Slashdot Mirror
Black Death Discovered In Oregon
redletterdave writes "The Black Death, a strain of bubonic plague that destroyed nearly a third of Europe's entire population between 1347 and 1369, has been found in Oregon. Health officials in Portland have confirmed that a man contracted the plague after getting bitten by a cat. The unidentified man, who is currently in his 50s, had tried to pry a dead mouse from a stray cat's mouth on June 2 when the cat attacked him. Days later, fever and sickness drove the man to check himself into Oregon's St. Charles Medical Center, where he is currently in 'critical condition.'"
Why the hell did he think it was a good idea to try to get the dead mouse away from the cat in the first place?
Maybe you shouldn't be screwing around with wild animals and their food . . .
Three days from now?? Thats tomorrow!! ~Peter Griffin
While an exciting headline, certain to raise the blood pressure of the angst brigade, this isn't terribly newsworthy. Bubonic plague has been found in animals (mostly prairie dogs in Colorado) for decades and apparently is the sixth case of plague in Oregon since 1995. It's easy to treat with antibiotics. The hardest part is actually thinking that Yersinia pestis is the causative organism.
Bonus points for Monty Python addicts.
Faster! Faster! Faster would be better!
Really though, from TFA:
it is treatable with antibiotics
the bacteria thrives in forests, grasslands and any wooded areas inhabited by rats and squirrels
Without the help of modern medicine, Europeans in the Middle Ages could do little to combat the plague.
So this is a bacterium that is common in the wild, which can be contracted by humans but is treatable with modern medicine. It is not as though we are facing another plague here...
Palm trees and 8
Obligatory Monthy Python Reference http://www.youtube.com/watch?v=grbSQ6O6kbs "I'm not dead yet"
no comment
Bubonic plague has been endemic (sustaining itself permanently, in this case in the animal population) in the western part of the US for years, although it is news to public health officials when a human contracts it. There was a case two years ago, also in Oregon.
The reason it doesn't sweep the nation the way it swept Europe is advances in hygiene, public health and medical treatment. Rats and fleas in the house aren't unheard of these days, but they're no longer universal. If people are getting bit by fleas they'll call the exterminator or the board of health; they won't just accept it as a fact of life. If they contract plague they'll go to the doctor who will cure it relatively easily.
Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
True, many of the hiking trails in New Mexico have signs warning that rodents may be carrying the plague. What surprises me, though, is the man is in critical condition. I thought the plague was easily treatable with antibiotics today. Is this a new antibiotic resistant strain?
If I can be modded down for being a troll, can I be modded up for being an orc, or a balrog?
No, must be confirmation bias on your part.
Black Plague is rare, but still happens you just usually don't hear about it because it's treatable with antibiotics and preventable by controlling rodent populations - neither antibiotic treatment nor effective prevention were known in europe during the middle ages.
Ive had mine in the army. I'm not worried
True, many of the hiking trails in New Mexico have signs warning that rodents may be carrying the plague. What surprises me, though, is the man is in critical condition. I thought the plague was easily treatable with antibiotics today. Is this a new antibiotic resistant strain?
Treatable when caught early.
I can has worldwide pandemic?
that is all.
Oh wait, anyone else ever know that putting something like 'PPPPPLLLLLLLLLAAAAAAAAAAAAGUE?!?" as a comment subject produces a "filter error: Too much repetition". Isn't it reasonable to expect that a mature person who can operate a computer and engage in discussion groups well aware enough of what constitutes too much or too little repetition?
Because I can clearly say it in the message body, just not the subject. Yet, its exactly what I wanted the subject to be!
Yep, it was a 50-year-old men. People in that demographic are infamous for avoiding medical treatment until it's too late.
