Slashdot Mirror


Jet Turbine Locomotives

An anonymous submitter writes "I saw this article in the paper today. Not only is it lighter than a comparable diesel engine, it should burn the fuel more completely and be a bit better for the environment. Not to mention it is much faster. They should make more of a point that the North American railway system needs a major overhaul in order to support faster trains." The Department of Transportation has some information about next-generation trains, including a design incorporating a flywheel to improve acceleration.

438 comments

  1. Or... by Luminair · · Score: 0

    http://www.rtri.or.jp/rd/maglev/html/english/magle v_frame_E.html

  2. Remindes me of the JATO Impala story by Drunken+Coward · · Score: 1, Interesting

    This reminds me of the urban legend where a guy attaches a JATO to his Impala and plants himself into the face of a cliff. Apparently the story had truthful elements, the real guy behind it did attach the JATO to an old push railroad car and it worked fairly well. So I can imagine something like that could be commercially viable with a little more advanced developement.

    --
    Have you been stalked by Seth today?
    1. Re:Remindes me of the JATO Impala story by Idarubicin · · Score: 5, Insightful
      Please, everyone--read the article before you post.

      This isn't about some jackass engineer at Bombardier strapping a jet engine onto a flatcar to make it go faster. Bombardier is proposing the use of a turbine in the same way they are used in natural-gas fired power plants. Presumably, the turbine will drive a generator whose electricity output will drive electric motors as in a conventional diesel locomotive.

      I'm all for it if it will bring high-speed rail service to North America. Electrifying the existing rail system will take decades if it happens at all--Canada and the U.S. just aren't densely packed enough to support the infrastructure investment seen in Europe. If we can get high-speed non-electric locomotives, we might see high-speed rail service to more cities, offering a viable alternative to the inconveniences of air travel.

      --
      ~Idarubicin
    2. Re:Remindes me of the JATO Impala story by arcadum · · Score: 1, Informative

      Presumably, the turbine will drive a generator whose electricity output will drive electric motors as in a conventional diesel locomotive.

      I think you meant diesel-electric .

    3. Re:Remindes me of the JATO Impala story by HughsOnFirst · · Score: 5, Interesting

      The "seven trains operating since 1977 in New York State using jet turbines
      incorporated into coaches."
      are awful trains.

      I remember when they went into service and replaced the nice big heavy comfortable
      slowish trains, with a lot of room, real dining cars, and seats that were
      like chairs. Then Amtrak bought these turbo trains from the French. They are
      not at all nice, lighter weight, uncomfortable, slowish trains with not much
      room, snack cars, and seats that are like airliner seats. ( Some moron
      at Amtrak probably thought they were loosing business to the airlines
      because people like those airline seats.)

      They were always getting disabled every time they hit a snowmobile because
      they were so fragile. They were supposed to be fast, but they aren't because
      the rail beds are so crummy.

      Fast trains aren't fast if they are on slow tracks, and until Amtrak
      can get their own tracks the freight trains will keep messing up the rail
      beds for all these fast trains.

      And they smell just as bad as diesel trains, because there is no
      difference between the jet fuel they use, and diesel fuel.

    4. Re:Remindes me of the JATO Impala story by Usquebaugh · · Score: 3, Insightful

      This is exactly what a diesel engine does. Spins a generator so it can drive an electric motor. Hell we could have nuclear trains if we wanted.

      The US is not ready for high speed trains, the infrastructre is FUBAR. Railroad crossings are lethal at the moment and likely to become worse with 100mph+ trains.

      The Amercian public is not wishing to travel by train, so get the passangers off the track and make them exclusively for freight.

      The best thing that could happen is for AmTrak to be put out of it's misery it's assets sold off and everyone forget about rail travel in the US.

      Maybe in 50 years if nothing better has come along America can rediscover trains but until the current crippled system is ripped out nothing will improve.

    5. Re:Remindes me of the JATO Impala story by Tattva · · Score: 2, Troll
      Then Amtrak bought these turbo trains from the French. They are not at all nice, lighter weight, uncomfortable, slowish trains with not much room, snack cars, and seats that are like airliner seats. ( Some moron at Amtrak probably thought they were loosing business to the airlines because people like those airline seats.)

      So by your reasoning:

      Horses are so much better than the smelly, prone-to-breakdown, ugly model T. I'll stick with my horse before I try this new Accura Integra because the model T sucked.

      --
      personal attacks hurt, especially when deserved
    6. Re:Remindes me of the JATO Impala story by Anonymous Coward · · Score: 0

      What? I just read your reply and it makes no sense. He wasn't saying that new trains suck. You, sir, are an idiot.

    7. Re:Remindes me of the JATO Impala story by Pig+Hogger · · Score: 2, Interesting
      This isn't about some jackass engineer at Bombardier strapping a jet engine onto a flatcar to make it go faster. Bombardier is proposing the use of a turbine in the same way they are used in natural-gas fired power plants. Presumably, the turbine will drive a generator whose electricity output will drive electric motors as in a conventional diesel locomotive.
      This actually was done in 1966 by the New-York Central railroad... They fitted two jet engines to a Budd Rail-Diesel-Car and sent the contraption careening down the pike at speeds up to 183 miles per hour in Western Ohio.
    8. Re:Remindes me of the JATO Impala story by Pig+Hogger · · Score: 2, Interesting


      The US is not ready for high speed trains, the infrastructre is FUBAR. Railroad crossings are lethal at the moment and likely to become worse with 100mph+ trains.

      Ha! When CN inaugurated it's Turbo Train back in 1966, the train hit a truck at a crossing. The train was going at 125 miles per hour, but the crossing gates were timed for 96 miles per hour, so when the train went by the crossing, the gates weren't down yet...

    9. Re:Remindes me of the JATO Impala story by gi-tux · · Score: 3, Insightful
      The Amercian public is not wishing to travel by train, so get the passangers off the track and make them exclusively for freight.
      Speak for yourself. I would travel by rail, if I could. Why?
      1) I like trains.
      2) I don't like planes.
      3) I would rather see the world than see the clouds.
      4) Speed doesn't really mean anything to me, I can work on a train while traveling.
      --
      I have no sig, does anyone have one to spare?
    10. Re:Remindes me of the JATO Impala story by Anonymous Coward · · Score: 0

      > And they smell just as bad as diesel trains,
      > because there is no difference between the jet
      > fuel they use, and diesel fuel.

      Riiiight. So Mav used to pull his fighter up to the pump with the green handle?

    11. Re:Remindes me of the JATO Impala story by Fulcrum+of+Evil · · Score: 2

      Horses are so much better than the smelly, prone-to-breakdown, ugly model T.

      Damn straight. Remember, you still have to ride on a dirt road because the road company can't afford to buy its own roads (to complete the analogy).

      --
      "We returned the General to El Salvador, or maybe Guatemala, it's difficult to tell from 10,000 feet"
    12. Re:Remindes me of the JATO Impala story by chasmosis · · Score: 1
      Fast trains aren't fast if they are on slow tracks, and until Amtrak can get their own tracks the freight trains will keep messing up the rail beds for all these fast trains.

      The tracks and rail beds those freight trains keep messing up are build and maintained by the rail freight company. I work for one of the few remaining class 1 railroads and according to company propaganda, Amtrac uses our track at a lower rate than standard, it's trains get priority over our own, and to top it off since Amtrack can't make any $ off of passenger traffic they are now hauling light freight at a lower rate than us over our own tracks.

      By the way, I know our company experimented with gas turbine powered locomotives in the 50's. They were discontinued at that time because they were too loud and we were unable to use them around any metropolitan areas. They were segregated to the long freight runs in the western US, until the end of their service life.

    13. Re:Remindes me of the JATO Impala story by CuCullin · · Score: 2, Informative

      "And they smell just as bad as diesel trains"

      I think there is one problem with that... in the US, we have sub-standard diesel. We have a much higher sulfur content than Europe, which is the reason for the odor. One of the reasons diesel in Europe costs more than in the US is that the process of removing more sulfur will cost more... and the US is roughly 5-10 years behind on sulfur content.

      I won't hypothesize about oil companies, etc., but I will say - I drive a diesel. I will buy another diesel soon. If I could afford to, I would purchase a new VW diesel, simply because they run cleaner, better, and longer... the difference in speed and the difference in volume between diesel and gas engines have changed greatly, you can no longer hear or smell a difference (when comparing a modern gas to a modern CDI or HDI engine).

  3. TechTV by davisshaver · · Score: 1, Informative

    Everyone must be getting this at once, because this was featured on TechTV not 5 minutes ago.

    --
    "What we have here is a failure to communicate"
    The Warden, Cool Hand Luke
    1. Re:TechTV by Anonymous Coward · · Score: 0

      probably 'cos it got into today's _USA Today_ as well. whoever's doing PR for Bombardier would seem to be working overtime...

    2. Re:TechTV by kent_eh · · Score: 4, Informative

      There are some pictures of this locomotive here

      --

      ---
      "I can't complain, but sometimes still do..." Joe Walsh
  4. Sounds good by sketerpot · · Score: 3, Interesting
    If it isn't too expensive, I'd like to see this used a lot more. Can existing trains be retrofitted with one of these things? Or is this just for trains of the (not too distant) future?

    If you were willing to foot the extra bill for one of these in new trains that you bought (assuming that you buy trains) it would have more advantages than just efficiency and speed--can you imagine how cool this would look in an advertisement?

    1. Re:Sounds good by Anonymous Coward · · Score: 0

      Jesus, man! Just imagen a beowulf cluster of these!

    2. Re:Sounds good by Goonie · · Score: 4, Informative
      If it isn't too expensive, I'd like to see this used a lot more. Can existing trains be retrofitted with one of these things? Or is this just for trains of the (not too distant) future?

      I doubt that existing trains will be able to be retrofitted with one of these things - at least, they won't be able to to take full advantage.

      If you're trying to build a high-speed train, all the running gear has to be rated for that high speed. That means suspension, brakes, etc. etc, and applies to all the carriages, not just the locomotive.

      Just adding one of these to a train would be like bolting a Formula One race engine in a Civic - it could probably be done, but it wouldn't be safe to use anywhere near its full potential.

      Not to mention that train tracks have maximum rated speeds also, so if you upgrade to high-speed trains you have to upgrade to appropriate track standards. Such upgrades are potentially quite expensive (you have to widen bends to reduce lateral G's, for instance).

      --

      Any sufficiently advanced technology is indistinguishable from a rigged demo
      --Andy Finkel (J. Klass?)
    3. Re:Sounds good by Anonymous Coward · · Score: 0

      >Can existing trains be retrofitted with one of >these things?

      Only if Bombardier can make money of it.

      At the price they charge to upgrade some metro and rail cars around the world, its pretty much a pick em.

    4. Re:Sounds good by Pig+Hogger · · Score: 4, Informative


      I doubt that existing trains will be able to be retrofitted with one of these things - at least, they won't be able to to take full advantage.

      If you're trying to build a high-speed train, all the running gear has to be rated for that high speed. That means suspension, brakes, etc. etc, and applies to all the carriages, not just the locomotive.

      High-speed is made possible by the tracks, not the trains. The french TGV (the fastest - 515 km/h that's 320 miles per hour) is a souped-up ordinary train. No exotic technology, no fancy tilt mechanism, no esoteric power system. Just bigger transformers, faster traction motors, faster gearing and more powerful brakes.

      But the track. Oooh, the track, it's a smoooooth gentle nicely laid ribbon of steel, designed to be travelled at speeds up to 250 miles per hour.

    5. Re:Sounds good by speleo · · Score: 2, Informative

      Sure, easy retrofit.

      The New York Central did this in 1966 by sticking some surplus J-47 engines onto a regular passenger rail car. The M-497 reportedly got up to 155-mph, occasionally leaving the tracks from time to time over grade crossings.

      You can read more about it here or look it up in a back issue of Invention & Technology Magazine from several years ago.

      Then there was the UP gas turbines, some steam turbines, and even some government research into nuclear-powered steam turbine locomotives.

      In short, a lot of reseach as been done in this area.

    6. Re:Sounds good by Fulcrum+of+Evil · · Score: 4, Funny

      Let me get this straight: The TGV runs at 320mph... on tracks rated for 250mph. Oh, that's gonna be fun.

      --
      "We returned the General to El Salvador, or maybe Guatemala, it's difficult to tell from 10,000 feet"
    7. Re:Sounds good by Pig+Hogger · · Score: 4, Informative
      Let me get this straight: The TGV runs at 320mph... on tracks rated for 250mph. Oh, that's gonna be fun.
      This was during a test run, some 11-12 years ago. The test run was with a modified, lighter (3 cars - 2 first-class and one test coach) and souped-up train. What was interesting is that the record-breaking run was done not only with a full complement of journalists, but with the French transportation minister on board (hence the first class coaches)...
    8. Re:Sounds good by gi-tux · · Score: 1

      Yes and the NYC had problems with over-passes that crossed the tracks. Especially if the over-pass was in a place where the train stopped with the exhaust under the overpass. I believe they had problems with the heat melting the asphalt of the time.

      The UP used their gas turbines to replace the BigBoy steam locomotives. They were somewhat successful as I understand, but apparently not as successful as quantity pricing.

      --
      I have no sig, does anyone have one to spare?
    9. Re:Sounds good by Goonie · · Score: 4, Informative
      But the track. Oooh, the track, it's a smoooooth gentle nicely laid ribbon of steel, designed to be travelled at speeds up to 250 miles per hour.

      With an electric wire on top, adding to the cost. The point of this train is, presumably, that you don't need to electrify the system. It'll still be expensive to upgrade the rails and reroute the track in parts, but not as expensive as the TGV.

      --

      Any sufficiently advanced technology is indistinguishable from a rigged demo
      --Andy Finkel (J. Klass?)
    10. Re:Sounds good by rweir · · Score: 2

      The french TGV (the fastest - 515 km/h that's 320 miles per hour)
      the track, it's a smoooooth gentle nicely laid ribbon of steel, designed to be travelled at speeds up to 250 miles per hour.

      Er...sounds like hitch hiking is the safest way to get around France:-)

    11. Re:Sounds good by Rolo+Tomasi · · Score: 1

      I'm not so sure ... I mean you put a turbine on the train to generate electricity, and then drive an electric motor. Why not put a big turbine on the ground and distribute the electricity via a power grid? This would make the trains lighter, allowing for more passengers and saving energy, and furthermore, one big turbine has a much better efficiency than 20 small turbines. Hell, you could even have a nuclear power plant power the rail lines and have no pollution at all! Yeah, yeah, I know, you lack the infrastructure ... it would be a good use for your money though, instead of spending ungodly amounts for your behemoth military machine. Whaddaya say, one aircraft carrier less, and get a state of the art nationwide railway grid for that?

      --
      Did you know you can fertilize your lawn with used motor oil?
    12. Re:Sounds good by TheToon · · Score: 3, Informative

      > The french TGV (the fastest - 515 km/h that's 320 miles per hour)
      > is a souped-up ordinary train.

      Pretty "ordinary" yes... but there's one striking feature that differs from ordinary trains:

      On a normal carriage, you have two boogie wheel pairs, one on each end of the carriage. On the TGV two carriages shares the same boogie in the intersection. Picture here: TGV boogie

      This picture is actually from a tilting prototype of the TGV.

      You can read more about the modifications to the TGV (Train Grande Vitesse) here, and some history here.

      --
      //TheToon
    13. Re:Sounds good by ColaMan · · Score: 2

      In inland Central Queensland (Australia) they use a 25kV AC overhead traction system on about 700km of track. This is used to haul coal from the inland mines to ports on the coast. Trains travel at up to 100km/h - and when you've got a train weighing 14 THOUSAND TONS, it takes a whole lot of energy to push it around. They use three loco's at the front and two more in the middle of the train, remote controlled from the front. Rumour has it it's about 12,000kW/hr to get one up to speed.

      Anyway, Cost for 700km and about 30 trains? In 1984 dollars it was about $12.00 per freight ton... and about 14Mt in '84 so that's $170 million 1984 dollars for 700km of track.

      Fast - forward that to 2002 dollars and (say) 5000km more track... and you'd probably not only have to not build a few carriers, you'd probably need to sell a few of the ones you have already.
      Not to worry though -I hear quite a few nation-states are in the market for military hardware these days ;-)

      --

      You are in a twisty maze of processor lines, all alike.
      There is a lot of hype here.
    14. Re:Sounds good by frost22 · · Score: 2
      the test run was with a modified, lighter (3 cars - 2 first-class and one test coach) and souped-up train.
      ... not to mention the larger wheels they mounted to get to the record speed.

      That pissed off the hell the guys working at the German competitor of TGV (the ICE), who, at that time, did use standard gear for their record attempts.
      --
      ...and here I stand, with all my lore, poor fool, no wiser than before.
    15. Re:Sounds good by frost22 · · Score: 2

      every serious European railtrack is electrified.

      The cost of electrification is minor, compared to the track costs as whole. Guys, you have to imagine not only better track material, but completely different less curvy trackways, new bridges, tunnels, you name it.

      --
      ...and here I stand, with all my lore, poor fool, no wiser than before.
  5. Noise by the_Bionic_lemming · · Score: 4, Insightful

    Living next to a railway crossing - I wonder how loud it's going to be - Judging from Jet's flying in and out of airports - I'll be moving away from any railroad tracks.

    --
    _ _ _ Go for the eyes Boo! GO FOR THE EYES!
    1. Re:Noise by trchub · · Score: 1
      I'm picturing the scene from Wayne's World, with Wayne and Garth laying on the car at the end of the airport, FEELING the jet airplane taking off.

      Think of the increased pleasure this will bring to children and college dropouts across the country - now they can have the same pleasure of Wayne and Garth anywhere trains pass by, not just at the end of an airport...

    2. Re:Noise by op00to · · Score: 2, Informative

      The turbine runs at a constant speed -- that is, it runs a electric generator which provides power to run the motors. The engine would probably be no louder than current diesel locomotives, and most likely quieter.

    3. Re:Noise by Waffle+Iron · · Score: 5, Funny
      Living next to a railway crossing - I wonder how loud it's going to be

      In the railroads' minds, louder is safer. They'll probably take advantage of the jet exhaust by routing it through a huge whistle and horn. It will continuously emit a piercing, deafening alien wail audible dozens of miles away. Railroad crossing accidents will become a thing of the past, because it will be too painful to remain near the tracks as the train approaches.

    4. Re:Noise by the_Bionic_lemming · · Score: 2

      I disagree with that - Diesal motors can be outfitted with Mufflers - Would a turbine function if its exhaust gasses were funnelled thru a series of chambers (creating backpressure)?

      --
      _ _ _ Go for the eyes Boo! GO FOR THE EYES!
    5. Re:Noise by dagnabit · · Score: 5, Informative

      Having been a gas turbine mechanic in the US Navy (gas turbines are used to power the Aegis-class cruisers, Arleigh Burke-class destroyers, and Perry-class frigates), I can say that there are silencers that can be used in the exhaust which will keep the noise down quite a bit... jet airplances are "extra noisy" because the hot gas flows out the back pretty much unabated (small loss to continue turning the gas generator portion, but most energy is "lost" out the back in pure thrust), whereas in a turbine "prime mover" application, much of the exhaust energy is used up turning the power turbine / reduction gear / generator.

      Plus the size of the turbines in these locomotives is probably similar to those in Huey/Blackhawk- sized helicopter... you can get a lot more HP out of a physically smaller gas turbine than you can from a diesel (the Navy gets 2500kW from a single Huey-sized turbine/ generator setup). And, to me anyway, the lower frequencies from a diesel are more "penetrating" than the higher turbine freqs...

      Another turbine advantage is they can run on almost anything flammable, given the right nozzles etc. Some power plants actually burn pulverized coal in their turbines. They can also run on methane, LNG, etc... so if/when it becomes unfashionable enough/too expensive/whatever to power the trains with dead dinosaurs, they can switch over to something else... (methanol anyone?)

      I've always thought a turbine-powered locomotive made a lot more sense from a size/weight/fuel economy point of view than a diesel engine... guess I shoulda patented the idea when I had it back in the mid-90s!

    6. Re:Noise by Anonymous Coward · · Score: 1, Interesting

      The other difference between noise from a plane and noise from a train is the noise footprint on the ground. With planes the noise footprint on the ground is much larger because the plane is in the air so more people further away from the plane can hear it and be affected. The train being on the ground has its noise dampened by buildings, trees, etc. so this limits the noise footprint.

    7. Re:Noise by Gumber · · Score: 5, Informative

      Most modern jet engines are high-bypass turbofans. A great deal of the exaust energy is captured in the turbine section and used to spin the big fan at the front of the engine. The result is that rather than generating thrust by ejecting a relatively small mass of exaust gas out the back at supersonic speeds, they pump a large quantity of air at subsonic speeds. The result is a quieter and more efficient powerplant.

      This doesn't really change your main point though. These aren't going to be as noisy as a jet engine.

      I'm going to guess though that these turbines are going to be a lot bigger than the ones in a huey. Or maybe not: http://www.bombardier.com/index.jsp?id=1_0&lang=en &file=/en/1_0/1_10/1_10_0.jsp
      Looks like they are about half again as powerful. I was imagining a freight locomotive.

    8. Re:Noise by QuasiEvil · · Score: 5, Informative

      Sorry, dag - Union Pacific beat you to it by about 4 decades. Back in the 1960s they experimented with 10,000 HP gas turbines that burned Bunker C oil. Eventually, reliability problems and the rising price of price of Bunker C did them in. However, they screamed like banshees and weren't allowed in many parts of the UP system due to their noise problems. While I'm sure advancements in noise damping tech will help significantly, it's hard to keep something producing several megawatts quiet.

    9. Re:Noise by littlerubberfeet · · Score: 3, Funny

      Think "Pushing Tin"

      --
      Sig (appended to the end of comments you post, 120 chars)
    10. Re:Noise by Tackhead · · Score: 4, Funny
      > In the railroads' minds, louder is safer. They'll probably take advantage of the jet exhaust by routing it through a huge whistle and horn. It will continuously emit a piercing, deafening alien wail audible dozens of miles away. Railroad crossing accidents will become a thing of the past, because it will be too painful to remain near the tracks as the train approaches.

      You're an optimist... I predict lawsuits from grieving parents of Darwinbait.

      "B-b-b-but the trains are so loud now, they practically forced Johnny to floor it and drive around the gates at the railroad crossing! When they made new trains that could go twice as fast as the old trains, why couldn't they also make them able to stop faster, too? Waaaah!"

    11. Re:Noise by nelsonal · · Score: 3, Informative

      A tubine in this application would funnel its exhaust gas through a series of chambers that increase in size to transfer the energy in the the hot pressured air into work for both compressing intake air, and turning the shaft connected to the generator. It wouldn't power the train with high speed exhaust. Its actually pretty similar to a big turbocharger in an automobile. After it is exhausted, a muffler would rob some energy, through backpressure, but the turbine would get most of it. I don't know how loud these would be, Triumph, or another European auto company used turbines in one of their cars for a few years.

      --
      Degaussing scares the bad magnetism out of the monitor and fills it with good karma.
    12. Re:Noise by digitalsushi · · Score: 3, Interesting

      At one meter, how loud in dB would something have to be for a deaf person with their back turned to realize a tone was being generated? And does the frequency matter?

      --
      slashdot: where everyone yells sarcastic metaphors to themselves to understand the issue
    13. Re:Noise by Steveftoth · · Score: 2

      Yes, you can feel low frequency. Bass can actually shake you while high freq ~20k is hard to feel.

      Also, loud high sounds damage your hearing faster than loud low sounds.

    14. Re:Noise by Pig+Hogger · · Score: 1, Flamebait



      Another turbine advantage is they can run on almost anything flammable, given the right nozzles etc. Some power plants actually burn pulverized coal in their turbines. They can also run on methane, LNG, etc... so if/when it becomes unfashionable enough/too expensive/whatever to power the trains with dead dinosaurs, they can switch over to something else... (methanol anyone?)

      Back when CN had it's turbo-train, mechanics would clean the turbines by running them full blast for a few minutes, then quickly switch the fuel for... water. The water would expand to steam thanks to the hot turbine, and they would run for at least 10 minutes on water alone...
    15. Re:Noise by Reverberant · · Score: 1
      My company actually made noise measurements of one of these locos running on Pueblo's test track as part of our HSR work for FRA.

      Alas, FRA hasn't given us permission to release the results yet...

      I will say that they are not as bad as jet planes, and they are comparable to the Acela Express trainsets.

    16. Re:Noise by Eccles · · Score: 2, Informative

      Sorry, dag - Union Pacific beat you to it by about 4 decades.

      Actually, the LMS has that beat by about 30 years. See this.

      --
      Ooh, a sarcasm detector. Oh, that's a real useful invention.
    17. Re:Noise by Anonymous Coward · · Score: 0
      Some power plants actually burn pulverized coal in their turbines.
      I've seen and worked in a number of power plants, but never even heard of other than gaseous or liquid fuels being used in a gas turbine. I known one can gasify coal (i.e. pre-combust it in lean-oxygen reactor, and then feed this combustible gas to a turbine), but one of the main technical problem in these is to clean the gas from any particles.

      Gas turbines' combustion takes place at temperatures above 1000 celsius (and in pressure of tens of times of atmoshperic one), and errosion due to any particles at such an environment is really agressive.

    18. Re:Noise by demonbug · · Score: 2, Informative
      While I'm sure advancements in noise damping tech will help significantly, it's hard to keep something producing several megawatts quiet.


      Have you ever heard a modern gas turbine? The things make this high pitched whine that is annoying as hell. Personally, as far as noise goes, I much prefer the deep bass rumble of a 12-cylinder, 188-liter-displacement diesel redlining at 1200 rpm. I like being able to feel trains coming from several hundred yards away. But that is really neither here nor there - I'm sure you are right, modern turbines are much quieter than older experimental ones.

    19. Re:Noise by rew · · Score: 2

      In an airliner, the jet turbine is driving some huge fans to propel the aircraft, causing vibrations in the air (sound). In these jet engines for electrical power, they are not moving as much air, thus I would expect much less noise.

    20. Re:Noise by Anonymous Coward · · Score: 0

      This is about as current as news as "I don't see a market for more than about 4 computers in the world".

    21. Re:Noise by AGMW · · Score: 1
      Rover and BRM (British Racing Motoring) had a Gas-Turbine powered car for a while - at least one remains in a museum somewhere, as I've seen it. It was never produced comercially so far as I know.

      They entered it into the Le Mans race in 1962.

