) Submit patient to massive radiation to kill existing stem cells in his body, 3) Put patient on IV drip of his own bone marrow (Yes, the stem cells "magically" end up where they are supposed to be in the marrow).

      The only difference here (AND IT'S A REALLY COOL DIFFERENCE) is that before they put the stem cells back in this guy, they used genetic engineering techniques to insert a good copy of the Interleukin-2 gene (a "bad" il-2 gene was causing his disease to begin with) into the DNA of the stem cells.

      The majority of the genetic engineering (e.g. recombinant DNA) techniques that made this possible were developed in the US over 20 years ago (and funded by US tax dollars). (These guys appeared to have done some cool things to make the stem cells more likely to be "infected" by the vector.) So don't use this story to make a case against the US policys on embryonic stem cell research. This work has nothing to do with embryonic stem cell research.

      The reason why this stuff probably didn't happen in the US is that our FDA officials are a bunch of overprotective suits. That said, there have been many uses of genetic engineering in the US (treatment of cystic fibrosis comes to mind) to date- although not all have been successful.

      Personally, I think it's awesome that these former bubble boys will have the chance to lead "normal" lives. Everyone involved in getting this done, from the patients themselves to their families to the doctors to the researchers to the governments to whoever paid for it (this must have cost millions including everyting), deserves much congratulations for their vision, courage and hard work.

    2. Re:my experience by nathanm · · Score: 2
      It's certainly not suprising to me this discovory occured in Europe. It's unfortunate the position the United States has taken towards stem cell research. It's pretty much closed to door and made the possibility of discoveries such as this very unlikely here in the U.S.
      The new stem cell policy wouldn't have affected this research at all since it only applies to embryonic stem cells. The bubble boys were cured with their own stem cells.

      Besides, the policy only limits government funding. Anyone could start new stem cell lines with private funds.
    3. Re:my experience by psamuels · · Score: 1
      Besides, the policy only limits government funding. Anyone could start new stem cell lines with private funds.

      <sigh>, I think you're wasting your virtual breath. There are people who simply want to believe George W Bush is a horrible religious nut out to destroy science and free society and bring back the Victorian age. I think they are the same people who, a few years ago, felt the desperate need to believe Dan Quayle was a moron simply because he believed the cue card in front of him at a spelling bee. (Actually that last bit can't be strictly true for the slashdotters - imagine the irony of spelling flames on slashdot.)

      --
      "How can you claim that you are anti-crack, while still writing a window manager?" — Metacity README
  14. How do Retro Viruses work? by changos · · Score: 1

    I remeber studing about viruses, and how they attack, but I'm not familiar with retro viruses. Could they affect other parts of the body, or how do they make them only able to attack the damaged cells? Thanks for the responses.

    1. Re:How do Retro Viruses work? by Digitalia · · Score: 2, Informative

      Retroviruses are cute little viruses that write DNA from RNA using reverse transcriptase, an enzyme. These viruses possess the ability to write that DNA into pre-existing DNA and, in this manner, convert cells and such to their cause. HIV is a retrovirus. However, much more beneficial retroviruses exist. The ability to write DNA into cells allows these viruses to be used to modify live cells. Take this with a grain of salt: I've never been a very good Bio student.

      --
      Pax Digitalia
    2. Re:How do Retro Viruses work? by professortomoe · · Score: 2, Interesting

      Nope, you're pretty much right about a retrovirus. My Bio teacher came up with a really great analogy about retroviruses, HIV in particular: Ok, say you've got eight men in a tank. These guys each have a set of blueprints. They drive their Panzer tank through the wall of the nearest Ford factory and tell the workers to make more tanks instead of those fruity Ford Taurus things. The workers construct 7 more tanks and the guys each hop into their respective tanks, driving out of the building through the walls, bringing it to the ground. You've got the tanks as the delivery system, the men as the viral RNA, and the factory as the cell. Mind you, I may have skewed it slightly because it's been a good three months since we covered that. Oh well, it's also tired time. Heh.

      --
      If I wasn't so lazy, I'd have a sig.
    3. Re:How do Retro Viruses work? by shadowbearer · · Score: 1

      Here's a better one: *grinning*

      Retroviruses are self-inserting security defeating trojan viruses that insert themselves as kernel module patches set to run at boot. ;-)

      They have many varied modes of transmission that mostly rely on kernel security vulnerabilities. They are also cross-platform executable and compilable.

      ( .NET anyone? :-)

      Fortunately, since their real mode of transmission is RL, we have kept them more or less quarantined. However, research indicates that Moore's Law may apply; this particular fork of technology may become accessible to Dark Wizards Of The Sand Dune...er...Garage, in the future. Therefore we need to be wary, for that occurence, and over-reaction by the Great UnGeeked Who Wish To Control All (GUWWTCA copyright Ablemonk Forever)

      ;-)

      It is definitely bedtime....

      This Post brought to you courtesy of ZZTop and Boone's Farm...and don't bother to Flame It, either.

      SB

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
    4. Re:How do Retro Viruses work? by doricee · · Score: 2, Informative

      In all cells things go like this:
      DNA -> RNA -> Protien
      aka the central dogma of biology

      A virus is incapable of doing this by itself, hence it cant reproduce by itself.
      So it hijacks the host cell.

      There are several classes of virus, based on
      what it injects into the host cell. Some have subclasses that are based mostly on what it looks like (capsid and envelope) of the virus.

      I. dsDNA
      (papovirus) warts
      (adenovirus) respiratory disease
      (herpesvirus) herpes, chickenpox
      (poxvirus) smallpox, cowpox

      II. ssDNA (parvovirus)
      roseola

      III. dsRNA (reovirus)
      diarrhea viruses

      IV. ssRNA that can serve as mRNA
      (picornavirus) polio, common cold
      (togavirus) rubella, yellow fever

      V. ssRNA that is a template for mRNA
      (rhabdovirus) rabies
      (paramyxovirus) measles, mumps
      (orthomyxovirus) Influenza viruses

      VI. ssRNA that is a template for DNA synthesis
      (retrovirus) HIV, tumor viruses

      The Retroviruses work something like this:
      RNA -> DNA -> RNA -> Protien

      This is a case where biology doesnt follow the central dogma of biology! The other virus classes still follow the central dogma.

      Another interesting disease agent is a prion, but thats involves a lot of speculation.

      -hope that helps.

  15. Moops? by DeafDumbBlind · · Score: 1, Redundant

    Great, now that the bubble boy is cured, maybe we can get that whole Moops/Moors things figured out.

    --


    Jesus used to be my co-pilot, but we crashed in the mountains and I had to eat him.
  16. Are we good at this, or what? by rnicey · · Score: 1

    So do we understand the retro-virus or not?

    I wish I knew more about this kind of biology. On one hand there's this stupid virus called HIV which is killing millions, has a few slightly varying strains and despite probably billions of dollars refuses to goddam die.

    Then on the other hand somebody has managed to genetically engineer a retrovirus that is capable of DNA splicing in a fantastically accurate fashion and can cure many inherited diseases.

    So, for the bio peeps out there, how?, why?

    1. Re:Are we good at this, or what? by big_groo · · Score: 2, Informative

      The problem with a retro-virus, is that each time it replicates, it takes a small chunk of the host's dna with it. Each iteration of the virus is a different virus altogether. Hence, the problems with developing a vaccine or cure. Influenza and HIV are both retroviruses. Google knows. Look up 'retro-virus/immunology' if you're interested in more reading...

      -1 offtopic.

    2. Re:Are we good at this, or what? by shadowbearer · · Score: 1



      Soolution = Nanotech.

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
    3. Re:Are we good at this, or what? by DarkMan · · Score: 2

      As well as the retro virus taking host DNA (see other reply), there is another factor at work.

      Most anitbiotics, and antvirals, work by stopping the infectious agent from reproducing, and it is the hosts immune system that kills the remaining infectious agent. HIV decimates the immune system. This doesn't help.

  17. more importantly.... by r00tarded · · Score: 1

    is there really a Dr. Thrasher? I thought he only existed in 80's skateboard movies.

  18. gene therapy by borg · · Score: 5, Informative

    The biggest problem with gene therapy is that long term expression of the target gene has been difficult to achieve. The inserted sequence, depending on the gene carrier, may or may not be inserted in to host genome. Actual insertion into the host genome is undesirable because of possible malignant transformation (insertion of the target sequence disrupts the function of a tumor supressor protein, or turns on a pro-tumor protein, etc.). Existing as a genetic sequence outside of the genome proper has also failed to achieve more than temporary expression of the desired protein.

    This article describes a technique to increase the effiency of the transfer of a therapeutic gene sequence into a target cell. It does nothing to address the biggest stumbling block of gene therapy. While this is sexycool news, being cured for 3 or 7 months doesn't mean being cured for life.

    Claimer: IAAMD
    I don't mean to be a downer. We're just a loooong way off from real gene therapy.

    --
    Fermat's other theorem: "I have a simple proof, but I can't write it down as I fear it's a DMCA violation to discuss it"
    1. Re:gene therapy by jso888 · · Score: 1

      That's just one of the problems with gene therapy.

      The other major problem is that we still don't know enough about how viruses (or other vectors for gene insertion) interact with biological systems to ensure efficacy, or safety either. Several gene therapy clinical trials involving viral vectors have been abandoned, simply because the body responded (normally) to the presence of virus in the body.

      You may be interested in looking through these articles on gene therapy from Real Scientific Journals; at the risk of pissing off the copyright police, I've linked to two good, readable review articles on the topic at my web site. I hope these can dispel some of the myths about GT.

    2. Re:gene therapy by punkyfish · · Score: 1

      Well, sorry if I'm a little late with this comment, but thnx for at least being practical about the issue. It seems to me that whenever 'scientific breakthroughs' that have even the remotest link with genes, are made public; people will start raving about possible moral repercussions and ethics. Almost as if we are all on the brink of creating a 'brave new world' for ourselves.When we are only getting started in a field we know very little about.

    3. Re:gene therapy by Scooter · · Score: 1

      Indeed - but cured for a while is better than not at all.

      "I want more Life, fucker!" - Roy Batty to his creator.

    4. Re:gene therapy by Coleco · · Score: 1

      As far as I remember, retroviruses are pretty good at inserting correctly into the genome. That is to say, they insert only in one place (the same place) and the insert is pretty stable. H. simplex is a retrovirus and it remains in your body for the rest of your life.

      Of course using a plasmid vector would result in a much less stable transformant (duh). I think the *big* problem with gene therapy is getting the insert into the cells. Retrovirus vectors have had some success in treating somatic cells. In this case, inserting the gene into stem cells works becase once you have inserted the gene into very small amount of cells then it will repopulate or 'regrow' the entire population. In contrast, if you had a defective gene in the neurons in your brain you would have to infect every single cell. This would be hard.

