even with a 54gb/s connection i dotn think any existing motherboard would be able to handle it, i have uncapped cable(the cable guy didn't configure it properly, really) and i can only get about 300kb/s total on kazaalite, this increases a bit when i close other programs, making me think that its dependant on my computer, and just to nitpick and convert your figures to a more sensible numbers (nobody shares dvd images)... (1 million * 700mb[a divx'd avi or som'n])/(24*60*60)= about 8GB/sec, still a heluva lot faster than anything that'll be avalible in the next decade or two
Re:And what of recordable greeting cards?
on
Fritz's Hit List
·
· Score: 1
hehee, nice to see other UPL/PLA readers on/., fone phreakings not dead yet!
AIW cards are hardly hidden, all these outputs they mention, aren't on the card, there are only like 2 or 3 outputs on the card iself and you plug some crazy cables into them
from BABF13 - Bart to the Future
Ralph: Mr. Flanders, your blindedid.
Flanders: Yeah, I never shoulda had that trendy laser surgery, it was great at first, but at the 10 year mark your eyes fall out.
yeah, but i was using magical movie acid as an example, the kind that eats a smoking hole through most substances in mere moments, i guess if u wanna be picky i shoulda used horrible disfiguring burns as an example of a radical change in your biometrics
most biometric scanners can compensate for small temorary differences, if 95% of your hand still matches the file your ok, so small cuts are no big deal, if however you spilled acid on your hand or something, that'd be a different story
RTFA, the codes have been avalible to dealerships, this means your local chain (quaker, jiffy lube) or your local mechanic still didn't have acess to them, so you'd either have to go the the dealership and pay their higher prices, or go to your local mechanic and pay more because it would take longer to figure out what was wrong, btw, IMO going to a dealership is throwing your money away ussually, free estimate, they told me it would cost $115 (parts and labor) to replace a seatbelt and a window roller handle thingy, i went to a junkyard, payed the guy about $20 and took the half an hour to replace them myself
I thought NBC was using all its monkeys to come up with ideas for new reality shows and new sketches for SNL?
Re:Only 7 ammendments left in the Bill of Rights
on
That Link Is Illegal
·
· Score: 2
i am very proud that my senator was the only one who voted against this, hes a great man, we here in wisconsin have some damn fine legislators (we don't talk about mcarthy though), if only the rest of the states had some leaders who knew what they were doing
how do 3 small objects (quarks) that are presumably the same shape (or at least 2, up up down...) make up a larger object thats ovoid? i realy don't think subatomic particles can ever be given a definite shape, heisenberg anyone, can we actually observe the shape or orbit(do they orbit?) of quarks?
does anyone know of any place where i could still buy the lego collectors edition x wing, i've got the interceptor, naboo fighter and tantive IV, the x-wing and the star destroyer are the only two i don't have
Jeez, whos gonna know, if some guy gave me half a million dollars to do it i'd sit there for a day and type random combinations of a, c, g and t, heres your genome...
acgtgtacgtcagtacgtcgtgcatcgatcgatctacgatcgatcgat cgatcgatcgatcgatcgatcgactgactagctagctacgatgtatgcgc gatttcggatatttcgagctacgctadgatcgatcgatcgatcgatcgat cgatcgatcdgatcgatagctagctagctagctagctgatcgatcgatca tcgatgcgtagttagtcgtcgtacgtagctatcgatcgatctagctagct agctag X 10^?
i remember some really great simpsons arcade game, it was like 4 or 6 players, i cant really remember the story though, also barts house of weirdness was great, but tough
Slashdot Mirror
a hersheys kiss?
i have light shows in the microwave with them
even with a 54gb/s connection i dotn think any existing motherboard would be able to handle it, i have uncapped cable(the cable guy didn't configure it properly, really) and i can only get about 300kb/s total on kazaalite, this increases a bit when i close other programs, making me think that its dependant on my computer, and just to nitpick and convert your figures to a more sensible numbers (nobody shares dvd images)... (1 million * 700mb[a divx'd avi or som'n])/(24*60*60)= about 8GB/sec, still a heluva lot faster than anything that'll be avalible in the next decade or two
hehee, nice to see other UPL/PLA readers on /., fone phreakings not dead yet!
thats kinda ironic, i sprung the extra $100 for the 8500 dv specifically because i wanted a firewire port and i was all outa pci slots
AIW cards are hardly hidden, all these outputs they mention, aren't on the card, there are only like 2 or 3 outputs on the card iself and you plug some crazy cables into them
i think the standard term is boeing bomb
i put a buncha estes E model rocket engines on my skateboard one time, would that count?
from BABF13 - Bart to the Future Ralph: Mr. Flanders, your blindedid. Flanders: Yeah, I never shoulda had that trendy laser surgery, it was great at first, but at the 10 year mark your eyes fall out.
ahhhh, so many acronyms!
yeah, but i was using magical movie acid as an example, the kind that eats a smoking hole through most substances in mere moments, i guess if u wanna be picky i shoulda used horrible disfiguring burns as an example of a radical change in your biometrics
if sweaty mousing palms are a problem try this... http://metku.net/index.html?sect=view&n=1&path=mod s/rottaflekti/index_eng
most biometric scanners can compensate for small temorary differences, if 95% of your hand still matches the file your ok, so small cuts are no big deal, if however you spilled acid on your hand or something, that'd be a different story
out... side?
RTFA, the codes have been avalible to dealerships, this means your local chain (quaker, jiffy lube) or your local mechanic still didn't have acess to them, so you'd either have to go the the dealership and pay their higher prices, or go to your local mechanic and pay more because it would take longer to figure out what was wrong, btw, IMO going to a dealership is throwing your money away ussually, free estimate, they told me it would cost $115 (parts and labor) to replace a seatbelt and a window roller handle thingy, i went to a junkyard, payed the guy about $20 and took the half an hour to replace them myself
I thought NBC was using all its monkeys to come up with ideas for new reality shows and new sketches for SNL?
i am very proud that my senator was the only one who voted against this, hes a great man, we here in wisconsin have some damn fine legislators (we don't talk about mcarthy though), if only the rest of the states had some leaders who knew what they were doing
how do 3 small objects (quarks) that are presumably the same shape (or at least 2, up up down...) make up a larger object thats ovoid? i realy don't think subatomic particles can ever be given a definite shape, heisenberg anyone, can we actually observe the shape or orbit(do they orbit?) of quarks?
does anyone know of any place where i could still buy the lego collectors edition x wing, i've got the interceptor, naboo fighter and tantive IV, the x-wing and the star destroyer are the only two i don't have
yeah its legos, but c'mon, its got a big netscape logo on the side
Jeez, whos gonna know, if some guy gave me half a million dollars to do it i'd sit there for a day and type random combinations of a, c, g and t, heres your genome... acgtgtacgtcagtacgtcgtgcatcgatcgatctacgatcgatcgat cgatcgatcgatcgatcgatcgactgactagctagctacgatgtatgcgc gatttcggatatttcgagctacgctadgatcgatcgatcgatcgatcgat cgatcgatcdgatcgatagctagctagctagctagctgatcgatcgatca tcgatgcgtagttagtcgtcgtacgtagctatcgatcgatctagctagct agctag X 10^?
stick it in a mac, if the mac melts, its not a standard audio cd
most tv based arcade games were allright
i remember some really great simpsons arcade game, it was like 4 or 6 players, i cant really remember the story though, also barts house of weirdness was great, but tough
yeah, screw the video game