      --
      Eclectic beats from Leeds, UK
      handmadehands.co.uk
    22. Re:Noise by smittyoneeach · · Score: 2
      I've always thought a turbine-powered locomotive made a lot more sense from a size/weight/fuel economy point of view than a diesel engine... guess I shoulda patented the idea when I had it back in the mid-90s!
      Boss, there is a little more to it than that. Quoting Cengel and Boles Thermodynamics: an Engineering Approach, p476 regarding Naval applications:
      'Compared to...diesel propulsion systems, the gas turbine offers greater power for a given size and weight, high reliabiilty, long life, and more convenient operation'.
      Now, Navies aren't beholden to a quarterly report, and calling voters 'stockholders' is problematic.
      Personally witnessed USS MyLast burn in excess of 110,000 gallons of fuel doing plane guard operations for an aircraft carrier. That is smoking some dinosaurs. I daresay that military operations are optimized for performance, not cost.
      It really gets at the business case: do the size/weight/maintenance/staffing characteristics of the gas turbine pay for the system over the long haul despite piss poor fuel economy. USNS Arctic is an example of where the whole idea starts to eat itself, which might partially explain why they moved her from the regular fleet to Military Sealift Command (hence USNS vice USS). Summarizing, gas turbines in a naval application don't scale well (20,000 tons displacement is usually quoted as the break-even point). Admittedly, that might have to do with Bird-Johnson CRP systems more than the turbine itself.
      Kind of interesting to consider the idea from an open/closed source software perspective. Probably a perilous comparison...
      --
      Get thee glass eyes, and, like a scurvy politician, seem to see things thou dost not.--King Lear
    23. Re:Noise by JimPooley · · Score: 2

      I was going to comment on Rover's turbine-engined car but you beat me to it. I think the reason it was never put into production was because they thought it wouldn't sell well enough (due to high running costs) to justify mass production.

      Pity, as it was quite a cool thing for Rover to do (in 1950!), and what they got looked the same as a regular car. They built a few others including the sports car you mention, and apparently the Rover 2000 was originally designed to allow the turbine engine to be mounted inside.
      There was a TV programme about this a while ago, where they were talking with one of the people who worked on the car. Apparently, when they were driving on public roads and through towns, everywhere they went they would see people looking up - they'd heard the turbine, and were looking for the jet plane!

      --

      "Information wants to be paid"
    24. Re:Noise by GreatOgre · · Score: 2, Informative

      Another problem I've heard about these was that when one of the locos was under a bridge idling, waiting for a block to clear (I think), it actually burned a hole in the asphalt road and it leaked into its ezhaust. I may have to find that again in one of my locomotive compendiums.

      As far as the noise went, I know that most cities prohibited their use and they spent most of their time in the vast expanse of the sparsly populated Midwest.

    25. Re:Noise by jroesner · · Score: 1

      I think that happened near Cheyenne. I remember seeing that in Trains many years ago...

    26. Re:Noise by frost22 · · Score: 2

      Yep. Really fast trains are loud

      But not from their engines. It's just driving noise - both tracks/wheels and air. In Germany, they ended up building noise protection walls along quite a few of the new high speed tracks

      --
      ...and here I stand, with all my lore, poor fool, no wiser than before.
    27. Re:Noise by DavidYaw · · Score: 1

      At one meter, how loud in dB would something have to be for a deaf person with their back turned to realize a tone was being generated?

      It depends on the person, of course, but in general, given no distractions, a piercing shriek at the top of your lungs would do it. At RIT, students in the dorm for the National Technical Institute for the Deaf would get each other's attention with backs turned from across the room by doing just that. But that was in a quiet dorm room with few distractions, I would imagine that doing something while outside would be a bit of a distraction, and make the same shriek less noticable.

    28. Re:Noise by LWATCDR · · Score: 1

      High pitched sounds are easier to muffle than low pitched ones. Think fog horn vs a scream.

      --
      See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    29. Re:Noise by Anonymous Coward · · Score: 0

      I don't get it, like the movie? or what..?

    30. Re:Noise by jafuser · · Score: 2

      I wonder why gas turbine + generators are not scaled down to portable-for-your-home sized units? Even my office uses a very large diesel generator that automatically fires up when the power goes out. Surely if gas turbine generators are more efficient, they would be used in the place of the diesel generators.

      --
      Please consider making an automatic monthly recurring donation to the EFF
    31. Re:Noise by Schaffner · · Score: 1

      In the 1960's Union Pacific tried developing a coal fired gas turbine. I don't mean the 50 or so Big Blows that used bunker C, this was one that would actually use pulverized coal in the turbine's hot section. It's main problem was as you noted, the ash eroded the turbine components. They tinkered with it for a few years and then gave up.

  6. IDK... by anzha · · Score: 2

    Currently, except for regional trains or overgrown subways, the people moving business for trains in NorAm is pretty dead. Planes and automobiles pretty much dominate the possibilities.

    If air travel could be reduced yet again in cost for bulk, it might well finish wiping out the trains altogether.

    --
    Do you know why the road less traveled by is littered with the bones of the unwary?
    1. Re:IDK... by RebelTycoon · · Score: 2

      and that's why in the long run we are all screwed in the continent. When we finally run out of oil, we are screwed!

      I also don't think airline tickets are coming down in price.

    2. Re:IDK... by Synn · · Score: 3, Interesting

      I looked into train travel a couple months, Florida to St Louis and it was more expensive than airfair.

      The trip would've taken longer than a bus too.

      So, no cheaper than airplanes and it takes longer than a bus... any wonder hardly anyone travels via trains anymore?

      We want fast or cheap. Trains are neither right now.

    3. Re:IDK... by Wyatt+Earp · · Score: 1

      Well, if airline tickets remain at a fixed price, or rise at a rate lower than inflation or the normal payraise rate, then airline tickets will be cheaper than they were before.

      Flights from London to New York or Seattle to London are cheaper than they were before.

      When we finally run out of oil? What if we don't run out of oil?

    4. Re:IDK... by Anonymous Coward · · Score: 0

      This is mostly because the passenger rail system in the U.S. sucks, period. Trains have several significant advantages (well, potential advantages anyway); they are not (or should not be in a properly designed system) affected in any way by weather; they are more efficient (no paying for all that lift - the ground does a nice job of holding you up); they don't need 2+-mile-long stretches of flat, straight pavement at each end, which allows the stations to be built even in downtown areas, reducing travel times. The main reason that air travel has such a huge lead of trains in the U.S. is the incredibly backwards state of passenger rail in this country.

    5. Re:IDK... by Tattva · · Score: 4, Insightful

      Oil exploration and energy generation in general are economic activities. The more oil costs, the more marginal fields will be exploited and the more alternatives will be found. This will take years and years, as it already has taken years and years. It's not like there's one tap in the ground and when it goes dry there is no more oil There are a number of different quality oil sources in the ground, and some are more expensive to exploit. As the price of oil goes up, they will become economically feasible, and there will be enormous economic advantages to find cheaper sources of energy. At some price, biofuel will be feasible, at some price wind power will become feasible, and at some price, solar power will become feasible. Gasoline cars will never be obsolete because those alternatives will be used for applications that are flexible with regards to the source of their energy (anyone that uses electricity for example) when those alternatives are cheaper than oil, so the demand for oil will decrease dramatically, leaving only those who have no choice but to use oil as the only market for oil.

      --
      personal attacks hurt, especially when deserved
    6. Re:IDK... by Anonymous Coward · · Score: 0

      The u.s.'s population is mostly along its three main coast lines. Instead of trying to spin a web of tracks across the country, they should concentrate on rail systems within those regions and a few connections between them. It can be done tecnically and economically but politically?... It's not an issue of efficiency or market potential but one of vested interests (auto industry/infrastructure rich guys + airline/aircraft/related infrastructure rich guys).

    7. Re:IDK... by Pig+Hogger · · Score: 2
      Oil exploration and energy generation in general are economic activities. The more oil costs, the more marginal fields will be exploited and the more alternatives will be found. This will take years and years, as it already has taken years and years
      Or you can beat the shit out of some arabian country to get their oil for free...
    8. Re:IDK... by Anonymous Coward · · Score: 0

      I was thinking this as well, but if I would need to go from LA to Houston or Seattle for a week-end, at the last minute, and didn't have $1000 for a plane ticket, you should be able to take a 8 hour train ride. Driving has fuel costs and milage costs on your car which most americans don't care about. If you would look at a trip from LA to Houston in terms of total cost, the train would be the cheapest.

      Now why are trains not popular, that is another story. They need to model it after the airline industry and have rental cars (or allow people to bring their cars on the train in a seperate car) available when you get there. And if they had faster trains it would make a difference.

    9. Re:IDK... by Anonymous Coward · · Score: 0

      I'd post logged in, but too many people will read this as a troll.

      As a whole, the continguous US states covers too much freakin' area to be train-worthy for short commutes. the idea of coastal train routes makes more sense to me.

      Also, the US culture likes its cars since cars are a symbol of freedom. Whereas Europeans will tolerate giving up some of their personal independence and convenience for the good of the whole, you'll be damned for trying to get an American to do the same. (That is of course unless you just have to due to metropolitan congestion.) US culture is very wasteful: just look at all the gas-guzzling minivans and ATVs that are marketed.

    10. Re:IDK... by ibm1130 · · Score: 1

      Of course train travel doesn't require you to get to the station three hours before departure to have you baggage fondled and feet probed. And thank god that shoe bomber guy didn't get creative and try a suppository bomb.

    11. Re:IDK... by Anonymous Coward · · Score: 0

      Oil exploration and energy generation in general are NOT economic activities. They are ENERGY activities. The key distinction is that if it takes more energy to extract the oil out of the ground than the energy contained within the extracted oil it cannot be done. It does not matter at that point how much money is thrown at the problem -- unless of course you are burning money to extract the oil (circa 1999) :-)

  7. Practicality of New Technologies by gotr00t · · Score: 5, Insightful

    As of right now, most North American railways are used to transport cargo, and the very fact remains that speed isn't really a problem right now, as even though trains are very slow, a speed increase would probably not be necessary, as it would only cost more on shiping. On the other hand, these new technologies could be more useful in other places, such as the Far East, where rail transport is still the primary way to transport both passengers and cargo.

    1. Re:Practicality of New Technologies by RollingThunder · · Score: 5, Insightful

      Sounds more like a "hole in the bucket" problem.

      We don't have large passenger traffic via rail because it's slow.
      We don't have fast rail because most rail traffic isn't passenger.

      Time to break that loop. If you could cheaply load your car on as well (think land-ferry), this would be a kickass way to vacation with a small car or minivan.

    2. Re:Practicality of New Technologies by /ASCII · · Score: 1

      The far east, as well as western europe, use electric trains. The infrastructure for electric trains is rather expensive, but once it's there, electric trains are cheaper and faster.

      --
      Try out fish, the friendly interactive shell.
    3. Re:Practicality of New Technologies by goodmanj · · Score: 2, Informative
      If you could cheaply load your car on as well (think land-ferry), this would be a kickass way to vacation with a small car or minivan.

      Amtrak already does this, depending on your definition of "cheaply".

    4. Re:Practicality of New Technologies by Anonymous Coward · · Score: 0

      ...Time to redefine 'fenderbender' if that happens...

    5. Re:Practicality of New Technologies by Jonathan_S · · Score: 2, Insightful

      Sounds more like a "hole in the bucket" problem.

      We don't have large passenger traffic via rail because it's slow.
      We don't have fast rail because most rail traffic isn't passenger.
      ---

      One problem with breaking this loop, is that only Amtrack is allowed to carry long distance passanger service, but the railroads own all the tracks. Since the railroads only move freight, and slow bulky freight at that, they have no motivation to upgrade their tracks or modify the routes to facilitate high speed trains.

      Amtrack can't make changes becuase they don't own the tracks or the right of way. Since high speed trains need straighter tracks, wider turns, and better tolerances than normal trains it is hard for Amtrack to run high speed trains.

      For example their Accela train (which has other problems of its own) only cuts about 30 minutes off the trip from Washinton DC to New York, even through it is much faster than the normal Amtrack trains. Partly this is becuase Amtrack has is stop at most of the stations on the route, which slows it down, but also the tracks aren't configured to allow high speed runs. The main lines run too close to the train stations so it has to slow down for station that it doesn't stop at.

    6. Re:Practicality of New Technologies by Dungus · · Score: 1

      My definition of cheap is not $250 or $350 for the car, PLUS $170 or $200 per passenger, round trip and coach.

      I just called them, couldn't believe that. Its always cheaper to fly than take the train.

    7. Re:Practicality of New Technologies by ceo · · Score: 1

      Actually, Amtrak does own most of the Northeast Corridor line between Boston and DC.The parts it doesn't own are between New Haven CT and New Rochelle NY, owned by Metro-North Commuter Railroad, and between the MA/RI border and Boston's South Station, owned by the Massachusetts Bay Transportation Authority.

      The Acela only gets up to its advertised 150mph on a couple of stretches of straight track in MA and RI. Through most of CT, the line has too many curves and drawbridges, and Metro-North won't let them exceed 79mph on their tracks. Between NY and DC, the catenary (the wire that delivers power to the train) is too old to allow for higher speeds.

      Amtrak did massivly upgrade the NY-Boston segment of the line in preparation for the Acelas, but there's only so much curve-straightening you can do without large property takings.

  8. Union Pacific has one by deadgoon42 · · Score: 5, Informative

    Union Pacific has a jet powered locomotive. They used to have more, but they burn so much fuel that they aren't very economical to operate. Plus, you can't park them underneath overpasses because the exhaust will melt the asphalt. So they just have the one now and it is mainly used for special loads and public relations.

    --

    Smeghead every day of the week.
    1. Re:Union Pacific has one by Detritus · · Score: 5, Informative

      There is a web page with a short history of these locomotives here. They were delivered to Union Pacific starting about 50 years ago. Union Pacific had 55 gas turbine locomotives. They were noted for their noise and high fuel consumption.

      --
      Mea navis aericumbens anguillis abundat
    2. Re:Union Pacific has one by onesandzeros · · Score: 1

      Yeah, they also couldn't run in certain areas because of noise pollution laws. Apparently they made a hell of a racket. I seem to remember seeing a show about these on TLC or Discovery. The turbine ran so hot, it was necessary to keep it spinning during cool down (after the actual power-generating operation of the turbine stopped) to prevent the shaft from deforming.

    3. Re:Union Pacific has one by MtViewGuy · · Score: 2

      The GE-built Big Blow locomotives were powerful but between the high fuel consumption, the loud whooshing sound and the very hot exhaust, no wonder why as soon as diesel-electric locomotives got more powerful by the early 1960's the Big Blows were quickly retired.

      Now, if GE, Pratt & Whitney or Rolls-Royce has finally licked the high fuel consumption and noise problem, then gas turbine locomotives might make a comeback of sorts. But we still have to deal with the problem of dealing with that hot exhaust from the gas turbine engine.

    4. Re:Union Pacific has one by UniverseIsADoughnut · · Score: 1

      This is normal for a turbine. It's much the same for a turbo charger in a car, you can't just turn most of them off without destroying them, you have to let them cool down. Most trains keap the engines running even when parked anyways since the engines don't care for being turned on and off. Also they don't put anti freeze in there cooling systems for some reason. Something to do with reacting with other things on the train if i remember right. So in cold weather they will never turn them off.

      Turbines just arn't ideal for this kind of thing. Other problems are turbines loose efficency when you scale them down. These are pretty big turbines but still near the low end of the size scale.

    5. Re:Union Pacific has one by ek_adam · · Score: 2

      If you're worried about melting the overpasses, use a gas turbine with co-generation like many ship powerplants do. When the low pressure exhaust leaves the gas turbine, it is run through a steam boiler. The steam could run a small steam turbine, or it could be used to heat passenger cars.

    6. Re:Union Pacific has one by Schaffner · · Score: 1

      Nope, UP doesn't have any more of the GTEL's. The only ones left are in museums, and they've had the valuable gas turbine and other equipment removed. UP does have other locomotives they use on special trains, including two steam locomotives and a "Centennial" diesel locomotive.

  9. Not actually getting thrust from the jet by Eight+01 · · Score: 5, Informative

    This may be obvious to most people, but this train doesn't actually get thrust from the jet engine. The jet engine is used to power an electric generator, which in turn powers electric motors for the wheels. This is how diesel locomotives work too.

    I'd guess the reason they say this locomotive is faster is due to the much lower power to weight ratio of the jet turbine compared to diesel engines. I don't see how this would make any difference on a fully loaded train, however, as the delta in weight between a jet turbine and a diesel engine has to be a small fraction of a percent of the overall weight of the train.

    1. Re:Not actually getting thrust from the jet by SirSlud · · Score: 2

      > as the delta in weight between a jet turbine and a diesel engine has to be a small fraction of a percent of the overall weight of the train

      On freight trains, sure, but on passenger trains, I'd be surprised if that reasoning held up. Experts?

      --
      "Old man yells at systemd"
    2. Re:Not actually getting thrust from the jet by Anonymous Coward · · Score: 5, Insightful

      The answer does not lie in the reduced weight of the engine compared to the whole train, rather the more powerful engine/motor they can put in the engine car using the same form factor.

    3. Re:Not actually getting thrust from the jet by captain_craptacular · · Score: 5, Informative

      I agree. Furthemore I don't think you WANT to go making the locomotive TOO light because traction will become a problem... You're talking about steel wheels on a steel track, the huge weight of a locomotive is the only reason there's enough friction to keep the wheels from spinning in place.

      --
      They who would give up an essential liberty for temporary security, deserve neither liberty nor security
    4. Re:Not actually getting thrust from the jet by op00to · · Score: 2, Interesting

      Less weight is a bad thing, by the way. Stopping on a dime is not something railroads are interested in -- basically if you're in the wrong place at the wrong time, it's your fault (or they screwed up, but that is usualy because of screwups between rail companies). In any case, the locomotives need to be a certain weight to pass FRA regulations -- a light locomotive would need to be weighed down anyhow with the requisite safety equipment -- check out the Acela Express. It could have been tons lighter than it is, but FRA regs made it one of the heaviest high speed trains ever.

    5. Re:Not actually getting thrust from the jet by uradu · · Score: 4, Funny

      > You're talking about steel wheels on a steel track

      If they were smart, they'd put rubber bands around the driving wheels, just like model trains to get more traction. But of course they didn't ask me.

    6. Re:Not actually getting thrust from the jet by Anonymous Coward · · Score: 0

      Of course they didn't, because you're talking out of your ass.

      Rubber breaks down too damn easy to be used on a steel track, knucklehead. Especially the uneven, rough tracks in areas that get significant ground frost.

    7. Re:Not actually getting thrust from the jet by uradu · · Score: 2

      > Of course they didn't, because you're talking out of your ass.

      Well silly me, I thought real locomotives were just like itsy bitsy model ones, except bigger.

    8. Re:Not actually getting thrust from the jet by Pig+Hogger · · Score: 2
      If they were smart, they'd put rubber bands around the driving wheels, just like model trains to get more traction. But of course they didn't ask me..
      The last time they put such wheels on a train, they killed 100 people...
    9. Re:Not actually getting thrust from the jet by mysticalreaper · · Score: 1

      I chased that link and while learning about the crash, i've yet to see anything about a rubber wheel. all ive' seen so far is: A broken wheel on the first passenger car has been fingered as the direct cause of the accident.

      i'm wondering if you could point to something more specific?

    10. Re:Not actually getting thrust from the jet by CvD · · Score: 1

      I don't understand this. Why have the inbetween stage converting the power from the turbine into electricity? Wouldn't it be more efficient to just transfer the power directly (with a lot of gearing in between, including a clutching system - like in helicopters)?

      Cheers

    11. Re:Not actually getting thrust from the jet by Fesh · · Score: 2

      Not really. Gas turbines want to run at a constant speed, so a clutch would either be subject to unbeleivable friction or too large to fit in the locomotive. Related is that to get a train started, you need high torque. Electric motors are good at producing high torque at low RPMs, while mechanical systems aren't.

      Also, to gear down the turbine enough to be useful and have components that can handle the forces involved, you'd have a transmission system that weighed more than the engine itself. If using electrical generation as an intermediate step is less efficient than direct mechanical connection (and this I doubt), you still get more power for size because you can install a larger engine in the same space that an smaller engine and a large transmission system would take up.

      Finally, if you had to maintain those things and something broke under the strain, would you want to have to go take apart the entire gearing system to get at the problem?

      --
      --Fesh
      Kill -9 'em all, let root@localhost sort 'em out.
    12. Re:Not actually getting thrust from the jet by mcpheat · · Score: 1

      The rubber wasn't around the outside of the wheel for traction, it was a 3 part wheel with a rubber ring around a steel core with a steel tyre in contact with the rail. It was designed for vibration isolation. Similar wheels were installed on the London-Edinburgh trains but were removed after this accident.

    13. Re:Not actually getting thrust from the jet by dr_db · · Score: 1

      Do you know what the difference between a 100 and a 200 ton locomotive is? 100 tons. They pour concrete into them to bring the weight up.

      They are not trying to obtain a better power/weight ratio, they are trying to fit more power into that limited space.

    14. Re:Not actually getting thrust from the jet by Anonymous Coward · · Score: 0

      But trains are modular. If more power is so critical for a train, why not just add another locomotive? Or two?

  10. Flywheels by DRnetman86 · · Score: 1

    Finally, something mainstream using flywheels. Initially it was believed that the Segway was going to have one built in, but this should be something to see.

    1. Re:Flywheels by Wonko42 · · Score: 2

      You know, my car has a flywheel. So does every other car in the world. If that's not mainstream, I don't know what is.

    2. Re:Flywheels by dattaway · · Score: 2

      I never understood this fascination with flywheels. When they have to put sand on the tracks to get traction, why would they need more temporary torque? Why not just increase the boost pressure from the turbos?

      I used to work with 2800hp V16 twin turbo engines like the ones on the trains, but for electrical generation only. The turbos were rated for 60,000 rpm and they could hammer the pistons hard and shake the ground with rpm's to spare.

    3. Re:Flywheels by Anonymous Coward · · Score: 0

      While not mainstream, and kinda ironic, model railroad locomotives have flywheels. Manufacturers like Atlas, Kato, and Life-Life have been using dual flywheels in order to propel the locos over spots on the track where bad electrical conductivity occurs.

      I know this is true for N Scale, since most of the locos I own have them, unsure of other scales.

    4. Re:Flywheels by catbutt · · Score: 1

      That's different. He's talking about using a flywheel to store energy, which is not particularly mainstream. In a car all it does is keep the crankshaft spinning more smoothly. Its like the difference between a battery and a capacitor.

    5. Re:Flywheels by ari_j · · Score: 3, Insightful

      Flywheels to help acceleration? I was under the impression that flywheels 'store' energy to help keep the cruising speed constant despite sudden changes in energy delivered from the engine. For example, in your car, when you push in the clutch, isn't it the flywheel whose rotational momentum buffers your wheels from the now-disconnected engine? Correct me if I'm wrong - this stuff interests me.

    6. Re:Flywheels by Anonymous Coward · · Score: 0

      What they're talking about here is using a flywheel to store up energy that would otherwise be thrown away as heat when a train is braked to slow down or stop. When brakes are applied to a train (airbrakes or electric regen braking), the forward kinetic energy of the train is turned into heat and lost forever. With a flywheel system, instead of that, a heavy flywheel (or set of flywheels) would be engaged to the wheels, acting against the forward motion of the train. The energy of the train would be used to spin up the flywheel, slowing down the train. The upside is that when it's time to speed up again, that energy (some fraction of it, depending on the efficiency of the system) can be turned back into forward motion of the train, by engaging the flywheel(s) back to the drive wheels this time helping pull the train forward.

    7. Re:Flywheels by ari_j · · Score: 1

      Oh yeah...I'd forgotten all about that use for flywheels.

    8. Re:Flywheels by LBU.Zorro · · Score: 1

      You are wrong.

      The flywheel in car engines is between the clutch and the engine. Its purpose is to buffer the power coming from the pistons and allow them to compress the next stroke etc.

      Pistons only provide power for 1/4 of their cycle, inhalation, compression, expansion, exhalation (yes there are better words for it, bah). Only the expansion phase generates power, and that is a massive shock shortly after ignition and then a fade away as the hot high pressure gas drops in pressure as work is extracted.

      The flywheel takes this, smoothes it, it is nothing to do with speed maintainance when you change gears.

      In the trains a flywheel would be used to:
      a) Store braking energy,
      b) Store excess drive energy

      This rotational energy could then be directed to the wheels to provide extra torque when needed.

      Z.

  11. Noise levels? by Anonymous Coward · · Score: 0

    So how loud are these trains? Considering that normal trains aren't exactly silent, and that jet engines are extremely noisy, it feels like there could be a heap of lawsuits waiting from people living near railroad tracks...

    1. Re:Noise levels? by SoCalChris · · Score: 2

      It's not a jet engine, it is a turbine that will be powering a generator. Most city buses now use turbines for their engine and they aren't that loud.

  12. [OT] turbine for the car? by Anonymous Coward · · Score: 0

    Turbines for the car have been attempted in the past with lack luster interest. Maybe this will not only garner interest for large engine locomotives, but mayve it will reiterate all the benefits turbine would add to the automobile industry, or even better, mass transportation. Anything to get us away from our car-centric world.

    1. Re:[OT] turbine for the car? by Smidge204 · · Score: 1

      The reason turbine powered cars never really got the attention was, simply, because it wasn't economical at the time.

      It is true that a turbine engine can run on just about anything that will burn. (Same with diesel engines, with the right fuel system mods). However, at the time the first turbine cars were developed, the cheapest fuel available was gasoline.

      After that, it was just cheaper to buy a regular piston engine car (which you know any garage would be capable of repairing, and could probably fix yourself)

      Add in the fact that they tend to be very *thirsty* engines, just like all other rotary designs, and you really have no reason to buy one. Therefore, they didn't make any.

      Now, considering how much fuel these trains would burn, it would be a lot more 'earth friendly' to simply fill the tanks with biodiesel which burns cleaner and more efficiently (and is made from veggie oil!), which doesn't require any refitting whatsoever.
      =Smidge=

  13. Better for the enviroment? by XorNand · · Score: 1, Informative


    Just because it "burns fuel more completely" doesn't automatically make it safer for the enviroment. Nor did I see any more proof of this in the article. Jet fuel is some pretty nasty stuff, enviromentally speaking. Sounds like a market-droid speak to me.

    --
    Entrepreneur : (noun), French for "unemployed"
    1. Re:Better for the enviroment? by Trusty+Penfold · · Score: 5, Informative

      When hydrocarbons are burned throroughly, the only waste products are hydrogen and carbon. These can be safely absorbed into the ecosystem.

      Incomplete combustion results in particulate matter and cancer-causing inorganic compounds.

    2. Re:Better for the enviroment? by Gruuk · · Score: 1

      It uses standard diesel fuel; you can see more information including equipment specs here, on Bombardier's website.

      --
      De gustibus et coloribus non est disputandum
    3. Re:Better for the enviroment? by MyHair · · Score: 2

      Jet fuel is some pretty nasty stuff, enviromentally speaking.

      JET-A fuel (used in the big jets like DC10's and 727's) is very similar to diesel, but more refined and pure.

      When I used to load planes on the ramp we put JET-A in all the ground support equipment like portable ramp lights, belt loaders, container loaders and pushback tugs. They were all made for diesel, though. Worked fine.

      Well, actually the fuelling company did that. I think that's why we used JET-A: I think it was cheaper to have the plane fuellers go ahead and fill up our GSE while they were out there with the truck than take all that stuff to our diesel pump or buy our own portable fueller.

    4. Re:Better for the enviroment? by MyHair · · Score: 2

      I forgot to mention that diesel (and JET-A) emissions are less harmful than gasoline emissions, environmentally.

      Diesel emmisions may seem worse because they smell worse to most humans, but they're actually safer than gasoline emissions.