      The other option is to screen the fertilized egg for geneitic diseases and then correct a broken gene at the single cell level so that the development of the person is normal. Of course this is GATTACA type stuff.. which is a whole other discussion.

    5. Re:gene therapy by lukesl · · Score: 1

      A couple of comments: first, you're right that long-term expression of the target gene is difficult to achieve. However, there are certain very important applications of gene therapy that only require transient expression of the transgene. One example is to regrow blood vessels to the heart, which is a recent success of gene therapy.

      Second, long-term expression is only difficult to achieve if you're using certain techniques to introduce the transgenes (e.g. retroviruses). If you combine "cloning" with gene therapy, you can use more typical lab techniques for stable transfection to get around this problem for certain classes of diseases, most notably diseases which affect blood cells, such as sickle cell anemia or even AIDS, if you could re-introduce CCR5 negative T cells, for example. A recent paper in Cell demonstrated repopulation of bone marrow with transgenic embryonic stem cells expressing the HoxB4 gene, which would make this possible in the absence of the Bush administration. And if we can figure out how to get hematopoietic stem cells (the blood-making stem cells in bone marrow) to proliferate in a dish forever, we can solve this problem without cloning.

      So basically what I'm saying is that the real stumbling block in generalized gene therapy (stable transfection in vivo) has not been overcome, and you're right that this is a long way off. However, there are important types of gene therapy that do not require this, and they are either already here or will be here shortly.

      disclaimer: iaamdphd

  19. Yes, Maybe by Shook · · Score: 2, Informative

    A stem cell is cell that can turn into different type of cells. There are many type of stem cells, and the controversy in the US is only over human embryonic stem cells. These cells can only be obtained by destroying what many consider a human life.

    Stem cells in adult bone marrow can turn into many types of blood cells. From the article, it sounds like the stem cells used came from the patients' own bone marrow so human embryos probably weren't used. The article doesn't say where the normal copy of the gene came from, but I doubt it would need to come from a human embryo.

    1. Re:Yes, Maybe by linzeal · · Score: 1

      I as a pro-lifer would rather go through a bone marrow donation than have a entire type of human life dehumanized and destroyed. Anyone else, and answer only if you know what a bone marrow donation is like.

    2. Re:Yes, Maybe by Gladiator · · Score: 1

      Then they used a modified form of a retrovirus found in gibbons to add a normal copy of the faulty gene to the stem cells.

    3. Re:Yes, Maybe by Tuzanor · · Score: 2
      I've never experienced one, but I've seen them done with my own eyes.

      For those that are wondering, bone marrow is INSIDE your bones, and to get at it you obviously have to get inside the bones. No problem, right? Just give the guy some anesthetic and jab a needle in and grab it. Except that because of the frailty of the stuff, you can't give a person the anesthetic. So while they are wide awake without any painkillers, they jab/drill into your bones and suck it out.

      The real ticker offer is that the recipient needs to only be injected with the stuff like a regular needle.

    4. Re:Yes, Maybe by DukeToma · · Score: 1

      You're absolutely right Shook. This was a case of Adult Stem Cell research which isn't controversial at all. Brian

  20. and there are... by shadowbearer · · Score: 1

    groups in the US and elsewhere (everywhere?_!) that want to outlaw this kind of technology. Ackthptht! Voter Inertia....

    Think about it: No rejection transplants, grown on demand, no immune system issues, and the technology to keep one alive for the required period is already here (sustains some patients for literally years while they wait for new kidneys or hearts)

    Sure, it can be abused. Name me one - ONE - technology of any kind that can't be abused or turned to evil means. Come, you know you can...

    Shadowbearer

    "It's Just a World, It's Not Heavy" - Atlas

    --
    It's old. The more humans I meet, the more I like my cats. At least they are honest.
    1. Re:and there are... by epiphani · · Score: 1
      Sure, it can be abused. Name me one - ONE - technology of any kind that can't be abused or turned to evil means. Come, you know you can...


      Why, the beer tap of course. It can be turned, but unless you can call left or right 'evil', then we're fine.

      cept for those damn vertical pull ones, then you're in shit.

      --
      .
    2. Re:and there are... by shadowbearer · · Score: 1


      I humbly bow before your subtle wisdom about the beer tap. You do have a point.

      Of course I will point out those erratic, unpredictable episodes whenst the keg runs dry...

      ShadowBurdened

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
  21. We understand no technology by Macrobat · · Score: 1
    Fear the use of technology we don't understand, but realize it's all a matter of degree. Nobody knows how computers work, for example. Of course, we all know a little bit about parts of it--some of us can program, others can design circuits on silicon chips--but nobody knows all the parts, or how many ways they can interact. And there's little way for us to explore the world (in the scientific sense) that doesn't involve the use of technology of ever-increasing complexity.

    Also, curing a fatal disorder is not taking something lightly. Although the "it might spawn some other disease" argument is compelling for emotional reasons, it's really an out-of-left-field consideration. You can say with equal certainty (i.e., little to none) that this achievement might also serendipitously lead to a plethora of other cures and treatments that might have otherwise eluded us. Then we'd be guilty of standing still when we could have done something.

    --
    "Hardly used" will not fetch you a better price for your brain.
  22. What to do with the bubble by Rude+Turnip · · Score: 1

    Every year he could pull the bubble out of the back of the closet and go trick-or-treating as a bubble boy.

    1. Re:What to do with the bubble by VikingBerserker · · Score: 1

      Nah, I'm sure Intel or AMD would like another nice clean room...

  23. Bahh! by Riskable · · Score: 1

    I think the solution to your fear is to become an atheist =)

    I mean, serously, if science brings us to the point where it's commonplace to "play God" then what's the point of worshipping a diety? Science already saves lives, improves the quality of life of billions, and enables us to control our own destinies. What's worshipping a god going to give you? Where has it gotten us in the past?

    Mohandas Karamchand Gandhi said, "God has no religion." If we're our own gods, then we should just give up on religion and believe in ourselves. If we can do that, you have nothing to fear.

    --
    -Riskable
    "Those who choose proprietary software will pay for their decision!"
    1. Re:Bahh! by Anonymous Coward · · Score: 1, Interesting

      > I think the solution to your fear is to become an atheist =)

      What is true isn't changed by what you think is true. You can believe war is not going to occur, but it very well may. Telling yourself it won't can't change that. Ignorance is not always bliss.

      > I mean, serously, if science brings us to the point where it's commonplace to "play God" then what's the point of worshipping a diety?

      Well, what's the point of worshipping at all? To bring glory. God being worthy of glory doesn't change regardless of what man accomplishes. Also, "playing God" is not at all close to "being God". A young boy can "play cops and robbers", but he's no closer to being a police officer than a young girl "playing doctor".

    2. Re:Bahh! by Riskable · · Score: 1

      > Well, what's the point of worshipping at all? To bring glory. God being worthy of glory doesn't change regardless of what man accomplishes. Also, "playing God" is not at all close to "being God". A young boy can "play cops and robbers", but he's no closer to being a police officer than a young girl "playing doctor".

      ...and believing in a god doesn't make it real either.

      --
      -Riskable
      "Those who choose proprietary software will pay for their decision!"
    3. Re:Bahh! by aweraw · · Score: 1

      ...and believing in a god doesn't make it real either.

      does believing in yourself make you a god?

      god is the universe, it is you, it is me, it is everything that has been and ever will be.

      --
      5468652047616D65
  24. Re:The Article... by Jouster · · Score: 1

    (Braces himself for the -1 offtopic, but it had to be said...)

    The only thing that's more disturbing than genetic engineering is the fact that this comment's parent got modded up for verbatim copy-and-paste. The AC didn't even use linebreaks.

    Jouster

  25. retrovirus information by jest3r · · Score: 5, Informative
    A retrovirus is special because it contains an enzyme called reverse transcriptase. This enzyme works backwards, translating RNA into DNA. Retroviruses contain RNA within their protein coat, and use reverse transcriptase to create DNA that can be inserted into the cell it is attacking. One of the most famous (or perhaps infamous) retroviruses is the HIV retrovirus, which causes AIDS.

    Retroviruses are being investigated for 3 reasons:

    1) They can be used as vectors to transport genetic information into a host cell.

    2) Reverse transcriptase can be used to isolate DNA sequences from a mRNA chain so that the gene can be manipulated through bioengineering techniques.

    3) To find a way to genetically engineer a cure for AIDS. If the action of reverse transcriptase can be halted somehow, the HIV virus will have no way to spread its harm through the body and millions of lives could be saved.

    more info

    1. Re:retrovirus information by cbnewman · · Score: 1

      here's the rub:

      where exactly does the retrovirus insert it's genetic payload? 95% of our genome is non-coding. the other regions that do actually encode for something useful are under strict regulatory control. speaking of which, what happens if the retroviral payload upsets one of the control regions? you may have just activated a tumor cell line.

      we've got a lot of work to do...

    2. Re:retrovirus information by professortomoe · · Score: 1

      Well, there are drugs that do block reverse transcriptase, but have limited results. Examples of which are AZT drugs and derivitives. If you want a good site with stuff about HIV + retroviruses, check out http://www.cellsalive.com/hiv0.htm

      --
      If I wasn't so lazy, I'd have a sig.
    3. Re:retrovirus information by jso888 · · Score: 1

      The primary reason why retroviruses are a big deal in gene therapy is that they integrate their genome into host DNA in the normal course of infection.

      Retroviruses carry their genome around as RNA. Once they infect a host cell, reverse transcriptase converts its RNA genome into DNA. Then the DNA gets inserted into the host genome, by other proteins that the virus carries around ready-made.

      Adenovirus does this as well, and is also a good vector for gene therapy.

      The ability to insert viral genome (or modified viral genome) into host cells is the big deal here.

    4. Re:retrovirus information by jest3r · · Score: 1

      yes ..

      history tells us that we will f*ck up large before we get an actual understanding as to what we are doing.

      The article states "Then they used a modified form of a retrovirus found in Gibbons"

      What they dont tell us is that since the treatment he has been eating alot of bananas and is now living up in a tree with the other monkeys.

    5. Re:retrovirus information by Ian+Bicking · · Score: 1, Interesting
      However, it is questionable that AIDS is caused by HIV at all

      It is strange that not everyone with AIDS has HIV, and not everyone who has HIV seems to get AIDS, even after many years. Barring other evidence, this should lead one to think HIV does not cause AIDS. Other evidence doesn't seem to be forthcoming.

