Slashdot Mirror
Purchase Your Personal Gene Map
dstone writes "Craig Venter, Time Magazine's Person of the Year in 2000 has a new hobby: collecting rich people's DNA. Millionaires are lining up to buy their personal gene maps for the cool price of USD$621,500. The process takes a week and you get some insight into your genetic mutations that may correlate with illnesses, cancers, Alzeimer's, etc. Venter is a high profile character in the genetic sequencing scene and the Human Genome Project. More info on him may be found here(1) , here(2), and here(3) . If you had the pocket change, would you give this man your business?"
...as to how long it is until someone patents my genes?
Software piracy is victimless theft.
I know I'd want to know, but what if you find out something that you can't do anything about? Maybe I don't want to know... Good thing I can't afford it.
A sucker is born every minute....
"TV, a medium as it is neither rare nor well done." Ernie Kovacs
What implicatiosn could this have, thoughts?
And why did you staple the trout to the RAM?
I'm sure it's not that easy to map someone's genes, but hundreds of thousands of dollars? They'd better tell me what kind of cancer I'll get, and when, for that much.
"Time is an illusion.
Lunchtime doubly so."
-Douglas Adams
David Borowitz
That's neat. If you charge for a service, people line up for it.
If the government mandated that you had to let them figure out your genome, people would scream.
Are these millionaires naive enough to think that a copy of their data will not be kept somewhere?
Sure, i'd do it, I could finally have scientific evidence that 1000's of dollars spent on therapy has told me - I'm insane, at the GENETIC level!
While this is neat and all, and it was an inevitable use of the technology - does this scream "Gattaca" to anyone else? How long before we're doing this for unborn fetuses, and aborting those with serious defects? Or choosing among the choicest embryos?
"Moderate drinking can help prevent amputated limbs" -- Abigail Zuger, NYTimes, 12/31/02
..there's still no gene for fate.
Now here's something you don't want your insurance company getting their hands on....
Increased risk of cancer? Sorry, not covered...
Increased risk of alcoholism? Those driver's insurance premiums just doubled..
Twenties Retirement
"Ever wonder which hollywood stars and starlets share common sequences?" Oprah's grandmother's dirty little secret!" "THE RICH AND POWERFUL: Genetically Inclined?"
no thanks
I'd buy something else... like a dozen dancing monkeys, a really awesome lawnmower, a whole lot of pudding, or maybe my own zombie slave. But, my own personal gene map, come on, that's just silly! Talk about wasting money.
Like the article says, there are no real practical uses for this. All that you get out of it is a long sequence of ATGCs which are pretty useless. I say useless because genes only show a predisposition towards certain diseases, but do not guarantee actually GETTING the disease. A complete health checkup would probably accomplish the same, at a drastically lower cost.
What happens if this guy finds the cure for cancer in your DNA? Is it your property? Same goes for lesser things, like a really good example of a gene. Is furthering the scientific community not optional?
And the same question goes for if someone gets your DNA from a hair you dropped, and makes some discovery through that. What rights do you have over your own genetic makeup?
The neat thing is, the price of this can only come down. I can't see it being cheap enough to be covered by health care (in countries that have such a beast), but imagine being able to plonk down $5000 or so to have your genome mapped - you could then know what to expect not only in your life, but what to expect for your children, especially when both you and your spouse have the same test done. I firmly believe that pre-emptive medical scanning - that is, determining and eliminating the possibility of a given illness before it occurs - will be one of the major scientific breakthroughs of our time.
They're really paying for is the true origin of their penile size. Is it really a product of nature or nurture...
Alcohol and Calculus don't mix. Don't drink and derive.
some day people will think back to how great the wealthy people of our time were and wan't to recreate them, I hope they release their map under the GPL
sir bard
Two words:
Holy Gattaca!
I just can't believe how amazed people here are that someone would charge $621K or whatever to have their genome mapped. This is something that had not even been done for any human barely 2 years ago, and then only at the HUGE expense to governments all over the world, and now you can get it done for less than a million dollars ? Do these people realize how immense is the enterprise they can buy now, for less than a lot of houses that dot-commers were buying in the Bay area that same 2 years ago ?
And many of these are the same people who probably ooh-and-ahh at anime cels costing tens of thousands of dollars, or who dream of plans spending tens of thousands of dollars wiring their house with the latest optical-this and wireless-that.
People have spent far more money in far sillier ways.
Craig's company Celera was mapping a suposedly anonymous genome, but then craig admitted it was his dna. As a Celera shareholder, I wonder if that qualifies as a $600k perk that he got.