    5. Re:Better for the enviroment? by spareparts · · Score: 1

      Actually, the waste products are carbon dioxide and water. This assumes ideal combustion, of course...

      HnCm + O2 -> H2O + CO2

      (fill in the n and m, and balance the equation...)

      Non-ideal combustion produces CO and oxides of nitrogen as well.

      IANAC (hemist), but I think that organic compounds are generally more likely to cause cancer by interfering with DNA replication (e.g. Benzene).

    6. Re:Better for the enviroment? by davidstrauss · · Score: 2
      When hydrocarbons are burned throroughly, the only waste products are hydrogen and carbon.

      Combustion produces CO2 and H2O, according to a UCLA hydrocarbon combustion study and my chemistry textbook, the latest edition of Zumdahl Chemisty. (Zumdahl is a professor at U of I: Urbana Champaigne.)

    7. Re:Better for the enviroment? by dhovis · · Score: 2
      No, when pure hydrocarbons are burned fully, the only products are water and CO2.

      Hydrogen and pure carbon (soot) would be considered bad to be coming out of an engine.

      --

      --
      The internet is the greatest source of biased information in the history of mankind.

    8. Re:Better for the enviroment? by Trusty+Penfold · · Score: 1

      Diesel is, roughly, a mixture if C16H34 to C20H42

      (IAAC)

    9. Re:Better for the enviroment? by Anonymous Coward · · Score: 0

      Evolution of H2 + C from HxCy is ENDOthermic, not EXOthermic. No heat = no work = no trains, planes or automobiles.

    10. Re:Better for the enviroment? by Anonymous Coward · · Score: 0


      Hydrogen and pure carbon (soot) would be considered bad to be coming out of an engine.


      But if it just worked that way, you could put a wicked afterburner on that thing

    11. Re:Better for the enviroment? by EngMedic · · Score: 1

      1. yes, you're correct that it's endothermic, because it requires an external energy source to start the reaction.

      2. combustion of any hydrocarbon CxHy, follows the following reaction:
      CxHy + O2 ----> CO2 + H2O
      the products are not elemental carbon and hydrogen. The products are Carbon Dioxide and Water.

      --
      filter: +3. Hey, look! all the trolls went away!
    12. Re:Better for the enviroment? by Anonymous Coward · · Score: 0

      Complete combustion is difficult to come by, gasoline is a hydrocarbon, after all. Chemistry textbooks describe reactions as being composed of 'pure' substances, and 100% pure anything is accepted as chemically impossible. (There's always different isotopes present in a given sample of element, or different steroisomers of organic compounds, as well as impurities) The particulate matter is likely generated from impurities arising from other elements bound to the hydrocarbons (ex. sulfur, bromine, chlorine, etc.) and the compounds which it forms with the hydrogen and carbon atoms present as well. Also, oils and lubricants (also largely composed of hydrocarbons) get burnt as well.

      (And an endothermic reaction is one which absorbs heat, not releases it. An exothermic reaction is one which releases heat, upon an initial input of activation energy to get the ball rolling...)

    13. Re:Better for the enviroment? by LBU.Zorro · · Score: 1

      Erm, no it is not endothermic, if it were endothermic, then not only would it require heat to start, but it would not be self-sustaining and would keep needing heat just to keep burning.

      You are correct that it needs heat to start, but once it is triggered the chemical reaction generates heat, and thus the reaction self-perputuates (aslong as there is fuel and oxidiser). I've never noticed a fire to burn cold, and cold exhaust fumes have never been an issue. Car engines have cooling systems, not heating systems (For the engine), car's overheat in traffic jams, not freeze, etc...

      It is exothermic.

      The definition for exothermic and endothermic reaction is not the initial requirements to trigger a reaction, BUT the result of the reaction itself. If a reaction requiring heat is endothermic then it CANNOT be sulf-sustaining, if it is exothermic then it has a chance at being self-sustaining.

      (Exothermic means the reaction gives out heat, endothermic means the reaction absorbs heat)

      the formula should be:
      CxHy + O2 ----> CO2 + H2O + HEAT

      The heat is generally what we use to do useful work, normally in the form of gaseous expansion driving pistons or turbines....

      Z.

  14. Now don't get too excited.... by PhantomHarlock · · Score: 5, Insightful
    The jet engine acts as a turbine to drive a generator for the electric motors, just like diesel engine. It does not actually propel the train down the track directly. And this is not the first time just turbine engines have been tried.

    UP had a few turbine locos in the 1960's but they didn't do well. In the past, the problem with turbines in locomotives has been low efficiency (especially at part throttle) and low reliability. They are getting better, but I doubt that you'll see them in freight locos in the near future. Their lighter weight is not a big advantage in freight pullers. Sounds good for lightweight passenger travel, though.

    Here is Bombardier's own page on it and a photo of the locomotive.

    ---Mike

    1. Re:Now don't get too excited.... by sohp · · Score: 5, Interesting

      Yes, the old gas turbines. Fast and fuel-efficient at high speed, but it's a fact of life in railroading that locomotives spend most of their lives idling in one yard or another. UP found that they sucked fuel almost as fast idling as at full throttle. "The turbines burned about 90% of max HP fuel at idle so they would shut the turbine down going down longer hill. BIG THING, is you never stopped turning the turbine hot because the shaft was so long/heavy that it would sag when hot and you would never get it turning again. If you did it would be somewhat out of balance and shake the heck out of things." -- http://www.northeast.railfan.net/turbine_faq.html

      Cool engines though, and other than the fuel consumption at idle, they were successful experiments.

    2. Re:Now don't get too excited.... by transact · · Score: 1

      I believe the new technology here is that the generator/motor pair are AC with modern electronics between them providing control. This allows the turbine and generator to run at constant speed. More fuel is run in when under higher load. This should allow for more efficient use of the turbine.

      The older system used DC generators and motors where the the turbine had to change speed as load varied. This is what led to the inefficiences mentioned above.

    3. Re:Now don't get too excited.... by Gumber · · Score: 2

      I don't quite understand why a turbine locomotive would be low efficiency. Can't you operate them at an efficient RPM even at low-load thanks to the electrics?

    4. Re:Now don't get too excited.... by morcheeba · · Score: 1, Offtopic

      In unrelated news, green tribbles have invaded the US, starting with washington. It is not known if they'll reach Canada.

      (check out the picture of the train at yahoo)

    5. Re:Now don't get too excited.... by Glytch · · Score: 2

      Goddamn, I wish I had mod points. That deserves a +1 funny. I had to look twice at the image URL to make sure it wasn't from The Onion or Satirewire.

    6. Re:Now don't get too excited.... by morcheeba · · Score: 1

      thanks... it's a classic star trek episoides (description here), so I thought more people would recogonize it. I used to live a couple of metro stops north of union station, and let me tell you, I haven't seen plants like that wandering DC -- If they aren't tribbles, then I wonder what they are!

  15. Re:in case it gets slashdotted by aengblom · · Score: 3, Insightful

    It won't get slashdotted. It's a major news site.

    Mod this down. If you like the content, GO TO THE SITE.

    Take my karma when above comment is lower than mine

    --


    So close and yet so far from the world's perfect ID number
  16. Pikers by 0WaitState · · Score: 4, Funny

    Spokesman Warren Flatau of the Railroad Administration said the agency has invested $13 million US in developing the turbine-powered locomotive since about 1997. With Bombardier matching that, JetTrain has cost at least $41 million Cdn so far.

    Don't they know you have to charge the US Gubmint at least $500 million to get any attention? There's not enough pork in this project for it to go anywhere.

    --

    Remain calm! All is well!
  17. Re:this shouldn't have been accepted by /. by davisshaver · · Score: 1

    If you want stuff like that, turn on TechTV or go to their site. They are running a story on a elevator that travels from surface to the bottom of the ocean.

    --
    "What we have here is a failure to communicate"
    The Warden, Cool Hand Luke
  18. in true style, we'll shoulder the blame by SirSlud · · Score: 1

    Faster more fuel efficient railway transportation?! Blame Canada! :)

    --
    "Old man yells at systemd"
  19. An overhaul would be great in the US by Geminatron · · Score: 5, Interesting

    I hate flying. The cramped seats. The claustrophobia. The ridiculous rules about standing and walking around...

    I'd much rather travel by train, but it's always been much too slow. Even though these new trains are still slower than flying, they make up the difference quite a bit.

    A smooth, relaxing train ride where all seats are Business class or better? Sign me up.

    1. Re:An overhaul would be great in the US by Anonymous Coward · · Score: 0

      I would like them to get better terminals however. Run the trains like the airports. I have ridden a train from Michigan to New Mexico and it only took 14 hours (plus a 4 hour layover) if I remember correctly. It takes 28 to drive and you have to stay at a hotel 1 or 2 nights. And it only takes 4 to fly. If they could get the time by train down to 10 and let me bring more bags than by plane for less money it may be a good way to travel again.

      I still think elecromagnetic tracks from LA to New York, Seattle to Miami would be the best.

    2. Re:An overhaul would be great in the US by Anonymous Coward · · Score: 0

      "only" 14 hours?

      "only" 10 hours?

      And all for the same price as flying? Screw that. Sign me up for flying.

      Now if they would only let me fly the plane I'd be happy.

    3. Re:An overhaul would be great in the US by hey! · · Score: 2

      For train service to succeed in this country, the things that need to be addressed in order of importance:

      (1) Price
      (2) Reliability
      (3) Comfort and Amenities
      (4) Speed.

      Price: In some ways, train and air travel are fungible: they get you from point A to point B. Therefore they should cost the same. If I am on business travel, and I take the train, I have to justify the cost differential. As long as this is the case, business rail travel will be limited.

      Longer trips with sleeping accomodations should cost the same as air travel plus a night in a hotel.

      Reliabilty: Trains should be the most predictable form of travel. I've personally taken the train back from NYC to Boston during raging nor'easters that snarled up air travel, and arrived within half an hour of schedule. I've also taken the same train during perfectly clear weather and arrived five hours late. People used to set their watches by the time the train went by, but Amtrak seems incapable of running a reliable service. A friend who travelled to Japan reported that he could find his train platform easily by noting when the train was scheduled to arrive; the train would pull up literally with a few seconds of that time.

      A lot of the misery of business travel is in the uncertainties. I travel a lot for business and I literally have nightmares about air travel. It's never about planes falling out of the sky, it's always a horrible snafu with connections. Amtrak is, unfortunately, no better than air travel in this regard.

      Amenities and Comfort: Air travel time is down time. Rail travel time is productive time. I have a customer who likes to travel by rail, so I've taken trips to trade shows with him, and got lots of business done in the nice glass top observation car. In fact, it's so good having a customer to yourself in a comfortable and interesting surroundings that it'd be worth it for companies to pay their customer's fares in situations like this. Trains already have air travel beat when it comes to comfort, but they really should sell the train as a way to get work done as you travel. Their should be high speed internet access, and their should be business services like fax and printing on board.

      Speed: The advantage of speed is that it expands the range of distances over which rail travel is competitive. Right now, I'd consider rail for trips that are between 200 and 500 miles. Under 2090 miles, I'd probably drive; the hassle of renting a car or getting a cab for the last part of the trip would negate any advantages rail would have. Over 500 miles, and I'd probably take a plane because of the time involved. If we imagined a world in which trains were twice as fast, I'd probably consider rail for trips from 150-1000 miles.

      However, I rank speed as last, because it is simply not likely that we'll get anything like a doubling of speeds anytime soon. At best we'll see marginal improvements in speed, which will be wiped out by reliability problems. I'd rather travel Boston to NYC in five hours guaranteed, than have the trip range from four to eight hours.

      --
      Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
  20. Fuel efficiciency by Sivar · · Score: 1

    Gas turbines (perhaps not the exact same thing as the article is talking about) were tested decades ago in cars. While they produced more power and created mostly non-toxic exhaust (i.e. you can live in an atmosphere of gas turbine exhaust for hours or more, but only a few minutes in conventional gas engine exhaust), they fuel efficiency was found to be terrible. 1.5-3MPG. If the two techs are the same, it looks like this problem has been largely solved.

    As an added FYI, the Army's M1 tank uses a diesel turbine that produces >1200HP (not that horse power is really a very useful measure of power, but I don't recall the torque numbers), but its gas mileage is... Not that great. :)

    Certain car companies are apparently still interested in the technology though, regardless. (not goatse.*, I promise)

    --
    Computer Science is no more about computers than astronomy is about telescopes. --E. W. Dijkstra
    1. Re:Fuel efficiciency by Anonymous Coward · · Score: 0

      As an added FYI, the Army's M1 tank uses a diesel turbine that produces >1200HP (not that horse power is really a very useful measure of power, but I don't recall the torque numbers), but its gas mileage is... Not that great. :)

      Horsepower is exactly a measure of power. The torque can be whatever you want. It just depends on the speed you extract said power.

    2. Re:Fuel efficiciency by HeghmoH · · Score: 2

      The main reason the M1 is so fuel inefficient is because it weighs forty tons and does most of its driving on rough terrain. Gas turbines can more efficient than internal combustion engines, so they should produce better mileage. Clearly there are other factors involved, but there's no reason they would inherently give worse mileage.

      --
      Mod down posts with a "Free Mac Mini/iPod" sig, they're spam!
    3. Re:Fuel efficiciency by demonbug · · Score: 1

      actually, I think the M1 weighs closer to sixty tons, but same difference...

    4. Re:Fuel efficiciency by ivrcti · · Score: 1

      As an ex-M1 platoon leader, I can tell you the reason they were so bloody thirsty is the weight as you pointed out, but also that the turbine ate more fuel idling than doing 40. Since the tank actually spends most of it's time sitting still, with the engine running to power the infrared vision, it's the idling that killed you. Now they are putting small diesel generators in the back (APU's) that make a big difference.

    5. Re:Fuel efficiciency by Anonymous Coward · · Score: 0

      I dont remember the weight of the origional M1, but it's not that terribly much less than the M1A2, which weighs in at right about 70 tons, without combat load. The engine in it is a 1500 hp turbine that guzzles fuel. It takes ~7 gallons of fuel just to start the engine. Once started, it's fairly quiet compared to a diesel. And it'll use most diesel-based fuels without issue. I've generally seen it running JP5, which iirc, is the same fuel they use for helicopters. As far as I can tell, it certainly burns a lot cleaner than conventional diesels with regard to particulate matter.

      IAATC ( I Am A Tank Commander )

  21. This is silly. by mumblestheclown · · Score: 1, Insightful
    There is a country (Japan) that spends hundreds of millions of dollars a year on train design research and has hands down by far the most effective rail network in the world from everything from technical efficiency of trains to timeliness.

    Because of Japanese expertise in this area, other countries (other asian states, some european) either licence the technology outright or tap the experts to develop their own technology (recently China and Korea are doing this).

    The problems the US faces are known quantities. Why re-invent the (fly-) wheel? The comparative advantage of nations is real. The US should shelve its hubris and buy a proven japanese design rather than investing in more white elephants.

    1. Re:This is silly. by SoCalChris · · Score: 5, Insightful

      There is a country (Japan) that spends hundreds of millions of dollars a year on train design research and has hands down by far the most effective rail network in the world from everything from technical efficiency of trains to timeliness.

      Because of Japanese expertise in this area, other countries (other asian states, some european) either licence the technology outright or tap the experts to develop their own technology (recently China and Korea are doing this).

      The problems the US faces are known quantities. Why re-invent the (fly-) wheel? The comparative advantage of nations is real. The US should shelve its hubris and buy a proven japanese design rather than investing in more white elephants.


      You missed the whole point of the article. All of Japan's (And Europe's) high speed trains are electric powered. For the US to use these technologies would require a huge investment on upgrading the current track to electrified. This engine will work on any track, and will save quite a bit of money in the long run if it actually works as described.

    2. Re:This is silly. by Anonymous Coward · · Score: 0

      other than of course, the fact that their rail network hasn't been around since the 1800s.

    3. Re:This is silly. by El+Cabri · · Score: 2, Interesting

      Because of Japanese expertise in this area, other countries (other asian states, some european) either licence the technology outright or tap the experts to develop their own technology AFAIK France has not licensed any ShinKanSen technology nor hired any Japanese expert to develop the TGV, which also goes much faster than its Japanese counterpart. Actually it's the French tehcnology that Bombardier licenses to build the Amtrak's Acela. The Germans have developped their own bullet train also, and are currently looking into maglev. The Italians also have their own, the Pendolino, which is based on active tilting for being able to take tight curves instead of building new routes.

    4. Re:This is silly. by f97tosc · · Score: 2

      The US should shelve its hubris and buy a proven japanese design rather than investing in more white elephants

      Actually there are good reasons for using different technologies. Japan is very small and has and the railroads are all electrified.

      One of the main advantages cited by the article was that this technology would make it possible to keep 'using existing track and without the prohibitive cost of electrifying rail networks.'

      Tor

    5. Re:This is silly. by MyHair · · Score: 2

      For the US to use these technologies would require a huge investment on upgrading the current track to electrified.

      Which, of course, is not as cost effective as it would be in Europe or Japan because the US is less densely populated.. (For those of you who thought: "well, why not do it right the first time?")

    6. Re:This is silly. by aaarrrgggh · · Score: 2

      How much work is it to electrify the track, compared with upgrading the rails themselves to support high speed trains?! Keep in mind, of course, that current trains slow down to a maximum of 50mph (memory serving) when they are within city limits, how much would it cost to eliminate grade-level crossings for a network of high-speed trains?!

      I can't imagine that the premium for providing an all electric system would grossly outweigh the improved efficiencies.

    7. Re:This is silly. by buck_wild · · Score: 1

      Why are they doing this then, since the tracks that are already there are not sufficient to get more speed than they already get with diesel?

      What's the point of retrofitting turbine engines to get speed, when they're essentially plotting their course on an unpaved coutry road?

      --
      If all you have is a hammer, everything looks like a nail.
    8. Re:This is silly. by Fulcrum+of+Evil · · Score: 2

      Presumably, they save on fuel costs.

      --
      "We returned the General to El Salvador, or maybe Guatemala, it's difficult to tell from 10,000 feet"
    9. Re:This is silly. by Anonymous Coward · · Score: 0

      Reminds me of this

  22. Looks cool! by snowlick · · Score: 1

    Here's a promo shot from the manufacturer:
    Train of the future

    I think we'll be seeing more of this in the future. It seems that security on these trains are very tight, but they are remarkably easy to stow-away on. Supposedly they can go on total lockdown in a few seconds, while timers pop up in each car, and they are all flooded with dark red light.

    snow

    --
    Crystal Meth: Would you ingest somthing made from a poisonous gas and an explosive metal? You do it every day -- Salt!
  23. Make your own jet engine by PhysicsScholar · · Score: 3, Funny

    Few know that the first practical gas turbine was made by a couple gentlemen who weren't even sure that it would actually work.

    But, these days it's almost a trivial task to make your own. Jet engines take air in the front at low speed and chuck it out the back at high speed.

    So, with that in mind, I could easily throw one of these together over a lunch break. All you need are a propane torch, a ten centimetre square sheet of foil, one of those hole punches, and a five centimetre square of brass metal.

    Make the nozzle fairly long for more power. If you want to have a nice methane-excretion sound like some teens' automobiles, poke a few dozen holes on the inside of the nozzle.

    Remember that Force = Mass * Acceleration as well as what time your girlfriend will be home so that you don't have to sleep on the couch that night.

    --

    Department of Physics and Atmospheric Science, Dalhousie University, Halifax, N.S., Canada, B3H 3J5
    1. Re:Make your own jet engine by Anonymous Coward · · Score: 0

      Stop getting excited when you hear the words "jet engine." A jet engine is based on a turbine. Ever hear of windmills? Those are turbines. A turbine is a mechanical device that converts liquid kenetic energy (e.g. wind), to rotational energy (torque).

      The only benefit I can see in using a turbine engine as opposed to a piston engine is that energy does not need to be converted from liquid to linear (pistons) then to rotational, but that's just academic.

    2. Re:Make your own jet engine by Tablizer · · Score: 4, Funny

      Stop getting excited when you hear the words "jet engine."

      Stop trying to ruin my action-packed vision of a mass winning of the Darwin Award.

    3. Re:Make your own jet engine by Anonymous Coward · · Score: 1, Informative

      Umm.. I think the mass/power ratio is another benefit. There's a reason these things are used on planes and its not because the engineers couldn't figure out how to make a piston work.

      In reference to a plane the mass/power ratio is very important. In locomotives cost/HP is much more important. Of course cost includes initial cost, operating cost, maintance cost, oppertunity costs due to unexpected downtime etc.

      I suspect the total cost of ownership is the reason we don't see these all over the place now. When it comes down to numbers, it is just cheaper to use the old technology.

  24. It's the government by p_rotator · · Score: 1

    Actually the problem is that the big auto companies have paid big bucks to Washington lobbyists to block any such rail travel improvements.

    In the 1970s, the first mag-lev trains were designed. (magnetic levitation, using the power of super-cooled hydrogen shot through a jet nozzle to propel a train hovering over a hyper-metallic track). The US Congress nearly passed legislation requiring each state to reserve a percentage of its budget to implement such an infrastructure. Unfortunately, the auto companies (GM/Ford/Dodge) "got to them" (the senators) before the Senate was able to vote on it.

    Honestly, I see no fast rail travel in our near future.

    1. Re:It's the government by f97tosc · · Score: 2

      In the 1970s, the first mag-lev trains were designed. (magnetic levitation, using the power of super-cooled hydrogen shot through a jet nozzle to propel a train hovering over a hyper-metallic track). The US Congress nearly passed legislation requiring each state to reserve a percentage of its budget to implement such an infrastructure. Unfortunately, the auto companies (GM/Ford/Dodge) "got to them" (the senators) before the Senate was able to vote on it.

      I am glad it got stopped. Even today, after the discovery of 'high temperature' superconductors and other break-through technologies these systems are extremely expensive to build and run.

      Don't take me wrong here, I would love to see a network of fast, clean maglev trains. But it has to be after technology makes it economically feasible rather than because some politician had a dream and decided to spend a shitload of tax dollars. Better to spend a reasonable amount on research instead.

      Tor

    2. Re:It's the government by Fulcrum+of+Evil · · Score: 2

      I would love to see a network of fast, clean maglev trains. But it has to be after technology makes it economically feasible rather than because some politician had a dream and decided to spend a shitload of tax dollars. Better to spend a reasonable amount on research instead.

      You need to spend the shitload of dollars to get the technology to a deployable state. If we just sat around waiting for stuff to become feasible, we'd never get anywhere.

      --
      "We returned the General to El Salvador, or maybe Guatemala, it's difficult to tell from 10,000 feet"
  25. I'm from montreal by neoform · · Score: 2, Interesting

    there was talk about these new bombardier trains being used to replace the current VIA rail trains that go between montreal and torronto.. i happen to live rather close to the tracks and i dunno if i want to hear a train flying down the tracks at 240kph at 11pm like the current VIA trains do.. :o/

    --
    MABASPLOOM!
  26. Mod this down by apankrat · · Score: 1

    I would like to see canada.com getting ./'ed.
    Or I will start copying CNN's articles and expect them to be modded up too :)

    --
    3.243F6A8885A308D313
  27. Acme Jet Engines has them by Anonymous Coward · · Score: 0

    just ask W.E. Coyote

  28. Turbine GENERATOR - sorry to pop your bubble... by dfung · · Score: 3, Interesting

    I guess they could be clearer, but I doubt this locomotive uses the jet engine for propulsion, rather it uses the jet engine to generate electricity that drives the same gigantic electric motor that moves the train today. Although the engine is a much higher-tech device to maintain than a diesel engine, it should be cleaner and possibly quieter as well.

    You can go faster because a turbine engine that generates the same kilowatts as a conventional diesel does will be lighter. Less weight can equal more speed.

    All that said, I'm not sure that "less weight" is a priority for most locomotives. If I remember correctly, the enormous weight of the locomotives is critical in pulling literally miles of loaded box cars up an incline. Of course, passenger trains are packed with very low density compared to freight, so maybe that's what this is for.

    1. Re:Turbine GENERATOR - sorry to pop your bubble... by dfung · · Score: 1

      Oh poo.

      OK, now that I've *really* read the article, I can see that this ISN'T a turbine generator.

      Duh.

      OK, how *does* this work then? Like a jet helicopter with a gearbox?

  29. Ancient History by Mystic+Smeg · · Score: 2, Interesting

    It's not that new an idea. British Rail's experimental APT-E train was gas turbine powered, back in 1972. However the line they were intended to be used on was electrified, and so this part of the project was abandoned.

    --
    "God is a being of terrific character...cruel, vindictive, capricious and unjust." Thomas Jefferson
    1. Re:Ancient History by El+Cabri · · Score: 1

      Note that the last time that anyone has looked at Britain as a role model for rail travel, the reign of Queen Victoria was yet to come.

  30. Trains as a broad social concept. by littlerubberfeet · · Score: 2

    For some people time is money.
    Oh well

    According to the articcle this seems to be mainly applicable to small freight trains and passenger trains. There s a huge valid market for these locomotives. The northeast coordoor would benefit greatly from higher speed trains, and they are a joy to ride on, much less hassle the La Guardia or Logan.

    The US rail system. It is a piece of shit. If we had viable transportation, there might be some more money to renovate the trains. They, despite their age, are a viable alternative to air travel. The Northeast coordoor and the SFO-LA routes are ripe for high speed trains. THis would do a lot to alleviate the crowding and security concerns involved with airplanes.

    --
    Sig (appended to the end of comments you post, 120 chars)
    1. Re:Trains as a broad social concept. by Mystic+Smeg · · Score: 1

      The North-East Corridor already has high speed electric trains.

      --
      "God is a being of terrific character...cruel, vindictive, capricious and unjust." Thomas Jefferson
    2. Re:Trains as a broad social concept. by Anonymous Coward · · Score: 0

      Acela is not "high-speed" the infrastructure is so crappy that it can only hit the top speed for 18 miles out of the total trip from boston to new york.

    3. Re:Trains as a broad social concept. by program21 · · Score: 1

      The trains are high-speed, but over most of the NEC there's something like an 80mph speed limit (the Acelas are capable of about 120, IIRC). I don't remember the reasons for this, although my guess is that the line was never designed for high speed trains.
      I ride the NJ Transit NEC trains sometimes, and when an Acela flies by it causes a fair bit of shaking in the NJT train. I assume this is one of the reasons the Acela runs slower than it's capable of.

      --
      This has been a test. Had this been a real emergency, we would have fled in terror and you would not have been informed.
  31. STOP PRESS: Americans play catch-up! by Anonymous Coward · · Score: 0

    Europeans have had gas turbine locos for decades.

    But the Americans have has gas turbine tanks for decades, so maybe that shows national priorities for technology rather than each continent's ability to impliment.

  32. This will never be effective by Anonymous Coward · · Score: 1, Funny

    If you think the roads are bad in your state, you should see some of the rails- sure, the railroads spend money on upkeep, but in many places the parallelness of the rails can deviate as much as 10 degrees and still be within spec.

    When trains encounter such areas of track, they simply slow down and take that spot "easy". Not ideal for high speed "bullet" trains.

    If the railroads decided to replace all the old section rails with ribbon rails, then you might have a different outlook on such a technology.