Yes, he contracted septicaemic plague, the blood-borne form of Yersinia pestis. That doesn't mean he contracted "the Black Death". The Black Death was almost certainly caused by a variant of Y. pestis which is no longer around (microorganisms tend to change a bit over the course of a few centuries). It's also the name of a specific pandemic of plague, and while there were other smaller outbreaks in the following centuries, they weren't generally referred to by that name. One human case of a disease that is now treatable with antibiotics and easy to contain does not make for a pandemic.
Wrong, it's a new zombie strain, carried by rodents and cats from Japan; I suspect it is entirely distinct from the zombie strain seen in Florida, originating in Cuba.
You forgot to add "and get off my lawn!"
#DeleteChrome
A professor once told us, "It's around, and yes, occasionally kills someone. You just see, 'person died of severe bacterial infection'."
Exactly this. In the Southwestern US there is a case of plague every couple of years. Not a big deal unless it isn't diagnosed and treated rapidly. It probably shows up in other areas of the world as well.
They keep finding plague in the prairie dog colonies out here. They do a news story about it every couple years. It's not really anything to get worked up about, unless you're doing something you shouldn't have been doing in the first place. Like messing with stray cats. Or maybe letting your dog run around in the prairie dog fields...
I'm trying to teach myself to set people on fire with my mind... Is it hot in here?
that the end of our civilization will start in Portland. Take a bath you hipsters!
OMG facts!
Yeah plague isn't really uncommon, there are still areas of Russia and Africa and other countries [citation needed] where plague is still a problem, mostly for livestock.
It wont really turn into the black death again, since we now have stuff like proper hygiene and antibiotics. Of course it could have been one of those super plagues the Soviets were designing that somehow got out, if that was the case commence you panicking now.
Admit nothing. Deny Everything. Make Counter-accusations.
Actually, epidemiology is entirely unsure about the matter. (Also, don't anthropomorphize inanimate objects, they hate it when you do that.)
Some people think it was the bubonic plague because that matches _some_ of the symptoms reported at the time and y. pestis has been found in mass graves from the period. (Obviously people who disagree are pulling out the "correlation does not equal causation" card.)
Other people believe it was ebola, anthrax, or something else because the incubation period, the rate and nature of the spread, and some of the symptoms don't match those of the modern bubonic plague.
Some people believe it was the y. pestis, but it behaved differently back then because humans had zero immunity when it was introduced, and both humans and the bacteria have had a few centuries to evolve since then.
And some people believe that it wasn't just one disease that was responsible for the black death but a number of different diseases sweeping through around the same time. They didn't know much about disease at the time, and if everyone has heard of the black death and a bunch of people get sick and die, everyone is going to blame it on the black death.
This Space Intentionally Left Blank
They've taken bets on how many days he's going to stay alive.
Come on! The guy has no insurance!
WARNING: Smartphones have side effects--most of them undocumented.
"I'm not dead!"
Yep, it was a 50-year-old men. People in that demographic are infamous for avoiding medical treatment until it's too late.
That is because by the time we are that old, we know that most doctors don't actually know as much as they think (meaning they tend to guess alot), and don't want to pay the high price for that.
Be seeing you...
Also, as a bonus, Seanan McGuire has an amusing "teaching song" about the Black Death which briefly covers a lot of the objections to the y. pestis theory. Unfortunately it doesn't seem to be one of the songs with a performance on YouTube, though you can hear a brief clip of it on CDBaby.
This Space Intentionally Left Blank
Wrong, it's a new zombie strain, carried by rodents and cats from Japan; I suspect it is entirely distinct from the zombie strain seen in Florida, originating in Cuba.
You may be on to something:
Portland police shorten hours at Laurelhurst Park after reports of group of teen boys attacking others
There is no "I disagree" mod for a reason. Flamebait, Troll, and Overrated are not substitutes.
Well, I've got an SDID that is a thousand times smaller, and I agree with the OP. This is barely news, let alone news for nerds. The bubonic plague is not-uncommon among the west coast's rodent population, and is easily treatable, and there's nothing particularly nerdy going on here.
neither antibiotic treatment nor effective prevention were known in europe during the middle ages.