HIV Crosses Species Barrier... into Muppets
in the the 21st century.
We'll experience a revolution in biotechnology and it's ability to give folks longer, healthier lives.
But many or the treatments will be very expensive.
At what point does being denied a cure for a disease due to poverty equal being denied the right to life?
Or do we just accept that the rich will live years, maybe decades, longer than the rest of US?
I think this would be one of the best investments a person could make. Too bad it will be all of rich people, which will skew the results of any statistics that could pop out of the research. All super rich people must have a gene or two that supplies an aggressive desire for money, and stupid gold digging mates.
Saskboy's blog is good. 9 out of 10 dentists agree.
I guess it could be fun to cheat death if you found out about something you had before it affected you.
The man who trades freedom for security does not deserve nor will he ever receive either. - Benjamin Franklin
Comment removed based on user account deletion
Bill Gates won't pay more then 640 K.
It ought to be enough for anybody.
This is the sale price.
If you had the pocket change, would you give this man your business?"
Of course not! The guy isn't dumb though. If you were willing to pay for your gene map, chances are all your 2000 clones (or however many he created) will be willing, and have the money to do the same!
Jobs? Which jobs?
Whoopie. This is the single worst fad since Pop Music. Why in the hell would you pay for something you already own, and have owned since the day you were concieved? They typical answer for the richie chicken folk would be "Because I can."
So, if I go out and patent my gene sequence, does that mean I can sue my offspring for being a derivitive of me? Is that what these rich fools are after? Sick. Sick, sick, sick. Amazing what having a ton of money will do to your brain.
Meanwhile, us regular folk will continue to make more educated and well thought out decisions (or at least as many as we can without being clouded by one thing or another. After all, we're not perfect...)
Blog Prophyts - Right On, Man
Why would I pay for something I already own?
Sure, it would be nice to know in advance if I am susceptible to getting diabietes like my grandmother, or heart disease like most of my mother's side of the family. However, if I do all I can to be healthy (i.e., not eating junkfood while laying on my couch all day), there is a significantly less chance of my being afflicted by these ailments. Some things could not be prevented, but I already know I have them (depression, bad eyesight).
If people spend their "pocket change" on this, they may be in for a suprise. They may find that they have the genes for an increased risk of myocardial infarctions (heart attack), but because they have neglected thier health, they may find it hard to change thier lifestyle to a more healthy one. Although many health-related problems cannot be avoided (for instance, Huntington's Disease, which usually doesn't show up untill your 30's), many diseases that you may be high-risk for can be prevented with a proper lifestyle.
--- At my sig, unleash hell.
...and your employer (or insurance company, bank, credit bureau, department of motor vehicles, Department of Homeland Defense, etc.) will do it for you FOR FREE!
With or without your permission.
Perhaps by then someone will offer a service where you can pay your $600K to PREVENT everyone from getting your gene sequence...
Oops, misread the headline....
"I think all foreigners should stop interfering in the internal affairs of Iraq"
-- Paul Wolfowitz, 7/21/2003
I will sell my DNA for 6 bucks
if i had the pocket change, would i? .. well .. if ;) .. i am what i am
i were the type that could afford to toss away a
half a million+ to find out something that i couldn't
do anything about, sure - given that i'm not that
well off, i'm guessing no
Next Distributed.Net project: Decode CowboyNeals Genes!
How big would the resulting data be? In the meg's, gig's? Would it compress well?
It would be cool to be able to carry around your own genome on a little CDROM in your wallet or purse.
Geoffeg
Imagine how many starving children could be fed if those millionaires donated the $621,500 to charity instead of getting their genes mapped and finding out what illness might kill them.
Oh well, like it would ever happen.
GoatPigSheep, the 3 most important food groups
This kind of reminds me of an old question I used to go around asking people: Would you rather know the date of your death, or the method of your death? ;)
Inevitably, most people would stumble around a bit, and then finally settle on "neither", because nobody wants to live knowing that they'd only have 10 or so years left or this world, nor knowing that each time they stepped on an airplane could be their last. So, with that being said, I think I'll save myself the 600K and enjoy the suspense.
"Quoting famous computer scientists out of context is the root of all evil (or at least most of it) in programming." - K
Jeez, whos gonna know, if some guy gave me half a million dollars to do it i'd sit there for a day and type random combinations of a, c, g and t, heres your genome... acgtgtacgtcagtacgtcgtgcatcgatcgatctacgatcgatcgat cgatcgatcgatcgatcgatcgactgactagctagctacgatgtatgcgc gatttcggatatttcgagctacgctadgatcgatcgatcgatcgatcgat cgatcgatcdgatcgatagctagctagctagctagctgatcgatcgatca tcgatgcgtagttagtcgtcgtacgtagctatcgatcgatctagctagct agctag X 10^?