      Basically, AIDS is just a disease of definition -- when you die of particular diseases, and happen to have HIV, you are declared to have died of AIDS. In Africa you can die of TB, have HIV, and be declared to have died of AIDS. The AIDS epidemic in Africa is in fact just a horrible amount of traditional (and often curable) diseases -- it is indeed a tragedy and deserves a great amount of attention, but they need antibiotics, clean water, basic medical care, and mosquito control. They don't need AZT.

      They've been talking about a 30%-50% HIV infection rate in Nigeria for 10, maybe 15 years. They should all be dead! They aren't. A lot of people are dead, but it's from all the same old reasons -- all the problems we, as a world and as a species, haven't been willing to attack since the 60s.

    6. Re:retrovirus information by spiro_killglance · · Score: 2

      Which history is that? Is that the history in
      which the detonation of the first H-bomb ignated
      the atmosphere killing everyone on the planet?
      Saving the worrying about what scientists are
      doing to other scientists and ethics commities
      who are qualified to that task. Sciences works
      by peer review not peon review.

    7. Re:retrovirus information by spiro_killglance · · Score: 2

      Maybe they could build a retrovirus that inserts
      an anti-sense version of reverse transcriptase
      gene into the genome, once there it would prevent
      you ever getting a retrovirus, of course it would
      also prevent gene therpy by viral agents.

    8. Re:retrovirus information by Xenophon+Fenderson, · · Score: 1

      It is the history in which a couple of tens of thousands of Japanese die because of the primary and secondary effects of two atomic bombs.

      It is the history in which researchers (cf. the Curies) and "volunteers" (cf. the recent DoE scandal) die because of an insufficient understanding of nuclear radiation, among other reasons.

      It is the history in which a lot of people die, for a very long time, before anyone gets a clue that drinking from a river that doubles as a latrine will give you cholera, dysentery, and a whole host of other really nasty diseases.

      I'm all for peer review. Lord knows there are plenty of misinformed people out there---how many people are comfortable calling it Nuclear Magnetic Resonance Imaging? However, scientists and doctors need a measure of humility, too. And the whole point of science is to make knowledge accessible to EVERYBODY, to uncover the "mysteries" and "secrets" used to chain a society to the service of a few, or one.

      Sorry, rant mode off.

      --
      I'm proud of my Northern Tibetian Heritage
    9. Re:retrovirus information by Ian+Bicking · · Score: 1

      Moderation on this comment has gone back and forth a bit -- for those who would moderate me down, I would be much more impressed if you could provide evidence (well, reference to evidence) that HIV causes AIDS. I'm open minded, I thought the HIV-detractors were crackpots too... but then I started noticing that no one responded to their criticisms with facts. The responses tend to be silence, ostracisms, and moral condemnations (that suggesting HIV doesn't cause AIDS is irresponsible). None of those have any place in science.

    10. Re:retrovirus information by Phocker_ · · Score: 1

      I don't need to point to information that is helpful...AIDS is not a disease HIV is a disease...AIDS is just a point in HIV when you're cell count drops below a certain number and you are unable to fight off disease..this takes years for some and in others it never even occurs. The african strains of AIDS aren't known to be particularily robust and the mortality rate isn't as high as it is with the American strain...weee

  26. We are always playing God by Macrobat · · Score: 1
    We play God when we decide to meddle with the construction of our genes, or of the atom, or of the environment.

    We are also playing God when we see the pain and suffering already present in our fellow humans' bodies or in the world at large but decide it's not worth it to take any risks or try something new.

    --
    "Hardly used" will not fetch you a better price for your brain.
  27. Isn't this the same as.. by Kotukunui · · Score: 1

    ...the plot for the latest "Spiderman" movie.

    Perhaps when Rhys reaches puberty he will suddenly develop super powers which will enable him to swing from tree to tree like a gibbon. "Bubble Boy" becomes "Monkey Man".

    That would be cool (as long as he only uses his powers for good)

  28. God's Biotech Lab... by gnovos · · Score: 3, Insightful

    I don't remembering God *having* a biotech lab, or at least it wasn't mentioned in any bible *I'VE* ever heard of... (Though, perhaps it's in $cientology's secret documents)

    UNTIL we can manipulate ALL REALITY with only the power of WILL, we will NOT be be coming anywhere close to "playing god".

    --
    "Your superior intellect is no match for our puny weapons!"
    1. Re:God's Biotech Lab... by dragons_flight · · Score: 4, Interesting

      Well technically, manipulating all reality through the power of will alone is a pretty good functional definition of what it means to BE God. Only important thing missing is knowing everything, but that probably comes along with all events playing out according to one's will.

      As you no doubt know, "playing god" is what the disdainful call it every time man gains control over an aspect of reality that was previously ruled by chance/God alone.

      Since God created us with intellect, reason and the ability to learn moral judgment, I for one, believe that we should "play God". Man is created in the image of God, and if we are to fulfill that destiny than it means learning to act with as much wisdom, knowledge and moral judgment as humanly possible, which certainly includes scientific exploration.

    2. Re:God's Biotech Lab... by Bugmaster · · Score: 1
      Actually, I once read an interesting analysis of the Genesis chapter that tried to determine what the phrase "God created Adam in his own image" means. The idea that God really has 2 arms, 2 legs, and all the other squishy bits, is kinda ridiculous, so it probably shouldn't be taken literally. The author's conclusion was that "...in his own image" refers to the qualities that make humans different from animals - self-awareness, reasoning power, and the ability to create new things.

      In other words, what makes us human is the same "stuff" that makes us closer to being divine than, say, a frog. In this case, it would be almost blasphemy to not "play God", since we would be debasing ourselves to the level of worms, and God obviously had something different in mind for us.

      (BTW, sorry, I read this a while ago and do not have the source)

      --
      >|<*:=
    3. Re:God's Biotech Lab... by Scooter · · Score: 1

      I agree - it makes me laugh every time I hear some guy saying "we are destroying the planet". We may be making the planet less suitable for supporting human life, but we are not destroying it. It started off as a fairly barren rock and will probably continue to exist long after the human race (and all other 'life') has departed from it.

      The "you're playing God" brigade's view of things evolves along these lines:-

      No human knowledge of something - it's magic/superstition

      A little knowledge but no manipulation - it's God/nature

      Beggining of human manipulation - "you're playing God"

      Routine manipulation - "we've never had a problem with that"

    4. Re:God's Biotech Lab... by Genom · · Score: 2

      Well technically, manipulating all reality through the power of will alone is a pretty good functional definition of what it means to BE God. Only important thing missing is knowing everything, but that probably comes along with all events playing out according to one's will.

      Sure - if you can manipulate reality by power of will alone, it should be dead simple to will yourself all the knowledge of the universe =)

    5. Re:God's Biotech Lab... by DohDamit · · Score: 2

      AMEN to that! I mean....well, I mean I agree.

      >ahem<

  29. Look out George! by capedgirardeau · · Score: 1, Funny

    Now he can kick George Castanza's arse.



    -----
    Help me give away a USD$500,000 Beer Store!

    --
    Wax on, wax off baby!
    1. Re:Look out George! by leadfoot180 · · Score: 1

      I was hoping for someone to make a Seinfeld reference! :)

  30. Disturbing? by paranoid.android · · Score: 2, Insightful

    And how is genetic engineering (or, at least, the type described in the article) disturbing? It almost certainly saved this baby's life, and prevented him from suffering a short, isolated existence in a plastic bubble, not to mention the psychological trauma of an accidental viewing of this piece of dreck.

    1. Re:Disturbing? by Jouster · · Score: 1

      It's absolutely glorious, to answer your question.

      Tomorrow, when a doctor acts to correct a mental disorder on your child and winds up deleting the spark for the next Van Gogh, what will you think? Science does not get judged by its first example, it gets judged by the eventual results of the full range of its uses.

      Jouster

    2. Re:Disturbing? by bani · · Score: 2

      So your default stance on science is that it is evil? Guilty until proven innocent?

      I can't see any other conclusion from your "Tomorrow..." statement. You are assuming the worst by default.

    3. Re:Disturbing? by Dyolf+Knip · · Score: 2
      Tomorrow, when a doctor acts to correct a mental disorder on your child and winds up deleting the spark for the next Van Gogh, what will you think?

      I will think of all the other "next Van Goghs" whose lives were saved by genetic engineering.

      Should we ban polio vaccines because it causes the disease in a handful of children who otherwise might not have had it, thereby essentially forcing it onto millions of others?

      --
      Dyolf Knip
    4. Re:Disturbing? by Jouster · · Score: 1

      Certainly not. But it is disturbing because it forces us, once again, to deal with issues that we haven't had to deal with before. I look at it as similar to the "Someone will die--either choose one or I'll choose fifty" scenario. It's certainly better to be able to save the forty-nine lives (or forty-nine artistic talents, or whatever) via genetic engineering, but do you want to be the one who has to decide which one must lose theirs?

      Jouster

    5. Re:Disturbing? by WowTIP · · Score: 1

      The matter is not what I would think, but what that child would think about it.

      Red pill: Pro: You will paint great pictures. Con: You will get a short life in misery, that ends with a suicide.

      Blue pill: Pro: You will lead a (relatively) happy life. Con: You might loose a grain or two of your artistic abilities.

      Which pill would you choose?

      If you actually suggests that we should let someone that is mentally ill stay that way, because "he paints so pretty pictures", then you make me sick.

      --

      --

      "I'm surfin the dead zone
      In the twilight, unknown"
    6. Re:Disturbing? by Jouster · · Score: 2, Insightful

      My statement was to defend my use of the word "disturbing". I feel it is most certainly disturbing that we are facing a technology that may one day destroy that which we think of as "human". I certainly don't think--and even more stridently, don't hope--that that will be the case, but the possibility exists. Just as the discovery of the principles of atomic energy allowed us to produce massive amounts of power at exceedingly low cost, it could just as easily have meant an end to every intelligent being on the planet.

      Thus, is the discovery of these new bioengineering principles disturbing? Possibly; I certainly believe so, but it could be argued. Unsettling? Without a doubt. We can no longer sit on our rear ends and let our children and our children's children decide what to do with this technology; it just landed in our laps. Will we use it to cure cancer, to prevent genetic ailments, to identify those who will suffer from male pattern baldness? Or will we use it to replace humanity with a homogenized mass of tissue, each unit performing the task for which it is programmed?

      Jouster

    7. Re:Disturbing? by Toraz+Chryx · · Score: 2

      a lot of artists might kill themselves out of frustration if you took away their abilities...

    8. Re:Disturbing? by Jouster · · Score: 1
      Okay, this is my fourth try at posting this, and I'm not going to retype everything.

      Basically, I certainly wouldn't say that. My example may have been too extreme. Instead, I can certainly see many situations in which parents choose to remove questionable genetic material which, if left in, might benefit the person. In particular, my parents would have probably removed my hyperfocus disorder, which would have reduced, in my opinion, my ability to program well.

