Gene Therapy Cures "Bubble Boy"
bofh31337 writes "NewScientist is reporting that Welsh boy Rhys Evans has been cured of the fatal severe combined immunodeficiency ("bubble boy") disease. The medical team, lead by Adrian Thrasher, was able to take the stem cells that give rise to immune cells from his bone marrow and add a normal copy of the gene to the stem cell using a retro virus. Seven months after treatment, Rhys was cured."
gene therapy could cure my first post habit.
I am a Computer Information Systems Professional at a major Fortune 500 corporation. Very recently the head of our IT department decided that we were going to switch every one of our networks over to Windows XP Professional. We had previously been running OpenBSD on all our quad processor Xeons. Some of them had had uptimes approaching a year! My personal favourite, Gerbil, had been running without a reboot for three years.
One day one of those Microsoft shills that you often read about on the Register came by for a visit. I grew very suspicious about what was going on when my boss and the Microsoft representative walked by my desk, and entered the server room. I could hear muffled voices through the closed door. The Microsoft representative was asking what we were running on our servers! My worst fears had come true. I sat at my desk for the rest of the day, silently awaiting the bad news. The news did not come until the next day. It was worse than I had feared. We were to be a Microsoft only shop from that day on! I could not believe it. The Microsoft representative had told my boss that the operating and support costs would actually go down. And my boss had fully bought into it, hook, line, and sinker.
Tough times hit our company in the last month, and we were forced to lay off a few of the less experienced IS/IT workers. One of them took this rather hard. As a last minute attempt at corporate sabotage, he decided to change all of the Computer Administrator passwords on a few of the XP Professional boxes sitting around in the server room. This caused absolute havoc, as Dell had failed to send along administrator passwords for the new boxes. Our company could not make use of these computers for three days. It took Dell that long to get us the administrator passwords. It is strictly because of Microsoft's poor implementation of a multi-user computing environment that our company lost three days of productivity.
Needless to say, I had our quad Xeons back running OpenBSD by the end of the week. Gerbil is back on its way to another glorious 3 years of uptime.
Science blows my mind. Too bad theres bad stuff that happens as well as good
Tim Smith - Ramblings from Nerd Land
fisrt PoSt
Take that!
first post!
.
I don't like the word "cured"...there's something final, fatalistic about it. can't we say, "his condition seems to have permanently improved"? is this just me?
there is an extra "normal" in the story heading. Pretty cool news btw.
I thought he was cured by scientology!
VISA's cure for celebrity shoplifters...
tcd004
Now can they just make me seven feet tall so I can play pro basketball?
Heroscape, it's like legos combined with anachronistic wargames.
Gene therapy has cured Welsh baby Rhys Evans of the fatal "bubble boy" disease. "His progress seems nothing short of a miracle," says his mother Marie. Another boy treated more recently continues to improve. The treatment, carried out at London's Great Ormond Street Hospital, is one of only a handful of successful gene therapy trials in people. It is also only the third trial of gene therapy for severe combined immunodeficiency or SCID. Alain Fischer's team at the Necker Hospital in Paris reported the first-ever treatment in 2000, of two boys, while an Italian-Israeli team recently reported promising initial results with two people who have another form of the disease. Nine people in total have had gene therapy at the Necker Hospital, and seven of them are doing well. But the researchers at Great Ormond Street think they have developed a better way of delivering the gene to correct the fault that causes the disease. Solitary confinement The type of SCID that the Welsh baby had is "X-linked", caused by a fault in a gene on the X chromosome that makes an immune protein called interleukin-2. The disease affects boys because they only have one X chromosome. The faulty gene stops the development of T cells, a key part of the immune system. Children must be kept in isolation to protect them from catching infections and usually die young. A bone marrow transplant can cure the disease, but suitable donors are only found in a third of cases. To treat the boys, the Great Ormond Street team took the stem cells that give rise to immune cells from the two boys' bone marrow. Then they used a modified form of a retrovirus found in gibbons to add a normal copy of the faulty gene to the stem cells. The virus has altered spikes on its surface which may mean it binds better to stem cells and transfers the gene to them more efficiently, team leader Adrian Thrasher told New Scientist. The engineered stem cells were then returned to the boys' bodies. Rhys Evans is now back at home, with normal T cell levels, seven months after treatment. The second child, treated just three months ago, continues to improve at home. The Great Ormond Street researchers say they are planning to treat another four boys over the next two years.
Im really happy that they were able to cure "bubble boy". hopefully this means that other oppritunities to cure people with "Gene Therapy"
Avoid The Rush, Start Thinking NOW!
--
Any Spelling Or Gramatical Errors In This Post Are There On Purpose.
Sadly there is no cure for the people who got sick after seeing the movie "Bubble Boy"
http://www.kubuntu.org/
It's too bad they couldn't cure the guy before that god awful movie was made.
...science can answer the Moors/Moops riddle which has plauged mankind since the dark ages!
The potential power of stem cell research is clearly evident in this case. My question, not to troll, is whether this type of research could have been possible/allowed in the US. AFAIK, the laws in the states allow a restrictive amount of stem cell research -- would this have been enough for similar treatment here?
I guess that John Travolta will not be appearing in a sequel...
The Guardian, and Yahoo
My other sig is also a
Paul Simon has announced a full recall of his "Graceland" CD...
Cache Rules Everything Around Me
Truly awesome.
Indeed this is good news however genetic manipulation is not something to be taken lightly. While at the moment this child has been cured what are the side effects of such a treatment later in life? What is to say that this won't spawn some new disease that affects the rest of use.
I fear the use of technology that we do not understand.
Apologies if I sound alarmist.
That was a rather heart-warming tale, as I'm an OpenBSD user myself. However, I must take issue with one statement:
We had previously been running OpenBSD on all our quad processor Xeons.
I wasn't aware that OpenBSD had gained SMP functionality. In fact, I'm quite certain it has not. Much to the dismay of myself and others mind you.
So may I ask, is this some sort of "anti-troll"?