    Also, without being too much of a know it all, I'd have to point out that harmonic vibration of the railcars moving at such elevated speeds could cause a derailment for no reason other than the train was moving too quickly.

  33. leaving on a jet....... by 2000+Britneys · · Score: 1

    train the song just doesn't sound the same anymore

  34. Loco-tech FYI by Xunker · · Score: 2, Informative

    Just an FYI, in case anyone is interested; the vast majority of commerical locomotives in the USA are already, in fact, electric, and have been since the 1950's. The diesel engines are there, sure, but they are there to generate power to turn electric motors.

    This is because electric motors have many degrees more torque at low speeds than any comparable internal combustion engine.

    --
    Hilary Rosen's speech was about her love of money and her desire to roll around naked in a pile of money.
    1. Re:Loco-tech FYI by Anonymous Coward · · Score: 0
      This is because electric motors have many degrees more torque at low speeds than any comparable internal combustion engine.

      That's incorrect.

      When a train is under power, its engine remains at the same higher RPM. Low end torque has really nothing to do with it.

      If locomotives used a gearbox system, then the engine must change its revs from idle up to the gear change speed. For this application there would need to be lots of low end torque. However, the amount of torque would be so high that designing and maintaining a gearbox that can handle it would be rediculously expensive.

      By using an electric generator, the engine can constantly rev at its optimal speed, making the engine as efficient as possible ($ saved on fuel)
      There are no gears to strip/replace/maintain ($ saved on maintinence), and there is probably a higher power transmission rate from the engine to the wheels (FYI: stick shift gearbox will suck out 15% of your power).
    2. Re:Loco-tech FYI by Xunker · · Score: 1

      Okay. make a gasoline engine produce usable power without revving it, I dare you.

      What you said was also true about effiency, but the simple fact is electic motors can turn slower while still having torque whereas IC engines must spin faster.

      --
      Hilary Rosen's speech was about her love of money and her desire to roll around naked in a pile of money.
  35. Turbine. Pfffft. by El_Smack · · Score: 5, Funny


    I was in a secret railroad switch-house last week, and I stumbled upon a locomotive that had been sitting there since 1880. It was fusion powered. The reactor ran on GARBAGE no less! It could levitate and even looked capable of time travel. The security guard who let me in said his only instructions were to wait for a man named "Doc Brown" to show up.

    --


    There are 01 kinds of cars in the world. The General Lee, and everything else.
  36. It got better... by Anonymous Coward · · Score: 0

    There were 3000 new job vacancies in the Manhattan area alone a week later!

  37. Already in use!! by prock307 · · Score: 3, Interesting

    I have seen several Freight Trains powered by gas turbines.

    http://www.railpower.com/2support/locomotives.ht m

  38. speed by trchub · · Score: 1

    This adds even more meaning to the Grateful Dead lyrics... "Driving that jet-train, high on cocain, Casey Jones you better, watch your speed!"

  39. Wow by Konster · · Score: 1, Offtopic

    Imagine if we could get one of these to power a Beowulf Cluster!

  40. Re:this shouldn't have been accepted by /. by sstory · · Score: 0, Troll

    whomever modded this should be able to distinguish negative from troll and offtopic. the train story was retarded, boring, and irrelevant, and should not have been accepted.

  41. Existing rail networks by Wonko42 · · Score: 4, Insightful
    They should make more of a point that the North American railway system needs a major overhaul in order to support faster trains.

    Is it too much to ask that submitters read the article they're submitting? The entire reason this train was developed is so it could be used on existing tracks with a minimum of modifications. It's right there in the second paragraph of the article: "Bombardier believes its 240-kilometres-an-hour JetTrain is the answer to providing high-speed rail service throughout North America using existing track and without the prohibitive cost of electrifying rail networks."

    1. Re:Existing rail networks by Anonymous Coward · · Score: 0
      The entire reason this train was developed is so it could be used on existing tracks with a minimum of modifications. It's right there in the second paragraph of the article: "Bombardier believes its 240-kilometres-an-hour JetTrain is the answer to providing high-speed rail service throughout North America using existing track and without the prohibitive cost of electrifying rail networks."


      For those who are a little slower than others...


      Electrification is not the only thing that allows trains to run fast on tracks. For speeds of 150 mph (240 km/h), the tracks ned to be much straighter that the ones in the U.S. generally are; also, they need increased amounts of support (probably no more wooden railroad ties, as these allow the track to move to much as the train rolls across), and smoother track (probably welded track, or you are going to be destroying the tracks at every joint). Remember, a train running at 150 mph would exert about 3.5x the force on the track as the same train running at 80 mph. Even without electrification, to achieve sustainable high speeds over long distances would require a significant expenditure in improving the railways.

    2. Re:Existing rail networks by Wonko42 · · Score: 3, Informative
      For those who are a little slower than others...

      So I take it you designed this train, then? Because the manufacturer says existing rail networks can be used, and I'm more inclined to believe the manufacturer than I am an anonymous coward...

    3. Re:Existing rail networks by Anonymous Coward · · Score: 0

      You're still wrong. Building high-speed rail lines is difficult and _hugely_ expensive; currently the British government are upgrading one rail line along the West coast so that trains can run 15mph faster (125 to 140mph, I believe)... the cost of merely doing that would build tens of thousands of miles of new six-lane highways, which would alleviate most of the country's traffic congestion problems.

      The reason why Amtrak is one of the few profitable or near-profitable rail systems in the world is that the trains are mostly slow freight; they don't need expensive rails and continual maintenance on tens of thousands of miles of track. Trains are inconvenient, inefficient, slow compared to planes, and utterly non-viable for anything other than commuter traffic in and out of large cities.

    4. Re:Existing rail networks by Anonymous Coward · · Score: 0

      Well, here's another anonymous coward telling you you're a fool. I've worked for a Bombardier subcontractor on the Acela high-speed trainset project and I can tell you Bomabrdier is a bunch of crackmonkeys. Oh, excuse me, "craquemonkets".

  42. What about heat? by krangomatik · · Score: 3, Interesting

    I had read about early attempts to use this technology to power trains, but I seem to recall some heat dissapation problems. I believe it was when these locamotives were stationary beneth things like overpasses and tunnels that they had problems with the output from the jets burning/melting things. My guess would be that they solve this using some of the same technologies they use to reduce the heat signature of aircraft.

    1. Re:What about heat? by delta407 · · Score: 2
      My guess would be that they solve this using some of the same technologies they use to reduce the heat signature of aircraft.
      Oh, come on, a few modern heatsinks could easily handle that.

      Really now, it's just a jet engine, not an Athlon. ;-)
    2. Re:What about heat? by Phosphan · · Score: 1

      They've been using turbines in the M1 tanks for years. If you can handle it in a tank, you can definitely handle it in a locomotive. The main problem in the M1 is the thirst, but it seems like modern turbine engines (at least those of the size a locomotive needs) don't have that handicap.

  43. Via's Turbo Train by Railroader · · Score: 5, Informative

    This isn't the first gas turbine locomotive that Bombardier has built. Back in the 70's and early 80's Via (Canada's Amtrak) had a gas turbine train (called the "Turbo") operating between Montreal and Toronto that was built by Bombardier. It wasn't as reliable as diesel engines and didn't offer any particular advantages. Gas turbine engines are considerably lighter than diesels and perhaps a bit more fuel efficient, but light weight isn't very important for a locomotive. I remember once watching the Turbo getting towed through Belleville ON by a diesel unit because there was a couple of inches of snow over the rails and the Turbo couldn't plough trough it.

    1. Re:Via's Turbo Train by Anonymous Coward · · Score: 0
      Gas turbine engines are considerably lighter than diesels and perhaps a bit more fuel efficient, but light weight isn't very important for a locomotive.


      This depends on the application of the locomotive. For freight trains, you are right, there is little to be gained from making the locomotive lighter as the weight of the loco is usually insignificant compared to the weight of the cargo it is pulling. However, with passenger locomotives, the weight of the locomotive and the rest of the rolling stock makes up the vast majority of the weight being moved. Reducing the weight of loco and rolling stock can drastically reduce the running cost of the system; lighter loco and rolling stock also mean lower dynamic forces that must be delt with by the track, which means lighter (and cheaper) construction of high-speed rail links. IF yo ulook at high speed rail locomotives in other countries (ICE, TGV, Shinkansen), weight is a significant factor in the design of the trains (hence such things as shared bogeys, lightweight aluminum alloys similar to those used in aircraft, etc.). The thing that makes externally powered trains so efficient is that they don't have to bother with carrying around all that fuel and generating capacity, which saves tremendously on weight.

    2. Re:Via's Turbo Train by Pig+Hogger · · Score: 2

      It wasn't built by Bombardier (it was only making snowmobilles then), but by United Aircraft and Canadian Vickers in 1966. It was then leased to CN. VIA inherited it in 1977 and ran more or less it until 1984... But it was a nice train to ride, as the bar car was in the cab, so you could watch the track ahead (and grab your beer glass before the train would start to shake in curves)...

    3. Re:Via's Turbo Train by Anonymous Coward · · Score: 0

      Gas turbine engines are considerably lighter than diesels and perhaps a bit more fuel efficient

      Lighter, yes. More fuel efficient, no.

    4. Re:Via's Turbo Train by Qubertio · · Score: 1

      Amtrak also ran TurboTrains for a while, mostly on their Empire Service (New York-Albany-Buffalo), but stopped using them around the same time VIA did. NYSDOT has recently embarked on a plan to restore seven TurboTrains for Amtrak's Empire Service; the first is supposed to enter revenue service in early 2003.

    5. Re:Via's Turbo Train by Schaffner · · Score: 1

      The gas turbine trains that New York state is having rebuilt are Turboliners that were built by Rohr in the 80's, not the United Aircraft Turbo trains.

  44. Re:this shouldn't have been accepted by /. by kurtz25 · · Score: 5, Insightful

    Trains are nearly obsolete? Gee, try telling that to the rest of the developed world. Most Japanese people ONLY use trains. The way to get around Europe is on the trains. In fact, it is not TRAINS which are obsolete, but the US and Canada, who still have these ridiculous diesel engines that are just not suited to getting people around (I had the misfortune--or the adventure--of geting around China for a month on diesel trains--30 hours from Canton to Shanghai; ugh). North America needs to jump on the railway bandwagon for a lot of reasons, most importantly to reduce energy consumption and associated air pollution. You may not realize it, but as much as gas costs now, it's STILL far, far less than what the rest of the world pays, thanks to a fossil of a fossil-fuel-hungry government. Unfortunately, this train doesn't really address that issue very well, as it still uses fossil fuel (albeit less than all those passengers driving SUVs). To really clean things up, we need electric trains, like the rest of the developed world. From a convenience standpoint, however, this train--should it be accepted by the public, which it won't be, since we all love our farcical SUVs so damn much--would make life a whole lot easier. Instead driving hours to get up to my meeting in San Francisco next weekend, I could sit on a train, kick back, drink a beer, read some news on my PDA, watch the scenery fly by, take a nap, and wake up refreshed and ready to work. I would not have had to deal with bastard drivers, getting lost, or even paying attention to where I was going. I also would not have had to be security screened, sniffed by drug dogs, had my fingernail clippers taken away, or sit in a cramped, loud seat in a fart-smelling plane. Trains are the way to go for short-to-medium length trips, and people like you, with your 1950's idea of the railroad, are the people who keep it from happening. Go on, spend some time abroad. Take advantage of other countries' great train systems. If you come back still thinking trains are "obsolete," I'll refund you the cost of reading this post. ;)

  45. Re:Umm, have we invented electricity yet? by f97tosc · · Score: 5, Insightful

    You know, the state of North American railways is in many ways worse than in some third world countries. Why can't we get proper electic locomotives like everyone else has?

    Because North America is very big, and relatively sparsly populated. It is not at all certain, that electrifying the entire grid is an economically optimal solution. In remote areas there are no power plants, so either you have to construct new ones in the middle of nowhere or the power has to go through very long cables (which causes a lot of losses).

    Tor

  46. Steal the French... by BSDevil · · Score: 2, Interesting

    Something I've never understood about plans for building high-speed rail networks: if you're gonna go and build on, then you're allready willing to spend a huge amount of money. Why not spend a bit more and get a system that works; i.e. go to the SNCF office in Paris, throw money at them and say "we'd like to borrow the entire TGV developing team for a few years" and then set them to work. SNCF introduced a whole new high-speed line (the TGV Mediteraniee) about a year and a half ago and it was running right on schedule within a few weeks after launch (or as much of a schedule as the French railway has). Acela's been going for how long without fully working?

    If you want a practical high-speed rail network, go get the French or the Japanese and be prepared to spend a huge amount of money, both on initial capital and maintenance. SNCF has like six TGV trains who just drive the rails constantly looking for cracks and fissuers - as a result, every inch of track on the network is rechecked every two months, if my memory severs me correctly.

    --
    Cue The Sun...
    1. Re:Steal the French... by program21 · · Score: 1

      The TGV is electrified, the main attraction of these new locomotives is that they allow high-speed trains to run over existing track, most of which is non-electrified. Saves a lot of cost on electrifying an untold number of miles of track.

      --
      This has been a test. Had this been a real emergency, we would have fled in terror and you would not have been informed.
    2. Re:Steal the French... by cheshiremackat · · Score: 1

      Actually.... Bombardier makes the SNCF trains. They incorporated the technology into the Acela trains (d'oh)... the only change is in the bogies between the passenger cars... the FTA wouldn;t allow cars to be linked like that in the U.S. This is just the next generation. The Acela trains are both electric and diesel... This engine is better as it runs without caternary wires. I want to take one from Toronto to Montreal or Chichago... and for the noise... it could possibly be muffled, but atleast it is at the head of the train, not in the middle of the passenger compartment like on airplanes.

      --
      Bad spellers of the world untie!
    3. Re:Steal the French... by jmj_sd · · Score: 1

      Bombardier makes the TGV ? That would be news to Alstom, one of Bombardiers main competitors.

    4. Re:Steal the French... by ceo · · Score: 1

      It's a consortium of Bombardier and Alstom.

      While the Acela design uses a lot of TGV technology, a major difference is that the Acelas are much heavier, which is partially due to FRA regulations pertaining to how much compressive force a railcar or locomotive must be able to withstand. There's a lot less of passenger trians sharing tracks with long, heavy freight trains in Europe, so their regulations are less strict.

    5. Re:Steal the French... by Anonymous Coward · · Score: 0

      The Acela trains are AC propulsion only, unless they've started using Metroliners to fill in for the HST.

      The Acela high speed trainset is a unit. You cannot use anything other than the AC powercar to run it.

      You *could* use one of these new turbine-powered powercars to run it, since the pictures show something that looks identical to the Acela powercar only red.

  47. Trains and weight by thogard · · Score: 4, Interesting

    If you look at the weight of a fully loaded train and the weight of an unloaded one you will see they are very close. A light weight train car will weight in at 50,000 lbs and can carry less than 3 times that. When the average loads these carry are a few pallets and is typicaly less than 10% of the weight of the car. The result is a huge mass that gets moved and that takes energy.

    The reason train cars weigh so much is so they don't come off the track when they are pulled around corners. Even with the large radius curves on trainlines, the side forces of a mile long train with a fully loaded car at the back will be quite high. The early solution to that problem was to make the train cars weigh more and the result is now all trains cars fit into a standard weight. This also makes passenger trains weigh far more than they should. The US rail industry could save a major part of its energy bill by introducing a lighter train standard but that would cost a fortune in new rolling stock.

    1. Re:Trains and weight by Anonymous Coward · · Score: 0

      It is essential that the locomotive is heavy. The heavier the better, actually. The weight is needed to provide enough friction between the steel wheels and the steel track.

      Every fall it becomes apparent how important this is when trains are delayed by the falling leaves that form a slippary mass between the wheels and the track.

  48. One reason by Synn · · Score: 3, Insightful

    There's a lot of surface area in the US so there's a lot of open space to cover for any rail system.

    One reason Japan's rail system is so much better than the United State's is because Japan is just that much smaller of a country. And as for Europe, Texas alone probably equals the space covered by several European countries.

  49. Jet fuel != Rocket fuel by kfg · · Score: 3, Insightful

    Although many people seem to think of them in the same way. Jet fuel is a very close relative to diesel fuel. . . and kerosene, and in a pinch they can often be substituted for one another, so substituting jet fuel for diesel will have *no* effect on the enviroment, per se. However, burning jet fuel more completely than a diesel engine burns its fuel will, indeed, have a positive effect and is virtually soot free.

    You want a nasty fuel enviromentally? Very little is worse than ordinary pump gasoline.

    KFG

  50. Trains have other purposes... by Scott+Hale · · Score: 2

    Trains aren't just for carrying people, you know. The real beauty of a train is its ability to haul very large loads over long distances. It can carry a vast amount of material from one location to another relatively quick.

    1. Re:Trains have other purposes... by anzha · · Score: 3, Interesting

      That's true, however, note that I said that when talking about people moving, trains were dead. the military, for example, loves trains because it moves all their tanks that way.

      However, in cargo moving speed is not necessary. Aircraft handle the high speed, low volume traffice quite well.

      --
      Do you know why the road less traveled by is littered with the bones of the unwary?
  51. high-speed cross-continental train would be great by g4dget · · Score: 3, Interesting

    At around 200mph, easily achievable using current train systems if you got high speed rail all the way, you should be able to go from downtown San Francisco or LA to New York in 15 hours. That is actually not that different from air travel if you take into account all the overhead associated with air travel (security, parking, transportation to/from airport, etc.), and it's a whole lot more pleasant. With improved technology, perhaps one could even get that down by a few more hours. And trains don't fly into buildings either.

  52. Why this came out today... by bashibazouk · · Score: 2, Interesting

    A similar article in the San Francisco Chronicle brings light as to why this came out now. A 25 billion dollar project to link San Diego, Los Angeles, San Francisco and Sacramento by high speed rail is close to becoming a reality. Expect lots of cool new train tech to come out in the next few weeks as train powers that be duke it out for this sizable contract.

    1. Re:Why this came out today... by Anonymous Coward · · Score: 0

      And if you live in California, remember to vote to approve funding when the ballot measure appears, so that we can see all the cool new train tech actually being put to use at some point in the future (though I am kinda sad that they decided to go wtih conventional steel-wheel-on-rail rather that maglev. Oh well.)

  53. Calif. will be voting on High Speed Rail in '04 by Anonymous Coward · · Score: 0
    California will be voting on a $9.95 Billion bond measure to build a high speed rail system between LA and SF. Check out the official government web site

    so may be it will happen in your life time

  54. Re:Turbine. Pfffft. by Anonymous Coward · · Score: 0

    Just wait about six months--Slashdot will run your parody as news. They can be so crap-tacularly dumb when it comes to technology!

  55. Re:Umm, have we invented electricity yet? by ceo · · Score: 3, Informative

    Most heavily-used mainline railroads in the US do have continuously-welded rail. It's expensive and tricky to build correctly, so they don't bother with it on more lightly-used lines.

    Same applies to concrete ties, bi-directional signaling, centralized traffic control, and all the other technologies that make railroads run faster and more efficiently.

  56. Re:Umm, have we invented electricity yet? by El+Cabri · · Score: 2, Interesting

    Yeah, Amercia big and scarcely populated is always the argument for having shitty train, shitty cellphone, shitty powergrid, basically shitty everything that needs a massive and coherent investment in a networked infrastructure. Wouldn't it rather be the over-decentralization and lack of public funding for anything that is not a weapon that is to blame ? A high speed train from San Diego to Seattle would be profitable within a decade and instantaneously take half the market from airlines (not for going all the way from San Diego to Seattle, but from LA to SF, from SF to Seattle, etc). Scarce population in the rest of the country or not.

  57. what's next.... by morcheeba · · Score: 2

    Jet powered bikes? No, seriously, turbine generators are efficient and low-maintainence. Too bad all that waste heat can't be used more effectively (its used as a dryer or for general-purpose heating in some industrial applications). Check out this neat brochure.

    1. Re:what's next.... by satterth · · Score: 1

      waste heat... hmmm...

      maybe you should look at http://www.stirlingengine.com/ these things run on heat. We've got them on incinerators.

      --
      Being called a dork on Slashdot must be like being called the retard in special ed.
  58. Ayn Rand?? by Anonymous Coward · · Score: 0

    Atlas Shrugged... here we come.

  59. The problem with turbines for automotive use. . . by kfg · · Score: 3, Informative

    is that they don't throttle well. They like to rev up, to VERY high speeds, and stay there. When attempts were made to use turbines in racing cars it was found that this made them very effective for oval racing, but nearly useless for road racing. They're even more useless for road driving with it's stop and start patterns.

    They are, however, when used at constant rate, far more efficient than piston engines. This makes them good for turning generators.

    This would make them good for *hybrid* cars, in which there is renewed interest. In fact, the locomotives that are in question here are conceptually the same as a hybrid car.

    KFG

  60. Tanks too... by gnarled · · Score: 4, Informative

    The M1 tank has a turbine engine also. Generally these types of engines are used in applications where a high power-to-weight ratio is required and cost is not the issue.

    --
    I'm a firm believer in the philosophy of a ruling class. Especially since I rule. -Randal, Clerks
    1. Re:Tanks too... by Anonymous Coward · · Score: 0

      Almost, but you forgot some other considerations.

      They have nearly constant running speed. (Means no speed control by turbine throttle, but other means.
      And just as much fuel is used with the engine running, regardless of whether the train is moving or not.

      The exhaust gas is _very_ hot.

      They are noisy.

    2. Re:Tanks too... by snoopdalf · · Score: 2, Interesting

      Jay Leno recently wrote in the Popular mechanics about his experiences riding a turbine powered motorcycle...

    3. Re:Tanks too... by Martin+Blank · · Score: 2

      That motorcycle also cost US$37,000.

      --
      You can never go home again... but I guess you can shop there.
    4. Re:Tanks too... by snoopdalf · · Score: 1

      Fuel consuption on that baby is 4-6 mpg. Performance of the engine is 320-350hp and 450 ft.-lb of torque. Baaaayyybeeeeee...(whhooOOOOSHHH) YAAAAAHHHHH... glugglugglug... empty...

  61. Jet train tests in 1966 by jdoff · · Score: 2, Informative

    Here's some information about the jet-powered M-497, tested in 1966 by New York Central. There's an interesting article about it in the Fall 1999 issue of Invention & Technology, if you have access to a copy.

    Anyway, you've got to check out the pictures:

    http://www.trainweb.org/railpix/ampix/nyc-m497s1.j pg
    http://www.trainweb.org/railpix/ampix/nyc-m497run1 .jpg

  62. Gas Turbines at Sea by KFury · · Score: 5, Interesting
    Someone previously mentioned the gas turbines powering Aegis-class destroyers, but I'd also note that they're now starting to be used in cruise ships as well.


    I had the chance to cruise on the Millennium last year, which has two gas turbine engines hooked to electrical generators which both supply energy to the ship's power grid and also power the motors driving the propellers. I'm sure kilotonnes of ship will help silence the engines, so I can't speak to noise, but they were amazingly vibration-free, unlike more common deisel engines with a direct physical linkage from engine to drivetrain to prop.


    I'm not sure how that translates to train use, but I'm curious to find out. Considering that they'd probably provide electricity to power the wheels, I wonder if a sufficiently sized flywheel arrangement or battery bank could mean that the engine could operate at constant speed, preventing the frequent idleup and idledown which creates a much more distracting noise at a distance than the noise of a constant engine...

    1. Re:Gas Turbines at Sea by Anonymous Coward · · Score: 0

      Even diesel engines in trains provide eletricity for the wheels.

      No reason why a ship couldn't do that for smoothness.

      Despite what some turbine people claim, diesel tends to be more effient and is dead solid reliable (unlike turbines with all the incy-wincy breakable parts). That's why diesel is used so often.

    2. Re:Gas Turbines at Sea by jpmorgan · · Score: 2

      The Canadian Halifax-class Guided Missile frigates (yes, we have missile frigates) has a pair of gas turbines that generate combined about 100,000 shaft horsepower.

      And when it comes to military and cruise ships, you don't find a lot of big boats with a direct drivetrain between the engines and the prop. Most go to electric for finer control.

    3. Re:Gas Turbines at Sea by Janne+Kyllio · · Score: 1

      Here in finland gas turbine ferries were planned in 70's to travel across the Baltic sea. Only one was made, though, due to the energy crisis I guess.

      The Finnjet was built in 1977 and was the fastest and the biggest ferry at the time in the world. Finnjet has AFAIK three gas turbine engines connected to a screw vie complex gearbox. Gas turbines are driven at full power and when less power is needed, one engine is shut down. Or two engines. Point is to run all engines that are on at most fuel efficient rpm and only change number of running engines when different power level is needed.

      I'm not sure if that technique can be applied practically to trains as well.

      I guess idea using gas turbines in ferries had something to do with finnish navy having two Turunmaa-class corvettes built in late 60's that had Rolls-Royce gas turbines.

    4. Re:Gas Turbines at Sea by Slashamatic · · Score: 2

      Go to St Pete (not the FL one) and take a trip around the harbour. There are the hulls of massive hovercraft in the naval yards. The propulsion seems to have been gas turbine, but using direct thrust rather than a turbo-prop like the British SRN4 (used for Cross-Channel ferry). This also appeared to be at least twice the size of the SRN4.

  63. Re:Who's going to pay for it? by Maul · · Score: 2

    I doubt it would be Amtrak. I say let Amtrak die.
    Let a new company with new vision and an eye towards the future of transportation develop a high tech train system in America. We don't need old companies to make a new train system.

    --

    "You spoony bard!" -Tellah

  64. Locomotives have to have the weight by A+nonymous+Coward · · Score: 2

    or they can't pull. Coefficient of friction between steel tires and steel rail is abysnally small, that's why they are so efficient, but also why they can't climb steep grades, and why the loco needs all that weight. Other cars could benefit from less weight, but not the loco. not the driving wheels at least.

    1. Re:Locomotives have to have the weight by sirinek · · Score: 2

      Its cool though if you put a sanding station at each of your stops along the way!! 8D
      siri

  65. Electric or Jet ? by Anonymous Coward · · Score: 0

    More than a hundred french TGV (=> 300 km/h capable) trains are running in Europe. First TGV prototype did run with a jet engine and they switched to electric soon thanks to advances in power electronics and innovative use of alternating current for traction.
    During 2003 Madrid - Barcelona (630 km)will be linked with a train at 350 km/h cruise speed (some trains manufactured by german Siemens and others by spanish Talgo)of course they all will be electric.
    I think this design based in jet engine power is a step back.
    Regards.

  66. Re:Who's going to pay for it? by bashibazouk · · Score: 1
  67. Link? by MyHair · · Score: 2

    Most city buses now use turbines for their engine and they aren't that loud.

    Which city? Which buses? Do you have any links? I'm curious.

    The ones I've heard lately don't sound like turbines.

    1. Re:Link? by SoCalChris · · Score: 2

      Here is the only link I could find off hand (PDF document though) http://www.isecorp.com/pdfs/Vol2_Issue_5_withAward .pdf. These buses are all over downtown LA.