"Sic Semper Tyrannosaurus Rex."
Eventually as the process becomes less expensive and less time consuming we should see this slowly seep into the public sector.. once that happens the scare of it should wear off as the uses of it take shape.
Personally, I think we're going to be seeing a LOT of gene therapy in our lifetime..
I just know I'm gonna be the last person on earth to die!
"Yup, we discovered how to let you live youthfully and healthily forever! All I need to do is give you this injection"
"Forget it doctor... he's gone."
waiting for my post to be modded through the floor...
"Good night, good work, sleep well, I'll most likely kill you in the morning." - Dread Pirate Roberts
...gattaca...gattaca...gattaca...
Besides that, how would they give you your genome? on a CD-ROM? no...too big...I don't even think a DVD would hold it...though I can't be sure.
What do they do, give you a hard disk? Give you a computer with the information embedded inside?
I think the distribution form factor would be an interesting problem here since it's so much data.
For $621,000 It had better be nice, though...
Maybe a numa with one of those $8000 IBM displays that's like 4000x2000 pixels or something like that...
Brian
Venter was merely a runner-up.
You pay for a printed copy of your credit history, don't you? You pay for a title search; school transcript...etc.
Don't be [simplistic] lame [/simplistic]...you are not paying to receive something you already own. You are simply paying for the transcript of the analysis of the raw data.
What is going on here is paying to have all this data dycrypted in advance. It won't be long before some business markets forecasting on the bulk data.
Comment removed based on user account deletion
towards finding a 'rich gene' to breed a race of monetarily inclined, super greedy, psychotic super-businessmen.
Oh yeah, sign me up!
if I can get my genome mapped, can I somehow alter my genes and get an extremely large rectum and anus, like this. This is what we all want to know.
We're only talking about 6 billion bits or so. You'd need about 2 CD's, if you didn't compress it at all.
-Mark
I expect to be shot down for this, but must be said: some day, people will look back on this generation with the same horror with which we look back on institutionalized slavery, and for the same reason - one humanity of one group is being denied for the benefit and convenience of another. Your comment is a reflection of that attitude.
"Lord, grant that I may always be right, for Thou knowest that I am hard to turn" -- A Scots-Irish prayer
Rumour/IMDB-Trivia has it that Leelee Sobieski collects locks of hair from major stars appearing with her in films.
:)
So if anybody wanted to buy themselves a prime bevy of Hollywood DNA to make gene maps from (for whatever nefarious cloney-type purposes) she'd be the person to see.
PS. A clone army of Leelees would be nice too
Perhaps a worthwile use for this technology would be to archive the genetic sequence of endangered species on a robust medium for future generations to reconstitute.
It would be funny to deliver Bill Gates his "Gene Map" with a restrictive End User License Agreement.
http://www.kubuntu.org/
Is it just me or has anyone else noted the striking resemblance The Filthy Critic has to Lee Harvey Oswald? I'm canajen eh! so I haven't got the gift for nefarious conspiracies that you yanks have but I just thought it should be pointed out and I've been away and wanted to see if it's as much fun to blow off karma with the points gone... ... no... it's not... Oh well where'd I put that bong.
"Academicians are more likely to share each other's toothbrush than each other's nomenclature."
Cohen
You can check out your ancestry as coded in your DNA, specifically what percentage Caucasian, African, etc. you are.
Craig Venter was NOT part of the Human Genome Project. Venter led, through Celera Genomics, the private effort to sequence the human genome. The Human Genome Project was the public group working on the sequencing the human genome.
The only thing Craig did for the Human Genome Project was give us someone to race against.
-krish
I don't get it, didn;t it take years to map the genome? thats right map it.. not make sense of it?
Now they can do it in a week or two?
are they using some sort of new horribly fast maineframe?
Anyone here have details on this? and how it's done?
Vague? Well, as an unconvinced person, perhaps you can understand telemarketers. You know... call you up while you're eating dinner, trying to sell you their cheap do-hickeys. You tell them to take your name off their list, but by the time they do that, they've already sold your name to a new company. Or your phone company selling your call lists to their "business partners." Which they do now. There's a lot more information in that list than meets the eye. Times you're most likely to be home (and not home.) Who you call and when. Collate that information with other call logs and you've got graphs of who your friends and aquaintances are, and who they're friends with.. etc.