      The logical next step, then, is to determine if a particular borderline disorder would be beneficial to the person. "Oh," they say, "he has a propensity towards logical thought. He'll be a programmer or mathematician or somesuch. Better leave the hyperfocus in." And once you're leaving things in, why not add things. "Ooh," they say, "he'll be sitting on it a lot, so let's give him an unusually large butt."

      So now we're left with two issues.
      1. I could win many programming jobs over a non-engineered programmer with equal qualifications. Now, if parents want their kid to get ahead in life, they have to direct him or her into a specific career path, even if that career path is "diversity".
      2. So here I am with a big rear end and a propensity for logic, but I really want to be a classical ballet dancer. Yo soy out of luck, more than likely.
      Genetic engineering isn't bad, but it is disturbing. We must critically examine each step we take with it, as we do with anything else, because it could very quickly and very easily turn into something none of us want.

      Jouster
    9. Re:Disturbing? by spiro_killglance · · Score: 2


      This has happened in real life. Billy MacKenzie
      the Singer/Songwrighter behind the Band, the Associates was a depressive. He was given prozac
      which seemed to destroy he's songwriting ability
      and so he killed himself. Of course he might have
      killed himself without the prozax too.

    10. Re:Disturbing? by Dyolf+Knip · · Score: 2
      It's certainly better to be able to save the forty-nine lives (or forty-nine artistic talents, or whatever) via genetic engineering, but do you want to be the one who has to decide which one must lose theirs?

      Problem solved. You are never even aware that any particular schlob would have been a Nobel prize winner in another universe, so there's no stress involved.

      To take your scenario of "you choose one or I'll choose 50"; you are never really aware that it is going on. Your 'choice', though it changes the fate of many, involves nothing more strenuous than deciding to innoculate your child against some harmful illness. If you knew beforehand that of these 50 children, one of them will do great things for the human race but only at the cost of untold misery for the others and you had to decide what to do, you're right, it'd be ulcer city. But you can't know, so you don't know, so there's no dillema.

      E.g., If I'd left home 5 minutes earier, I wouldn't have been in that car accident and this lady wouldn't have been killed and her unborn child would have become the first American Dictator and started WW3. I must be a hero, but all I did was misplace my keys. I don't worry about it because even though I know that even my most trivial acts can change the future, it's obvious that second guessing everything I do will get me nowhere. All I can do is make the best choice based on the info I have. In this case, I choose to give a child an immune system.

      --
      Dyolf Knip
    11. Re:Disturbing? by WowTIP · · Score: 1

      Yes, when you rephrase it like that, I can very much agree with you. It was the notion that we shouldn't cure a suffering individual for the public good that scratched my nerves. I really really do contempt all events where some individual should suffer because of some greater good for (some) society. In your case the disorder seem to be something you value, and therefore, should not be removed. The part that I think is really important is that it is you that value it, which also gives that nooene should do anything to anyone without their expressed consent... Now I am getting way offtopic, but...

      Glad we straightened that out. :)

      --

      --

      "I'm surfin the dead zone
      In the twilight, unknown"
    12. Re:Disturbing? by Jouster · · Score: 1

      Three years of college-level biology. I'm convinced that, if my cell organelles aren't self-aware yet, they should be. ;)

      Furthermore, I don't necessarily believe that fear is killed by knowledge; sometimes, it is exacerbated by it. For example, let's say we live in a society that fears genetic engineering. Somebody comes out with a bacterium that will change tRNA in real-time based on a set of criteria. Those without the knowledge say, "Oh, so it isn't changing DNA? Then it's not GE, and I'm not afraid." Meanwhile, those with the knowledge see it for what it is--GE by any other name.

      Perhaps it would be the case with GE that ignorance would breed fear, but too many people have too much tied up in this to ever notice there's a bad side. Most of them are going to say, "Oh, this could cure Granny's cancer," or, "If I ever have a kid with HIDD, this will cure him/her." The opposition to this will mostly come from the religious right, further diminishing the small chorus of far-left voices, such as myself. We are trying to instill just the right amount of healthy fear in the populace, without removing the potential this development brings with it.

      And as for your "obtw", Van Gogh was an example designed to appeal to the masses. For those with more specialized knowledge, I offer the example that Einstein's brain was malformed. The malformation allowed him to concentrate extensively on math and logic, but largely destroyed any chance he might ever have had at a long-term social life.

      Jouster

    13. Re:Disturbing? by Jouster · · Score: 1

      Thank you for your very insightful comment. If I had one of those nice little "spare" users with moderation points like the one that started this whole thread, I'd mod you up quite a bit.

      As you've succeeded in killing this argument, I'd like to ask you to read my example a little lower on the thread that discusses hyperfocus disorder.

      Again, my congratulations and thanks for a very nice comment!,
      Jouster

  31. this would be ok under current US research laws by cbnewman · · Score: 1

    it sounds like the stem cells used in this case were taken from the boys' own bone marrow. the objections raised in the US are from embryonic stem cells.

    with modern technology, all stem cells taken from adults can only differentiate into certain types of cells ("pluripotent"). this may change as we work some basic science out. they only need immune cells, so they could settle for precursors to that particular cell line (e.g. they don't need to grow a new pancreas for him)

    fetal, or embryonic, stem cells are totipotent and have the ability to become any cell in the body. boy would scientists like to know more about how to do /that./

  32. Re:gene therapy; Varley plug by shadowbearer · · Score: 1

    I don't think that anyone can deny anymore that soon we will have a great amount of potential control over genetics. The real issue in that field has shifted over from obtaining data to data analysis; and as computers and software improve that will get easier.

    I will not enter here the argument about whether it should be or not. It's irrelevant anyway, barring a global economic crash of vast proportions. The technical ability is going to come. Live with it.

    I always thought that Varley's "Steel Beach" novel was an excellent treatment of that particular sort of social fork disease...

    Shadow'ed

    --
    It's old. The more humans I meet, the more I like my cats. At least they are honest.
  33. A great example of "safe" genetic engineering by encebollado · · Score: 2, Informative

    This gives a great example of the safer of the two types of gene engineering, somatic. This type of gene therapy only modifies the genetic makeup of certain cells in the body. None of the effects of the changes could propogate onto his children. I wish we could see more of this type of gene therapy.
    The other type, germline, alters genes in gametes (eggs and sperm). Any changes here would probably (at least with our technology) be irrevsible and would be carried by any decendents. Thankfully, people are being more cautious with this kind since the effects would be much more permanent and far reaching.

  34. not in the US of A by e40 · · Score: 1

    The administration (almost, but not quite) elected by the people would like to prevent this type of medicine from being practiced in this country. Thanks, Dubya.

  35. Other points by Faux_Pseudo · · Score: 4, Interesting

    While this was going on there is a couple in California that is hopeing (as in activly looked for sperm donner who was deaf) to have a kid that is deaf so that he will be like the rest of the family (minus the cats). So while we have gene experaments going on to inhance the lives of people and potentialy bring a brave new world kind of classism effect [BadThing(TM)] we have also got people who are actively trying to set the pace of progress back.

    1. Re:Other points by crisco · · Score: 2

      Washington Post article. I think they're from the east coast, not CA.

      --

      Bleh!

    2. Re:Other points by mekkab · · Score: 3, Insightful

      Ahhh, I see you read a little washington post magazine while on the can this Sunday!

      However your argument is a gross generalization on both fronts. To go O.T. for sec, the Deaf article is not just commenting on the desireability of a physical conidition (not being able to hear) but of the fierce culture that has associated itself around it. They (the capital-d Deaf) stick together like birds of a feather.
      I don't know how fostering one's own community is stetting the pace of progress back, but YMMV.

      back on topic- to extrapolate from this gene experiment where we have no long term data to establish its true efficacy to a Gattica-type dystopia is almost trolling as a luddite. Just like the "we shouldn't play God!" troll, we have to realize its out of our hands. Technology is neither good nor bad.

      And if you live in America, you have nothing to worry about, since it will either be outlawed, the funding will be cut, or Hollywood will legislate what genes you can use. Whoops, sorry! This isn't a DMCA/RIAA/CBDBTA/TINSTAAFL article!

      --
      In the future, I would want to not be isolated from my friends in the Space Station.
    3. Re:Other points by ostiguy · · Score: 2, Insightful

      Dude, when I was in high school, the dumb kids hung out together. Do you advocate allowing parents to genetically engineer dumb kids so the dumb community doesn't get upset?

      ostiguy

    4. Re:Other points by mekkab · · Score: 2

      actually, it's not a personal thing. Personally, I think/feel that the Deaf take it *WAY* TOO FAR to the exclusion of everyone who is hearing. I've heard stories of Deaf parents considering aborting children when they found that their child would come out normal. And comparing dumb kids in high school to a tight knit intergenerational community is pretty ignorant. ostiguy, were you one of those dumb kids? ;)
      (just kidding!)

      And how in hell would those Dumb people figure out how to genetically engineer more Dumb? (that's capital D dumb to you, Mr. Smarty pants!)
      I mean I've seen a fish ride a bicycle but this is ridiculous!

      --
      In the future, I would want to not be isolated from my friends in the Space Station.
    5. Re:Other points by i0lanthe · · Score: 2
      I'm not sure how this is crazier than people who assert in polls that, if the technology were available, they would choose to raise only children that were blonde. But then, I consider that pretty dashed crazy.

      (no blonde jokes intended)

      --
      "The Crystal Wind is the Storm, and the Storm is Data, and the Data is Life"
  36. miracle? by marksilverman · · Score: 1

    "seems nothing short of a miracle" Tell me something, why is it that after every great medical or scientific achievement someone has to come along and call it a miracle? It's not a miracle. In fact, it's the EXACT OPPOSITE of a miracle. It's an achievement of man, with no help from the divine.

    1. Re:miracle? by seanellis · · Score: 1

      This is a piece I wrote some time ago and never posted, but which seems appropriate to the virtual redefinition of the term "miracle", which is now far more commonly used in conjunction with real scientific discoveries like this than with supposed magic tricks by a nonexistent creator:

      An Awesome New Millennium To You All

      Dr George Carey, the Archbishop of Canterbury, used his Christmas 1999 sermon to set the stage for life in the new millennium. Rather than concentrate on peace, spiritual matters, or the relevance of Jesus into the next 1000 years, Dr. Carey used his unique position instead to attack science.

      "We live in a world where our sense of awe has been somewhat anaesthetised," he said. "The awesome seems increasingly circumscribed."

      If the pursuit of knowledge has taught me anything, it's that the sense of awe and wonder gleaned from observing the universe as it really is, is orders of magnitude beyond that which the Church peddles.