  68. Re:Umm, have we invented electricity yet? by f97tosc · · Score: 1

    A high speed train from San Diego to Seattle would be profitable within a decade and instantaneously take half the market from airlines (not for going all the way from San Diego to Seattle, but from LA to SF, from SF to Seattle, etc).

    What do you base this claim on? If it is true, why are not the privately operated train companies constructing such a line?

    Tor

  69. American railway system? by tit4tat · · Score: 2, Insightful

    The submitter noted that "...the North American railway system needs a major overhaul in order to support faster trains." Frankly, I wonder if that's likely.

    Even without regard to the current economic climate, no one (especially the U.S. Federal government) seems too interesting in overhauling the railway system. Rail travel is great, but Amtrak has been begging to cease service on many, many routes because, for the most part, people don't ride trains anymore. Most travellers seem to feel that flying is cheap (enough) and safe (enough), and even with the new airport security measures, flying is faster than train travel.

    As for cargo trains, previous posters correctly observed that faster cargo transport is not a compelling need.

    Just my 2 cents.

    1. Re:American railway system? by HeghmoH · · Score: 1

      On many routes, taking a plane is cheaper. And given Amtrak's safety record, the plane is most likely safer, too. (I've read that the chances of dying on any given plane trip is one in a million... anybody know if that's right?) Not to mention that unless your route is quite short, the plane will be faster. So the advantage of the train is that you have a bigger seat and the ground is lots closer. Plus there's no chance that anybody will take it over and drive it into a building. Give the advantages/disadvantages, is it any wonder nobody takes the train?

      --
      Mod down posts with a "Free Mac Mini/iPod" sig, they're spam!
  70. Been there done that by Anonymous Coward · · Score: 0

    This has already been done BTW. In Canada in the year 1967 they made such a train for Canada's 100th birhday and yes it worked it went right across the country. I think it's been scrapped now.

  71. Rail service by ces · · Score: 5, Insightful

    I don't know if you are familiar with rail service in Europe but it is a good alternative to flying or driving. For example high-speed rail is considered THE way to travel between Paris and Brussels.

    There are train corridors that already are quite popular such as Vancouver BC-Seattle-Portland, Boston-NYC-DC, and LA-San Diego. Many areas have corridors they would like to see higher speed, more frequent, and more reliable service. In some cases the states and cities are even willing to invest their own money (YVR-SEA-PDX Talgo service).

    If I want to travel between Seattle and Portland (about 200 miles) I have 3 options:
    1. Fly, 1hr to get to airport, 2hrs to clear security and check in, 1hr for flight, .5 hr to get into downtown Portland. 4.5hrs total.
    2. Drive, about 4 hours, 6 or more during rush hour or if there is an accident.
    3. Train, .5hr to station, .5hr to .25hr waiting for departure, 2.5hr train ride, .25-.5hr to get to destination in Portland. 3.5hr-4hr total.
    and trains don't require a body cavity search.

    If we were willing to invest even a fraction of the total subsidies given to either the auto industry or air travel industries in passenger rail services people actually wanted to use we could probably achieve ridership rates approching Europe.

    --
    Happy Fun Ball is for external use only.
    1. Re:Rail service by Anonymous Coward · · Score: 0

      Take you 4 hours to drive 200 miles? Either you're driving in traffic the whole way, or you drive like my (late) grandpa. 200 miles at 70mph=2.8 hours travel time.

    2. Re:Rail service by nelsonal · · Score: 1

      Trains will requre just as much security after some idiot takes control of it and derails it into something important.

      There are a whole lot of people in the middle of the country that will probably never ride trains. Autos don't get much in subsidies anymore, besides the highway system, which was built for its defensive attributes, I can't think of too many other subsidies to the auto industry, especially net of all the taxes that are levied on auto companies, auto licensing, gas, and tolls. Pasenger trains recieve billions worth of subsidies, the only routs that make money are the corridors you mentioned. And lots of land was given to the rail companies to build the original rails. Air might get more subsidies, those rural air service subsides are quite large. And having airports built by cities helps.

      Yes, trains make a lot of sense, especially along both costs, and as a cargo hauler, but passenger rail service to the middle of the country will probably never replace autos or busses on the highway system.

      --
      Degaussing scares the bad magnetism out of the monitor and fills it with good karma.
    3. Re:Rail service by Hadlock · · Score: 1

      the problem is that many people live in seattle, wa, and want to go to disneyland, ca or disneyworld, fl, not just somewhere where you can drive in the same time it takes to find a train station, buy tickets, and then board, travel, get off, and then rent a car b/c you didn't drive and thus have poor personal travel options inside the city.

      airlines kick ass when it comes to distances of thousands of miles that need to be traveled in less than a day. of course in europe, it'd different, where the population density is alot higher and your buisness isn't thousands of miles away and a train to the next town is about as far as you're ever going to go

      --
      moox. for a new generation.
    4. Re:Rail service by rodgerd · · Score: 2

      If you can't think of protectionism in the auto industry, you ought to be looking at it's immunity to externalities that many other industries don't enjoy, import restrictions for non-US auto manufacturers, and the fucking about with the steel industry.

      And a quick visit to snopes will debunk the idea the highways were built for defense purposes (in the US, anyway).

    5. Re:Rail service by nelsonal · · Score: 1

      Alright, autos do get plenty of protetion from imports, but I would guess that over the history of the country train service has recieved more, they were parceled out large chunks of land in exchange for building their rail lines. I think its just that most of the subsidies for autos and air service are quite recent, while the rail subsidies occured many years ago. I'll go check snopes now, thaks for the info.

      --
      Degaussing scares the bad magnetism out of the monitor and fills it with good karma.
    6. Re:Rail service by ka9dgx · · Score: 3, Insightful
      As a daily communter on the last intra-urban electric railway in the US, I can tell you that ridership has actually hit peaks not seen since 1960. The South Shore Railroad has really done a nice clean up job, thanks to some local involvement of people with foresight.

      Riding the South Shore is usually a wash, in terms of time. However, in terms of sanity, its a lifesaver. I can use the time to read, write, talk with friends, or sleep, all safely and conviniently. Its like getting 1.5 free hours per day.

      --Mike--

    7. Re:Rail service by N+Monkey · · Score: 3, Insightful

      I don't know if you are familiar with rail service in Europe but it is a good alternative to flying or driving. For example high-speed rail is considered THE way to travel between Paris and Brussels.

      Not just Paris and Brussels but London as well despite the fact that the train currently runs at about 1/2 speed between the 'chunnel' and London. (The high speed link is still under construction).
      Although the train doesn't travel quite as fast a plane, :-), you save a lot of time in other ways.
      The stations are closer to the city centres (i.e. in them!), the 'check in' is fast and you don't have to wait for you luggage to arrive (pulversised) on the baggage carousel.

    8. Re:Rail service by LWATCDR · · Score: 1

      f we were willing to invest even a fraction of the total subsidies given to either the auto industry or air travel industries in passenger rail services people actually wanted to use we could probably achieve ridership rates approching Europe.

      1. Until Sept 11th there where very few subsidies to the Air Travel industries.
      2. Per passenger mile traveled we are spending a lot more on passenger train travel than air travel.
      3. Passenger trains just do not work as well for the US as Europe and never can. I live in Florida and so far this year I have been Seattle, Dallas, Ohio, New York, and New Orleans.
      Only the New Orleans trip could be replaced by a train trip. As to some of the shorter trips if you take a train what then. When you get there how does one get around. Most cities in the US have sucky mass transit. And I have waited for HOURS in rental car lines.
      In some places Rail will win and that is great but do not blame it on the Airlines. I have a friend that will not fly and is a tree hugger of the first order. She took a train from Florida to Huston Tx. She spent MORE than a first class plane ticket to get state room. Guess what? It sucked. She was HOURS late getting back and spent the last few Hours of the trip on a BUS. Fine fine trains tell me how great trains are. Until I see it here it is not an option.

      --
      See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
    9. Re:Rail service by Misao · · Score: 1

      > Either you're driving in traffic the whole way

      Well, not the _whole_ way.... but yes, traffic is fairly heavy from Seattle to Portland, especially in the stretch from Seattle to Olympia. I-5 can be a royal pain, particularly during certain times of the day. 4 hours from Seattle to Portland is not unreasonable - and it can certainly take more.

      Misao

    10. Re:Rail service by Anonymous Coward · · Score: 0

      Autos still recieve subsidies as do airlines. only about 2/3's of the cost of highway system is covered via auto related user fees. As far as making money, the airlines have made a grand total of $10 billion since 1938. Not a very good return for the past 70 years! This is not even considering that they are not including the construction cost of building airports in the P&L's! Denver's new airport cost about $3 billion.

    11. Re:Rail service by Anonymous Coward · · Score: 0

      50% of U.S. flights are for distances of less than 400 miles. That is U.S. flights. *not* European. For distances between 100 and 600 miles High-Speed Trains ( > 150mph ) will smoke door-to-door trip times for airplanes.

    12. Re:Rail service by ces · · Score: 2

      Local, State, and Federal governments spend huge amounts of money maintaining roads, building new ones and improving exsisting ones.

      Also remember the very large sums involved in ensuring cheap gasoline. I mean would we even care what happened in the Middle East if they did not have oil?

      And what about environmental damage? Air pollution, water pollution, paving open spaces, etc. all have costs.

      --
      Happy Fun Ball is for external use only.
  72. tis has been done before... by Anonymous Coward · · Score: 0

    but unfortunately I don't have a link to back that up. In a transportation engineering class we learned about a jet-powered locomotive where the jet engines were mounted vertically and ran generators, the electricity from which was used to power the wheels. Unfortunately, the high-temperature exhaust had a negative impact on overcrossings. It was also extremely loud (you ever hear a jet engine close up?).
    This doesn't seem to solve the main problems with trains in the U.S., including track incapable of handling high speeds and poor scheduling (not enough trains running often enough or on time to conveniently get anywhere).

  73. 240 kph is second rate by Anonymous Coward · · Score: 0

    High speed rail is 300+ kph, and has been since 1964 in Japan, and 1981 in europe, and they do in countries much smaller, physically, than North America. Instead of being both late to the party and low performers, we should instead push the envelope. The competition are the shinkansen lines in Japan and the TGV in France:

    http://www.japan-guide.com/e/e2018.html

    http://www.railway-technology.com/projects/frenc ht gv/specs.html

  74. Let Amtrak die? by anthony_dipierro · · Score: 3, Informative

    That's just another way of saying "let the bondholders pay for the mess." Which isn't necessarily a bad idea, but someone ultimately is going to have to pay.

    Let a new company with new vision and an eye towards the future of transportation develop a high tech train system in America.

    There's not a single passenger train system in the world that isn't subsidised by some government. Cut the funding and you can expect ticket prices to rise and the number of passengers to drop sharply.

    Of course in todays low interest rate environment maybe the system could be sustained, at least until interest rates start going up again.

    We don't need old companies to make a new train system.

    Considering that it's only old companies that have the capital to make a new train system, yes we do.

  75. Remember the Turbo Train ? by mchummer · · Score: 2, Interesting

    Fascinating - Bombardier has unearthed the Turbo Train. Back in the late 60's - early 70's United Aircraft built and maintained a number of Pratt and Whitney turbine powered train sets. These operated between Boston and New York - Where you could connect with the high speed Metroliner Electric MU cars running New York to Washington.

    They were kind of cool. The trainset was semi-permanently arranged with 1 wheelseet between cars. They employed the same tilt-technology pioneered by Talgo years before in Europe (and still used today) that allowed their operation at higher speeds through curves superelevated for lower speeds. If you were riding in one of the dome seating areas in the propulsion unit you had a good view. If you were riding at night and had a smart conductor that knew enough to turn off the station stop lighting in the dome you had a spectacular view ahead - if you had one that was lazy and left the lights on you couldn't see out and the lighting was too bright to sleep.

    BTW - Regular riders knew the seat pads unsnapped (a design for easy maintenance/cleaning) and could be repositioned for greater comfort during the long trip.

    Ah, technology - the more it changes the more it stays the same.

    I'll have grounds
    More relative than this: the play's the thing
    Wherein I'll catch the conscience of the king.
    Hamlet. Act ii. Scene 2

    1. Re:Remember the Turbo Train ? by Anonymous Coward · · Score: 0

      >United Aircraft built and maintained a number of Pratt and Whitney turbine powered train sets.

      N or HO scale? ;-)

  76. (here's why) Re:Been there done that by buzban · · Score: 1
    been there done that indeed...go look up the Union Pacific locos, among others.

    and know why it died? JETS ARE F(*&^ING LOUD!. How many of you live near a railroad? imagine every one of the trains that passes being a jet instead! doh! ;)

    1. Re:(here's why) Re:Been there done that by shadowj · · Score: 2, Informative
      JETS ARE F(*&^ING LOUD!.

      And so are diesel locomotives. I had the misfortune to attend an outdoor wedding that happened to be near a trainyard, and the ceremony was completely drowned out by a nearby idling locomotive.

      Besides, as numerous posts have pointed out, this isn't a jet engine... it's a gas turbine generator. Closely related, to be sure, but not the same. A jet engine's purpose in life is to throw a whole lot of fast-moving air out the back; a turbine generator is designed to spin that turbine efficiently, and there's no reason why it has to move more air than is necessary to accomplish that task. A land-bound locomotive can also carry a lot of sound shielding that would be impractical on an airplane.

      Finally, aside from the volume of generated noise, the quality of the sound is quite different. During the 70's and 80's a turbine-powered train (cleverly called the Turbo Train) hauled passengers across Canada; I worked near Montreal's downtown train station, and watched (and heard) the train come and go many times. The noise level was no worse than a diesel, and actually kind of interesting... it was a high-pitched whine rather than a low-pitched rumble, and I found it much less annoying.

      --

      --Larry

      Never attribute to malice that which is adequately explained by incompetence

    2. Re:(here's why) Re:Been there done that by Pig+Hogger · · Score: 2

      blockquote> And so are diesel locomotives. I had the misfortune to attend an outdoor wedding that happened to be near a trainyard, and the ceremony was completely drowned out by a nearby idling locomotive. That's what happens when you go to a trainspotter's wedding...

    3. Re:(here's why) Re:Been there done that by jhawkins · · Score: 1

      That's why locomotives are required to have a clearly labeled "Fuel Cut Off" handle. Take a quick walk around the loco, and pull the handle. Isn't that what it's for?
      Safety, schmafety....

  77. Wow, the jobless rate was higher in 1997 by Anonymous Coward · · Score: 0
    We wonder whose fault that was.

    And who was President for the years Enron (and MCI and...) needed to restate their earning for? i.e., when did they lie?

    And who left Bin Laden alone for eight years to fester, only pausing to flip a few cruise missiles in a wag-the-dog situation?

    1. Re:Wow, the jobless rate was higher in 1997 by Anonymous Coward · · Score: 0
      ...and who played golf with all those corporate fraud princes? Who accepted hundreds of thousands of dollars in campaign money from them?

      Who refuses to sponsor a bill that would punish corporate fraud (which is GREAT for consumer confidence, by the way)?

      I'll give you a hint...it's not my cock!

    2. Re:Wow, the jobless rate was higher in 1997 by Anonymous Coward · · Score: 0

      Who sold overnight stays in the White House to Chinese officials for campaign $$$?

      Who played golf every freakin weekend with big business (I'll give you a hint-- Bush don't play golf)? Who had Hollywood in his backpocket?

      Who ignored the attacks on the USS Cole, in Africa, and the first WTC?

  78. Re:Who's going to pay for it? by anthony_dipierro · · Score: 1

    Are you suggesting that they aren't going to receive any federal funds for this project? If not, then I guess I don't care, since I don't live in Calfornia, but somehow I doubt it.

  79. Don't get too excited by any speed improvements. by stephanruby · · Score: 1

    Don't get too excited by any speed improvements. In France for example, bullet trains are not allowed to go at their optimal speeds because some of the rail tracks might have some people walking on them.

  80. No way! [nvws] by Anonymous Coward · · Score: 0

    I remember one time I rode a train from D.C. to Hartford. I mean, trains are so *bumpy* ...I'd rather take a car. Plus, cars are a better way to pick up the chicks at bars and stuff.

    Btw: I am looking for a girlfriend. See my guidelines here

    Authentic post by NaveWeiss

  81. Re:this shouldn't have been accepted by /. by ergo98 · · Score: 2, Informative

    but the US and Canada, who still have these ridiculous diesel engines that are just not suited to getting people around

    Umm...why not? The engine is locomotion unit, and whether it uses diesel, gerbils, or a squadron of nerds, it simply needs to move some cars. I use Go Transit to get to work, and they utilize diesel engines fabulously in a light rail system: Works superbly.

  82. Re:this shouldn't have been accepted by /. by Anonymous Coward · · Score: 0
    How'd your food get from the farms to the processing plants to your supermarket's distribution center? Want to bet by train?

    Want to know why those immigrant's bodies were found in a grain hopper? Because the largest grain crop in the world moves to market by train.

    That computer your sitting at probably came across the Pacific (probably as parts) in a 20- or 40-foot container that was loaded onto a train at some time.

    Do you send packages cross-country by parcel post or UPS ground? They probably go most of the way by train.

  83. Right-of-way by MountainLogic · · Score: 4, Insightful

    The problem with shutting down the system is the loss of right-of-way. IF you loose that the game is over forever due to cost of replacing the land as well as NIMBY issues. There have been some attempts at rail banking (saving the right-of-way after the rails are pulled out. As much as I would like to see rail upgraded "distroying the line to save the line" just won't work.

    1. Re:Right-of-way by afidel · · Score: 2

      That's simple do what many rail owners did here in Ohio, sign long term non exclusive leases to the state for things like bike paths, but they also ran fibre optics lines that powered MCI's network and so made a profit. They can always reclaim the right of way with a couple year notice to the state.

      --
      There are 4 boxes to use in the defense of liberty: soap, ballot, jury, ammo. Use in that order. Starting now.
  84. Problems with electric trains by Anonymous Coward · · Score: 0
    Stringing the wires and distributing the electricity isn't a problem in urban or more dense areas - like Japan and most of Europe.

    Five hundred miles gets you across most of Europe and bounces you back and forth across Japan like a ping pong ball.

    Five hundred miles gets you about halfway between New York and Miami. And maybe 15% of the way from New York to Los Angeles.

  85. Re:Umm, have we invented electricity yet? by Synn · · Score: 2

    Actually there already is an electric train from LA to San Diego and one in the NE. Florida is looking at one from Tampa to Orlando as well.

    But because everything's so sparse in the US we've come to use cars a lot more than other countries. So any people-moving rail system has to compete with automobiles, which everyone in the US over the age of 16 owns.

    The US is a lot different than Japan or Europe. You can't directly compare infrastructures.

  86. may actually be more environmentally friendly... by Freedom+Bug · · Score: 3, Insightful

    "Unfortunately, this train doesn't really address that issue very well, as it still uses fossil fuel"

    Actually, it addresses it very well. With the JetTrain, you have a fossil-fuel turbine generating electricity which turn electric motors on the train wheels. With an electric train, you probably have a fossil-fuel turbine generating electricity which turn electric motors on the train wheels.

    The JetTrain would use slightly more energy because it has to push a large engine and a big tank of fuel around. It's minimal compared to the weight of the load, though.

    An electric train would use massive amounts of energy and resources to build out electric tracks over thousands of miles.

    it's a one time versus an ongoing cost.

    Compared to SUV's, the savings are fricking massive.

    Bryan

  87. An interesting step, perhaps not soon useful by Anonymous Coward · · Score: 2, Informative
    I hate to say it, but the barrier to high-speed rail isn't the locomotives. It's the track. A current GE P42 locomotive, one of the main workhorses of the Amtrak fleet, has 4200HP (hence the name) and an as-configured top speed of 106 mph. There is no track in the US where it can safely go that fast (the Acela service can run faster on the northeast corridor, but it's a quite different train set entirely). The GE AC6000 has 6250 HP (so why isn't it called the AC6250?) and something on the order of 27000 (twenty seven thousand) foot pounds of torque redlined at 1200 rpm. If you need more power, just MU ("multi-unit") as many as 4 of them.


    Power isn't the issue, folks. Not when it comes to speed. A war-veteran GM E7 can exceed a safe speed on most track in the US. The problem is the track. And track is devastatingly, mind-bogglingly expensive. As a power-of-ten estimate, figure new track is going to cost around 1-10 million dollars per mile. I know that sounds absurd, but it's true. It's an engineering acomplishment along the lines of a major urban interstate highway, except it's like that everywhere. Not just the urban parts.


    The big problem with rail is the same problem as the big problem with air: operators offer a product that the market will only pay the marginal cost for. The fixed cost (building either rails and trains or airports and planes) cannot be recovered. It's a guaranteed losing game.


    But it's not all bad news. The attractive part is that the turbine may save fuel costs (modern aeroderivative turbines are fairly good, with net thermodynamic efficiencies in the 40% range) and it could burn a range of cleaner and more energy-independent fuels (the US at least *could* quickly become self-sufficient in natural gas production, for instance).


    And yes, it does seem odd: it's being touted as a passenger solution when Amtrak is broke, and yet the interesting application is freight.


    To quickly address a previous posting about weight: low weight isn't exactly an advantage for locomotives. The ability to climb grades is essentially a linear function of the locomotive weight. Steel wheels on steel track, non-spinning, is close to ideal newtonian friction. You need more downward force to make more tractive force. It's unavoidable. And stopping ability does, in practice, degrade with reductions in locomotive weight. The reason is that train operators love to use "dynamic braking." This is using the electric traction motor to make electricity, hence slowing the train. It's not regenerative... the electric power is used to heat resistor banks on top of the locomotive. This is why you see "heat waves" rising off of locomotives at urban stations: they spend much of their operating life slowing down. The friction brakes are used every so many minutes (because the FRA rules require it, so they don't rust up or even freeze in cold weather) but they're train brake shoes are expensive so you try to minimize their use. Besides, dynamic braking gives really smooth stops, and passengers appreciate that.


    But I bet it sounds cool. :-)

    1. Re:An interesting step, perhaps not soon useful by hoytt · · Score: 2, Interesting

      I hate to say it, but the barrier to high-speed rail isn't the locomotives. It's the track. A current GE P42 locomotive, one of the main workhorses of the Amtrak fleet, has 4200HP (hence the name) and an as-configured top speed of 106 mph. There is no track in the US where it can safely go that fast (the Acela service can run faster on the northeast corridor, but it's a quite different train set entirely). The GE AC6000 has 6250 HP (so why isn't it called the AC6250?) and something on the order of 27000 (twenty seven thousand) foot pounds of torque redlined at 1200 rpm. If you need more power, just MU ("multi-unit") as many as 4 of them.

      Just look in Japan, France, Germany or Spain, all countries with HST lines. IIRC all these countries except Germany use the just for highspeed passenger trains. The German ones are also use for freight at night. The costs of building such a line go into the billions of Dollars. Most of it atleast in Europe is payed by the governments. So if you want lines in crowded areas in the US (North East, Southern CA) you'll need to find ppl who are willing to invest billions of Dollars into a project and given the current status of US rail traffic I doubt many would be interested. The new Cologne - Frankfurt HSL took 6 years to build, is 110 miles long and the train reaches a speed of 205 mph.

      As for power, the best place is to go to Switzerland and see the class 460 SBB engines go up the Gotthard. For major freight trains the SBB puts two class 460 electrical engines with a topspeed of 230 km/h and a maximum power output of 6.1 MW (± 8300 hp). And a maximum tractive effort of 300kN.

  88. Breaking the rail problem by dpilot · · Score: 5, Interesting

    We also have a Congress who feels that Amtrak should be paying its own way, and not requiring federal subsidies.

    Meanwhile, just how big is the tax infrastructure that's already in place supporting our road and highway system? Road traffic is really *heavily* subsidized by our taxes, and not just the ones at the pump, tires, and vehicle registration.

    I've also heard that there's a heavy federal infrastructure involved in air transport, though I know nothing of the breakdown there between private and public sector. I remember Reagan ordering the air traffic controllers back to work, suggesting public sector, there. (I don't remember Taft Hartley being invoked, though it may have.)

    --
    The living have better things to do than to continue hating the dead.
    1. Re:Breaking the rail problem by nelsonal · · Score: 1

      Air traffic controllers are federal employees. I think he threatened to or actually fired the ones who went on strike. I think I read that Nixon was the last president to envoke Taft-Hartley, before the dockworkers strike.

      --
      Degaussing scares the bad magnetism out of the monitor and fills it with good karma.
    2. Re:Breaking the rail problem by dpilot · · Score: 1

      So I guess my point is that both road and air travel are heavily subsidized. How can rail hope to compete without a leveled playing field?

      --
      The living have better things to do than to continue hating the dead.
    3. Re:Breaking the rail problem by Pig+Hogger · · Score: 3, Insightful
      We also have a Congress who feels that Amtrak should be paying its own way, and not requiring federal subsidies.

      But it will give billions to the nearly-bankrupt air-transport industry...

    4. Re:Breaking the rail problem by TamMan2000 · · Score: 2

      The ones that went on strike were fired. It was illegal for them to strike, no need for Taft-Hartley...

      --
      "I'll have a Guinness, no wait, make that a Coors Light" -Grad student I work with, who shall remain anonymous...
  89. But what to do with that HOT exhaust? by MtViewGuy · · Score: 2

    Okay, modern gas turbines can be silenced and have lower fuel consumption than the gas turbines used on the famous GE Big Blow locomotives.

    But we still have one big problem: what we do with that hot exhaust from the gas turbine? One of the biggest banes of the Big Blow locomotives was that the hot exhaust posed a huge fire and high-temperature hazard to anything nearby, especially the undersides of bridges.

    GE and GM's EMD better figure out how to cool that gas turbine exhaust in a very small space before we can consider using gas turbine engines on a locomotive again.

    1. Re:But what to do with that HOT exhaust? by MrCreosote · · Score: 3, Insightful

      think of anti-noise and anti-IR technology developed for military aviation - most attack helicopters now-a-days are virtually silent (until its right on top of you) and have very low IR signatures (to avoid Stingers)

      --
      MrCreosote Meow!Thump!Meow!Thump!Meow!Thump! "You're right! There isn't enough room to swing a cat in here!"
    2. Re:But what to do with that HOT exhaust? by G-funk · · Score: 3, Interesting

      Boil something with it, turn another turbine, generate more elecricity.

      --
      Send lawyers, guns, and money!
  90. Re:Umm, have we invented electricity yet? by El+Cabri · · Score: 1

    which "privately operated train companies" can raise the $5bn to $10bn that it would cost ? How would they obtain to preempt all the land they need to build the rails and stations ? Private funding of modern, major infrastructure has resulted in financial disasters far too often in history, from the Panama Canal to the Chunnel, for any bank to back such an initiative without gov involvement. Why would the states and federal government put billions on highways and nothing on rail ?

  91. Canadian - American Unit Conversion by ALoverOfPeace · · Score: 1

    A "couple of inches of snow" Canadian is the equivalent of 2-3 feet of snow, 60 mph winds, and hail stones the size of my fist American.

  92. power to wheels by PhiberKut · · Score: 0, Interesting

    Currently: Diesel > Generator > Electric Motors > Wheels
    Turbine A: Turbine > Generator > Electric Motors > Wheels
    Turbine B: Turbine > Gears > Wheels

    Is Turbine B possible? How do the losses of a generator & electric motors compare to a gear system?