No, I'm not wearing my tinfoil hat right now. But all that information adds up, and keeps adding up, and eventually you can get some detailed life information. "So what, only criminals would fear that." Well, you don't have to fear it to be creeped out by it. And aggravated when you get those damn calls no matter how many times you tell them "Take me off your damn list."
Josh
... he got paid to sequence his own. Go figure.
sic transit gloria mundi
... where the Bill Gates' money gene is. Unfortunately, the subsequence that accounts for it probably expresses the lack of business ethics characteristic, as well.
That is all.
Comment removed based on user account deletion
hmm... thanks for the personal attack. I don't mind my ideas being criticized, but they don't make me lame... anyways...
The difference between this and, say, a credit report is that the credit report is not part of you. It may describe your lack of paying bills, but it only describes a quality of you.
On the other hand, your genome is you. It is what you are - who you are. Credit reports created, modified, and under certain circumstances, destroyed. The information in them changes, so it is necessary to check on it from time to time - the same way you buy current newspapers as opposed to the same issue every day. Your genes are, for the most part, static. They are with you from the time your dad's sperm met with your mom's egg. Credit reports and school transcripts are explicit properites of you, but your genome is implicit.
I'm not arguing with you about the service aspect of this; after all, it is just as much of a service as getting a copy of your credit report. It is just the content that I see differently
--- At my sig, unleash hell.
I knew the guy when he was a civil servant... He was never satisfied with the money, prestige, or clout he had at the NLM (National Library of Medicine)... He has taken much of the data he used tax dollars to produce, and somehow found a way to profit from it massively... Good for him, and bad on us for tolerating this huge abuse of something which should be patently impossible to patent or own.... especially something as private, and unique as genetic material.... DNA=Intellectual property=NOT!
I was at a lecture given by Leslie Orgel (a very famous biochemist known for work on the molecular origin of life) and he made a very nice point when asked about the genome project. He likened the sequencing of it to deciphering the white pages of a phone book for a large city. If we ever work out the proteome (the collection of proteins that the genome codes for, along with post-translational modifications, binding partners, etc...which is much beyond what is specified in the genome), then we will have the equivalent of the yellow pages. Yet, even with both of these references, you could only begin to try and understand how the city (and by comparison, the cell) functions.
So while having your personal genome might be cool in the uber-rich kind of way, the usefulness is still quite limited.
-Ted
-=-=- Quantum physics - the dreams stuff are made of.
Since when does a map of your genes not qualify as a description of you? They don't take your DNA away from you and sell it back....they take a sample and analyze it and give you a 'map' that is in human readable (sic) form.
How can you insist that they ever possess anything of yours other than a representive sample? A sample that is used to provide a detailed matrix that describes your physical makeup.
BTW, I don't recommend participation in online public forums if you fear a 'personal attack'. It is hard to know when to duck.
Isn't the absolute worst case scenario of your argument that a telemarketer might call one day who had so much knowledge about you(DNA, psychological profile, buying habits, etc.) that they might actually offer something to you that you would actually WANT/NEED and wouldn't be able to resist buying(because it was generally useful or whatever) Bwahaha, the evils of targeted marketing! "What how did you know I was looking for a diamond heart pendant with platinum engraving for my wife's birthday...oh well, $19.95 sure I guess I'll take it. You're going to send me a free information booklet on a new FDA approved nutritional protocol that works against prostate cancer *blush* uh..uh o.k. I'll read it over and then get back to you..."
For great justice take off every sig.
so will it still take 9 months to compile?
13 year old white supremacists are shitty web designers.
I dont think that most /.ers think it is too expensive. They think it's ludicrous for any single person to spend that much money on nothing. I could get more useful info off of the Linux Kernal Map over at thinkgeek for $30, than a map of my DNA.
Actually, the constant media harassment was irritating them, so the two parallel (public/private) projects declared the gene to be sequenced BEFORE either project was complete.
The enormous media frenzy that happened as a result took up some extra time, but enabled them to get back to the science in peace - with extra funding in several cases.
There may be a gene for believing that 'lifestyle' is important, but I think it's too subjective to be touted as a means to an end.
'proper lifestyle' is a myth. State of mind and environment wield much more influence than something as basic as diet. Try factoring in no diet and see what happens...try feeding the same family the same foods, good or bad, for three generations and see what effect that has in the end....I say not nearly as much as some people today claim.