      Water into wine? A conjuring trick for children. How about changing sand into stuff that thinks? How about seeing and moving individual atoms? Isn't that more awesome?

      Resurrection of the dead? Highly speculative. How about the revelation that every cell in our bodies contains all the information required to generate the whole thing over again from scratch? Doesn't that engage your sense of wonder?

      He goes on: "We increasingly bring with us the expectation that whatever is revealed can be explained - if not now, then later."

      Is explanation not a good thing, then? And the expectation of explanation often drives us to look for one. In a capricious, arbitrary universe, where natural laws are there to be broken, then this might be an adequate excuse, but we don't appear to live in a universe like that.

      Every time this argument for ignorance is presented, I am minded of the penultimate scene in The Wizard of Oz, where the powerful wizard commands the hapless travellers to "Pay no attention to the man behind the curtain." Of course, the Archbishop is merely upholding church dogma, which encourages people not to apply critical thinking too strongly otherwise it might undermine church dogma.

      In any case, the argument fails because explanations are often the most awesome part of any scientific endeavour. The classic question is "Where do we come from?", to which the church replies that we were created on a whim by a capricious superbeing and that's the end of the matter - sit down and be quiet.

      The actual answer is staggering, and required centuries of patient research to discover. In the beginning, space and time expanded together from a dense, incomprehensibly hot state. After a while, the expansion caused this to cool, and the primordial maelstrom settled down into clouds of stable atoms. Although some hydrogen still remains, almost all the atoms in our bodies were forged in the heart of huge stars, which exploded, flinging the material out into space where it coalesced into a second generation of stars with planets. Somehow, these atoms teamed up into molecules which were able to reproduce. A huge arms race then developed between these replicators, culminating in the fantastic diversity of life on this planet with us as one particularly gifted species.

      Notice how this isn't cut and dried. How did life start? Is intelligence inevitable? What started the big bang? Lots of room for bigger, better wonders in the future.

      It occurs to me that Dr. Carey's speech makes sense if your viewpoint is a relatively narrow one. If you stand in front of a room full of people, and the best you can offer them in the wonder stakes is a few parlour tricks from a left-wing revolutionary nearly 2000 years dead, it's little wonder that they yawn and fidget. After all, an evening's viewing on the Discovery channel can show them things that are more awesome and more wonderful. Every day. With evidence. In their living rooms.

      Sorry Dr. Carey. Awe and wonder are alive and well beyond 2000. It's the Church that's anaesthetised and circumscribed.

      This story of a cure created by "playing god" is one example of the awesome stuff that science comes up with every day.

  37. Uh, no. by bani · · Score: 4, Insightful

    Remember that one of the arguments against vaccination when it was discovered, was that we shouldn't be "playing god". Eg people should just accept death by lethal contagious viruses like smallpox -- vaccination is "playing god".

    Just about every significant medical discovery has been opposed with the "playing god" argument.

  38. Dem hippy protesters by LadyLucky · · Score: 2

    Should have to go to talk to the person cured, and explain why they think not doing this research is more important to their values than him being cured.

    --
    dominionrd.blogspot.com - Restaurants on
  39. Being God by Sean+Clifford · · Score: 2, Interesting
    We're not going to use this technology responsibly - we don't use any technology responsibly. Of course, we'll develop "good" uses for the technology - treat and cure diseases, discover new forensic techniques, grow new organs, and blah blah blah.

    But we'll also develop targeted bioweapons to kill "terrorists","Dangerous Radicals", Saddam Hussein, or other enemy-of-the-year. We'll do horrible shit with this, possibly doomsday our species along with our environment.

  40. Re:Question - OOPS! by pedro · · Score: 2

    I got the two states interposed..
    A Zygote (fertilised ovum, basically) *precedes* a blastocyst, which, in turn, precedes an embryo.
    Sorry 8P

    --
    Brak: What's THAT?
    Thundercleese: A light switch.. of TOTAL DEVASTATION!
  41. X chromosomes by Scrameustache · · Score: 1

    the Welsh baby had is "X-linked", caused by a fault in a gene on the X chromosome that makes an immune protein called interleukin-2. The disease affects boys because they only have one X chromosome.

    I'm so tired of the press saying crap like that!
    I'm sorry people, but boys have 45 X cromosomes and one Y chromosome. The girls have 23 pairs of X chromosomes.

    Maybe journalist have only 2 chromosomes...

    --

    You can't take the sky from me...

    1. Re:X chromosomes by jso888 · · Score: 2, Informative

      I should hope not.

      People normally have 23 pairs of chromosomes. Of those chromosomes, only 1 is an X chromosome, and one a Y chromosome in boys. Girls have 2 X chromosomes.

      The other 22 pairs of chromosomes may be X-shaped, but they most assuredly not what biologists refer to as X chromosomes; they're referred to by pair number 1 through 22.

      Furthermore, having an abnormal number of chromosomes (aneuploidy) can cause congenital disease. In the case of sex chromosomes, I refer you to Klinefelter's and Turner's syndrome. In the case of other chromosomes, Down's syndrome (extra copy of chromosome 21), trisomy 13 and 18 (extra copies of chromosome 13 or 18).

      Sheesh.

    2. Re:X chromosomes by Scrameustache · · Score: 2

      The other 22 pairs of chromosomes may be X-shaped, but they most assuredly not what biologists refer to as X chromosomes

      Ok...
      Now that you mention it...I vaguely remember one of my college teacher saying something to that effect...
      I often have trouble expressing to people why I left science classes and went fort art college instead...I think I'll user this example from now on. Its just cute enough :)

      sheesh...

      --

      You can't take the sky from me...

    3. Re:X chromosomes by PlatinumMac · · Score: 4, Informative
      No, everyone has 44 autosomal chromosomes and 2 sex chromosomes (either one X and one Y or two Xs).

      X chromosomes are distinctly different from the autosomal chromosomes. No human being can live with a missing autosomal chromosome (e.g. only one chromosome 21 instead of two) -- embryos with this type of defect are miscarried so early that they are not even detected, even though embryos with three copies of an autosomal chromosome (a defect arising from the same mistake in meiosis which causes the loss of an autosomal chromosome in some embryos) are detected -- some even live to adulthood (Down syndrome). On the other hand, all human beings can be said (in general) to have only one X chromosome; in females, one X chromosome is almost completely inactivated in each cell.

    4. Re:X chromosomes by Wolfier · · Score: 2

      Great English explanation :)

      Does anyone think it is a good start, towards the cure of all genetic diseases passed to boys just because we don't have a backup copy of X?

      Looking towards the day when difference in life expectancy between the male and the female is negligible.

  42. Oh For Christ's Sake! by thedbp · · Score: 1

    When will scientists stop being such shameless huckster opportunists, constantly promising lofty goals and wasting MILLIONS of dollars to give us nothing more than ....

    oh ... wait ...

    hey, good job guys :)

  43. Actually, these were adult stem cells by xaymaca2020 · · Score: 1

    It's important to note that is was accomplished using adult stem cells and not embryonic stem cells. Thus, the usual 'baby harvesting' arguments do not apply here.

  44. Re:How did they test this? by hayden · · Score: 1
    How do you test something like this? Have someone cough on him?

    Well the usual method of getting him to cough wouldn't have helped at all, would it?

    --
    Nerd: Derogatory term typically directed at anybody with a lower Slashdot ID than you.
  45. stem cells not the answer to life's problems by mshurpik · · Score: 1

    They cured the kid's disease with stem cells. Great. What else can stem cells do? I'm not entirely sure I care.

    I'm not a religious moralist, and I find the pro-life side of the embryonic stem cell debate disturbing. However, every once in a while, the views of liberals converge with those of religious conservatives - for example, with Catholics on the death penalty. I think this may be one of those cases.

    The supposedly liberal view on stem cells is that we have a moral imperative to cure obscure diseases. We can, therefore we must. Well, I'm not impressed with that logic. It's not clear that the cures will be widely available, or that stem cell research won't accelerate the pace of frankenstein genetics experiments.

    Meanwhile, most of the disease in this country is self-inflicted. Heart disease, lung cancer, alcoholism, obesity. A few public policy initiatives would do much more for public health than any stem cells would.

    There's a corporate power-play going on here with regards to the information in these stem cells. Miracle cures are the carrot on the stick. Public policy is being ignored.

    1. Re:stem cells not the answer to life's problems by Coleco · · Score: 1

      Of course what we're talking about in this case is not *embronic* stem cells but bone marrow from the the boy's own body. So there not really any moral question in that regard.

      Other than that, the technique doesn't strike me as groundbreaking, merely a novel use of existing techniques. It not really a case of 'moral imperative to cure an obscure disease' but more, 'it would probably be easy to do this'. If the knowedge is available to help someone, as rare as SCIDS is, shouldn't we just do it? I guess it's easy to wax philosophic when it doesn't affect you.

      As far and cancer and whatnot, yes it's true there are high risk activities, but people get sick that aren't in high risk groups. It's easy to look at statistics and say 'X causes Y' but in reality, on a case by case basis, it's not so cut and dried. But why insist on any moral imperative at all? The truth is that being sick sucks, why don't we show a little compassion?

    2. Re:stem cells not the answer to life's problems by mshurpik · · Score: 1

      Of course what we're talking about in this case is not *embronic* stem cells but bone marrow from the the boy's own body. So there not really any moral question in that regard.

      Yes, I am aware. But without a moral question, what's the purpose of 181 slashdot comments? I was trying to be relevant.

      If the knowedge is available to help someone, as rare as SCIDS is, shouldn't we just do it?

      Yes, this is good news.

      But why insist on any moral imperative at all? The truth is that being sick sucks, why don't we show a little compassion?

      I believe I did show a lot of compassion by suggesting that we take seriously the hundreds of thousands of cases of preventable diseases. Sorry that this was not clear.

    3. Re:stem cells not the answer to life's problems by Steve+B · · Score: 1
      It's not clear that the cures will be widely available


      What's your point? Obviously, a limited supply is better than no supply.


      Meanwhile, most of the disease in this country is self-inflicted. Heart disease, lung cancer, alcoholism, obesity. A few public policy initiatives would do much more for public health than any stem cells would.


      WTF does a decision to eat less, excersize more, not smoke, and not drink to excess have to do with "public policy"? Dragging that notion into the argument undercuts the whole point of personal responsibility.


      There's a corporate power-play going on here with regards to the information in these stem cells.


      What information? Is there some sort of secret message written into DNA by aliens?


      Public policy is being ignored.


      Irrelevancies should be ignored.

      --
      /. If the government wants us to respect the law, it should set a better example.
    4. Re:stem cells not the answer to life's problems by MassD · · Score: 1

      Very shortsighted response. Gene research does more than just cure obscure diseases. Cancer is a genetic disease, and while some cancers are, as you say, self inflicted, many are predisposed. Gene research and therapy may cure or prevent a vast number of cancers.