    --
    Elijah Chancey www.elijahsadventure.com nomadic IT consultant, bicycling across america "all that you touch / and all
    1. Re:power to wheels by zenyu · · Score: 3, Informative

      Turbine B: Turbine > Gears > Wheels

      Is Turbine B possible?


      Not really. The great thing about turbines is that you can run them really hot. The bad thing is they are fragile to shocks. You run these things either at the limit of your metals or use something inherently fragile like ceramics(experimentally at least). This allows you to get a big temperature difference, which means lots of energy can be extracted (at least that's what all those thermodynaics equations seemed to be about.)

      If you tried to run it direct to the wheels you'd probably have to run it so cool that any energy efficiencies would be lost. You also wouldn't get the acceleration you can get by putting electric motors under every car in the train, powered by single lightweight generator car.

  93. Turbine Locos by Anonymous Coward · · Score: 0

    One of the major railroads (I think it was Union Pacific) experimented with turbine-powered locomotives for freight service in the 1960's. One advantage was supposed to be lower fuel cost--the things ran on bunker-C. They eventually, gave up on them, though, because they cost more to maintain than diesels.

  94. Gas Turbine Automobiles by Grimace1975 · · Score: 1

    Brief response: Gas turbines can be utilized as a power source in automobiles. Turbines have numerous advantages, but using one in an automobile does not work well. Reasons including complex systems support, rotational torque, high RPMs, and not easily throttled. A solution could be accomplished by utilizing numerous smaller turbines. Staging them up and down as needed for the required horsepower. This could be attuned to a car engine turning on and off cylinders, as well as disconnecting them from the drive shaft, that are currently not needed. These small gas turbines could also use transmission fluid as there medium, running it right through there compression blades instead of air, and directing the fluid directly to the torque converter for usage. Timing systems would no longer be required, simplifying the engine. Timing belts, lifters, drive cam, rods, pistons and the drive shaft could all be removed. Small turbines could be modularized for easy insertion and replacement, increasing maximum available horsepower as needed, as well as easier maintenance.

  95. Re:This is silly. (Check the UK) by hoytt · · Score: 1

    You missed the whole point of the article. All of Japan's (And Europe's) high speed trains are electric powered. For the US to use these technologies would require a huge investment on upgrading the current track to electrified. This engine will work on any track, and will save quite a bit of money in the long run if it actually works as described.

    There's one train in the UK which is considered the fastest diesel in the world. The former BR class 253, also known as the HST is a diesel train with two motor 'heads' and 8 cars in between. The HSTs came into service in the mid 1970s and reached the 125 mph in their regular schedule. BR used the in the services on the East Coast main line, the West Coast main line and lines into Cornwall. Although BR doesn't exist anymore and the lines to Edinburgh and Glasgow are electrified these days they are still used by GNER, Virgin and others. I sat in one this spring between Darlington and Inverness.
    It felt great to be in a piece of UK railway history.

  96. MHD? by po8 · · Score: 3, Insightful

    What ever happened to Magnetohydrodynamic (MHD) engines? It seems like they'd be perfect for a locomotive application, inasmuch as they can take fuel directly to electricity with no moving parts. A quick Google search shows one old but promising article on an LMMHD auto engine, and that's about it: comments on the infeasibility of this approach would be appreciated.

  97. Fortunately, technology is better in 2002 by MtViewGuy · · Score: 3, Informative

    I think if we were to design a gas-turbine locomotive in 2002, the worries about fuel consumption, noise levels and exhaust emissions are no longer major issues, thanks to the efforts of GE, Pratt & Whitney and Rolls-Royce in the last 25 years in dramatically reducing fuel consumption, noise levels and harmful exhaust emissions on airliner jet engines. A Turbo Train using a modified version of today's modern jet engines would be quite powerful, generate much less noise, have very low emissions and would be far more efficient than the old GE Big Blows that UP used during the 1950's and 1960's.

    However, we still must eliminate a big problem with gas turbines: the hot exhaust from the engine. Both GE Transportation Systems and GM's EMD will have to figure out how to cool that exhaust in a very small space before we can build a modern gas-turbine locomotive. Remember, we're not taking about a ship, where there is plenty of space to either divert the hot exhaust or install various technologies in the exhaust stream to cool the hot exhaust.

  98. Re:Umm, have we invented electricity yet? by Anonymous Coward · · Score: 0

    >Sheesh, some rails in Europe that have been abandoned since Hitler's day are in better shape than most of our transcontinental rails.

    Well, since you started the Godwin's Law fun, I'll help you out:

    It's because in North America we haver far fewer people per mile of track than Germany had even just after the holocaust. It just isn't effective.

  99. Re:Umm, have we invented electricity yet? by Anonymous Coward · · Score: 0

    FYI:

    The Boston - New Haven railroad was supposed to be electrified in 1909. It was electrified in 1999.

  100. Re:Turbine. Pfffft. by buck_wild · · Score: 2, Funny

    "Where we're going, we don't *need* roads."

    --
    If all you have is a hammer, everything looks like a nail.
  101. Re:Umm, have we invented electricity yet? by shepd · · Score: 1

    >Wouldn't it rather be the over-decentralization and lack of public funding for anything that is not a weapon that is to blame?

    Canada, part of America, might be something you should look at.

    We have the same shitty quality services as you do (telco service is a _little_ better), yet most of ours were publically funded, and we (probably) have a smaller military than the Taliban has followers. There's exceptions, I suppose. Ontario & Quebec do generate enough power to sell to you... :-)

    And we have the same population to service ratio problems, too (in some [many] areas its worse, but we usually just give up on those areas).

    You're just plain wrong there. Sorry.

    --
    If you could be told what you can see or read, then it follows that you could be told what to say or think - BoC
  102. Re:this shouldn't have been accepted by /. by buck_wild · · Score: 1

    We'll go electric once the rails collect solar energy. :)

    --
    If all you have is a hammer, everything looks like a nail.
  103. Why the USA has slow trains by maggard · · Score: 5, Informative
    The US doesn't have separate trackage for passenger & freight traffic or very advanced signaling systems.

    Thus US rail passenger vehicles must be built to withstand impact with freight trains. Other nations have a far greater percentage of passenger-only track including many dedicated lines. Also in many nations the rail infrastructure has been continuously modernized resulting in more sophisticated switching and control system.

    Amtrak inherited its system after decades of private neglect and was originally a way to prevent the various passenger rail services in the US from individually being shut down or sliding into bankruptcy. That passenger rail still survives in the US at all after decades of far less support then virtually every other transportation medium speaks to its tenacity and durability. Unfortunately Amtrak has always been stuck with conflicting missions and starved for infrastructure (again, much of what it began with was already obsolete or decrepit; upgrades, replacements and refurbishments have always been piecemeal and/or minimal.) That and impressively bad management.

    Another problem has been the extraordinarily high strength requirement has been set by the US's Federal Railroad Administration which results in US rail passenger cars being at a minimum of twice as heavy as every other nation's. A result is that there is literally no other market for US vehicles thus tried & proven designs from other nations can't be used in the USA. Spanish, Swedish, German, etc. - none of their highly successful trains can now be imported into the US due to the FRA's unique requirements.

    Thus when folks point out the curiosity of Amtrak hiring the consortium of Alstom/Bombardier to design & build the Acela instead of buying a successful somethingelse model they're ignoring that the somethingelses simply aren't allowed to run in the US on an ongoing basis. After license and redesign fees it would have cost more to convert an existing train then to just design & build one to Amtrak's (& the FRA's) unique requirements, which is what was done.

    Of course now Amtrak & Alstom/Bombardier are mired in suits and counter-suits, ignoring the mediation structures built into their contracts and publicly blaming each other for the problems the Acela is facing. Amtrak claims the Acela doesn't meet specifications and was delivered late. Alstom/Bombardier claim Amtrak wasn't timely in providing specifications and making design decisions, many of the problems are with features Alstom/Bombardier advised against, and that Amtrak is running the vehicles on substandard track & caternary against Alstom/Bombardier's recommendations.

    Of course much of this could have been avoided had the usual process of building a test train, running it ragged for a year, then dissembling it to examine it for understanding of it's rail performance, maintenance characteristics, wear patterns, practical experiance, then refining the design before going into production been followed. Indeed reexamination of the original train's evaluation appears to show the precursors of many of the problems now appearing on the Acela.

    Instead however Amtrak ordered 20 trains in one design/build package (and now claims it'll never order another.) Thus as each trainset was built it was manufactured slightly differently from the ones before as experience was applied and improvements made. This now gives Amtrak 20 subtly different trainsets and no further application of the lessons learned nor incentive on the designer/manufacturer to refine the vehicle.

    Whatever the case the losers are the citizens of the US & Canada. Why Canada? It turns out the money Amtrak used to purchase Acela Express was from a $1 billion low-interest loan from the Export Development Corp. of Canada. Yep, if Amtrak goes belly-up not only will the US public be out but also the Canadians. As you can imagine the prospect of a US quasi-governmental agency going belly-up and forfeiting on it's debts to Canada doesn't play well north of the border

    Ironically there is a widely rumored proposal in Canada for investing CA$3-billion to improve train service in the Quebec City to Windsor corridor (incl. Montreal, Ottawa, Toronto, and possibly Kingston). The "VIAFast" upgrade is expected to take advantage of trains like Bombardier's newly (re)announced turbo train as well as track-swapping with CPR & CNR to create a dedicated passenger rail route. Indeed there's even renewed interest in a new high-speed Calgary-Edmonton corridor route to serve that rapidly growing part of the country.

    Anyway, now you know why the US is stuck with slow trains: Inheritance, lack of investment, political game playing, lousy management, and extreme requirements. On the other hand neighbors in much the same situation are instead expanding their rail systems in logical yet ambitious ways. Makes me think of the tortiose & the hare...

    --
    I don't read ACs: If a post isn't worth so much as a nom de plume to its author then I wont bother either.
    1. Re:Why the USA has slow trains by anaplasmosis · · Score: 1

      Interesting post. I have travelled on the Acela Express a few times (between NY & Philly) and by train in Europe & the UK (I'm a Brit with parents who live in the USA). If the Acela Express *was* designed and built specifically for the US market, the design was plagiarised from European ones, and I can superficially see no difference between it and European designs. Interestingly, several British train operators are suing train manufacturers for poor reliability.

  104. Union Pacific does not have one... by Anonymous Coward · · Score: 0

    ...except maybe in a museum somewhere. The big one they still run is a Centennial, a 6600 HP diesel, not a turbine. All their turbines were retired.

  105. Won't make a difference by weiyuent · · Score: 3, Insightful

    I fail to see how a jet train will make much difference given that passenger rail travel is generally a failure in North America.

    There is the immediate issue of population density - it is not high enough to economically justify the huge construction and maintenance costs. Very few passenger routes (mainly between large cities in the North East) actually turn a profit.

    Of course, this exact same argument could be levelled against passenger car travel, as the hidden subsidies in the form of public roadworks, tax benefits to car manufacturers and oil companies, etc. all add up to about 4 times as much as the visible cost of owning and operating the average car.

    The issue then becomes, at the core, one of culture. We are wedded to our cars, they are ingrained into our very way of life far more than their mere utilitarian purpose entails. Life in America revolves around the car, not the other way around. Given that, passenger rail travel has no hope of succeeding beyond a few niche markets.

    Finally, the high-speed rail travel is only moderately successful even in its ideal arenas of rail-crazy Europe and Japan. The Eurostar, Thalys and ICE make a profit (and that's BEFORE accounting for public subsidies) only over middle distances connecting the major hubs, i.e. London, Brussels, Paris. Other routes to Switzerland, Germany and the South of France have always been making huge financial losses, even more so now with the advent of low-cost, low-frills airlines that get there in half the time.

  106. Re:STOP PRESS: Americans play catch-up! by Anonymous Coward · · Score: 0

    >>maybe that shows national priorities for technology

    Yeah we like to defend ourselves rather than rely on another country to do that for us.

    Or did you think all those US tanks in Europe were to protect the cities in the US from the USSR?

  107. Turbine Powered Locomotives :P by trotski · · Score: 2, Informative

    People seem to have a short memory... does anyone remember the TurboTrain?

    This train ran in Canada and the US until the late 70s. In had several problems which made it uneconomical to opperate, these problems were:

    High fuel consumption
    Noise

    Turbines can be a very efficient power source, but only when running at their full RPM. A train such as TurboTrain has to stop at stations, as well as obay signals and speed restrictions. Therefore, because of this stop and go the train has to constantly do, the turbine is actually less efficient than diesel.

    The bottom line is that this idea has been tried and it has failed. I'm afraid it's difficult to concider this announcment from Bombardier nothing more than vaporware.

    --

    "Entropy is the bad-guy, and he is everywhere"
    1. Re:Turbine Powered Locomotives :P by Anonymous Coward · · Score: 0

      I have some contacts at P&W Canada which have confirmed that this is NOT vaporware. The argument about the fact that a turbo has to run at full RPM all the time is a non issue since it will be to drive an electric generator, just like diesel engines drive electric generators in diesel-electric locomotives which is then fed to electric motors that are connected to the wheels.

      The goal, in this case, is to produce electrical power, which can be done continuously without changing the turbine's RPM too much or even shutting it down completely at stop.

      This procedure is quite common on turboprop aircraft which must land in remote areas where no external power supplies are available: in that cse, one of the turboprops is kept on while it's propeller is stopped by an electric break. The same approach could be used on a locomotive.

      I have also worked at P&W for a while and can also confirm that this approach has been studied, cost-wise, in the past and that there aren't any technological hurdle to prevent is realisation.

  108. Factual correction by Anonymous Coward · · Score: 0

    Sorry, wrong. San Diego-to-LA has train service, but it's not electrified.

  109. Website sucks, so do their trains and planes? by Anonymous Coward · · Score: 0


    Bombardier owns LearJet, Evinrude/Johnson, this train engine business, and who knows what else. So, one would think that Bombardier would want a good web presence, right? Well, their sites are totally Unix/Linux unfriendly and broken in other ways too. Only an idiot who didn't want to sell things would publish his/her website in
    Flash only.
    P>Let's hope that they design their products better than their website. I'm glad I'm not taking one of their planes, trains, or boats anytime in my lifetime.

  110. Everything old is new again by rtlives · · Score: 1

    The first turbine powered RR engine was build back in 1948. Had some problems, like melting the asphalt when it went under bridges...

  111. Physics of Trains by nuggz · · Score: 2

    The weight of the train and the weight of the car is irrelevant.
    Assuming the same CoG the heavy car stays on just as well as the light car.
    Mass cancels out.

    1. Re:Physics of Trains by mandolin · · Score: 2, Insightful
      The weight of the train and the weight of the car is irrelevant.

      Until you're trying to tow a trainload of coal up a steep (by train standards) mountain grade..

    2. Re:Physics of Trains by nuggz · · Score: 2

      It matters for the pulling up a hill.

      It does not matter for turning.

    3. Re:Physics of Trains by Dwarfgoat · · Score: 1

      WRONG.

      It's what's known in the industry as "stringlining." It's why heavier (loaded) cars are switched to the front of a long train, and the "empties" (unloaded cars) are always coupled to the rear when possible.

      The flanges on the wheelsets (that little ridge on the inside of the wheel that actually keeps the car on the rails) can only take so much lateral force before jumping the rails.

      If a train with empties in the center of the train attempts to pull through a curve (especially while accelerating) the lighter cars in the center will derail and be pulled into a straight line between cars heavy enough to stay on the tracks. This can affect anywhere from 5 to 100 cars, and is a REAL BITCH to clean up...especially when it happens on a hill (which is where one generally finds sharper radius curves on a rail line). One would be amazed how far a freight car can roll off the tracks when pointed downhill!

      --
      That? That was a pigeon.
  112. Apples to Oranges by maggard · · Score: 2
    There is a country (Japan) that spends hundreds of millions of dollars a year on train design research and has hands down by far the most effective rail network in the world from everything from technical efficiency of trains to timeliness.
    Japan, Germany, France, Spain, Sweden...

    However none of their vehicles can run in the US. Electrical power isn't the problem, its weight requirements. The US's passenger rails are actually freight rails. Thus passenger vehicles must be contructed to withstand impact with freight vehicles. Japan, Germany, France, Spain, Sweden, none of their vehicles are built to this extraordinary requirement and so it's simply not possible to buy an off-the-shelf design for the US market.

    There are a few Spanish Talgos operating under grandfathered dispensations in the PNW but that is it. Even the Swedish X-2000 Amtrak tried out a few years ago was on a limited permit. If there's gonna be a high-speed rail in the US (and Acela isn't most other nations's idea of "high speed") then it's a custom job. Say "they did it" all you want, the requirements are so different it's all apples to oranges. Get the specs changed it'd be a different story, but for now nobody else's trains can be certified for US interstate rail or on US freight rail.

    --
    I don't read ACs: If a post isn't worth so much as a nom de plume to its author then I wont bother either.
  113. Re:Umm, have we invented electricity yet? by nelsonal · · Score: 1

    Becuase one of the main advantages America does have is the most liquid capital markets in the world. If by investing $5 bn to $10 billion to build an clean, efficient, fast rail line would make $1-$2 billion a year in profit for investors, we would have one already. Look at all the investment in the long distance phone networks over the past 5 years. Well over $200 billion was invested. Now it will be a few years before the companies will use all of it. But consumers should enjoy cheap long distance for the forseeable future. One problem with private infastructure funding is that it is difficult to capture the gains from infastructure, unless your have a monopoly, as the phone and power grids show, but since not even a monopoly provider of rail service, Amtrak, can make a profit in the US. I doubt private funding would make a profit either.

    --
    Degaussing scares the bad magnetism out of the monitor and fills it with good karma.
  114. Re:Umm, have we invented electricity yet? by nuggz · · Score: 1, Troll

    Why would we want electric locomotives? Fossil fuel is cheaper and more efficient.

    Plus the electricity would probaly come from burning more crap at power plants.

  115. The French did this back in the 1960's by Anonymous Coward · · Score: 0

    The original TGV prototypes used gas turbine engines. See this link.

  116. old news.... by TheHawke · · Score: 1

    Research into Turbine/electric locomotives went back to post WWII days when they experimented with a coal fueled turbo/electric. http://www.railpower.com/2support/locomotives.htm
    Oh, it packed plenty of power but it's efficiency rating was very poor and it guzzled fuel like a SUV..
    The current design fares better but it still does not achieve no higher than 50% efficiency on the bench.
    GE just came out with a turbine designed to drive generators for home electric useage that IS the size of a locomotive and achives a whopping 60% efficiency rating.
    http://www.fe.doe.gov/techline/tl_ats_ge1.shtml
    The major issue with anything thats powered by a gas turbine is gas mileage, hence why diesels have yet to be replaced by a more efficient power plant. Diesels burn all of it's charge with high energy return. This promotes high torque and high horsepower ratings.
    Gas turbines have powerful, but thin legs. If they were put on a very high high torque test they would stall and flameout, possibly inducing a burner chamber blowout.

    --
    First rule of holes; When in one, stop digging.
  117. Different Beasts by Meathead · · Score: 4, Insightful

    I'm really not sure why everyone gets down on American railroads. American railroads are completely different beasts from those in Western Europe and Japan. They are geared towards freight, particularly bulk freight. They move huge quantities very cheaply. Do Europeans have anything comparable to the 100+ car long freight trains that are common in the US? (Just drive I-80 west of Iowa. Original transcontinental railroad still handling hugh trains.) Also remember that the US freight equipment tends to be much larger (because of all of the grade separation requirements, railcars in Europe must fit under all of those old underpasses, while upgrading to stacked containers requires many fewer modifications to the road in the US.)

    Huge freight trains and fast passenger trains just don't mix well on the same lines. The US could build dedicated passenger lines (like European governments did) in some locations, but a national network just doesn't make much sense. Even the regional networks would require constant subsidies to operate.

    I know, its off topic.

    1. Re:Different Beasts by mulhall · · Score: 1

      Have you seen the 3km long train in Africa? Carries iron ore, sheesh that's more metal than Iron Maiden on a good day.

      http://i-cias.com/m.s/mauritan/matrain.htm

      Zouerate to Nouadhibou. Only way in, only way out (Monopoly anyone?) $5 a ticket.

  118. Turbines are *more* efficient, not less... by aquarian · · Score: 5, Informative

    Don't compare old-tech, experimental turbines with what's available now. The whole reason for this project is that turbines are *more* efficient than diesels, not less. If diesels were more efficient, they'd be the first choice for electric powerplants, and they're not- turbines are.

    Another reason for this project is that the service requirements of a passenger train are different from that of a freight train. Passenger trains pull lighter loads, travel faster, and need to accelerate more rapidly. Most locomotive technology in the US was designed with pulling freight in mind. Even the passenger locomotives are based on freigh-pulling designs. This project is a clean-slate design, with a specific purpose in mind. It should fulfill that purpose much more efficiently.

    1. Re:Turbines are *more* efficient, not less... by Anonymous Coward · · Score: 1, Informative

      Not true at all. The reason gas turbines are used in large power plants is simply that the diesel engine does not scale above about 30-40 Megawatts. You cannot get the fuel/air mixture into and out of the cylinder fast enough. The gas turbine, on the other hand, has practically no limits to its construction size. Large gas turbines are typically of the order of 260-280 Megawatts.
      They are NOT more efficient than diesels!

  119. Slashdotters *are* trainspotters! by aquarian · · Score: 3, Funny

    I knew Slashdotters were just a big bunch of trainspotters, and now they're all coming out of the woodwork. This is amusing...

  120. Missing the point, I think by videodriverguy · · Score: 2, Interesting

    The original article points to the value of this new train as being partly that current tracks need not be electrified.
    Surely the point is that existng tracks cannot handle anything other than the painfully slow vehicles of yester year - take a look at Acela, that barely manages an average of 60MPH for all its hype.
    The sad truth is that existing tracks and trains have a lot of derailments; unless the track is replaced there will only be more of the same.
    Sorry, but the idea of being in a train pulled by a super fast turbine on ancient tracks is not appealing to me. Does crash, burn seem familiar to anyone?

  121. Would the engine reverse stop the train faster? by Anonymous Coward · · Score: 1, Funny

    If it can stop an airplane...

    1. Re:Would the engine reverse stop the train faster? by trotski · · Score: 1

      For what it's worth, as you probably know the train won't use the thrust from the turbine. Therefore engine reverse will do nothing, but you already knew that, didn't you?

      --

      "Entropy is the bad-guy, and he is everywhere"
  122. Turbine trains? Not a good idea. by Pig+Hogger · · Score: 5, Interesting

    Although this looks promising on paper, one can but wonder if that turbine locomotiveis yet another boondoggle (sp?).

    Given that the turbine's fuel appetite does not significantly changes when the turbine goes from idle to warp factor nine (unlike a diesel), one wonder what fuel economy will be with a SINGLE 5000 hp turbine engine. Okay, granted, with hotel power (to light-up the cars and air-condition/heat them), you still suck some power from the engine when the train is stopped.

    One would think that a sensible way to address this problem would be to use 10 smal 500 HP engines whose number that kick-in would depend of the power needed at a time. But of course, this would mean higher maintenance costs and more chances for something to go wrong. However, modular design could make it easy to replace a turbine.

    Case in point: the old United Aircraft Turbotrain, designed in the sixties, had 6 Pratt & Whitney PT-6 turbine engines, each one of which could be replaced by three mechanics in less than 30 minutes (this was a NICE train: the bar was in the engine's cab, so you could look at the track ahead whilst sipping a beer, and switch to a stiffer drink whenever the train missed a school bus or a gasoline truck at a crossing).

    Even if we end-up with a super-magical turbine locomotive that runs all the time and doesn't suck fuel all the time as well, we'd face a little problem that is caused by the turbines's very suitableness for powering aircraft: low weight.

    Of course, low weight means less power needed to go at high speed. But is means also less weight on drivers. Perhaps railroads will be clipping newspapers coupons looking for sand clerance sales (sand can be injected right in front of driving wheels to boost adhesion if the wheels start to slip Wheels will definitely slip if there isn't enough weight on them)...

    So, one wonders of the suitableness of a turbine locomotive-hauled passenger train. Will it slip? Will it haul? I'm afraid that a turbine
    engine will have to be weighted up... But that weight need not be always deadweight. Big cities call for big commuter train traffic: the thing electrification is for. So, why not add a pantograph and power transformer allowing for full-power operation under catenary when approaching terminals? At least, this will reduce downtown air pollution.

    Wouldn't a better way be to have distributed traction throughout the train? You keep power generation in a lightweight power car (it would hardly be a locomotive anymore), and have traction motors throughout the train itself, so to take advantage of the weight there, too. Smaller traction motors, too, or at least, bigger derated ones. The first french TGVs had powered axles under the passenger coaches, and the Hikari Japanese bullet-trains running on the Shinkansen, as well as the newest german ICE trains have distributed powered axles through the trains (and the ICE-3 trains are real neat, too because the front seats of the first cars look on the track ahead, over the engineer's shoulders).

    But of course, one hits other problems, such as safely sending traction power throughout the train. You're talking at something like 1000 amps at 600 volts there. Coupling/uncoupling cars would cause problems, and at each car, you also have connections that can go wrong. 100 years ago, in Paris, a subway train caught fire, killing more than 100 people. The cause: high-intensity traction power sent through flexible cables throughout the train. Such lessons from the past are not easily forgotten...

    An lighter articulated train would be better in this respect, but then, you end-up with with an unflexible consist.

    A normal train car has two 4 wheel trucks, one at each end. On an articulated train, adjacent cars share the same truck. Since trucks are rather heavy, you end up with significant weight savings (a 10 car normal train has 20 trucks, whereas an articulated 10 car train has only nine count them right, and don't do a fencepost error). The downside is that you cannot easily remove or add a car, they are all stuck together, so you have an inflexible train which can't be adjusted for varying loads.

    But, again, adding cars and removing them is expensive, more expensive than hauling around empty seats (or it seems, looking the way some MBAs with adding machines seem to think in railroad adminive departments). But, after all, the french TGVs are articulated, so this is less a problem it might see.

    Aha! Let's compromise on, oh, four car articulated, self-contained (1 first class parlour/club-car, 2 second class coaches, bar car & checked luggage/bicycle space with reversible control cab) units, two of which could be powered by one power car. So a 16 car train could be feasible, and you can retain some flexibility.

    And then, do we have a tilt-train ? Tilt-trains are attractive, but is still one more thing that can go wrong. And with motorized trucks, you have less room to put the needed power-banking mechanisms...

    A tilt train is a train that will tilt in the curves to compensate for cant deficiency . Cant deficiency is when the track is banked less than what would be needed for the speed the train goes through the curve. So, to prevent people from being tossed around curves, you simply tilt the train inwards, much like an airplane that does a banked turn. The new Bombardier Amtrak Acela train is a tilt-train, as well as the Bombardier VIA Rail LRC s that have been running for more than 20 years in Canada.

    There are two kind of tilt-trains: passive-suspention and active-suspension . Passive-suspension tilt trains are simply hung down and swing out in curves, whilst active suspension trains have electronic acceleration sensors that control hydraulic rams that tilt the carbodies. The old United Aircraft Turbo train and the old Talgo Pendular trains had passive suspension.