Neither were there pervasive antibiotic resistant bacteria. Today it is "treatable with antibiotics"; but we cannot rely on there not being new strains that are resistant to antibiotics.
"I can survive with the Plague for another 15 years and get on medicare"
Learn to love Alaska
Even back in the Ye Olden Days when the plague was rampant there was strains / variations that where a lot more virulent. If you caught the strain that was the one that rapidly progressed to septicemic plague you where toast in hours to 1-2 days.
To err is human; effective mayhem requires the root password!
There are 1-2 cases of bubonic plague in the US every year. "Yersenia pestis" is part of the normal body flora of several animals, especially underneath the nails of the armadillo. Now when we see cipro resistant plague, then you can panic.
Seven puppies were harmed during the making of this post.
You now a days all the mouse manufacturers have switched to USB. Those with the old serial green connector that looks like S-video connector are quite rare, and many people are fond of them, even if they are totally dead and it is unlikely for them to become valuable again. So, yeah, if a cat tries swallow it, I would pry it from its mouth too.
sed -e 's/Chuck Norris/Rajnikant/g' joke > fact
One big cause of plagues in the Middle Ages was therefore situations that caused huge increases in the rodent population. This happened whenever there were food shortages, because people would stop being able to spare food to feed dogs and cats. When you stop feeding your dog, pretty soon you have to kill it (and then you may as well eat it). Without dogs and cats around, the rat population would take off. That's why in famines, as soon as people get done eating dogs and cats they start to eat rats. But of course the combination of lots of rats with underfed, weakened people means that plague can kill a lot of people. Indeed, the worse food security you had in your town, the more people tended to die of plague.
Actually they did have rodent population control in those days, but it's effectiveness was severely curtailed as they associated cats with witchcraft and so went around killing them. An enlightening glimpse of how perpetuating a climate of fear with no sound basis can backfire!
These views express my own personal opinions, not those of the other voices in my head
That may happen, but antibiotic resistance usually happens because of overprescription, and people not following directions. Since there aren't many cases of Plague, pretty much any time it does pop up, those people are under careful care, so if there is any antibiotic resistance to it, it's probably because of "environmental antibiotics" - pets under treatment peeing excess, same for farm animals, leaching landfills, etc.
The living have better things to do than to continue hating the dead.
From the linked article:
Even though there are about seven cases of the Black Plague in the U.S. each year, most cases have been in the West and the Southweset, the bacterium is considerably less fatal than it once was. According to the CDC, 1 in 7 cases are fatal, but the disease can now be treated with antibiotics.
I know, I know I'm not supposed to read the article...
No, must be confirmation bias on your part.
Black Plague is rare, but still happens you just usually don't hear about it because it's treatable with antibiotics and preventable by controlling rodent populations - neither antibiotic treatment nor effective prevention were known in europe during the middle ages.
I'm not sure you are entirely correct. The Black Plague is a particular stain of bubonic disease, or at least a group of stains. Although the bubonic disease is still around (and easily treatable), it is not the same stain. One would expect this news is regarding a different stain than was we "usually" see these days. Otherwise, why would be it news worthy ?
morcego
That may happen, but antibiotic resistance usually happens because of overprescription, and people not following directions. Since there aren't many cases of Plague, pretty much any time it does pop up, those people are under careful care, so if there is any antibiotic resistance to it, it's probably because of "environmental antibiotics" - pets under treatment peeing excess, same for farm animals, leaching landfills, etc.
Antibiotic resistance usually happens because of the widespread use of sub therapeutic doses of antibiotics as a 'growth enhancer' in animal feed, and the ability of bacteria to exchange genes, even between different species of bacteria. A fairly recent example of this behavior is the EHEC strain, a strain of previously harmles e.coli bacteria that seems to have absorbed the gene for producing a deadly toxin from the dysentery bug.