Remember: umount it before you fsck it.
Well, so then, if the stem cells are placed next to a Shakey's Pizza, they would become another Shakey's Pizza! And you'd have your own Shakey's Pizza where you didn't have to charge yourself to eat!
all your genes r belong to us.
www.nih.gov/news/stemcell/index.htm has the latest information about what's taking place in the U.S. in regards to stem cell research. It's a great resource for anyone wanting to learn more about this amazing new science.
What an incredible first large-scale public step in gene therapy!
Hopefully this will only be the first of many such successes.
if only they could cure that itch right between my shoulder blades that I can never seem to reach...
"You worthless post!"
-Shakespeare, 2 Gentlemen of Verona, 1. 1. 147
So the "bubble boy" is cured. How do you test something like this? Have someone cough on him?
I remeber studing about viruses, and how they attack, but I'm not familiar with retro viruses. Could they affect other parts of the body, or how do they make them only able to attack the damaged cells? Thanks for the responses.
'scuse my ignorance but the article describes 'adding an extra copy of the faulty gene to the stem cells'. Isn't this going to make the little chap XXY? Doesn't that have uh some other unpleasant side effects?
Ahhhh, or is the retrovirus attacking the original X to add another copy of the specific gene. That makes sense. Boy I hope they haven't dragged anything else in with that extra gene...
Miss Kittin & The Hacker
80s revival? Kittin, armed with loads of irony and a deadpan that would turn Peter Sellers green, skewers the self-absorption, soulless vanity, hyperconsumption and celebrity obsession of the Me decade. Miss Kittin They say there's an Eighties revival on. If that turns out to be more than a media-contrived mirage, I'd like to congratulate Miss Kittin for pretty much raining on everyone's parade. Because, while Mods in skinny ties gyrate to revival New Wave and dance floors bump to faux-cheese House homage, Kittin's dry husk vocals show off a side of Eighties culture that a lot of these closet Renaissance Fair kids would rather ignore. Kittin, armed with loads of irony and a deadpan that would turn Peter Sellers green, skewers the self-absorption, soulless vanity, hyperconsumption and celebrity obsession of the Me decade.
"Kittin now delivers two very different albums, with two different production partners." Having appeared on one of the flagship bits of the supposed revival, Felix Da Housecat's Kittenz and Thee Glitz, Kittin now delivers two very different albums, with two different production partners. On both albums, the music is notable mostly for its synths-and-drum-machines simplicity, though each producer has his own take on their synth-pop inspirations. Kittin's contributions are what make them both truly worthwhile, reflecting smartly on both the music and the time that spawned it.
At one end of her personality is First Album, in collaboration with programmer The Hacker. The cover's murderous vignette neatly sums up the bleak, gothic tone within. The pulsating beats are mechanical and cold, less likely to be mistaken for Yello than Bauhaus. Tracks like "1982" and "Frank Sinatra" are hilariously cynical, chronicling glamorous nights on the town without a hint of zest or passion. "To be famous is so nice. Suck my dick, kiss my ass," she demands on "Sinatra," obviously getting nothing from the demand of subservience or the acts themselves. Here, Miss Kittin plays the ultimate art-damage casualty, a jet-set corpse droning through life one martini at a time. First Album, while not uniformly dark, is definitely not "dance."
Producer Golden Boy, on the other hand, has populated or with glammy, melodic, often energetic beats. Even here Kittin is too cool for school, a snide bitch smoking Carelias in a corner booth and making fun of all the little people out on the dancefloor looking silly. Everyone hates her, but her running commentary is sharp: "What do you think of this track? Here comes another break..." But then again, the propulsive, pretty "Rippin Kittin" showcases both Kittin's genuine singing ability and the provocative question: "Mommy, can I go out and kill tonight?" First Album may be better as a whole, but this song is the only moment when irony most convincingly cedes to art, when both Kittin's icy detachment and the mechanical music she shields herself with mingle in the perfect balance of self-conscious critique and genuine enjoyment.
Best Miss Kittin quote, "Suck my Dick, lick my ass."
Death to Celine Dion, I wish Ovarian cancer upon her. Death to those who destroy the sanctity that is OUT computer.
Islam is Death, Death to Islam.
Great, now that the bubble boy is cured, maybe we can get that whole Moops/Moors things figured out.
Jesus used to be my co-pilot, but we crashed in the mountains and I had to eat him.
So do we understand the retro-virus or not?
I wish I knew more about this kind of biology. On one hand there's this stupid virus called HIV which is killing millions, has a few slightly varying strains and despite probably billions of dollars refuses to goddam die.
Then on the other hand somebody has managed to genetically engineer a retrovirus that is capable of DNA splicing in a fantastically accurate fashion and can cure many inherited diseases.
So, for the bio peeps out there, how?, why?
is there really a Dr. Thrasher? I thought he only existed in 80's skateboard movies.
four-oh-four
Now I've seen it all! Moops!
Appended to the end of comments I post? 120 chars?!
The biggest problem with gene therapy is that long term expression of the target gene has been difficult to achieve. The inserted sequence, depending on the gene carrier, may or may not be inserted in to host genome. Actual insertion into the host genome is undesirable because of possible malignant transformation (insertion of the target sequence disrupts the function of a tumor supressor protein, or turns on a pro-tumor protein, etc.). Existing as a genetic sequence outside of the genome proper has also failed to achieve more than temporary expression of the desired protein.
This article describes a technique to increase the effiency of the transfer of a therapeutic gene sequence into a target cell. It does nothing to address the biggest stumbling block of gene therapy. While this is sexycool news, being cured for 3 or 7 months doesn't mean being cured for life.
Claimer: IAAMD
I don't mean to be a downer. We're just a loooong way off from real gene therapy.
Fermat's other theorem: "I have a simple proof, but I can't write it down as I fear it's a DMCA violation to discuss it"
A stem cell is cell that can turn into different type of cells. There are many type of stem cells, and the controversy in the US is only over human embryonic stem cells. These cells can only be obtained by destroying what many consider a human life.