    It should work politically: engineers looove that kind of contraptions! And politicians looove to be associated with forward-thinking technology... But what kind of engineers? Aircraft engineers are clueless about railroad problems (one should remember the woes suffered by the late UAC turbo train), and railroad engineers are justifiably wary of sleek lightweight technology that falls apart at the slightest rail joint...

    I am afraid that having efficient turbine power for high-speed passenger trains would end-up in a costlier, less flexible exercise than using electrified off-the-shelf technology in the long run...

    1. Re:Turbine trains? Not a good idea. by boa13 · · Score: 3, Interesting

      100 years ago, in Paris, a subway train caught fire, killing more than 100 people. The cause: high-intensity traction power sent through flexible cables throughout the train. Such lessons from the past are not easily forgotten...

      Actually, things happened a bit differently. While it is true that the train caught fire due to an electrical wiring defect, the blaze didn't kill many people; most if not all the passengers of the train escaped and survived.

      What happened is that the train being mostly made of wood, it generated a lot of smoke while burning. Additionnally, the venting in the subway tunnels was simply bad at that time. So, the hundred or so people who died there were in fact in the next train, which stayed stopped in the tunnel, where most of its passengers were asphyxied or killed in the panic that ensued.

      It was still the very beginning of the subway at that time; lots of lessons were learned the hard way.

  123. for a *real* innovation... by Anonymous Coward · · Score: 0

    check out this site. It may never happen, but it would be really sweet.

  124. I forgot this.. by TheHawke · · Score: 2, Informative

    Union Pacific did run about 30 of the GTEL (Gas Turbine Electric Locomotive) 8500 series on their lines in 1949 and they would haul mile-long trains at a swift 70 MPH. Their drivetrains could deliver about 8500SHP at the cars and were later upgraded to 10,000SHP! U.P. calculated that a single unit (thats a rail term for each car in a train, for you new to railroading) could haul 734 fully loaded rail cars at a steady 12 MPH!
    BUT for the long hauls, a tender full of Jet-A was needed to quench thirst of the gas guzzlers and were subsequently retired in 1970.
    These monsters of the rail line were the prime moneymakers of UP's lineup and did their duty without complant and with plenty of punch.

    http://utahrails.net/all-time/all-time-loco-chro n- 02.htm
    http://www.riverraisinmodels.com/up8500.ht ml

    --
    First rule of holes; When in one, stop digging.
  125. I like that noise by Anonymous Coward · · Score: 0

    I live about a mile from a rail line and love going to sleep hearing the engines working upgrade.

    As an aside, on Sept 11, the train horns seemed to be a little louder, the engines a little more powerful, as if the railroad had given the engineers permission to make a little more noise than regulations usually allowed; just to remind people that, while the airlines might have been grounded, the railroads were still getting their job done (and at less cost per ton than any other means of conveyance.)

    1. Re:I like that noise by Anonymous Coward · · Score: 0

      As an aside, on Sept 11, the train horns seemed to be a little louder, the engines a little more powerful, as if the railroad had given the engineers permission to make a little more noise than regulations usually allowed; just to remind people that, while the airlines might have been grounded, the railroads were still getting their job done (and at less cost per ton than any other means of conveyance.)

      You are gay. That is the most stupid thing I have ever read. You had a tear in your eye as you wrote that, didn't you? Bell end.

  126. Re:this shouldn't have been accepted by /. by Anonymous Coward · · Score: 0
    If a train brought it, a salesman sold it!

    But if Slashdot bought it, that doesn't prove much, does it?

  127. Interesting talk in the railroad.net forums by dolanh · · Score: 4, Informative

    I plugged "JetTrain bombardier" into google and got postings on the railroad.net forums. Seems quite a few folks there are pretty skeptical. A good read, in all:

    http://www.railroad.net/forums/messages.asp?TopicI D=5208

  128. Train? We don't need no steenking train! by visgoth · · Score: 1

    I'd rather have a jet turbine motorcycle! Act now, before your place in the darwin awards hall of fame is taken.

    --
    My patience is infinite, my time is not.
  129. Re:high-speed cross-continental train would be gre by Hadlock · · Score: 2, Interesting

    actually popular science quoted average air speed @ 100 mph after you factor in security, time spent on the ground, taking off, travling, landing, ect... of course it skyrockets to i think 250 mph when you take a direct flight

    --
    moox. for a new generation.
  130. I disagree by djupedal · · Score: 2

    Finally, the high-speed rail travel is only moderately successful even in its ideal arenas of rail-crazy Europe and Japan

    Shinkansens have been racing from one end of Japan to the other since 1964. One train can carry more than 1000 passengers. Business men use it as a fully equipped mobile office while they move around the country in comfort. How anyone can trivialize this as a 'moderate success' amazes me. Lucky for us, the Japanese have happily ignored this kind of short-sighted objectivity and gone about their lives while others wait for traffic to clear and hope the next offramp isn't under construction...

    High speed rail in Japan has reduced the need for airports and the infrastructure that goes along with that mode of public transportation. This may be an easy point to miss, since it seems to not be conspicuous in it's absence.

    Go to Japan and ride one of these for yourself...it's an 'E' ticket (more fun than you can imagine...).

    1. Re:I disagree by MtViewGuy · · Score: 2

      Except for one thing: how come on many Japanese domestic routes Japan Airlines and All-Nippon Airways are flying 747's fitted with seating for nearly 600 passengers?? And there are multiple flights per day?

      If you're talking under 180 minutes transit time a high-speed train makes sense, but when you're talking Tokyo to Fukuoka that same train takes nearly seven hours for a one way trip. No wonder why JAL and ANA are flying these 747's with high-density seating.

  131. This isn't NEW it's 40 years OLD! by tehramero · · Score: 1

    Turbine engines are nothing new at all. But if you read Popular Science and the mass media you'd think it was a fabulously new idea. In fact, most diesel locomotives today are turbine powered. This is not new at all. It's so not new, it's already standard practice in the industry. Trains are turbine powered, today, now. So are helicopters. Geez.

  132. Would 120 mph trains really help? by Anonymous Coward · · Score: 0

    I rode Amtrak trains across the country and back during the past summer and I swear our average speed was like 42 mph. The train was capable of atleast 80mph (as measured by our GPS reciever onboard) but hardly ever was actually at that speed. Arn't speed limits on tracks the problem anyway?

  133. However, technology has improved by MtViewGuy · · Score: 4, Insightful

    I think you're basing your assessments on the old United Aircraft Turbotrains and the even older GE Big Blow locomotives that Union Pacific Railroad ran during the 1950's and 1960's.

    Fortunately, if you've read Bombardier's web page, JetTrain has been designed with the following in mind:

    1. The train is designed to meet the very strict FRA requirements for crash survivability, requirements that are actually stricter than those in much of Europe.

    2. The JetTrain locomotive uses far more modern gas turbine engines than the old Turbotrain. Remember, Turbotrain was built during the 1960's; with 30 years of research and development since then derived from developing quieter, more fuel efficient and less-polluting jet engines for the commercial aircraft industry since 1970, Pratt & Whitney today can deliver a gas turbine engine for the JetTrain that will use much less fuel, spew out way less exhaust emissions and generate far less noise than the old Turbotrains.

    3. Because JetTrain is a clean sheet design, it won't have to owe anything to current diesel-electric locomotive technology, technology that emphasizes more on initial pulling power for heavy trains. Remember, the entire JetTrain trainset uses the latest in materials technology to keep the weight down while still meeting FRA safety standards.

    If Bombardier can demonstrate it can properly cool the hot exhaust from the gas turbine engine so it doesn't become a fire/high-temperature hazard to nearby objects, JetTrain with its potential 155 mph (250 km/h) top speed could be just the train for a number of Amtrak routes here in the USA. Already, Amtrak is in the process of upgrading the Chicago to Detroit corridor to handle trains in excess of 100 mph; JetTrain would be a natural for this route. And since Amtrak's Southwest Chief long-distance train between Chicago and Los Angeles runs mostly on AT&SF railroad trackage (which was rated for 100+ mph operation back in 1937!), imagine a JetTrain variant of the Southwest Chief going between Los Angeles and Chicago in under 36 hours! (That is faster than the record for this route set by the Santa Fe Super C freight train in the late 1960's.)

    While having high-speed electric trains with overhead wiring is nice, you're forgetting that setting up all that catenary wiring is exorbitantly expensive, especially when you also have to tie in that wiring into the local electrical grid. And don't forget the NIMBY crowd that might not be too thrilled by the installation of all that wiring for various reasons.

    I think if Bombardier can work out the bugs on JetTrain, it may become the primary form of locomotion for high-speed rail in the USA, mostly because you can skip out on the expensive overhead catenary wiring installation.

    1. Re:However, technology has improved by Pig+Hogger · · Score: 2
      I think you're basing your assessments on the old United Aircraft Turbotrains and the even older GE Big Blow locomotives that Union Pacific Railroad ran during the 1950's and 1960's.
      <boast mode>(I just inherited an old UAC turbo train operating manual this week...:) )</boast mode>

      Turbine power was initially considered for the French TGV; it is the petroleum crisis in 1974 that decided them to go electric. The TGV001 prototype was turbine-powered. And the RTG turbo trains weren't exactly failures either (they are still running in France).

      1. The train is designed to meet the very strict FRA requirements for crash survivability, requirements that are actually stricter than those in much of Europe.
      This has nothing to do with the issues I am voicing; the UAC (and the UP Big Blows) were also fully compliant for FRA ratings... However, the buffing-strength ratings are merely an excuse to justify the unacceptable lack of ATC on most of north-american signalling systems. In Europe, it is unthinkable to have the smallest switcher go without ATC; heck, the german Indusi system was invented in the 1930's!!! (Follow the link, Indusi is incredibly ingenious; even though it is based on magnetic induction and resonance, it can run even with mechanical signalling with no electric power whatsoever).
      2. The JetTrain locomotive uses far more modern gas turbine engines than the old Turbotrain. Remember, Turbotrain was built during the 1960's; with 30 years of research and development since then derived from developing quieter, more fuel efficient and less-polluting jet engines for the commercial aircraft industry since 1970, Pratt & Whitney today can deliver a gas turbine engine for the JetTrain that will use much less fuel, spew out way less exhaust emissions and generate far less noise than the old Turbotrains.
      Nowhere in the little information available do I see comparative figures for fuel consumption in full-power/vs idle modes... However, I stated that hotel power requirements mean that there will be still some significant demand on the turbine even when the train is idle. However, I am not convinced the turbine's fuel consumption will vary according to load (but, it is a rather moot point, because running at 150 mph will ask for plenty of power).
      3. Because JetTrain is a clean sheet design, it won't have to owe anything to current diesel-electric locomotive technology, technology that emphasizes more on initial pulling power for heavy trains. Remember, the entire JetTrain trainset uses the latest in materials technology to keep the weight down while still meeting FRA safety standards.
      I somehow suspect that it uses current electric locomotive components in the traction department... I know Bombardier, and they don't invent much (they buy all their technology). You should see the MU cars they make; they're horrible kitbashs of various technologies - some components were designed more than 50 years ago...
      If Bombardier can demonstrate it can properly cool the hot exhaust from the gas turbine engine so it doesn't become a fire/high- temperature hazard to nearby objects, JetTrain with its potential 155 mph (250 km/h) top speed could be just the train for a number of Amtrak routes here in the USA.
      I don't think this is a problem; turbine helicopters don't set fire to nearby buildings... If you mix the exhaust with enough air, you can cool it down significantly. After all, there is so much energy coming out of it.
      Already, Amtrak is in the process of upgrading the Chicago to Detroit corridor to handle trains in excess of 100 mph; JetTrain would be a natural for this route.
      Is that on GT? Hopefully not... What happens with the RTG modernization projects we heard about some years ago?
      And since Amtrak's Southwest Chief long-distance train between Chicago and Los Angeles runs mostly on AT&SF railroad trackage (which was rated for 100+ mph operation back in 1937!), imagine a JetTrain variant of the Southwest Chief going between Los Angeles and Chicago in under 36 hours! (That is faster than the record for this route set by the Santa Fe Super C freight train in the late 1960's.)
      But does the AT&SF has the ATC mandated for >79 mph running? Plus, I don't honestly see it pulling Superliner coaches at high-speed, the high center of gravity... And will the lightweight hog have enough weight on drivers to climb the mountain grades?
      While having high-speed electric trains with overhead wiring is nice, you're forgetting that setting up all that catenary wiring is exorbitantly expensive, especially when you also have to tie in that wiring into the local electrical grid. And don't forget the NIMBY crowd that might not be too thrilled by the installation of all that wiring for various reasons.
      Yet it is the only sensible long-term way to do it. Turbine-power is at best a stopgap measure. As such, it is a good solution to lure people back onto trains. Once you have a cricital mass of people going, it becomes easier to justify.

      However, one thing that will need to be done is to tackle the airline lobby head-on; best way would be to associate them. In Canada, Air-Canada has it's fingers in an eventual TGV pie, because they know very well how expensive it is to run airplanes, and they saw what happenned (oblivion) to domestic air transport in France when the TGV came online 20 years ago.

      I think if Bombardier can work out the bugs on JetTrain, it may become the primary form of locomotion for high-speed rail in the USA, mostly because you can skip out on the expensive overhead catenary wiring installation.
      Still, with the amount of power needed to move a train at high-speed, using gas turbines will soon reach a wall only electrification can break.
    2. Re:However, technology has improved by MtViewGuy · · Score: 2

      Turbine power was initially considered for the French TGV; it is the petroleum crisis in 1974 that decided them to go electric.

      Of course, it also helped at that time the French government was aggressively pursuing the construction of nuclear powerplants all over the country. That made it much of practical to have TGV's to be powered by overhead cantenary wire.

      However, I stated that hotel power requirements mean that there will be still some significant demand on the turbine even when the train is idle.

      The final version of JetTrain will have a flywheel system to augment the generational capacity of the gas turgine engine. That means the gas turbine can be smaller, which means lower noise and additional fuel savings.

      The problem with stringing up overhead cantenary wiring is that if you're too far away from the electric power source its gets exorbitantly expensively to power up and maintain; that was one reason why the Milwaukee Road railroad abandoned their electric locomotives over the Rockies in 1974. In Europe and Japan, because of the higher population density it's much easier to hook up overhead cantenary wiring to the local electric grid. I can just see a large fraction of the cost of the California HSR system is the cost of installing, maintaining and getting power for the overhead cantenary wiring. Besides, they're not exactly beautiful in design, and that will guarantee the NIMBY crowd will oppose such installations in scenic areas.

    3. Re:However, technology has improved by Pig+Hogger · · Score: 2

      The final version of JetTrain will have a flywheel system to augment the generational capacity of the gas turgine engine. That means the gas turbine can be smaller, which means lower noise and additional fuel savings.

      Aside from the fact that the flywheel could allow the turbine to idle without fuel (how about train hotel power?) far more efficiently than batteries would allow a quick restart, it merely adds weight and complexity to the system for dubious returns.

      The problem with stringing up overhead cantenary wiring is that if you're too far away from the electric power source its gets exorbitantly expensively to power up and maintain; that was one reason why the Milwaukee Road railroad abandoned their electric locomotives over the Rockies in 1974.

      The CRI&P electric plant was pretty much obsolete by the time it was dropped; it was virtually unchanged for more than 50 years.And the CRI&P was in a poor financial condition (as were many US roads then), and it certainly could not face the high capital costs needed to replace it's electrical plant. Not to mention that newer diesels were much cheaper to operate and did not justify the upkeep of the catenary.

      CN had a similar electrification that lasted until 1995, and at the end, it was pretty much a nightmare to maintain...

      In Europe and Japan, because of the higher population density it's much easier to hook up overhead cantenary wiring to the local electric grid.

      Not really. Much of Europe's electrification is done with 16 2/3 hz electrical power, so the railroads have to have their own generating and distribution facilities; they just can't hook-up to the commercial power grid.

      I can just see a large fraction of the cost of the California HSR system is the cost of installing, maintaining and getting power for the overhead cantenary wiring. Besides, they're not exactly beautiful in design, and that will guarantee the NIMBY crowd will oppose such installations in scenic areas.

      Modern high-voltage catenary is pretty well unobtrusive; high-voltage allows conductors, feeders and suspension wires to be much smaller than with comparable power DC catenary. But again, whatever you do, you will find NIMBIes bitching about...

  134. It's not the tracks holding Amtrack back... by default+luser · · Score: 2, Insightful

    ...It's the switching and signaling. Amtrack's older fleet of Diesel trains have an operating speed of 103mph. The more recent trains introduced in the mid 90s can do 110mph in service. Most of the switching and signaling on Amtrack's thousands of miles of non-electrified track require a human to see and react to the signal. So, with the exception of high-speed electric routes, most Amtrack railways are limited to 79mph for safety reasons. Municipalities also have the power to limit train speeds at a local level, if 79mph is considered too dangerous. Amtrack introduced a computer-based switching system to counter this, but I imagine just like everthing else Amtrack has attempted, it was implemented half-assed at best. http://www.cnn.com/TECH/9610/12/high.speed.trains/ Until a switching system SOMEWHERE NEAR the complexity of the FAA's air-traffic control system is introduced, it doesn't matter how fast you can make the engine go.

    --

    Man is the animal that laughs.
    And occasionally whores for Karma.

  135. You have it all wrong jackass by Anonymous Coward · · Score: 0

    My cock is round,
    my cock is square.
    My cock is in my underwear.

    It likes to fuck,
    it likes to grow
    It likes to see come camel toe.

    My name is Bob
    and I'm a snob.
    'cause my cock is quite a knob.

    I like 'em big
    I like 'em fat
    I even like to play with scat.

    So poop on me.
    Poop's for free!
    Poop all day then go pee.

  136. Some real facts about the turbine engine used... by catiafunk · · Score: 2, Informative

    Working for the manufacturer (Pratt & Whitney Canada) of the turbine engine for the JetTrain (truly a misleading name, but I'm not in Marketing) I can give you some facts: The turbine is a ST40 that produces about 5000 HP, weighs about 3000 lbs (about 38000 lbs less than a comparable diesel engine). The cyclic power demands are definately a concern for the turbine, but improvements in cooling within the engine remove any worrys. As for the mention of the the train with 10 1960's era PT6's: 10 engines @ ~350HP = 3500HP weight: 10x400lbs = 4000lbs BTW Bombardier has to add about 6000 lbs of dead weight to the locomotive to ensure proper traction...

  137. Re:This is silly. (Check the UK) by HeghmoH · · Score: 1

    On the continent, the high speed trains run dozens or hundreds of routes a day, and have no trouble hitting 200mph or more. An average speed on the Paris-Marseille route (computed as time when the train starts until time when the train stops, divided by distance) would typically be about 190mph. So, 125 is nice for a diesel, but it's not competitive with certain electric trains.

    --
    Mod down posts with a "Free Mac Mini/iPod" sig, they're spam!
  138. Re:STOP PRESS: Americans play catch-up! by Anonymous Coward · · Score: 0

    nah, they're just target practice so we can do the real work, like the s.a.s. in afghanistan.

  139. fuck trains! by Anonymous Coward · · Score: 0

    public transportation is for commie pinko liberals anyway!

  140. Gas Turbines 101 by nighthawk · · Score: 3, Informative

    Sigh,

    Time for gas turbines 101. Here's the biggest difference betwen Gas turbines and Diesels. A diesel can idle on almost no fuel whatsoever, that's why you hear them idling all the time. The fuel/wear and tear it takes to start them vastly outweighs the fuel needed to run them for an hour or eight. Because they use a reciprocating compressor, and a reciprocating compressor maintains is efficiency accross its speed and horsepower band (actually dropping off at the top end) you can turn them down to zero HP out and the fuel going in drops to 1-5% of max power.

    GT's have a compressor which relies on the velocities of the compressor blades and the air mass flowing through the compressor to make its magic happen. You dump all the vibrating, clanking, and flailing parts of a recip engine and rely on the momentum/dynamics of the working fluid to get a gizmo which takes 14.4 PSI air at the front and shoves 200-300 psi air out the back with one moving part which is in perfect rotary balance.

    The problem is: It only performs this miracle in a small RPM range. Slow down by 10% and the efficiency goes to pot. Long story short, GTEs have only one fuel flow setting, ON. that's why the military was working on an APU for the M1 Abrahms tank. IT would keep the housekeeping electrical systes running without throwing all the fuel away!

    There have been advancements in GTEs. Variable inlet stators allow them to have a somewhat broader band of acceptable efficiency. I would not be surprised to see that this engine has intercoolers between the compressors stages. This is a BIG help to efficiency (less HP needed to crank the compressor). This is not done in AC engines because intercoolers are bulky, but not heavy. The second thing you COULD do in a train is to use a recuperator. The takes the nice cool compressed air, and heats it with the exhaust air. Saves on fuel big time, reduces the noise and and the thermal plume of the engine. Again bulky but not heavy.

    Modern, digitally controlled, intercooled, rucuperated, gas turbine engines are bone head simple to operate and basically have squat for moving parts and maintenance needs. And they're light. Damn light. Mostly air in fact.

    Modern Turbochanred intercooled diesels are damn efficient too. Comfortably close to Carnot efficiency. BUT the massize engine block needed to take the reciprocating pistons is god auful heavy. Damn near a solid block of iron.

    Modern diesel freight engines need to be heavy because they need lots of traction to get moving. A passenger train hauls mostly air and aluminum. People weigh squat next to 100 ton freights. That's why passenger cars are so long. They're full of air. Its posible for this type of passenger train to weigh 1/20-1/100 of a freight train with the same HP. A lightweight engine will impose much smaller dynamic loads on the track system.

    A big limiting factor is the engine weight. Modern high speed/non electric passenger trains have big fat engines up front. In europe, they offload the engine by using overhead electric power.
    This is an interesting solution to the speed problem. I hope it works.

  141. Think that new jet turbine train's by Anonymous Coward · · Score: 0

    gonna go thru Rock Ridge Sherrif?

  142. vulnerability to terrorism by Anonymous Coward · · Score: 0

    do we really want to encourage high-speed passenger rail? talk about an inviting terrorist target . . .

    there is no way to defend thousands of miles of rail that run through every part of the country

    at least with airplanes you only have to defend the airports

  143. Jet Engines as Pumps by primenerd · · Score: 1

    This reminds me of the pumping system used on the Trans-Alaska pipeline. 1950's era Rolls-Royce jet engines are used to pump the oil.
    A turbofan is bolted down and the hot exhaust is aimed at a rotor. The rotor in turn is used to drive the physical pump that moves the oil. The beauty of this is the incredible range of throttle these engines provide, allowing for exacting adjustment in response to variations in oil viscosity etc. The jet fuel is refined on site from the oil in the pipeline. Each pump station has two engines, allowing for repairs and backup.
    The reason for the 1950's engines was reliability. When the system was designed in the early 1970's, the engine with the greatest proven track record was chosen. To their credit, these engines have been operating virtually non-stop 24/7/365 for 25 years. If I remember correctly they have broken several records. I just think it is interesting that over 20% of the United States' oil supply is moved by Eisenhower era engine technology.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  144. seating and transit by djupedal · · Score: 2

    Tokyo to Hakata/Fukuoka is 4hrs 53 minutes by Shinkansen, not seven hours. There are 12 HS trains daily out of Osaka.

    747 HD seating is a recent development in terms of supply demand. Cultural changes that see less working time and more domestic tourism have pushed the limits of all systems. Just because one seems impacted doesn't mean the others have failed.

    You're also ignoring the fact that the Shinkansen depot is in the center of Toyko. The nearest air terminal is Narita...another 1.5 hrs away by Shinjuko Express. Your reference to a 180 minute commute being the only commute making sense ignores the fact that air terminals are not downtown. Try calculating door-to-door for a realistic picture.

    At 300kph, and stops inside the city limits, high speed trains in Japan have been, and will remain, the foundation of Japan's domestic distance traveler.

    1. Re:seating and transit by MtViewGuy · · Score: 2

      Actually, you're wrong about domestic flights out of Tokyo being out of Narita. Narita (NRT) is primarily an international airport. Domestic flights in and out of Tokyo use Haneda Aiport (HND), which is far closer to downtown Tokyo and is connected to Japan's rail network and the Tokyo subway system by a short monorail ride.

      However, I haven't head anything about the latest JR trainsets being used on the Tokaido/Sanyo line runs lately--the newest JR high-speed trainsets are used on the Tohoku, Joetsu, and a few other Shinkansen lines where domestic tourist traffic is more dense.

  145. Monorail! by Chicks_Hate_Me · · Score: 1

    Ok, it seems kind of pointless to invest all this new technology when you are forced to use old tracks. The fact is, conventional rail is loud, slow, and dangerous. I say we invest money into building monorail around the country, then we won't to worry about over demanding maintenance, derailments, accidents (at-grade rail at fast speeds = no good at crossings), and overall noise of these "high speed" conventional rail. Monorails are quiet, safe, easy to maintain, and fast (Maglev technologies = 300+ mph).

    We need to stop being the dinosaurs of transportation and take on a new technology that will surpass all other countries (if the Japanese don't beat us to it ;)

  146. Re:Turbine. Pfffft. by Anonymous Coward · · Score: 0

    I guess the security guard was working under the direct orders from NYC deputy mayor Mike Flaherty?

  147. high speed rail in california... by demonbug · · Score: 1
    I know this isn't directly related to the article, but folks from California (and elsewhere) might be interested in
    this site, and, more specifically, this page about plans for high speed rail in California. They were considering MagLev for a while, but it looks like electrical traction is what they have decided on if funding is approved.


    So, come November 2004 my fellow Californians, remember to vote for the cool trains powered not by diesels or turbines, but honest-to-god caternary action. I, uh, hear they are going to run on Linux. Yeah, that's it. The "Golden State Happy Penguin Express". Yessiree.

  148. Amtrack DESERVES to die... by SvnLyrBrto · · Score: 1

    > We also have a Congress who feels that Amtrak
    > should be paying its own way, and not requiring
    > federal subsidies.

    I'm all in favor of more travel via train... ESPECIALLY locally, I'd LOVE it if, for example, if BART and MUNI were to dramaticlly expand the areas they cover and reduce my need for a car.

    But Amtrack is operated by a bunch of incompetant fucktards. It deserves to die a nasty death.

    As an example of the stupidity of Amtrack:

    Last time I went to the east coast to visit family, (I'm in San Francisco, they're in West Palm Beach, Florida.), I thought it would be cool to look into taking a train. This was before 9/11. I wasn't scared to fly. It was just for the hell of it; because I thought taking the train would be fun. So I put my origin, destination, and travel dates into Amtrack's online trip planner.

    To get myself from San Francisco to West Palm Beach, Amtrack wanted me to:

    1) First, take a bus (WTF???) to Emeryville.
    2) Take a train From Emeryville to Los Angeles.
    (So far, so good, right? But wait.)
    3) Then, Amtrack wants me to take another train, LA to Chicago.
    4) Change trains, Chicago to New York.
    5) Change trains again, and go down the east coast from NY to WPB.