I can haz bubonik plaguez? http://lh5.ggpht.com/_3iv5LGzCFf4/SdUvJpZF39I/AAAAAAAAB5s/eY-hdDrHU9I/bubonic.jpg
Or did I miss a memo? :)
If Google really cared they would fix Android Chrome to reflow text, instead of discriminating
I have no fear. I know if I don't use it then I can't be hurt by it. What it does to you is of course your business. I'm sure the effects aren't all that beneficial. I've seen plenty of pot heads and it was enough for me to pass on the experience.
Black Plague is rare, but still happens you just usually don't hear about it because it's treatable with antibiotics and preventable by controlling rodent populations
I live on the edge of a national forest at the "urban/forest interface". Every once in a while there will be a report of Y. Pestis (aka "The Plague") in squirrels or something in the park nearby (it's a nature center that leads into the forest). I don't recall any cases where it was transmitted to people. Even if it were relatively common, there are far more dangerous things in the forest, even right here at the developed edge. Most Saturdays in the summer seem to bring a lot of helicopter traffic over the house, as the sheriffs fly back and forth plucking people off of a dangerous climb that leads to the second of many small waterfalls. A couple people died there last year, and already this month I think there have been two major falls of ~150+ feet. Both survived, but with pretty serious injuries. Plague is a lot easier to deal with.
You say 1-2 cases, and the article, in two different places, says 7 cases per year and 10-15 cases per year. I don't know whom to believe!
The CB App. What's your 20?
I am actually a better programmer after smoking a _small_ amount. My right-brained creative problem solving abilities are greatly increased, at the expense of some of my left-brained activities (such as doing math in my head). This is particularly important for me, a heavily left-brained thinker. Whenever I get stuck on a problem, I go have a "smoke break," and suddenly I have all kinds of ideas flowing through my head (some of which are even good). Results will vary depending on the person though.
Fanboy Status: Apache Flex, C#, Eclipse, KDE, Pirate Party, Ron Paul, Slackware, Windows 7
Madagascar has closed its ports.
I think Pot may be like most things. A little probably wont hurt and might even be beneficial in some cases. Unfortunately it gets treated like alcohol by most people. If a little is good then more has to be better. That said, I don't really see why it's illegal.
I'm almost positive it's exactly the same. Except the plague episode was from a jar from a ship that had a cat, and the cat episode was a neighbour's pet that had previously died. Or something like that.
Survivors of this plague, when paired, produce offspring that are often missing the CCR5 receptor which the majority of HIV strains bind to for infection.
This would (in theory) boost the future population's natural immunity, at least for that segment of the population, and until there's enough of that population to give marrow transfusions to the other population to give them artificial immunity to those strains. Of course, we then have to worry about the strains that work in a different manner, which would begin to become more prevalent.
Just another bandage, but better than having to take a constant supply of drugs!
Still waiting on Serviscope_minor to wake up to fucking reality and realize that Jessica Price isn't going to fuck him.
Can nobody else figure this out?! Oregon + cat + rare centuries old plague = witch. That's just clear as day lol. Obviously it was a black cat as well. Time to start up the Salem witch trials again! What? I have the wrong Salem? It's Salem Massachusetts, not Salem Oregon? Shut up, lol.
Okay, theory 2: apparently icanhascheezburger.com wasn't kidding. Cats really are trying to kill everyone and take over the world.
Oh, and major correction to the bajillion above posts. This is NOT evolutionary Darwinism. This dumbass who basically tried to wrestle a rat away from a stray cat is doing something immensely stupid that will get everyone else killed. That's sort of the opposite.
the ability of bacteria to exchange genes, even between different species of bacteria.
This is a good time to remind everyone that the whole concept of different species is an intellectual model that we have found to be convenient in simplifying reality enough that we can understand it, sort of. We might all be in agreement about where the lines are between different species, but that does not impose any limitations on the reality Out There: it might be this way, or it might not.