Stem cells in adult bone marrow can turn into many types of blood cells. From the article, it sounds like the stem cells used came from the patients' own bone marrow so human embryos probably weren't used. The article doesn't say where the normal copy of the gene came from, but I doubt it would need to come from a human embryo.
If I get it right, then... uhm. I don't get it.
It says MOOPS!... I'll kill you!
groups in the US and elsewhere (everywhere?_!) that want to outlaw this kind of technology. Ackthptht! Voter Inertia....
Think about it: No rejection transplants, grown on demand, no immune system issues, and the technology to keep one alive for the required period is already here (sustains some patients for literally years while they wait for new kidneys or hearts)
Sure, it can be abused. Name me one - ONE - technology of any kind that can't be abused or turned to evil means. Come, you know you can...
Shadowbearer
"It's Just a World, It's Not Heavy" - Atlas
It's old. The more humans I meet, the more I like my cats. At least they are honest.
Also, curing a fatal disorder is not taking something lightly. Although the "it might spawn some other disease" argument is compelling for emotional reasons, it's really an out-of-left-field consideration. You can say with equal certainty (i.e., little to none) that this achievement might also serendipitously lead to a plethora of other cures and treatments that might have otherwise eluded us. Then we'd be guilty of standing still when we could have done something.
"Hardly used" will not fetch you a better price for your brain.
Every year he could pull the bubble out of the back of the closet and go trick-or-treating as a bubble boy.
Bill Clinton: Pimp we can believe in. - The Shirt!!!
You beat me to it!
Okay, I'm happy for The Bubble Boy, and everything...but I was really hoping to get some good PR by playing cards with him someday.
I was even going to let him win.
Dammit.
NIGGER
I think the solution to your fear is to become an atheist =)
I mean, serously, if science brings us to the point where it's commonplace to "play God" then what's the point of worshipping a diety? Science already saves lives, improves the quality of life of billions, and enables us to control our own destinies. What's worshipping a god going to give you? Where has it gotten us in the past?
Mohandas Karamchand Gandhi said, "God has no religion." If we're our own gods, then we should just give up on religion and believe in ourselves. If we can do that, you have nothing to fear.
-Riskable
"Those who choose proprietary software will pay for their decision!"
By the way, GOSH (Great Ormond Street Hospital) owns a perpetual copyright on James M. Barrie's Peter Pan works. No, it's not a 95-year copyright or a life+70 copyright. It's a perpetual copyright, recognized by the Berne treaty. (Read More...) When Disney brings Peter Pan II to Region 2 (where European copyrights are more strictly enforced), GOSH is going to make a wad of dough on royalties, giving Disney a taste of its own medicine.
(posted without bonus because it's only tangential to the article)
Will I retire or break 10K?
Retroviruses are being investigated for 3 reasons:
1) They can be used as vectors to transport genetic information into a host cell.
2) Reverse transcriptase can be used to isolate DNA sequences from a mRNA chain so that the gene can be manipulated through bioengineering techniques.
3) To find a way to genetically engineer a cure for AIDS. If the action of reverse transcriptase can be halted somehow, the HIV virus will have no way to spread its harm through the body and millions of lives could be saved.
more info
ROTFLMAO i live in mason city, iowa. come get me.
-----
so i says to mable, i says
.sraey owt txen eht revo syob ruof rehtona taert ot gninnalp era yeht yas srehcraeser teertS dnomrO taerG ehT .emoh ta evorpmi ot seunitnoc ,oga shtnom eerht
tsuj detaert ,dlihc dnoces ehT .tnemtaert retfa shtnom neves ,slevel llec T lamron htiw ,emoh ta kcab won si snavE syhR .seidob 'syob
eht ot denruter neht erew sllec mets dereenigne ehT .tsitneicS
weN dlot rehsarhT nairdA redael maet ,yltneiciffe erom meht ot eneg eht srefsnart dna sllec mets ot retteb sdnib ti naem yam hcihw
ecafrus sti no sekips deretla sah suriv ehT .sllec mets eht ot eneg
ytluaf eht fo ypoc lamron a dda ot snobbig ni dnuof surivorter a fo mrof deifidom a desu yeht nehT .worram enob 'syob owt eht morf
sllec enummi ot esir evig taht sllec mets eht koot maet teertS dnomrO
taerG eht ,syob eht taert oT .sesac fo driht a ni dnuof ylno era sronod elbatius tub ,esaesid eht eruc nac tnalpsnart worram enob
A .gnuoy eid yllausu dna snoitcefni gnihctac morf meht tcetorp
ot noitalosi ni tpek eb tsum nerdlihC .metsys enummi eht fo trap yek a ,sllec T fo tnempoleved eht spots eneg ytluaf ehT .emosomorhc
X eno evah ylno yeht esuaceb syob stceffa esaesid
ehT .2-nikuelretni dellac nietorp enummi na sekam taht emosomorhc X eht no eneg a ni tluaf a yb desuac ,"deknil-X" si dah ybab hsleW
eht taht DICS fo epyt ehT tnemenifnoc yratiloS .esaesid eht sesuac
taht tluaf eht tcerroc ot eneg eht gnireviled fo yaw retteb a depoleved evah yeht kniht teertS dnomrO taerG ta srehcraeser eht tuB .llew gniod era meht fo neves dna ,latipsoH rekceN eht ta ypareht
eneg dah evah latot ni elpoep eniN .esaesid eht fo mrof rehtona evah ohw elpoep owt htiw stluser laitini gnisimorp detroper yltnecer
maet ilearsI-nailatI na elihw ,syob owt fo ,0002 ni tnemtaert
reve-tsrif eht detroper siraP ni latipsoH rekceN eht ta maet s'rehcsiF nialA .DICS ro ycneicifedonummi denibmoc ereves rof ypareht
eneg fo lairt driht eht ylno osla si tI .elpoep ni slairt ypareht eneg
lufsseccus fo lufdnah a ylno fo eno si ,latipsoH teertS dnomrO taerG s'nodnoL ta tuo deirrac ,tnemtaert ehT .evorpmi ot seunitnoc
yltnecer erom detaert yob rehtonA .eiraM rehtom sih
syas ",elcarim a fo trohs gnihton smees ssergorp siH" .esaesid "yob elbbub" lataf eht fo snavE syhR ybab hsleW deruc sah ypareht eneG
"It was penguin lust...at its worst." --someone
We are also playing God when we see the pain and suffering already present in our fellow humans' bodies or in the world at large but decide it's not worth it to take any risks or try something new.