    The total round trip time would have eaten up TEN DAYS of my two-week trip! And the bastards were going to charge MORE than it eventually cost me to fly! (six hours each way, with ONE plane change in Philidelphia)

    Thanks, Amtrack, but no thanks. I'll keep flying; terrorist risk or no.

    cya,
    john

    --
    Imagine all the people...
  149. Is there a chance the track could bend? by Anonymous Coward · · Score: 0

    ... Not on your life my Hindu friend!

  150. Re:high-speed cross-continental train would be gre by jpmorgan · · Score: 2
    And trains don't fly into buildings either.

    Thank god for that. You think a 767 moving at high speed carries a lot of energy? The typical long-haul freight train you see crossing the Rockies carries more energy than a large nuclear bomb. You slam on the breaks on a a five mile long double-stacked freight train and it comes to a stop 10 miles down the track.

    To see people rush crossings is sad. People have no respect for the power of the train.

  151. THE ONLY PROBLEM... by crazyhorse44 · · Score: 2, Funny

    is that the exhaust is so hot, it melts the asphalt off of any underpass that it passes under too slowly.

    --
    . SLASHDOT: Home of the vicious nerd.
  152. First Gas Turbine Loco by arnold2 · · Score: 2, Informative

    Don't want to get all train-spotty anoraky here, but the Swiss firm of Brown-Boveri produced the world's first gas turbine locomotive during the Second World War ! A project was set up in Great Britian immediately after the end of the Second World War to fund the development of a gas turbine powered locomotive to find a alternative to steam and diesel traction. This was before nationalisation and the two companies jointly behind it were the Great Western Railway and Metropolitan Vickers. The Swiss Locomotive Company produced their loco with a gas turbine built by Brown-Boveri in 1950. It was BR No 18000; one powered by a Metropolitan Vickers engine became 18100 delivered in 1952. The engine underwent testing and trials and went into mainline service on British Rail's Western Region. There were problems and failures and BR 18000 was taken out of service in 1959 :-)

  153. Re:Umm, have we invented electricity yet? by communazi · · Score: 2, Insightful

    I would prefer that you did some research before you begin spouting off a load of bullshit about a topic you know nothing about. Gone are the days of 40 rail sticks that need to be bolted together by hand. On all the Class 1 railroad main-lines in the United States (Union Pacific, BNSF, etc,) there is a federal mandate for continuously welded rail that will support heavy freight (>10,000 foot trains, several thousand tons) at 79 MPH. The rail that is laid is welded continuously after being extruded in 1000+ foot pieces.

    The reason not all rail in the United States is welded is because our railroads need to maintain 100,000+ miles of track. This is an amazing task. Probably 70,000 miles is not welded rail, and was probably built in 40 foot sections. One rail weld cost approximately 600 dollars (US) because of the precision and method necessary to not compromise the integrity of the rail itself. If we assume conservatively that we have 50,000 miles of rail to weld, will 40 foot rails, and at 600 dollars per weld, the total comes to approximately 8 billion dollars. This expense would have minimal benefit because the rail that would be welded does not carry enough traffic to justify the expense.

    Finally, the main reason our railroads are not electrified (other than the massive amount of electrification that would have to occur) is the type of cargo we haul on the railroads. European and Japanese railroads are primarily passenger railroads. This function lends itself to high speed and low weight. Our railroads are primarily freight carrying, and long heavy trains at that. Currently, to take a loaded, 10,000 foot train over Cajon Pass in California (approx 2% grade for 20+ miles), 6 6000 horsepower locomotives are required. Each of these locomotives generates approximately 4-5 MegaWatts at peak capacity. That is enough to power a multitude of homes. The logistics of delivering that kind of power is just unreasonable. Some mining railroads use electric locomotives, or used to. Kennecott Copper in Nevada and Utah comes to mind immediately. They had some of the largest electric freight locomotives ever built, and yet they dieselized. Why? because the cost of providing 12,000 volts over a couple hundred miles of rail was prohibitively expensive. Can you imagine the immense cost of doing the same for the entire US rail system? It would be impossible.

    Electrification works great on a small scale, for passenger operations. Large scale freight operations do not lend themselves particularly well to electrification.

    Please at least have some facts before you make a post bashing the US rail system. The rail system works amazingly well for the scope of the operations it has to carry, and the distances it has to cover. I guarantee you that we would be much less prosperous as a country without them.

    --
    They called me crazy, but we showed them didn't we?
  154. Gas turbine locomotives are nothing new. by MROD · · Score: 1

    As far back as 1972, the UK's Advanced Passenger Train (Experimental) used two power cars running on gas turbine engines. see this for a few more details.

    --

    Agrajag: "Oh no, not again!"
    1. Re:Gas turbine locomotives are nothing new. by mikerich · · Score: 2
      The APT Prototype is now in the National Railway Museum at York. As a real gas-guzzler it was killed off by the 1973-74 oil shocks. It really was the end of the 'White Heat of Technology' as it came along about the same time as Concorde - although without the latter's 'success'. But it was exciting to grow up at the time - one of the World's fastest trains, the fastest plane and we even had a space programme!

      But back to the APT... A friend was an engineer on the project and said that British Rail had a had no end of trouble with the exhaust...

      If it came out the top, it would damage overhead electrical cables, out the side and it tended to set light to the verge, and out the bottom it burned the sleepers on the track.

      Eventually they spread the exhausts over the top of the power car and it worked fine - if noisily.

      Then they decided to go back to the drawing board and design an electric-powered train. And we all know what happened to that in the cold light of Thatcherism...

      Lots of APT stuff here.

      Best wishes,
      Mike.

  155. Jet Turbines/Locomotives/Been There/Etc by ibm1130 · · Score: 1

    Funny nobody mentioned the Canadian turbo trains of years gone by.
    Powered by 8 Pratt&Whitney PT-6 ( Huey helicopter
    for an idea of the size ) engines.
    Problem was they were aircraft engines not specifically designed for service on land.
    Diferent dynamic environment so reliability suffered.
    Mind you with 8 of them you could lose one or two and still cruise along at 90 mph. Not really all that high speed, conventional just jet powered.
    There was a 747 style hump at the front for the driver and s small passenger area so you could sit behind the cab and see what was happening.
    A fun ride.

  156. HSS Stena Explorer by turgid · · Score: 2

    The coolest boat I've ever been on was the HSS Stena Explorer which goes from Harwich (England) to the Hook of Holand.
    This thing is a 100 000 horsepower, 126 metre-long catamaran that cruises at about 40kts (IIRC). It takes 120 cars and 50 lorries.
    It is totally awesome pounding across the north sea leaving every other vessel standing.
    It is powered by two small and two large gas turbines. The small ones are for low speed and the large for high speed. They drive several waterjets wich are steerable, and they're operated at maximum efficiency (hence small and large for different speeds).
    There is a plasma display with a map updated by GPS in realtime showing your progress, at the bow.
    The second time I crossed the sea in it, it was pretty rough, but I managed not to spill my pint, whereas all the scurvy land-lubbers were decidedly green :-)

  157. Re:this shouldn't have been accepted by /. by mikerich · · Score: 2
    Umm...why not?

    In the UK there has been concern over the safety of lightweight diesel trains since the Ladbroke Grove collision which killed 31 people.

    A lightweight Thames Turbo train crashed into a high-speed Great Western train, the fuel tank in the Thames Turbo exploded sending fire into the front part of the Great Western train, the front locomotive of which then burned.

    One of the recommendations of the Cullen Enquiry into the disaster was that rail companies should look at the safety of diesel trains and either remove the risk entirely, or redesign trains to better withstand a crash. (Although in the case of Ladbroke Grove what could have been done? The trains collided at nearly 200 kph)

    Many of our commuter services in London and the big cities are now electrified, but small diesels are used in the regions and across South West England.

    Best wishes,
    Mike.

  158. Real problem with US rail system by xyote · · Score: 1
    The problem with the US rail system isn't some technical issue. It's that it doesn't have the huge massive hidden subsidy that the US trucking industry has.

    The civil engineering rule of thumb for wear and tear on roads is a power of 4 by vehicle weight. This means that a 10 ton truck causes as much road wear as 10000 1 ton cars. That means for every $10 in highway taxes a car pays, a 10 ton truck should pay $100,000 dollars. But they don't. Most of it is subsized by taxpayers. If railroads got even a fraction of that, railroads could burn money for fuel and still be more econimical than trucks.

    Unfortunately, because this is a hidden subsidy, it totally distorts the perception of problems with the US rail system.

    1. Re:Real problem with US rail system by nagora · · Score: 1
      The civil engineering rule of thumb for wear and tear on roads is a power of 4 by vehicle weight.

      Have you got a reference for that figure? I'd be interested in looking in to this in more detail.

      TWW

      --
      "Encyclopedia" is to "Wikipedia" what "Library" is to "Some people at a bus stop"
    2. Re:Real problem with US rail system by xyote · · Score: 1
      I've seen the power of 4 formula in a New Scientist article and in a separate NYT article way way back so I can't give you references to those. I did a web search at one to try to find web references to it. Nothing came up but it's one of those you know the info is out there how do you phrase the search request things.

      I did come up with a lot of state highway dept studies to be used for determining truck taxes and tolls. Massive amount of forulas and calulations. Lot's more varibles, number of axles, road surface construction details, etc... The amount of politics and lobbying has to be incredible.

      I agree that the power of 4 rule of thumb does seem to be unbelievable and it would be nice to have a reference so it doesn't sound like an alien conspiracy theory. Perhaps any civil engineers out there have some info on this.

    3. Re:Real problem with US rail system by xyote · · Score: 1
      Wait, I should have taken another shot at searching the web. Here has the following quote.
      According to a study by the American Association of State Highway and Transportation Officials (AASHTO), a single heavy truck, weighing 80,000 pounds, can do as much damage to roads and bridges as 9,600 passenger cars. Furthermore, the Federal Highway Administration estimates that a 90,000-pound truck would create two-thirds more wear and tear on the infrastructure than one weighing 80,000 pounds.

      I haven't looked thru AASHTO's web site yet.

  159. Union Pacific have been using gas turbine engines by Anonymous Coward · · Score: 0

    Thought the 'Big Boy' locos used Gas turbine engines. The exhaust was directed through the roof of the loco.

    This really is something that has been done and is well known.

  160. Problem with "memetic equivalence" by dpilot · · Score: 2

    I won't dispute a word you say, since I don't really don't know much about Amtrak. A while back we looked into taking it for a trip, and it just wasn't convenient, largely like you say.

    But we seem to have a problem. Here in the good old USA two manifestations are:

    Passenger rail travel == Amtrak

    Manned space travel == NASA

    I'm sure there other examples. Both mentioned entities are troubled, and I'm sure both have good points as well as bad. But the real problem seems to be that we can't get beyond those entities to see beyond them. As Amtrak flounders, nobody else seems willing to go into the field. Most people seem to blame NASA for the lack of anyone else in that field.

    Not sure what the solution is, just trying to consolidate the problem.

    --
    The living have better things to do than to continue hating the dead.
  161. No upgrades? by Slashamatic · · Score: 2
    Um if you put a new locomotive capable of high speeds and heavier loads then you had better uprate the track. The high speed tracks in Germany are completely new.

    The only real advantage apart from infrastructure cost of carrying your own fuel is that you don't have to worry about power transmission over long distances. Track tends to be further away from civilisation in the US.

  162. Re:Turbine. Pfffft. by docbrown42 · · Score: 1

    I was in a secret railroad switch-house last week, and I stumbled upon a locomotive that had been sitting there since 1880. It was fusion powered. The reactor ran on GARBAGE no less! It could levitate and even looked capable of time travel. The security guard who let me in said his only instructions were to wait for a man named "Doc Brown" to show up.

    Ah, so that's where it ended up.

    --
    Ed Wedig
    Graphic design services
    docbrown.net
  163. Jet turbines by Anonymous Coward · · Score: 0

    They actually did this in the 60's. The out come was they were to noisy. Produced to much heat when in tuunnels, and were'nt as fuel efficient as thought. The first two probably still stand but as for the fuel efficiency engines have come a long way.

  164. Simple Solution by docbrown42 · · Score: 1

    > In the railroads' minds, louder is safer. They'll probably take advantage of the jet exhaust by routing it through a huge whistle and horn. It will continuously emit a piercing, deafening alien wail audible dozens of miles away. Railroad crossing accidents will become a thing of the past, because it will be too painful to remain near the tracks as the train approaches.

    You're an optimist... I predict lawsuits from grieving parents of Darwinbait.

    "B-b-b-but the trains are so loud now, they practically forced Johnny to floor it and drive around the gates at the railroad crossing! When they made new trains that could go twice as fast as the old trains, why couldn't they also make them able to stop faster, too? Waaaah!"


    There's a simple solution to that: why not route some of the jet exhaust out of the front of the train. Kind of like a reverse mounted jet engine. Then, when the train needs to stop quickly, the engineer fires up the jet and STOPS.

    --
    Ed Wedig
    Graphic design services
    docbrown.net
    1. Re:Simple Solution by Tackhead · · Score: 3, Funny
      > > "B-b-b-but the trains are so loud now, they practically forced Johnny to floor it and drive around the gates at the railroad crossing! When they made new trains that could go twice as fast as the old trains, why couldn't they also make them able to stop faster, too? Waaaah!"> > There's a simple solution to that: why not route some of the jet exhaust out of the front of the train. Kind of like a reverse mounted jet engine. Then, when the train needs to stop quickly, the engineer fires up the jet and STOPS.

      *evil grin*

      I'd love to see that in action. Johnny's pick-me-up truck gets incinerated in a blast of jet wash, windows implode, and then the train, still travelling at 140 MPH, (because even a jet engine producing 50,000 pounds of thrust doesn't do much against a train weighing tens of millions of pounds!) crushes him like a bug anyways.

      (Paging Father Darwin, pickup on Track Six!)

  165. Re: Water cooled engines by jhawkins · · Score: 1

    Yes, certain of these big engines cannot use antifreeze, they have to use water. I believe it has to do with either the cylinder sleeve or the gaskets/seals in the engine.
    A railroader friend of mine said his company had two engine blocks freeze and crack (and almost lost a third one) because of the water. See, the engines his RR uses have a 1500-watt heater and circulating pump that they will plug in when the engine is shut down at a yard or maint. facility. If there is no power for some reason, and it gets close to freezing, there is a safety valve that is supposed to dump the water out of the engine if it is about to freeze. Needless to say, the valve doesn't always work, and that's why they have two blocks to replace. Fun stuff!

  166. Everyone has a car by ACNeal · · Score: 2, Insightful

    Everyone has a car for the 300m trips. After that commuter flights, or flights are real cheap, and faster than rail ever could get. How long does a flight from NY to LA take? How much does it cost? Are you ever going to get that price/performance with rail (and still get some sort of performance)?

    That is why there isn't the infrastructure investment. No one rides them. That is why AmTrack, as heavily subsidized as it is, slowly whittles its lines away year after year.

    Flights are just too damn cheap, or you have a car (or can rent one). Gas is cheap, cars are cheap, flights are cheap in relation to other areas of the world. No one cares about rail anymore in this area. That is why we don't spend the money.

    1. Re:Everyone has a car by cunniff · · Score: 1

      Yeah, but you can't fly a train into a building under most circumstances. And the terminal infrastructure is much less expensive than an airport. The rail infrastructure, granted, is much more expensive than, well, the sky, but for the most part, it's almost in place already (modulo some track upgrading we'd need to do for high speed service, which you'd only want to do between major hubs anyway).

      Of course, trains do have their own vulnerabilities to terror-style attacks, higher than automobiles, but not as bad as airplanes.

      Last year, I spent a pleasant 5 days touring Germany by rail. Much better than flying or renting a car. I wish we'd get over ourselves here in the states and get a decent passenger rail system (Amtrak isn't anything close to what you'd call decent)

  167. electricity? TGV? by Frederic54 · · Score: 1

    never heard of the TGV in Europe (especially France) for example? in europe almost any locomotives use electricity, not diesel/fuel that pollute, are slower, etc... the TGV has a top speed more than 500km/h, but it's cruise speed is 360km/h, which would be enough in USA to go from one city to another

    --
    "Science will win because it works." - Stephen Hawking
  168. Why not "regular" engines ? by billcopc · · Score: 1

    IANARO, but why can't we just drop a good big-block combustion engine in there and call it a day ? Drop a few if you like. If it can pull a fricking tractor across a mud strip with umpteen pounds up its ass, I don't see why it couldn't pull a train (with a properly adjusted transmission). And since these things practically idle their way from point A to B, you could tune it for low-torque high-economy once you've got the rig up to speed. Trains have a Hoek-load of momentum, well enough to keep this thing rolling for miles with just a trickle of horsepower to keep the speed up.

    --
    -Billco, Fnarg.com
  169. Fuel efficiency and Saftey by briancnorton · · Score: 1

    What was not mentioned was fuel efficiency and saftey. Higher speeds are great, but not at the expense of more crashes. The entire rail system is out of date. The big problem with the turbines is that they eat expensive fuel like it's going out of style. Ask a tank driver what kind of mileage they get, then add 20,000 tons.

    --

    People who think they know everything really piss off those of us that actually do.

  170. Been there, done that by covertlaw · · Score: 1

    Union Pacific Railroad did this in 1952. They figured out they were too loud and sucked down too much fuel oil. http://www.uprr.com/aboutup/history/loco/locohs05. shtml

  171. right and wrong... by TamMan2000 · · Score: 2

    Gas turbines do scale up better, and they are more efficient. Diesels are more efficient in the small ranges, and gas turbines are naturally (think basic cycle definitions) MUCH more efficient, but it is hard to design and manufacture all the parts for small gas turbines without terrible efficiency losses (when the gas path gets that narrow, it is much more important to consider boundary effects, which is difficult to do...). In the power range they are talking about, a gas turbine IS more efficient, but more expensive to maintain.

    disclaimer: I work for the company that makes the engine we are discussing, but I deal with military jet engines most of the time...

    --
    "I'll have a Guinness, no wait, make that a Coors Light" -Grad student I work with, who shall remain anonymous...
    1. Re:right and wrong... by joib · · Score: 2

      Gas turbines in power stations are combined cycle, ie. they additionally have steam turbines using the excess heat from the gas turbines. This pushes up efficiency quite a lot, the best designs are about 60% efficient today. The best diesels are about 50-60%, and I find it hard to believe that a gas turbine without the steam turbine will get close to that.

    2. Re:right and wrong... by TamMan2000 · · Score: 2

      they do combined cycle diesels too, and they are not past the mid 50s in efficiency. Diesels without the combined cycle are lucky to hit 50.

      5-10% may not sound like alot but it is huge! hell, 1% is huge when you are talking about this stuff...

      --
      "I'll have a Guinness, no wait, make that a Coors Light" -Grad student I work with, who shall remain anonymous...
  172. WRONG!!! by Dwarfgoat · · Score: 1

    WRONG.

    It's what's known in the industry as "stringlining." It's why heavier (loaded) cars are switched to the front of a long train, and the "empties" (unloaded cars) are always coupled to the rear when possible.

    The flanges on the wheelsets (that little ridge on the inside of the wheel that actually keeps the car on the rails) can only take so much lateral force before jumping the rails.

    If a train with empties in the center of the train attempts to pull through a curve (especially while accelerating) the lighter cars in the center will derail and be pulled into a straight line between cars heavy enough to stay on the tracks. This can affect anywhere from 5 to 100 or more cars, and is a REAL BITCH to clean up...especially when it happens on a hill (which is where one generally finds sharper radius curves on a rail line). One would be amazed how far a freight car can roll off the tracks when pointed downhill!

    --
    That? That was a pigeon.
  173. Bush plays golf every weekend by Anonymous Coward · · Score: 0

    Do you work for Ari?

  174. Fuel is similar by TamMan2000 · · Score: 2

    Jet A and diesel ARE almost identicle. AND for not flight aplications you can get a gas turbine to run on just about anything with very slight mods...

    --
    "I'll have a Guinness, no wait, make that a Coors Light" -Grad student I work with, who shall remain anonymous...
  175. snowmobiles? by smartfart · · Score: 2
    They were always getting disabled every time they hit a snowmobile because they were so fragile.

    Say what?

    ...and don't you think the snowmobiles ended up being disabled as well?

    You'll have to pardon me, I'm from the south, so I wouldn't know about trains running over snowmobiles. Does this happen often?

    1. Re:snowmobiles? by HughsOnFirst · · Score: 2

      Well it's like this,
      Kids ( of all ages as it were ) would travel up and down the rail bed because it was smooth, flat, and isolated from the local authorities. I.E. if you wanted to run a stolen snowmobile flat out while drunk, the railroad tracks would seem to be ideal ( if you were drunk ) the problem was that the "kids" would try to cross the tracks and wedge the runners under the rails. Then they would just wander off and leave them there. Than the Turbo train , would come along , hit the snowmobile, which was small and low enough to gu under the train, but was substantial enough to mess it up enough that it would need repairs on the spot.

      And yeah, the snowmobiles ended up being "disabled" as well.
      And I'm from the central valley of california, 103 f in the summer, and I thought this was pretty bizarre as well.

  176. FAKE NAVEWEISS! by Anonymous Coward · · Score: 0

    The real NaveWeiss doesn't use the [nvws] tag on AC messages. And also, the link to the "authentic post" should point on another journal entry.

  177. Dedicated tracks by Malc · · Score: 2

    I read something in the National Post in the last week about Via (Canada's equivalent to Amtrak) wanting CDN$3 billion from the goverment. They want a single dedicated track in the Windsor-Montreal corridor so that they can get faster trains. This would increase the max speed from 170 to 240 kph, but there would be fewer stops (eg small stations). I wouldn't be surprised if Jean Cretin approved this money as part of his departing legacy building scheme.

  178. What about bladeless turbines? by Anonymous Coward · · Score: 0

    What about bladeless (Tesla) turbines in a hybrid-electric vehicle? It seems using an electric motor for traction and a simple-to-manufacture turbine for power generation might be a good solution.

  179. As long as cars get the subsidy by IIci · · Score: 1

    The American automobile infrastructure has evolved to the point where we are stuck with its success. How? We have problems with raising fuel prices to account for highway deaths and emergency service as well as polution since it would unfairly hit the poor who have no adequate public transit to get to work. We won't see the expansion of a interstate toll system to pay for the maintenance of roads as the trucking industry has a huge sway, despite the fact that road damage comes mostly from higher weight vehicles. So instead we pay for all of it through income taxes regardless of usage patterns. What will a governor do, add another lane to a highway to increase capacity or spend the money on new high speed rails with wider curves and imminent domain purchases and all the legal crap that comes from forcibly getting land from people (remember high-speed needs new rail layout to achieve speed). Having a subsidized transit system is vital since the increase in activity between locations can only strengthen the service industry and economy. But spending the subsidy all in one area provides diminishing returns, and returns on investment should be taken account of. You can have a 10 lane highway, but if it feeds into one lane exits, you still get congestion. This train may address the poor state of American railways, but does nothing to change the political climate that is the real chokepoint.

  180. Re:The problem with turbines for automotive use. . by back_pages · · Score: 2

    I work in a plant that manufactures turbine components. We have some land based rings that are so massive (approx. 23 sections per ring, 250 lbs per section) and reach such high RPMs that I'm told it takes over 12 hours for them to come to rest once the fuel is cut off. That's a lot of horsepower. These are used for power generation as well as naval engines. I'm not sure if the marine applications turn generators or a drive shaft, though. With proper gearing, I would think that it would be similar to turbines that drive helicoptor rotors.

  181. Why not use Combined-Cycle (Gas & Steam) Turbi by Anonymous Coward · · Score: 0

    If you want efficiency, combined cycle is the way to go. It's used in a lot of stationary power plants. The hot exaust from a gas turbine is used to create steam for a steam turbine. IIRC the total thermodynamic efficency can by close to 80% ! The specific power output would be less and perhaps maintenance would expensive when compared to a diesel, but it would use less fuel.

  182. Unlike traditional trains that run over people, by Rareul · · Score: 1

    this one will be able to suck people in, and spit them out whole, ala: Man Sucked Through Jet Intake

    ?sp

  183. And Tractors !!! by HughsOnFirst · · Score: 2

    The all time dumbest application of turbine power is undoubtedly the turbine tractor.

    "Several factors prevented the HT-340 from reaching commercial production. Gas turbine engines are able to produce great amounts of power from a very small package, but high fuel consumption is their downfall. When added to the difficulty of adequately filtering the massive amounts of air required by the turbine engine, and the noise produced, it was not a practical machine. "

    Another photo here

    Gee, put a low torque high speed engine with lousy fuel economy and a propensity for very bad things happening when dirt or foreign objects get sucked into in on a slow moving tractor whose main function is to disturb the soil in one way or another.

    Something they don't mention is that the IHC Turbine Tractor would flip over backwards because it didn't weigh enough and was too powerful. Airplanes want to be light weight , and tractors want to be heavy. I remember filling the tires of our tractors with powdered lead when I was a kid, (another pretty dumb thing considering you want to keep lead and food well separated. ) and hanging 55 gallon barrels of concrete on the front.

  184. Potted plants? by tgrigsby · · Score: 1

    This picture (http://www.railpace.com/turbine/jet3.jpg) of the jet train had me cracking up. As someone how used to take BART trains to a job in Oakland many years ago, I found the potted plants sitting on the platform hysterical. What the heck? That's the best presentation they could make? I guess they spent all their money on the train and couldn't afford anything more festive for the press conference....

    --
    *** *** You're just jealous 'cause the voices talk to me... ***
  185. Re:Remindes me of the JATO Impala story (OT) by some+guy+I+know · · Score: 1

    Apparently the story had truthful elements, the real guy behind it did attach the JATO to an old push railroad car and it worked fairly well

    This person claims that his adventure is probably the source for the rocket car UL.
    It's pretty funny, and worth the (long) read.

    --
    Those who sacrifice security to condemn liberty deserve to repeat history or something. - Benjamin Santayana
  186. Last Post! by alpg · · Score: 1

    Too often people have come to me and said, "If I had just one wish for
    anything in all the world, I would wish for more user-defined equations
    in the HP-51820A Waveform Generator Software."
    -- Instrument News
    [Once is too often. Ed.]

    - this post brought to you by the Automated Last Post Generator...

  187. Last Post! by alpg · · Score: 1

    This "brain-damaged" epithet is getting sorely overworked. When we can
    speak of someone or something being flawed, impaired, marred, spoiled;
    batty, bedlamite, bonkers, buggy, cracked, crazed, cuckoo, daft, demented,
    deranged, loco, lunatic, mad, maniac, mindless, non compos mentis, nuts,
    Reaganite, screwy, teched, unbalanced, unsound, witless, wrong; senseless,
    spastic, spasmodic, convulsive; doped, spaced-out, stoned, zonked; {beef,
    beetle,block,dung,thick}headed, dense, doltish, dull, duncical, numskulled,
    pinhead; asinine, fatuous, foolish, silly, simple; brute, lumbering, oafish;
    half-assed, incompetent; backward, retarded, imbecilic, moronic; when we have
    a whole precisely nuanced vocabulary of intellectual abuse to draw upon,
    individually and in combination, isn't it a little to be
    limited to a single, now quite trite, adjective?

    - this post brought to you by the Automated Last Post Generator...