      There are genetic links to heart disease, diabetes, cancers, infections ( bacterial and viral). Most any condition that does not involve some sort of contaminating poison could be elminated with gene research. With the rise of bacteria resistant to antibiotics, gene research could solve that problem.

      To call it Frankenstien experiments is quite ignorant. Was Saulk's work frankenstien? Pasture?

      Corporate power-play or not, it should go on.

  46. Name me one... by Convergence · · Score: 5, Insightful

    Name me one thing in nature we fully understand. Name me one thing.

    We don't know, *for sure* how atoms work or are built. We don't know if there is a 5th repulsive force in nature. There's lots we don't know..

    But what we do know.... To our knowledge, this therapy may help a guy who's *never* had a chance to go out into real life. Maybe it'll give him cancer in 30 years. Maybe it won't.. But just because it might possibly be catastrophic doesn't mean that nothing should be done.

    That way leads to stagnation and helplessness. We don't know and can't know. That is why this so-called 'precautionary principal', that something must be proved 'safe' before it can be used or sold is garbage. We can't know and won't know for *sure* anything.

    1. Re:Name me one... by k98sven · · Score: 5, Insightful

      We can't know and won't know for *sure* anything.

      How interesting.. this is called relativism (not the Einstein kind)

      Now, I would like to ask you, does that statement apply to itself?
      If yes, then we can't be sure that everything is unsure
      - which renders the possibility that things indeed can be known for sure.

      If no, then you are assuming that at least one thing -can- be known for sure,
      which means that other things may be as well.

      In short: That is a self-contradictory statement.

      Also, in stating that we don't know most things
      -for sure- , you seem to imply that everything is equally uncertain. This is not the case.

      For example, for the last 500 years or so, we have known that the earth orbits the sun, and not vice-versa.
      Of course we can't be -absolutly certain- this is the case, but I'd say that it would be very unlikely for the opposite to be proved.

      Science is not about solid truths, nor has it ever been:
      It's about knowing things with a known degree of certainty.

    2. Re:Name me one... by DarkKnightRadick · · Score: 1

      I agree. Just because we don't know something is safe doesn't mean we shouldn't try it. Personally, I've lived through cancer (6 yrs in remission) and while I wouldn't wish it on anyone, there is more known about cancer then SCID and I'd be willing to place 100:1 odds that Rhys would rather fight cancer then live in a bubble the rest of his life, I know I would rather fight cancer again and again then live isolated from the entire fucking world.

      --
      "There is a way that seems right to a man, but its end is the way of death." Proverbs 16:25 (NKJV)
    3. Re:Name me one... by cmckay · · Score: 1

      We don't know if there is a 5th repulsive force in nature.

      You are forgetting lawyers, my friend... they are most definitely a repulsive force! ;-)

    4. Re:Name me one... by sharkey · · Score: 2

      5th repulsive force

      1. Mariah Carey
      2. Celine Dion
      3. Rosie O'Donnell
      4. Lawyers
      5. Chelsea Clinton

      --

      --
      "Outlook not so good." That magic 8-ball knows everything! I'll ask about Exchange Server next.
    5. Re:Name me one... by mitchskin · · Score: 1

      How about:

      We can know one thing for sure, which is that we can't know anything else for sure.

    6. Re:Name me one... by cadallin451 · · Score: 1
      true that science is not about solid truths, at all times, but it can be. Especially since once you reach a high enough level of technology, things that you infer in previous centuries from experimental data, (such as the earth, in fact, orbiting the sun) can eventually be directly observed.

      It would be trivial to send a probe perpendicular to the plane of the solar system and then have it look "down" and send back movies of the earth orbiting the sun. It would be more difficult, but still possible, to send a human being to do the same. This experiment would clearly be solid irrefutable proof of the Copernican solar system, equivalent to saying "the sky is blue, because I can see that it is." People could still argue, but they would have no argument unless they start denying the soundness of human perception.

  47. The retrovirus is harmless. by red_gnom · · Score: 2, Informative
    The retrovirus is used only as a harmless vehicle for transportation of the good gene. It has an ability to penetrate into cells. Eventually the virus gets destroyed, and the "fixed" gene remains inside.
    Gene therapy


    Similar method was originally tried on cystic fibrosis patients, but the positive results lasted only for about three weeks, after that repaired cells were replaced back again with the faulty ones.
    It seams to be more complicated.
    Cystic Fibrosis Gene Therapy

  48. HIV treatment by ironfroggy · · Score: 1

    Could this sort of procedure be used to treat HIV?

    1. Re:HIV treatment by Coleco · · Score: 1

      I'm in molecular biology, and I've actaully thought about this before. 1 in 200 people get hiv but don't die from aids because of a faulty cell receptor that prevents the virus from infecting the cell. If one was to use a retrovirus vector with the faulty gene inserted.. that just might confer resistance. Just an idea anyway.

    2. Re:HIV treatment by morie · · Score: 2
      It most probably would be problematic, to say the least. The good receptors woukld still be there, ready for infection. Unless you knock them out, your solution is useless. to knock them out you would have to insert a stretch of DNA into them, or delete a part.

      You would have to use a recombinant vector, i.e. a vector which has the start and end of the gene for the correct receptor with it, and some deletion or garbage in between. It _could_ recombine, but would not work for a multi-cellular organism, since only part of the cells would become immune.

      The idea of dual complex treatment is just a bit to much at this moment if you'd ask me.

      and yes, I'm a Molecular Geneticist

      --
      Sig (appended to the end of comments I post, 54 chars)
    3. Re:HIV treatment by spiro_killglance · · Score: 2


      It wouldn't be a cure, but if you created a
      new line of stem cells in the bone marrow that
      produced HIV resistant T-cells, the HIV infected
      person would never lose his/her immune system,
      and so live a nearly normal life.
      But they would still be capable of passing on
      HIV though.

    4. Re:HIV treatment by Coleco · · Score: 1

      Actually, that's true, you'd have to knock out the other gene. Hrm.. it was just an idea. The neat thing is that even if you have a small number of modified cells, that the resulting T-cells would out-compete the HIV infected ones.

  49. Incoherant, yet irrelevant! by Doktor+Memory · · Score: 2

    Read the article. Embryonic stem cells were not used. They used his own stem cells.

    --

    News for Nerds. Stuff that Matters? Like hell.

  50. Inciteful by Iffy+Bonzoolie · · Score: 1

    Is "Inciteful" the same as "FlameBait?"

    --
    Run a pencil-and-paper RPG campaign with your far-off friends: Gametable!
  51. Old News! by goodEvans · · Score: 1

    Yawn

    This is only the first time it has been done in England. If you read THIS article, you will see at the bottom that the French did this TWO YEARS AGO.

    1. Re:Old News! by goodEvans · · Score: 1

      Heh. How do you think we feel when English, Welsh OR Scottish people refer to us as part of the "British Isles"?

  52. Really? by 7dragon · · Score: 1

    What the fuck is a retro virus?

    1. Re:Really? by Tony+Hoyle · · Score: 1, Flamebait

      It's a virus with a big afro & platform shoes that struts around going 'Yeah, baby!'.

    2. Re:Really? by dondelelcaro · · Score: 2, Informative
      What the fuck is a retro virus?
      A retrovirus is a virus that carries its genetic material in RNA instead of DNA, and as such, needs RT, or reverse transcriptase, in order to make DNA from its RNA. The other major type of viruses are DNA viruses, which do not require RT to integrate into the host's genome.
      --
      http://www.donarmstrong.com
    3. Re:Really? by dannywalk · · Score: 1

      Hehe! That made me laugh. I spurted coffee out! Good one!

      --
      Man Needs God Like Birds Need Helicopters
  53. How about "playing god", not "Playing God" by Bowfinger · · Score: 4, Insightful
    FWIW, my comment was taken more literally and more negatively than I intended. Sorry for provoking people.

    I'm not suggesting for a minute that we stop. I am truly in awe of what they have accomplished, and the incredible potential for improving human lives. I thought this was an exciting story, and I am happy for the boys who suffer from this disease. Maybe it's because I'm more of a physical sciences kind of guy, but thought of being able to mainipulate individual human genes, effectively retroactively as I understood this, is just mind-boggling. If we're advanced enough to pull this off, are there any limits to what we can do?

    And that is where the negative side of my comment comes from. What are the limits to what we can do, and (rhetorically) are we up to the responsibilty? The answer is "no" - though the prospects for good are unlimited, some will abuse this technology. It's the inevitable cloud that accompanies the silver lining.

    In my opinion, that's part of the price we pay for advancing. Genetic manipulation seems much like our first steps into atomic power (another subject that provoked fears of "playing God"). It is far more revolutionary than medications or cutting trees or most of the other ways we manipulate our world. These other things can have tremendous cumulative effect due to scale, but their potential individually is fairly narrow and limited. A new drug may heal - or hurt - a few individuals, but it can't change the shape of the human race.

    Genetic manipulation is different. It can literally change the face of humanity. The potential for good is awesome, but it will come with a price. And that's the risk we accept every time we move forward.

    Again, sorry for provoking a religious discussion. My use of "playing God" was only meant as a metaphor for the power and potential of this development.

  54. Re:How did they test this? by spiro_killglance · · Score: 2

    Blood tests!

    White blood cell count.
    And they can also see if the white blood
    celss are efficient is a test tube.

  55. How about AIDS? by xtremex · · Score: 2

    Can this be used to cure Aids as well? I mean, honestly, I've asked myself a couple of times, if I ever got AIDS, why couldnt I have a bubble? Isn't having bubble boy disease similar to AIDS? (no immune system?) I mean, instead of taking drug cocktails, why not live in a bubble?

    --
    If you're not a Liberal in your 20's, then you have no heart.If you're still a Liberal in your 30's you have no brain.
    1. Re:How about AIDS? by Phosphor3k · · Score: 1

      Your own bacterium that help you digest food would eventually eat you.

    2. Re:How about AIDS? by Steve+B · · Score: 4, Informative

      Nope -- see the Straight Dope column answering that question.