"Hardly used" will not fetch you a better price for your brain.
...the plot for the latest "Spiderman" movie.
Perhaps when Rhys reaches puberty he will suddenly develop super powers which will enable him to swing from tree to tree like a gibbon. "Bubble Boy" becomes "Monkey Man".
That would be cool (as long as he only uses his powers for good)
I don't remembering God *having* a biotech lab, or at least it wasn't mentioned in any bible *I'VE* ever heard of... (Though, perhaps it's in $cientology's secret documents)
UNTIL we can manipulate ALL REALITY with only the power of WILL, we will NOT be be coming anywhere close to "playing god".
"Your superior intellect is no match for our puny weapons!"
Everything you do is playing God. Nothing is natural. You can't eat, you can't take medicine, you can't walk, without "playing God" in some way. It's nothing to be terrified of. It's what we are as humans. If you believe the Christian faith, this is the same thing they've been saying the whole time. We are made in "God's image" and everything we do is a small scale mimic of him.
Relax.
I decided to rebuild my RedHat box, because it got fucked up due to a bunch of mail issues revolving around a package called omail. I posted a question here asking if anyone ever used it, because I figured someone here would have. No answers, but I'm not surprised, because there are much better webmail optins for qmail - this one was just attractive because it didn't require POP or IMAP. Anyway, by the time I got done trying to make the fucker work, I was at the point where it was easier to back shit up and rebuild my box than to back out all the changes I had made.
.iso files from their FTP. I validated their checksums and they were good. Then, I burnt the CDs using Easy CD Creator, had no problems, and began the install. Eveything went fine with disc one. I put the second CD in when prompted, and everthing went fine. For a while.
/. h4x0rs poring through every line of source code and bug fixing!
Now the fun starts. I went to Red Hat and got the latest
The, I got an error. xpdf-0.92-5.i386.rpm could not be installed.
[quote]This is due to either bad install media, a missing file, or a corrupt file[/quote]
Ok, I can skip installing this, it is just a PDF viewer, so who cares? Well, my only option was [quote]Press to try again[/quote].
Hmm. Ok, I will try it again. . Nope, same thing. OK, I will just replace this CD with one that has the file burned in the appropriate path. Well, that doesn't work either. After all, there is no option. Nor is there an option so i could stick a paper clip in the little hole and have it eject. Also, I can't even skip that file and worry about it later. So, now I am rebuilding my install and trying to skip the xpdf install. However, going through every option I was going though before, xpdf wasn't ebing installed.
Open source software is certainly top quality! I don't know what I would do without those ub3rl33t
While I'm downloading disc two again, I decided to fuck around with that CD: Cygwin on a Win2k box could read the file fine. Fuck Linux.
Now he can kick George Castanza's arse.
-----
Help me give away a USD$500,000 Beer Store!
Wax on, wax off baby!
And how is genetic engineering (or, at least, the type described in the article) disturbing? It almost certainly saved this baby's life, and prevented him from suffering a short, isolated existence in a plastic bubble, not to mention the psychological trauma of an accidental viewing of this piece of dreck.
it sounds like the stem cells used in this case were taken from the boys' own bone marrow. the objections raised in the US are from embryonic stem cells.
/that./
with modern technology, all stem cells taken from adults can only differentiate into certain types of cells ("pluripotent"). this may change as we work some basic science out. they only need immune cells, so they could settle for precursors to that particular cell line (e.g. they don't need to grow a new pancreas for him)
fetal, or embryonic, stem cells are totipotent and have the ability to become any cell in the body. boy would scientists like to know more about how to do
I don't think that anyone can deny anymore that soon we will have a great amount of potential control over genetics. The real issue in that field has shifted over from obtaining data to data analysis; and as computers and software improve that will get easier.
I will not enter here the argument about whether it should be or not. It's irrelevant anyway, barring a global economic crash of vast proportions. The technical ability is going to come. Live with it.
I always thought that Varley's "Steel Beach" novel was an excellent treatment of that particular sort of social fork disease...
Shadow'ed
It's old. The more humans I meet, the more I like my cats. At least they are honest.
This gives a great example of the safer of the two types of gene engineering, somatic. This type of gene therapy only modifies the genetic makeup of certain cells in the body. None of the effects of the changes could propogate onto his children. I wish we could see more of this type of gene therapy.
The other type, germline, alters genes in gametes (eggs and sperm). Any changes here would probably (at least with our technology) be irrevsible and would be carried by any decendents. Thankfully, people are being more cautious with this kind since the effects would be much more permanent and far reaching.
The administration (almost, but not quite) elected by the people would like to prevent this type of medicine from being practiced in this country. Thanks, Dubya.
While this was going on there is a couple in California that is hopeing (as in activly looked for sperm donner who was deaf) to have a kid that is deaf so that he will be like the rest of the family (minus the cats). So while we have gene experaments going on to inhance the lives of people and potentialy bring a brave new world kind of classism effect [BadThing(TM)] we have also got people who are actively trying to set the pace of progress back.
Ascii artist &
Slashdot's ranking has dropped again! 1471 down to 1507 according to Alexa's ranking system. Good job guys!
He He He, I hope that now the bubble boy is cured, maybe we can get that whole Moops/Moors things figured out.