We're talking about physical predispositions that tend to disregard lifestyle. Some cultures tolerate what would be considered toxins to others. One man's junkfood is another man's pet.
People that spend on this now are investing in knowledge....knowledge they can use now, and in the future (this includes ways we can't imagine today).
I'm sorry, but I fail to see the insight in trivializing this kind of opportunity.
It's a penis stretcher. Wanna try it?
It was inevitable... Microsoft makes people pay for their beta's, and now Celera is making people pay to provide them with more information about the human genome, which would have otherwise cost them $600k a pop to sequence out themselves.
I think this is a good thing, since they will drive down the price, and they will get a broader information base than just Ventner's own genes: what's been sequenced is *a* human genome, not *the* human genome.
On the privacy side of things, I'd just as soon keep the contents of my chromosomes to myself (particularly 6, 11, 12, 17, 21, and 23), thanks, but that said, I'd like to read it myself and compare it to statistical data, without anyone looking over my shoulder, or writing my name down in a database next to the information.
-- Terry
I'd tend to think of DNA mapping more parallels data recovery services. Sure you physically /own/ that hard drive that won't spin, but you won't be able to get any useful information from it until you have a professional read it for you.
/own/ that strand of genetic matereal inside your body, but what does it mean to you without being mapped?
Sure you might
DNAPrint Genomics (DNAP) on Friday announced a service where they will tell you your racial makeup. Such and such percentage of Islander, Caucasian, African, et cetera. This stuff may seem frivolous, but there are people who care immensely about that kind of thing-- one very large group is Mormons. I recall reading about their geneology database; supposedly it used rather innovative technology (this was a few years back.) The serious uses will come when such things as drug side effects become predictable by DNA samples. There are certain drugs, like statins, that have a high rate of side effects or inefficacy, and the reasons for these are apparently genetic-- some people are just not responsive to them, or it causes damage to some obscure vulnerability that others may not have. Apparently DNAP is working on tests for statin drugs that will predict drug response and side effects. Becomes especially important when you're a cancer patient with only enough time to try one treatment when, say, five are available. You want to know which of those five is going to offer the highest chances of success based on your genetics and the exact genetic pattern of the cancer... This field is predictive genomics and it's going to be huge.
Intolerance for ambiguity is the mark of the authoritarian personality.
All your bases are belong to us!
-- Gov't
.
Sorry to have to post anonymously, but this is gonna be a little controversial and I don't want y'all to hate me ;)
I'm not exactly sure what's wrong with DNA-based cost scaling.
I mean, look, if you're a certain age, you pay more for car insurance.
Your prior existing medical conditions and lifestyle already also determine how much you pay for health insurance.
Why is it wrong to include genetic information in this evaluation? If you are genetically inclined to get a certain type of cancer, why shouldn't you pay more for cancer-related health services? If you're genetically prone to alcoholism, shouldn't your car insurance reflect that?
These seem like they could be perfectly legitimate factors, just like other less-biomedical factors already in use in the insurance industry. The risks of insurance are regularly judged by your demographics and the statistical risk/probability of the insurance company paying you.
So what's the objection? Is there something magical about DNA that it shouldn't be included in your health profile?
Meanwhile, there are a billion people with perfectly good genetics trying to stay alive on $6.21 a month. Do you know how much good you could do with a half million dollars in a third world country?
I see alot of comments joking about already owning their gene map and about releasing their map under the GPL.
No, you don't and no, you can't.
Most of the genes in your body are already patented, trademarked, and/or copyrighted. Those that aren't will be within the next few years.
We don't own our own bodies.
I hope that literally scares the shit out of you. It did to me: I locked myself in my bathroom until I could cope with the insanity of some corporation owning the natural devices that construct humans.
Wired had a very informative article on this some time back. Also, you can Google for the info and you'll find it.
What really scares me is that I've got at least 80 years left to live. I'm going to be fighting and putting up with a lot of shit before I can finally rest.
It'd be nice if some of you would give me a hand.
obviously no deficiencies vs. no obvious deficiencies
"There! Now no one can say I don't own John Larroquette's spine!"
"Oppression and harassment is a small price to pay to live in the land of the free." -- Montgomery Burns.
1. Make rich people pay for their own gene map
2. Find statistic corrolations from those maps to diseases, disabilities or lifespan
3. Profit
Uhh wait.... shouldn't there be a ??? in there somewhere?
Kjella
Live today, because you never know what tomorrow brings
See subject.