      --
      /. If the government wants us to respect the law, it should set a better example.
  56. Other issues by nucal · · Score: 4, Informative
    A few reasons why this worked so well:
    • This form of SCID is due to a total gene deletion - so that gene replacement was feasible. A lot of genetic diseases are due to genes expressing proteins that are mutated, but still produced. These mutant proteins can frequently have a dominant negative effect, that is, they mess up normal copies of the protein or other proteins in the cell. In this case, adding more good copies of the gene in question will not help.
    • Being able to treat stem cells in isolation is a big advantage, since you don't have to target cells in the context of the whole body (needle in haystack problem). In culture, the virus to cell ratio can be really high, increasing the probability of successful infection. Also, stem cells successfully expressing the gene of interest can be selected and preferentially propagated in culture before re-introducing into the patient.
    • Another big advantage in being able to treat isolated cells is that you avoid the potential problem of an immune response to the virus itself. This was a big problem recently with a different class of viruses. In some ways SCID, being an immune deficiency, is the ideal disease for viral gene therapy, since these patients are less likely to react to the virus itself.
  57. Bioweapons by primenerd · · Score: 1

    I assume you are refering to Western Europe or the United States in you weapons argument. There are several international bans on biological weapons (the United States has not engaged in offensive microbiological weapons since the Nixon administration).
    Also I must ask what you mean by "targeted" bioweapons. We do not posess the technology to "target" a weapon beyond the scope of what species it effects (which is usually a trait inherited from the natural stock microbe). It is (and will remain) impossible to target a virus or bacterium to kill one man or nationality.
    I do believe that the reason Sadam Hussein is the enemy of the year is HIS desire to develop bioweapons.
    I could see some dangerous applications to the retroviral method used, but I do not think we need to fear much from killer stem cells being released on an unsuspecting world.
    Lighten up!

    ~primenerd
    Microbiology/ Computer Engineering Undergrad

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    1. Re:Bioweapons by Sean+Clifford · · Score: 2
      First, someone please mod primenerd's post up. He makes excellent points, which I'll address below:

      I assume you are refering to Western Europe or the United States in you weapons argument. There are several international bans on biological weapons...

      I was referring to the United States military, primarily. I was raised in a military family, and played soldier for a while. If something is weaponable it will be used. In the early 80's I was into RC planes in a big way. We had a squadron of planes - mostly junior NCO GIs and brats - and discussed military applications of the technology. I should have wrapped the whole post in <rant></rant> tags. :)

      (the United States has not engaged in offensive microbiological weapons since the Nixon administration)

      Uh, right.

      Also I must ask what you mean by "targeted" bioweapons. We do not posess the technology to "target" a weapon beyond the scope of what species it effects (which is usually a trait inherited from the natural stock microbe). It is (and will remain) impossible to target a virus or bacterium to kill one man or nationality.

      Thanks, I didn't now that. I'm not a microbiologist so I will defer to your expertise. I had assumed that it would eventually be possible to target specific individuals via a DNA fingerprint of some sort.

      Don't get me wrong. I'm all for stem cell research. I'm happy and amazed that Rhys Evans aka "Bubble Boy"was cured. I hope it advances medical science by an order of magnitude on the technology scale.

      However, I do believe that if it's practical to weaponize something, it will be done. Technology in and of itself is neither good, nor bad. Ethics can only be applied to how it is used.

      No doubt, we will do great good with biotech. Hopefully we will avoid any potential catasrophes along the way.

      I do believe that the reason Sadam Hussein is the enemy of the year is HIS desire to develop bioweapons.

      Yes, that and other things. Saddam Hussein is not a warm and fuzzy teddy bear. He's an asshole, but an effective and powerful dictator. He stood up against the United States and a "coalition army" and remains in power. He's well-respected for that - even if he's not loved.

      There were political reasons why we didn't knock him out the last time. We would have pissed off his neighbors who are already massively supsicious and resentful of our military presence where they live.

  58. moo. by primenerd · · Score: 1

    They also believed that people would grow horns and develop cow-like features , another fear was that the pustules would be little cow heads. This fear came from the fact that the smallpox vaccination was derived from the bovine cowpox virus.
    I bet that is Jenner had introduced vaccination a few hundred years earlier he would have been paid a visit by the inquisition.
    Religion and science tend to be destructive to each other. I get nervous whenever one confronts the other.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  59. Re:I understand some technology by CyberDruid · · Score: 1

    I understand how a hammer works.
    1. For destructive purposes you basically bang the flat end into the object that you want to destroy.
    2. For naildriving purposes you position the pointy side of the nail towards where you want it to sink in. Then you hit it with the flat end of the hammer in much the same way as if you were trying to destroy the nails head [see 1].

    --

    Opinions stated are mine and do not reflect those of the Illuminati

  60. We've been playing god for thousands of years by xeeno · · Score: 1

    Every time we cure someone.

  61. Re:Question - OOPS! by bonoboy · · Score: 2

    Yeah, blastocysts have differentiated tissue types. Zygotes are one cell, I believe.

    --
    toeslikefingers.com - because
  62. So god's like neo in the matrix by shomon2 · · Score: 2

    Well technically, manipulating all reality through the power of will alone is a pretty good functional definition of what it means to BE God.

    This is all very simple until things get polytheistic:

    So what about the lesser gods? Like the little ones who make the bus come in time and protect rivers etc? I thought you could define god as anything that's not actually human ( or !cowboyneal)).

    Also, "creative gods" doesn't mean they also own everything they created. So I'm not proprietary humanware and I'm recursively able to create and play too, thank you very much. Regardless of who created me.

    Then again, if it was greek gods, I'm sure you'd get loads of bitching about who created who, and some crap about zeus laying claim to all the other guys and creating proprietary viral licensing etc. Next thing you know that other guy would start firing his lighning bolts and chaos ensues. What a bore. That's what you get from gods who sit around together all the time. Bit like big brother the other way round.

    Better to have gods who are a little more isolated but more independant and with a little more space to work in. Maybe there's a god of only science, and scientific exploration, enemy but mostly tolerant of the god who protects spiritual hippy dippy shit. Even Linus and open source are seen as god and religion respectively by some. One god. That's monopoly.

    Ale

  63. Offtopic?! by invid · · Score: 1

    How could this be moderated "Offtopic"? It's a joke about the topic. The topic is about a bubble boy leaving his bubble. The joke is about a bubble boy leaving his bubble. Ontopic.

    --
    The Moore-Murphy Law: The number of things that will go wrong will double every 2 years.
  64. Van Gogh by paranoid.android · · Score: 1

    Considering the 'spark,' as you call it, for the original Van Gogh was in all likelihood paranoid schizophrenia, I'd think it a good thing, were it deleted. That's nothing my child, nor any child for that matter, should have to suffer through, even if the possible result is that some great artistic talent is diminished. I'd happily trade the possibility for a bunch of pretty pictures for a child with a healthy mental state, but that's just me.

  65. Re:Disturbing? Perhaps... by Zzootnik · · Score: 1

    So Yes. It's quite Disturbing. After All we're seeing what is quite possibly our future.

    What would a Neanderthal think of us?

    That's right...For all intensive purposes, we have made the Force of Evolution null and void with respect to Human Beings. (Darwin award nominees excepted, of course...) Our real growth is coming in our heads- and that growth is feeding back into our bodies. It's quite self-deterministic if you think about it applied to the species, but then the Traditional 'Evolution' concepts are that way somewhat as well. It's simply that this version seems to be consciously directed by a certain segment of society (the scientists and those funding them- Scary, eh?).

    I'm thinking that instead of having a corporation pay someone to change their name to NIKE (has already been done-really!), that people will be paid to have the nike logo melanin'd into their new child's scalp or face or arm or what-not...
    ...But then again- that's a disturbing thought all it's own...

    THe potential good is still there, but potential is all it is. We have to be able to get together as a species and use it for good...

    ...to which I say "Pfft! Right! Like that'll happen anytime soon..."

    At any rate, it's this, or stagnation, people. We can't go backwards (cause that'd just suck...). Unless someone wants to find a side track off the Evolutionary ladder?

    --
    Sig currently under construction. Mind the gap....
  66. Exactly the opposite by drew_kime · · Score: 2

    Let's assume we believe in the existence of a supreme being in the Western Judeo-Christian tradition. What is His nature? To create the world and set the rules by which it functions, and then leave its inhabitants to exercise their free will within it.

    And what is the nature of man? To strive to understand the rules by which nature works, and do everything in his power to exploit those rules to his own ends.

    In short, it is the very nature of God to allow events to happen without his direct intervention. It is the very nature of man to attempt to control events.

    "Playing God" would be letting someone die even though we can save him.

    --
    Nope, no sig
  67. MODERATORS, HELLOOOO??!! by Sapphon · · Score: 1

    Offtopic, wtf? Invid summs it up, how the hell was my post offtopic? Sure, it may not have been deserving of 'Funny', but it damn well isn't deserving of an 'Offtopic'
    Now with my luck the same bonehead will come back and moderate this post as Offtopic or flamebait or something, jeez.

    Read the guidelines, and go find a comment that's worth modding UP, not something you mod down just 'cause it doesn't have you rolling on the floor with hysterics.

    --
    Antiquis temporibus, nati tibi similes in rupibus ventosissimis exponebantur ad necem.
  68. Survival of the Weakest by ari_j · · Score: 2, Insightful

    As in favor as I am of stem cell and other genetic research and, more importantly, applications being found for the results of that research, curing a disease that causes such a massive immune system failure has to be done at the source: it's a genetic thing, as far as I know, so we have to let these people die. Keeping them around may be humanitarian. Curing their disease may make living worthwhile and hopefully can let them contribute to society. Letting them reproduce, however, will weaken our gene pool; and now that they can come out of their bubbles, they'll be reproducing even more. Just like cancer cells in an otherwise healthy body: the unwanted units become more and more pervasive and harder to contain or remove.

  69. Re:Question - OOPS! by JimMcCusker · · Score: 1

    Blastocysts do not have differentiated tissue types. It's hard to differentiate when there's only 8 cells or so. Later in the blastocystic stage there is some differentiation, but that's just the placenta forming (it's more a locational differentiation at this stage than an anatomical or physitiological one though).

  70. Peggy Noonan article. by kannen · · Score: 2
    On March 8, Peggy Noonan had a particularly wonderful article in the Opinion Journal. Within that article, she had these things to say:
    I am experiencing a change of temperament, if that is the word. I have mostly gone through life as a short-term pessimist and a long-term optimist, but now I find, and perhaps it's only temporary, that I am increasingly a short-term optimist and a long-term pessimist. That's not quite right. I am certain there is a heaven, which is not a pessimistic belief. But my long-term thoughts about the world are not as sunny as once they were.

    And yet I am happy each day and enjoy my life.

    While I am worried about the future in a way I cannot shake.

    ...

    The friend who had e'd me followed up with news that the Chinese are creating dozens of cloned embryos in their labs. The British medical journal New Scientist has reported a Chinese team "based at Shanghai No. 2 Medical University" says it has "derived stem cells from hybrid embryos composed of human cells and rabbit eggs." The journal said scientists throughout the world fear similar research in the US and UK has been "bogged down" by "ethical concerns."