"seems nothing short of a miracle" Tell me something, why is it that after every great medical or scientific achievement someone has to come along and call it a miracle? It's not a miracle. In fact, it's the EXACT OPPOSITE of a miracle. It's an achievement of man, with no help from the divine.
A young boy named Rhys was cured by a gene transplant from X-Man "Wolverine" on Tuesday morning. "Wolverine," whose origins remain steeped in mystery, has special mutated genes that allow rapid cell generation.
"I'm so happy that this mutant stepped forward to save humanity!" said Laura, Rhys' mother. "But I hope this doesn't mean my son is now a mutant freak."
Senator Robert Kelly condemned the actions of the scientists. "Comingling mutant DNA with human DNA is disgusting and morally reprehensible. I'm afraid this may set an very unfortunate precedent.
The donor himself puffed pensively at his cigar, and rebuffed questions by this reporter by extending a series of metallic claws from his knuckles. Rhys is expected to appear with Wolverine again on Monday at a pro-mutant fundraiser.
Liberate your mind in two clicks or less.
I just heard some sad news on talk radio - Horror/Sci Fi writer Stephen King was found dead in his Maine home this morning. There weren't any more details. I'm sure everyone in the Slashdot community will miss him - even if you didn't enjoy his work, there's no denying his contributions to popular culture. Truly an American icon.
Remember that one of the arguments against vaccination when it was discovered, was that we shouldn't be "playing god". Eg people should just accept death by lethal contagious viruses like smallpox -- vaccination is "playing god".
Just about every significant medical discovery has been opposed with the "playing god" argument.
Should have to go to talk to the person cured, and explain why they think not doing this research is more important to their values than him being cured.
dominionrd.blogspot.com - Restaurants on
But we'll also develop targeted bioweapons to kill "terrorists","Dangerous Radicals", Saddam Hussein, or other enemy-of-the-year. We'll do horrible shit with this, possibly doomsday our species along with our environment.
Twice: in the movie Dogma and again in Jay and Silent Bob Strike Back.
I got the two states interposed..
A Zygote (fertilised ovum, basically) *precedes* a blastocyst, which, in turn, precedes an embryo.
Sorry 8P
Brak: What's THAT?
Thundercleese: A light switch.. of TOTAL DEVASTATION!
the Welsh baby had is "X-linked", caused by a fault in a gene on the X chromosome that makes an immune protein called interleukin-2. The disease affects boys because they only have one X chromosome.
I'm so tired of the press saying crap like that!
I'm sorry people, but boys have 45 X cromosomes and one Y chromosome. The girls have 23 pairs of X chromosomes.
Maybe journalist have only 2 chromosomes...
You can't take the sky from me...
When will scientists stop being such shameless huckster opportunists, constantly promising lofty goals and wasting MILLIONS of dollars to give us nothing more than ....
... wait ...
:)
oh
hey, good job guys
Stem cell research is only limited to people using government grant money to do the research.
Stem cell research is allowed fully by the private sector and is allowed by government funded institutions with only caveat (they cant create new embryonic lines).
It's about time someone spoke up against this "god" non-sense. How primitive can we be to weild atomic energy and genetic engineering in one hand, and rant about the notion of an invisible mythological "unevolved intelligence" on the other. This is the 21st century C.E. people, we *can* be adults if we try reeeeeeal hard. Don't let the boogie man get you while you mix up them genes you saaahhntests.
at least you spelt them right (i think)
It's important to note that is was accomplished using adult stem cells and not embryonic stem cells. Thus, the usual 'baby harvesting' arguments do not apply here.
They cured the kid's disease with stem cells. Great. What else can stem cells do? I'm not entirely sure I care.
I'm not a religious moralist, and I find the pro-life side of the embryonic stem cell debate disturbing. However, every once in a while, the views of liberals converge with those of religious conservatives - for example, with Catholics on the death penalty. I think this may be one of those cases.
The supposedly liberal view on stem cells is that we have a moral imperative to cure obscure diseases. We can, therefore we must. Well, I'm not impressed with that logic. It's not clear that the cures will be widely available, or that stem cell research won't accelerate the pace of frankenstein genetics experiments.
Meanwhile, most of the disease in this country is self-inflicted. Heart disease, lung cancer, alcoholism, obesity. A few public policy initiatives would do much more for public health than any stem cells would.
There's a corporate power-play going on here with regards to the information in these stem cells. Miracle cures are the carrot on the stick. Public policy is being ignored.
Name me one thing in nature we fully understand. Name me one thing.
We don't know, *for sure* how atoms work or are built. We don't know if there is a 5th repulsive force in nature. There's lots we don't know..
But what we do know.... To our knowledge, this therapy may help a guy who's *never* had a chance to go out into real life. Maybe it'll give him cancer in 30 years. Maybe it won't.. But just because it might possibly be catastrophic doesn't mean that nothing should be done.
That way leads to stagnation and helplessness. We don't know and can't know. That is why this so-called 'precautionary principal', that something must be proved 'safe' before it can be used or sold is garbage. We can't know and won't know for *sure* anything.
Gene therapy
Similar method was originally tried on cystic fibrosis patients, but the positive results lasted only for about three weeks, after that repaired cells were replaced back again with the faulty ones.
It seams to be more complicated.
Cystic Fibrosis Gene Therapy
Could this sort of procedure be used to treat HIV?
Question
http://www.ironfroggy.com/
Glaucoma
Acne
Weight loss
Hair growth
Penis enlargement
Breast enlargement
Accelerated muscle growth
This is basically everything that everyone wants according to all the media I see. People would jump at the chance to get these things if offered in a easy gene injection treatment. The super virus is coming and thats why I'm moving to Mars. Who's coming with me?
Read the article. Embryonic stem cells were not used. They used his own stem cells.
News for Nerds. Stuff that Matters? Like hell.
Wow, someone's offtopic happy today.
I think offtopic sucks... stream of consciousness conversations rule.
Is "Inciteful" the same as "FlameBait?"
Run a pencil-and-paper RPG campaign with your far-off friends: Gametable!