This company makes a super secret experiment for some ultra secret organisation and it somehow goes wrong, projects gets confused and as a result, millions of baby BillG's born!
Well OSS World can produce RMS'es in that case eh?
Let's see ... I could take the already available human genome sequence, take out a few Adenines and Thymines here, add a few Guanines and Cytosines there, and sell it to you as "yours". And I can do that in a couple of minutes. And Mr/Ms Millionaire, you wouldn't know the difference.
I can see the DNA records of famous celebrities being sold off-shore to black market cloning labs, and producing celebrity look-a-like "sex-toys" to rich clients (delivery time= 15+years without some sort of "force growth" technology).
If you could afford it, who wouldn't want to have their own little Brittney (or other flavor of the moment sex object), raised to completely adore you?
Ed Wedig
Graphic design services
docbrown.net
He secretly sequenced his own dna during the human genome project. That is the scientific equivalent of Neil Armstrong stepping onto the moon and saying "HI MOM!"
"We know very little about the link between differences in genes and ill health."
What better way to find out the link between ill health and differences in genes than through people *paying* you to map their genes?
Sure, it could be considered a whole bunch of case studies, but it's better than what we have right now. The opportunity is a great one. The funding for running the process up to mapping the gene is paid for by the customer, who (in my perfect world) signs an agreement to allow testing to be done with a copy of that map, and a history of the illnesses present in the customer's life. They could even offer a discount if the customer allowed the Dr.s to follow up on future illnesses.
Of course, that would mean the rich would have to be scientifically minded, whereas they're more like "blah blah blah... I love me... blah blah blah"
Anonymous Coward
Because gene analysis is mainly an information enterprise, it will follow Moore's Law and drop a zero in price every five years or so. The first reason is that gene analysis is computer intensive. Celera and the Human Genome Project own some of the largest computer complexes in he world for reassembling shotgun gene pieces. Thus gene analysis will piggy back computer advances.
Second, gene analysis is getting smarter. Coding genes only occupy 2% of the genome. Of this, only 0.1% differs between individual beings. this cuts the analysis problem from 3.2 billion bases to about 100,000 bases. Mapping which 100,000 bases are important is the next stage of technology.
In summary, instead of a month and $600K, in 20 years your should do this in an hour for $50.
Oh come on, this is so obviously just a way for some big corporation to clone celebrities and sell them back to rich geeks :)
Burn the land and boil the sea, you can't take the sky from me
I don't know Gattaca, outside of having the vague notion that it was dystopian. But you might look into an old Heinlein novel called "Beyond This Horizon". He envisions a society that uses this kind of technique, but which is also quite libertarian. (Mind you, he was quite down on genetic modification rather than selection...)
The technology does not determine the kind of society. It determines the range of kinds of societies. We already have all the technical capability needed to create a truly dystopian society, and we have had it for decades. (We seem to be edging that way, but certainly not at a rate limited by technical capabilities.)
I think we've pushed this "anyone can grow up to be president" thing too far.
I don't believe Venter's idea is to sequence someone's entire genome. I think Venter plans to sequences the sections of people's genomes that contain known genes.
You see, even though there are 4 billion base pairs, There are still only about 30,000 genes. Even at 1000bp per gene (which is a good average if you want to include exons and introns), that's still only about 30 million base pairs.
All they have to do is have the right set of primers on hand (which they already do because they sequenced the whole thing already). So Celera is in a unique position to do this without too much of a startup or operating cost.
Don't worry, though. This kind of thing will remain cost-prohibitive for almost everyone else for centuries.
Those who can, do. Those who can't, simulate.
Most of these are $1k/year items, some of them are $10k/year, some of them cost no money and just take time.
Some parents do these things. And some parents park their children in front of the television, feed them Domino's Pizza and Coke, and never look at their child's homework. This difference in nurturing already exists! In my opinion, this has much more impact on a child's life than Gattaca-style "make them a few percent stronger".
Now.. imagine that every company did that. You would be overloaded with advertising targeted to you, and in addition, maybe I don't WANT SuperPharm knowing that I have some rare neurodegenerative disease or something. The point is the choice is removed from the person to decide who gets what information, information that is personal to them.
So what if it does? There used to be this standard response to situations which was "The good book says..." and then the story that was told in the Bible that supposedly told how to live in the present day. So we are supposed to believe Danny DiVito more than Moses these days?
Seastead this.
Then just cancel your landline, and go with a cell phone for all you communique... Many places now have laws about telemarketing to those.
I'd vote for date. What if "method" was something like "heart attack" or "terrorist?"