    Ah, those pesky ethical concerns. They slow you up just when you could be creating in a Petri dish the recipe for Rabbit Man. And then of course you could grow him, bring him into being, for all but dunces know that what man can do he will do(*). And then perhaps once you've grown him you can have Rabbit Man for dinner.

    (* - My emphasis, not original)

    I certainly don't think that this is the step that is going to break the camel's back. Clearly, this is an awesome and great and GOOD achievement. And we will do great things in this fashion. But research like this requires great responsibility, and not everyone will understand that.
  71. Right there with you! by BLKMGK · · Score: 2

    Michael J. is a perfect example. He's a perfect example IMO, this was a good guy struck down by a disease that many of us know little about. To watch him fight this is truly heart breaking and at the same time inspiring. I don't know your grandmother but I'm sure there are many others out there just like her and if we can find a way to prevent or cure diseases like that I think we should try. No one I know wants to end up invalid in a bed struck down by something like this - I'd rather die quickly. My grandfather is slowly slipping, not a particular disease just old age has taken it's toll. It breaks my heart and that of my family to watch it. This man was a rocket scientist, literally, who helped get the Posiden (sp?) missle program going and who did lots of engineering things during WWII. To watch him lose his mind is awfull.

    Those who would cry out against helping people like these kids should try one of hese diseases on for size themselves. I fully understand that such research could also lead to destructive things but not trying to help could be nearly as bad. We simply have to hope that people use common sense and proceed slowly. Unfortunatly I think common sense is in shorter and shorter supply these days (sigh)....

    --
    Build it, Drive it, Improve it! Hybridz.org
  72. Those who are against it, obviously don't know by Ranma · · Score: 1

    I have asthma, I've had asthma all of my life. I have to take a pill in the morning, and an inhaler around when I have attacks. I will have this for the rest of my life, and most probably will get worse. How the hell are a bunch of religious morons going to tell me that this is what god wanted for me? I sure as helld on't want it.

  73. Genetic degradation by 5n3ak3rp1mp · · Score: 1

    Perhaps we can't get away from this "playing God" business, but did it occur to anyone that fixing "nature's mistakes" before nature takes its pre-genetic-understanding course, might result in a degraded human genome? 200 years from now when we've figured out how to cure most common genetic diseases with gene therapy, will it also be very common for babies to be born needing this very same therapy in order to survive?

  74. clarification by kalyptein · · Score: 1

    Saw someone posting about the normally transient effects of gene therapy. This has certainly been an issue in the past. There's a cystic fibrosis treatment that uses an inhaler loaded with adenovirus (your basic 'cold') to add the gene to lung cells. Adenoviruses do not incorporate into the host DNA, so eventually the new gene is lost, takes a few months I believe.

    Retroviruses, as used in this case, *do* incorporate into the host's DNA, so they can potentially be permanent changes. I say potentially, because the host can sometimes shut down or jettison it. If it couldn't, my current research project would be showing much better results.

    The problem with any kind of gene therapy is to affect *all* of the target cells, and *only* the target cells. So far this has been pretty much impossible. What makes this case interesting, it that the doctors took the kid's own genetically-defective bone marrow cells and replaced the gene. Since this was done outside the body, they could select from culture only a healthy, properly working cell. Its not stated, but I assume they then irradiated him to destroy his bone marrow, and then let the altered cells repopulate.

    As the article says, this disease can be cured with the help of a donor. The cleverness here is using gene therapy to turn the patient into his own donor. Pretty slick, IMHO.

    --
    Entropy gets everyone.
    1. Re:clarification by praksys · · Score: 1

      I'm not a biologist, but I can think of a reason why this case might have been unusually successful. Presumably when the body rejects alien DNA it is some part of the immune system that does the work.

      If the DNA mods were applied to the cells which are responsible for the immune system, then rejection seems less likely.

  75. Sorry, but the thing is... by EggplantMan · · Score: 1

    By not speaking out in opposition you are spoken for by the more vocal factions.

    --

    ?-|||-----x<*))))><
  76. Re:I understand some technology by Macrobat · · Score: 1
    How was that hammer made? Specifically, what metal is the head, what kind of wood/metal/whatever is the handle made of, how were these things gathered and assembled and mass-produced?

    You see, you know part of how a hammer works. But not the whole story. Certainly (well, probably) not enough to make one yourself. And building a hammer factory and mining the ore have pronounced effects on the economy and environment, in ways that nobody fully understands. That's what I'm getting at.

    --
    "Hardly used" will not fetch you a better price for your brain.
  77. Re:Playing God? redundant by Boronx · · Score: 2, Funny
    Yeah well, god is a lazy bum.. about time somebody replaced him.

    Someone mod this +1 Inciteful

    Amen.

  78. Re:huh? by oldays · · Score: 1
    It's from a seinfeld episode. George argues with a bubble boy about a trivia question about Moors. They fight, and hilarious complications ensue.

    You're seinfeld impaired, arentcha?

  79. Zygotes by shobadobs · · Score: 1

    Zygotes are also the balls of cells that form shortly after that one cell starts to divide numerous times.

  80. Moors! by Hoi+Polloi · · Score: 1

    As he was going to the hospital you could hear this argument:

    "Moops!"
    "Moors you idiot!"
    "Moops!"
    "Its Moors!"
    "Sorry, the card clearly says 'Moops'"

    --
    It is by the juice of the coffee bean that thoughts acquire speed, the teeth acquire stains. The stains become a warning
  81. Re:Disturbing? Perhaps... by Squalish · · Score: 1

    Agreed. Disturbing. Nitpick: Nike Logo melanined in? It's called Tattooing, and it has existed for hundreds of years. Another thing: Evolution has the unique ability to never be rendered null and void as long as life remains. It will merely not function in the traditional way. Suppose, for example, that there is a trailor-trash gene(actually, its much more likely just a self-propagating social meme, but just supposing). People who have it tend to be trailor trash and have more children than usual while having less ability to hold a job. This phenotype(genetic trait) will gain a bigger and bigger percentage of the world population. What I am saying, in my strange, uber-complicated way of saying it, is that as long as procreation happens, evolution will continue. Evolution is the circumstances leading up to child-production combined with the child's circumstances of reaching mating age.

    --
    People in Soviet Russia, however, appear to be afflicted with amusing juxtapositions of the aforementioned situation
  82. Damn by Squalish · · Score: 1

    This is one of the first times I have ever seen gene therapy actually HELPING anyone. People would talk and talk about it, that one day it would cure any disease they could think of as long as they got research grants, that it would save the world. Then there were the people that criticized it for being too creepy(among other things, but "being too creepy" is usually the best argument). It became an Issue - are you For or Against it? This is amazing in and of itself not just that it was a "suprising new implication of gene therapy research" or something as pointless as ordering one human genome without any identification(its something like SETI's white noise without any pattern recognition).It actually, finally, for one of the first times, helped someone.Damn. The future: not the one with flying cars and a robot house-servant imagined in countless baby boomer daydreams;not the one available on the sci-fi channelnot the one vaguely thought of as what has to come next in the worldnot the Next Big Thing But the future shouted from the rooftops of countless research institutions at the parade of forward-thinking VentureCaps,The one told to the CEO of the medicine companies by mindless consultants looking for a buckThe one forever promised by the marketting departments of companies that don't really need marketting departments, because they don't sell anything.The one where if someone is sick, they can be cured.The one where we have the technologyWhere We have the resourcesWe can remake PEOPLE Better... Stronger... and Faster... This is one of the first tangible results of an industry that has based itself around promises of results sometime in the next 50 years... The future is now, people.

    --
    People in Soviet Russia, however, appear to be afflicted with amusing juxtapositions of the aforementioned situation
  83. What IS disturbing.... by Boffin1 · · Score: 1

    The genetic engineering methods used here aren't new. Retroviruses have been around longer than humans have, and we all have copies of DNA in our genome which is thought to have been introduced by retroviruses. The scientists involved here are to be congratulated for using a potentially damaging phenomenon to allow someone to live a normal, healthy life. As an immunologist, I am blown away by the fact that these guys have managed to recreate an entire immune system from scratch for this kid. Furthernore, only the immune system cells within this kid have the altered genome, thus it isn't going to be passed on to his offspring - this is sure to calm some of the alarmists out there that worry about Nazism and teleogy becoming more popular through scientific progress. This technique has the potential to wipe out the majority of immune system disorders in the world today, from autoimmune diseases like Multiple Sclerosis and Lupus to immunodeficiency disorders such as AIDS, and even some forms of diabetes. I hope everyone that reads this article realises how huge this really is. Finally I'd like to say to all those people that have the urge to bash such scientific advances - put yourself in the shoes of someone who is suffering one of the diseases that this and other controversial fields of science can one day cure (perhaps sooner than you think). The fear and loathing of this kind of advancement is a direct result of ignorance, and the further away from such issues people are, the more idealistic and judgemental they become. I doubt whether the parents of this boy give a damn where the stem cells came from or how they were altered before they cured their son.

    1. Re:What IS disturbing.... by Jouster · · Score: 1

      Okay, wow, people, calm down. I am not advocating, by any means, that we stop research into this field, nor am I suggesting that this child being cured is a bad thing. I am trying to point out that, just like any other major scientific advance, this has the potential to injure a great many of us. With that in mind, I am reminding us all to watch out for ways in which that could come to pass, and to move to prevent them when you see them. In the meantime, this is a wonderful and fruitful area of study that I sincerely hope is not stifled, and I apologize if, in reminding people of their duty to maintain the ethics of humanity, I came across as being in opposition, instead.

      Jouster

  84. Tooo Bad by mrnick · · Score: 1

    Tooo bad it was too late for John Travolta! *lol*

    --

    Encryption: I may not agree with what you say, but I will defend your right to encrypt it...
  85. Wouldn't that defeat the purpose here? by CptNerd · · Score: 1

    Let's see, the kid had no immune system, so we cure it by using stem cells from some embryo, which means he has to take anti-rejection drugs to keep him from destroying the new cells, which only work because he has no immune system, but the anti-rejection drugs stop his new immune system from working....

    Or worse, his new immune system doesn't recognize *his* cells, since they don't match the cells from the embryo...

    --
    By the taping of my glasses, something geeky this way passes
  86. Re:huh? by oldays · · Score: 1
    I think it's the funniest show I ever saw, by far. Some episodes are sub-par, though, especially some of the old ones, where actors didn't hit the right wavelength yet. But i guess you have to take the good with the bad.

    The best thing about Seinfeld is that there's 3 stellar actors.. well, okay, Kramer isn't stellar but he gets by on quirkiness. At any rate, I don't know any other sitcom that'd have even one actor as good as George or Elaine. They save the average material and make it great, and they make great material brilliant.