Yawn
This is only the first time it has been done in England. If you read THIS article, you will see at the bottom that the French did this TWO YEARS AGO.
I was looking forward to the episode where the Bubble-Boys Bubble-Friends emerge from their bubbles and take revenge on George.
I picture them beating him with Trivial Pursuit boards while shouting "Moors! It was the moors! Not moops goddammit, say moors!"
Antiquis temporibus, nati tibi similes in rupibus ventosissimis exponebantur ad necem.
What the fuck is a retro virus?
He still wants those, right?
I'm not suggesting for a minute that we stop. I am truly in awe of what they have accomplished, and the incredible potential for improving human lives. I thought this was an exciting story, and I am happy for the boys who suffer from this disease. Maybe it's because I'm more of a physical sciences kind of guy, but thought of being able to mainipulate individual human genes, effectively retroactively as I understood this, is just mind-boggling. If we're advanced enough to pull this off, are there any limits to what we can do?
And that is where the negative side of my comment comes from. What are the limits to what we can do, and (rhetorically) are we up to the responsibilty? The answer is "no" - though the prospects for good are unlimited, some will abuse this technology. It's the inevitable cloud that accompanies the silver lining.
In my opinion, that's part of the price we pay for advancing. Genetic manipulation seems much like our first steps into atomic power (another subject that provoked fears of "playing God"). It is far more revolutionary than medications or cutting trees or most of the other ways we manipulate our world. These other things can have tremendous cumulative effect due to scale, but their potential individually is fairly narrow and limited. A new drug may heal - or hurt - a few individuals, but it can't change the shape of the human race.
Genetic manipulation is different. It can literally change the face of humanity. The potential for good is awesome, but it will come with a price. And that's the risk we accept every time we move forward.
Again, sorry for provoking a religious discussion. My use of "playing God" was only meant as a metaphor for the power and potential of this development.
Can this be used to cure Aids as well? I mean, honestly, I've asked myself a couple of times, if I ever got AIDS, why couldnt I have a bubble? Isn't having bubble boy disease similar to AIDS? (no immune system?) I mean, instead of taking drug cocktails, why not live in a bubble?
If you're not a Liberal in your 20's, then you have no heart.If you're still a Liberal in your 30's you have no brain.
which we didn't see?
ths way, curing the "bubble boy", we allow it to procreate and possibly make offsprings with another genetic anomaly... nature saw this and decided to stop the chain at this unfortunate boy.
we go against nature. that's a serious no-no.
now commence flaiming me with "oh yeah? what if YOU were that child, wouldnt you rather live?".
Looking for people to chat about multicopters, coding, music. skype: gtsiros
I assume you are refering to Western Europe or the United States in you weapons argument. There are several international bans on biological weapons (the United States has not engaged in offensive microbiological weapons since the Nixon administration).
Also I must ask what you mean by "targeted" bioweapons. We do not posess the technology to "target" a weapon beyond the scope of what species it effects (which is usually a trait inherited from the natural stock microbe). It is (and will remain) impossible to target a virus or bacterium to kill one man or nationality.
I do believe that the reason Sadam Hussein is the enemy of the year is HIS desire to develop bioweapons.
I could see some dangerous applications to the retroviral method used, but I do not think we need to fear much from killer stem cells being released on an unsuspecting world.
Lighten up!
~primenerd
Microbiology/ Computer Engineering Undergrad
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
They also believed that people would grow horns and develop cow-like features , another fear was that the pustules would be little cow heads. This fear came from the fact that the smallpox vaccination was derived from the bovine cowpox virus.
I bet that is Jenner had introduced vaccination a few hundred years earlier he would have been paid a visit by the inquisition.
Religion and science tend to be destructive to each other. I get nervous whenever one confronts the other.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
I understand how a hammer works.
1. For destructive purposes you basically bang the flat end into the object that you want to destroy.
2. For naildriving purposes you position the pointy side of the nail towards where you want it to sink in. Then you hit it with the flat end of the hammer in much the same way as if you were trying to destroy the nails head [see 1].
Opinions stated are mine and do not reflect those of the Illuminati
Every time we cure someone.
Yeah, blastocysts have differentiated tissue types. Zygotes are one cell, I believe.
toeslikefingers.com - because
Well technically, manipulating all reality through the power of will alone is a pretty good functional definition of what it means to BE God.
This is all very simple until things get polytheistic:
So what about the lesser gods? Like the little ones who make the bus come in time and protect rivers etc? I thought you could define god as anything that's not actually human ( or !cowboyneal)).
Also, "creative gods" doesn't mean they also own everything they created. So I'm not proprietary humanware and I'm recursively able to create and play too, thank you very much. Regardless of who created me.
Then again, if it was greek gods, I'm sure you'd get loads of bitching about who created who, and some crap about zeus laying claim to all the other guys and creating proprietary viral licensing etc. Next thing you know that other guy would start firing his lighning bolts and chaos ensues. What a bore. That's what you get from gods who sit around together all the time. Bit like big brother the other way round.
Better to have gods who are a little more isolated but more independant and with a little more space to work in. Maybe there's a god of only science, and scientific exploration, enemy but mostly tolerant of the god who protects spiritual hippy dippy shit. Even Linus and open source are seen as god and religion respectively by some. One god. That's monopoly.
Ale
How could this be moderated "Offtopic"? It's a joke about the topic. The topic is about a bubble boy leaving his bubble. The joke is about a bubble boy leaving his bubble. Ontopic.
The Moore-Murphy Law: The number of things that will go wrong will double every 2 years.
If this is true and it works, then there may yet be hope for insipient supply side republicanism (ISSR).
How is parent off-topic? yerricde just described one of GOSH's funding sources, which will become much more significant in the near future as Disney begins its Peter Pan marketing campaign in the UK.