Most of the time the taxonomy of species, genus, phylum, etc is a good enough model to be useful. But when it comes to things that can affect inheritance of traits, it is important to remember that what we have is just a model, and is certainly wrong at some of its edges. With activities like prophylactic antibiotics and genetic engineering of food crops the species model just does not work. A more conservative, and saner, way of looking at antibiotics in cattle feed and GM corn is that we are monkeying with the genetics of an entire ecosystem, not just the target "species".
At this level the concept of "species" is just wrong. In fact it is worse than wrong, it is entirely inappropriate.
Will
I cannot offer any citations since the research I did on plague was back in the day before Internet and if I kept the notes I have lost track of where they might be. But as I recall there was strong evidence that bubonic plague and pneumonic plague were the same bacterium; that the only difference was in the mode of transmission. If bubonic plague got to the lungs, y. pestis was dispersed in aerosols as the victim coughed, and inhalation of the bacterium would assure a lung infection. This mode of transmission can be very deadly, with onset of symptoms, including cough, in hours and death within one or two days.
I live in Oregon, where we have a documented case of plague every couple of years. At the time I read up about plague I was studying to be a Registered Nurse, and would occasionally see a doctor's order for a blood test to rule out plague.
Will
Read up on your evolutionary theory.
They feared that it could be used to suppress protest or support unpopular rule.
That said, I don't really see why it's illegal.
Yeah it's interesting to think about. In the UK the government ignored and overruled scientific advice on cannabis and made it a Class "B" drug (with stiffer penalties), presumably because politics trumped science. I would imagine it's societal (cannabis is a drug, alcohol for some reason isn't "it's not a drug, it's a DRINK") and maybe even financial - in many parts of the world it'd be so easy to grow that it would be difficult to monetise in the way big companies like.
I do not want your cheap brainburning drugs. They are useless for work. And I am a working man today.
Yep, it was a 50-year-old men. People in that demographic are infamous for avoiding medical treatment until it's too late.
That is because by the time we are that old, we know that most doctors don't actually know as much as they think (meaning they tend to guess alot), and don't want to pay the high price for that.
What a strange country the U.S. is
We have bubonic plague endemic in prairie dog colonies in Colorado. It is spread by fleas and every so often, a dog colony collapses as it flares up.
We are warned to keep cats away form the colonies because they carry the fleas but I've never read where cats actually get the plague.
False. That happens occasionally, but the vast majority of antibiotic resistance is because bacteria that cause human diseases are really, really good at developing resistance to antibiotics.
It only has to happen once for every useful antibiotic effective against that kind of bacteria.
For antibiotics to guarantee no new future plague caused by a kind of bacteria, they have to work every time.
Or new kinds of antibiotics have to be developed at a rate no slower than the development of new resistance.
There are usually several cases of Bubonic Plague in the US every year.
It is treatable with antibiotics.
Can anyone tell me how to set my sig on Slashdot?
Search YouTube for "Juan de los Muertos" for Cuban zombie goodness
No sig for the moment.
How exactly does the presence of sublethal levels of antibiotics in the environment lead to selective pressure on E. coli to take up a shiga-toxin gene? Current research I have seen indicates the toxin provides an advantage in persistent carriage in livestock and has nothing to do with surviving antibiotics in animal feeds.
I strongly agree with the sentiment that antibiotics in agriculture are severely overused, but I do not think this is a valid example.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
The other half of controlling Black Plague is nutrition. A big part of why it thrived was due to inadequate high-nutrition foods, resulting in diminished immune systems. (That's a part of your 'prevention' picture.)
~/ssh slashdot.org ssh: connect to host slashdot.org port 22: too many beers
Most people are jerks too, so I guess it depends on which kind of jerk you prefer to spend your time around.
I am glad I do not have to maintain your code base.
On the contrary, I get complimented all the time on the "readability" of my code. It is the one art form I excell at.
Fanboy Status: Apache Flex, C#, Eclipse, KDE, Pirate Party, Ron Paul, Slackware, Windows 7