Considering the 'spark,' as you call it, for the original Van Gogh was in all likelihood paranoid schizophrenia, I'd think it a good thing, were it deleted. That's nothing my child, nor any child for that matter, should have to suffer through, even if the possible result is that some great artistic talent is diminished. I'd happily trade the possibility for a bunch of pretty pictures for a child with a healthy mental state, but that's just me.
So Yes. It's quite Disturbing. After All we're seeing what is quite possibly our future.
What would a Neanderthal think of us?
That's right...For all intensive purposes, we have made the Force of Evolution null and void with respect to Human Beings. (Darwin award nominees excepted, of course...) Our real growth is coming in our heads- and that growth is feeding back into our bodies. It's quite self-deterministic if you think about it applied to the species, but then the Traditional 'Evolution' concepts are that way somewhat as well. It's simply that this version seems to be consciously directed by a certain segment of society (the scientists and those funding them- Scary, eh?).
I'm thinking that instead of having a corporation pay someone to change their name to NIKE (has already been done-really!), that people will be paid to have the nike logo melanin'd into their new child's scalp or face or arm or what-not...
...But then again- that's a disturbing thought all it's own...
THe potential good is still there, but potential is all it is. We have to be able to get together as a species and use it for good...
...to which I say "Pfft! Right! Like that'll happen anytime soon..."
At any rate, it's this, or stagnation, people. We can't go backwards (cause that'd just suck...). Unless someone wants to find a side track off the Evolutionary ladder?
Sig currently under construction. Mind the gap....
Let's assume we believe in the existence of a supreme being in the Western Judeo-Christian tradition. What is His nature? To create the world and set the rules by which it functions, and then leave its inhabitants to exercise their free will within it.
And what is the nature of man? To strive to understand the rules by which nature works, and do everything in his power to exploit those rules to his own ends.
In short, it is the very nature of God to allow events to happen without his direct intervention. It is the very nature of man to attempt to control events.
"Playing God" would be letting someone die even though we can save him.
Nope, no sig
Offtopic, wtf? Invid summs it up, how the hell was my post offtopic? Sure, it may not have been deserving of 'Funny', but it damn well isn't deserving of an 'Offtopic'
Now with my luck the same bonehead will come back and moderate this post as Offtopic or flamebait or something, jeez.
Read the guidelines, and go find a comment that's worth modding UP, not something you mod down just 'cause it doesn't have you rolling on the floor with hysterics.
Antiquis temporibus, nati tibi similes in rupibus ventosissimis exponebantur ad necem.
As in favor as I am of stem cell and other genetic research and, more importantly, applications being found for the results of that research, curing a disease that causes such a massive immune system failure has to be done at the source: it's a genetic thing, as far as I know, so we have to let these people die. Keeping them around may be humanitarian. Curing their disease may make living worthwhile and hopefully can let them contribute to society. Letting them reproduce, however, will weaken our gene pool; and now that they can come out of their bubbles, they'll be reproducing even more. Just like cancer cells in an otherwise healthy body: the unwanted units become more and more pervasive and harder to contain or remove.
Blastocysts do not have differentiated tissue types. It's hard to differentiate when there's only 8 cells or so. Later in the blastocystic stage there is some differentiation, but that's just the placenta forming (it's more a locational differentiation at this stage than an anatomical or physitiological one though).
If fiddling with genes is what determines if one is "playing God", then all animal and plant breeders are guilty! They should "allow nature to take its course" and let the animals and plants mate as they will. And where does that leave human mating, which is often based on conscious choice? Chose your mate and you're playing God once again. It seems that allowing randomness to govern one's future is the only way to stay humble. So flip a coin to chose who you hit on tonight, or feel the wrath of God!
Michael J. is a perfect example. He's a perfect example IMO, this was a good guy struck down by a disease that many of us know little about. To watch him fight this is truly heart breaking and at the same time inspiring. I don't know your grandmother but I'm sure there are many others out there just like her and if we can find a way to prevent or cure diseases like that I think we should try. No one I know wants to end up invalid in a bed struck down by something like this - I'd rather die quickly. My grandfather is slowly slipping, not a particular disease just old age has taken it's toll. It breaks my heart and that of my family to watch it. This man was a rocket scientist, literally, who helped get the Posiden (sp?) missle program going and who did lots of engineering things during WWII. To watch him lose his mind is awfull.
Those who would cry out against helping people like these kids should try one of hese diseases on for size themselves. I fully understand that such research could also lead to destructive things but not trying to help could be nearly as bad. We simply have to hope that people use common sense and proceed slowly. Unfortunatly I think common sense is in shorter and shorter supply these days (sigh)....
Build it, Drive it, Improve it! Hybridz.org
Or is he still going for the record? :)
tone
I have asthma, I've had asthma all of my life. I have to take a pill in the morning, and an inhaler around when I have attacks. I will have this for the rest of my life, and most probably will get worse. How the hell are a bunch of religious morons going to tell me that this is what god wanted for me? I sure as helld on't want it.
Perhaps we can't get away from this "playing God" business, but did it occur to anyone that fixing "nature's mistakes" before nature takes its pre-genetic-understanding course, might result in a degraded human genome? 200 years from now when we've figured out how to cure most common genetic diseases with gene therapy, will it also be very common for babies to be born needing this very same therapy in order to survive?
Saw someone posting about the normally transient effects of gene therapy. This has certainly been an issue in the past. There's a cystic fibrosis treatment that uses an inhaler loaded with adenovirus (your basic 'cold') to add the gene to lung cells. Adenoviruses do not incorporate into the host DNA, so eventually the new gene is lost, takes a few months I believe.
Retroviruses, as used in this case, *do* incorporate into the host's DNA, so they can potentially be permanent changes. I say potentially, because the host can sometimes shut down or jettison it. If it couldn't, my current research project would be showing much better results.
The problem with any kind of gene therapy is to affect *all* of the target cells, and *only* the target cells. So far this has been pretty much impossible. What makes this case interesting, it that the doctors took the kid's own genetically-defective bone marrow cells and replaced the gene. Since this was done outside the body, they could select from culture only a healthy, properly working cell. Its not stated, but I assume they then irradiated him to destroy his bone marrow, and then let the altered cells repopulate.
As the article says, this disease can be cured with the help of a donor. The cleverness here is using gene therapy to turn the patient into his own donor. Pretty slick, IMHO.
Entropy gets everyone.
By not speaking out in opposition you are spoken for by the more vocal factions.
?-|||-----x<*))))><
Oh wait, that was Craig Shergold. Why couldnt Craig have been the one to be cured!?!? Why, god, why?!?
You see, you know part of how a hammer works. But not the whole story. Certainly (well, probably) not enough to make one yourself. And building a hammer factory and mining the ore have pronounced effects on the economy and environment, in ways that nobody fully understands. That's what I'm getting at.
"Hardly used" will not fetch you a better price for your brain.
Someone mod this +1 Inciteful
Amen.
Play Command HQ online
...since there is no god, the point is moot!
Does that mean no sequel to the hideous movie "Bubble Boy"?
linuxhelpnetwork.homelinux.net
I don't get it.
Eat shit and die, eugenecist troll!
Eat shit and die, eugenecist moderator!
Zygotes are also the balls of cells that form shortly after that one cell starts to divide numerous times.
As he was going to the hospital you could hear this argument:
"Moops!"
"Moors you idiot!"
"Moops!"
"Its Moors!"
"Sorry, the card clearly says 'Moops'"
It is by the juice of the coffee bean that thoughts acquire speed, the teeth acquire stains. The stains become a warning
The playing God aspect of this is no different than when we give a blood transfusion to a person who is bleeding to death.
nomadic people of the northern shores of Africa, originally the inhabitants of Mauretania. They were chiefly of Berber and Arab stock. In the 8th cent. the Moors were converted to Islam and became fanatic Muslims. They spread SW into Africa (see Mauritania) and NW into Spain. Under Tarik ibn Ziyadthey crossed to...
Agreed. Disturbing. Nitpick: Nike Logo melanined in? It's called Tattooing, and it has existed for hundreds of years. Another thing: Evolution has the unique ability to never be rendered null and void as long as life remains. It will merely not function in the traditional way. Suppose, for example, that there is a trailor-trash gene(actually, its much more likely just a self-propagating social meme, but just supposing). People who have it tend to be trailor trash and have more children than usual while having less ability to hold a job. This phenotype(genetic trait) will gain a bigger and bigger percentage of the world population. What I am saying, in my strange, uber-complicated way of saying it, is that as long as procreation happens, evolution will continue. Evolution is the circumstances leading up to child-production combined with the child's circumstances of reaching mating age.
People in Soviet Russia, however, appear to be afflicted with amusing juxtapositions of the aforementioned situation
Only this statement is true.
This is one of the first times I have ever seen gene therapy actually HELPING anyone. People would talk and talk about it, that one day it would cure any disease they could think of as long as they got research grants, that it would save the world. Then there were the people that criticized it for being too creepy(among other things, but "being too creepy" is usually the best argument). It became an Issue - are you For or Against it? This is amazing in and of itself not just that it was a "suprising new implication of gene therapy research" or something as pointless as ordering one human genome without any identification(its something like SETI's white noise without any pattern recognition).It actually, finally, for one of the first times, helped someone.Damn. The future: not the one with flying cars and a robot house-servant imagined in countless baby boomer daydreams;not the one available on the sci-fi channelnot the one vaguely thought of as what has to come next in the worldnot the Next Big Thing But the future shouted from the rooftops of countless research institutions at the parade of forward-thinking VentureCaps,The one told to the CEO of the medicine companies by mindless consultants looking for a buckThe one forever promised by the marketting departments of companies that don't really need marketting departments, because they don't sell anything.The one where if someone is sick, they can be cured.The one where we have the technologyWhere We have the resourcesWe can remake PEOPLE Better... Stronger... and Faster... This is one of the first tangible results of an industry that has based itself around promises of results sometime in the next 50 years... The future is now, people.
People in Soviet Russia, however, appear to be afflicted with amusing juxtapositions of the aforementioned situation
The genetic engineering methods used here aren't new. Retroviruses have been around longer than humans have, and we all have copies of DNA in our genome which is thought to have been introduced by retroviruses. The scientists involved here are to be congratulated for using a potentially damaging phenomenon to allow someone to live a normal, healthy life. As an immunologist, I am blown away by the fact that these guys have managed to recreate an entire immune system from scratch for this kid. Furthernore, only the immune system cells within this kid have the altered genome, thus it isn't going to be passed on to his offspring - this is sure to calm some of the alarmists out there that worry about Nazism and teleogy becoming more popular through scientific progress. This technique has the potential to wipe out the majority of immune system disorders in the world today, from autoimmune diseases like Multiple Sclerosis and Lupus to immunodeficiency disorders such as AIDS, and even some forms of diabetes. I hope everyone that reads this article realises how huge this really is. Finally I'd like to say to all those people that have the urge to bash such scientific advances - put yourself in the shoes of someone who is suffering one of the diseases that this and other controversial fields of science can one day cure (perhaps sooner than you think). The fear and loathing of this kind of advancement is a direct result of ignorance, and the further away from such issues people are, the more idealistic and judgemental they become. I doubt whether the parents of this boy give a damn where the stem cells came from or how they were altered before they cured their son.
Tooo bad it was too late for John Travolta! *lol*
Encryption: I may not agree with what you say, but I will defend your right to encrypt it...
I feel touched you've followed my posting career to determine that all I post is crap. But, since i'm so stupid, I'll probably forget about the blackout and post it regardless, eh?
Sapphon
Let's see, the kid had no immune system, so we cure it by using stem cells from some embryo, which means he has to take anti-rejection drugs to keep him from destroying the new cells, which only work because he has no immune system, but the anti-rejection drugs stop his new immune system from working....
Or worse, his new immune system doesn't recognize *his* cells, since they don't match the cells from the embryo...
By the taping of my glasses, something geeky this way passes