Shut the fuck up you fucking asshole. Noone cares about you. Remember that episode where you and Picard were stuck on the holodeck? I don't. Because it SUCKED.
The only thing you fucktards talk about is holes. Did you know that other than all you faggots the hole's only known enemy is the pile???? You're all a bunch of pole smoking anal fisters.
Thanks for all your support and I know you all love smoking cock but I am shutting this site down as of 6am eastern standard time. The SCO lawsuit is just too much to deal with. Oh, and since all the spelling and grammar are correct so far (BTW note previous sentence ends with preposition), I offer this as proof of identity - "i cant spel or punktuate'~! Hapy cock sucking and see you on the flipside.
InSovietRussia... Oh fuck you, Yakov Smirnov ... Hell, you?d need it to steady your nerves when you?ve a nine-foot skateboarding
gorilla standing over your shoulder, breathing its foul, stale, hot breath... bastardsons.the0rem.net/articles/dating.shtml - 49k - Cached - Similar pages
/dev/null: InSovietRussia, The Coils Build You! ... Rebutt Out (A Pun! HeHe!) | Main | Llama Whipping Goodness August 09,
2002 InSovietRussia, The Coils Build You! Aw, screw the rebuttal.... www.kevinsblog.com/nullified/archives/001743.htm l - 6k - Dec. 9, 2002 - Cached - Similar pages
Like most successful trollers, I have found that choosing the best target is the first step towards creating a good trollerism. This may include singling out an OSS freak, someone who plays Everquest any other eccentric. Pretty much anyone with 'geek' tendencies will suffice.
Section Two: Analysing Your Target
If you plan to troller your target, you need to define his or her weaknesses. The first step of this process was already taken care of when you chose your target based on being a 'geek'. You must now investigate the target of your trollerism in more depth. If your target has a username on a forum, there's a good chance a bio or homepage link is available to the troller (you) to read and be more comfortable. In a way, this is like "getting to know your enemy", except this schmuck is just a target of a trollerism, not your enemy LOLZ. Previous posts of the trollerism target are also a good reference; they provide valuable insight into the trollerism target. If there is no extra research to be done on a target, and unless the trollerism target is of exceptional magnitude characteristically in posts, it would be wise to resign efforts against the trollerism target.
Section Three: Troller The Fool
So you've got a lot of information on your target. It's time to proceed with the festivities. Compose your reply to the target in a manner which appears benign; your target begins reading your reply post. He or she doesn't realise you're going to be trollering them in a paragraph or so, because your reply is composed largely of relevant and pertinent information. When drawing near to the conclusion of the paragraph, try to work an insult to something which the trollering target finds dear. For example, if part of the post is about "Star Trek", call it Star Wars mid-way through and mention some studies you've heard before about science fiction fans. You'll be well into the task of really trollering this sucker by now. Continue to troller him or her by subtly attacking other favourite topics of the trolleree throught the reply.
Section Four: Wait for it.......
Ah, the big payoff of your trollering efforts. This sucker replies with a point-by-point rebuttal which at least doubles the length of your reply. If you obtain similar or smaller reply-to-rebuttal ratios, you're doing very well!
Section Five: The Classic Troller Final
So your trollerism target has replied, you've won the game. Submit yet another reply with "YHBT HAND" or an encoded variant; e.g. "Young Hens Bleed Thoroughly, Hold A Necklace Dear". This adds extra wit to your troller, because the trollerism target will be very upset after deciphering the riddle! Good luck trollering!
Reply Trollers and Their Art
Section One: Choosing Your Target
Like most successful trollers, I have found that choosing the best target is the first step towards creating a good trollerism. This may include singling out an OSS freak, someone who plays Everquest any other eccentric. Pretty much anyone with 'geek' tendencies will suffice.
Section Two: Analysing Your Target
If you plan to troller your target, you need to define his or her weaknesses. The first step of this process was already taken care of when you chose your target based on being a 'geek'. You must now investigate the target of your trollerism in more depth. If your target has a username on a forum, there's a good chance a bio or homepage link is available to the troller (you) to read and be more comfortable. In a way, this is like "getting to know your enemy", except this schmuck is just a target of a trollerism, not your enemy LOLZ. Previous posts of the trollerism target are also a good reference; they provide valuable insight into the trollerism target. If there is no extra research to be done on a target, and unless the trollerism target is of exceptional magnitude characteristically in posts, it would be wise to resign efforts against the trollerism target.
Section Three: Troller The Fool
So you've got a lot of information on your target. It's time to proceed with the festivities. Compose your reply to the target in a manner which appears benign; your target begins reading your reply post. He or she doesn't realise you're going to be trollering them in a paragraph or so, because your reply is composed largely of relevant and pertinent information. When drawing near to the conclusion of the paragraph, try to work an insult to something which the trollering target finds dear. For example, if part of the post is about "Star Trek", call it Star Wars mid-way through and mention some studies you've heard before about science fiction fans. You'll be well into the task of really trollering this sucker by now. Continue to troller him or her by subtly attacking other favourite topics of the trolleree throught the reply.
Section Four: Wait for it.......
Ah, the big payoff of your trollering efforts. This sucker replies with a point-by-point rebuttal which at least doubles the length of your reply. If you obtain similar or smaller reply-to-rebuttal ratios, you're doing very well!
Section Five: The Classic Troller Final
So your trollerism target has replied, you've won the game. Submit yet another reply with "YHBT HAND" or an encoded variant; e.g. "Young Hens Bleed Thoroughly, Hold A Necklace Dear". This adds extra wit to your troller, because the trollerism target will be very upset after deciphering the riddle! Good luck trollering!
Slashdot Mirror
n/t
fp? nope.
Shut the fuck up you fucking asshole. Noone cares about you. Remember that episode where you and Picard were stuck on the holodeck? I don't. Because it SUCKED.
Only fags post on slashdot.
...was the Timothy's cum on Michael's back. Oh wait, I guess that would be 'glistened.'
The only thing you fucktards talk about is holes. Did you know that other than all you faggots the hole's only known enemy is the pile???? You're all a bunch of pole smoking anal fisters.
...the mess i made in my pants this morning.
Thanks for all your support and I know you all love smoking cock but I am shutting this site down as of 6am eastern standard time. The SCO lawsuit is just too much to deal with. Oh, and since all the spelling and grammar are correct so far (BTW note previous sentence ends with preposition), I offer this as proof of identity - "i cant spel or punktuate'~! Hapy cock sucking and see you on the flipside.
Cmdr Tafco
Will it run chong vorbis files?
Cock sucks Java.
or any of its forms should be EXECUTED (buckwheat style.) Starting with myself for merely typing the word.
Cock sucks YOU!
Slashdot sucks as much cock as Michael.
Tentacle Rape 3: The Grade School
>gi|18611945|gb|BM491014.1|BM491014 pgp2n.pk005.c18 Normalized Troll Causing Pituitary/Hypothalamus/Pineal Library of Trolls (pgp2n) Trollus Trollus cDNA clone pgp2n.pk005.c18 5' similar to ref|NP_006570.1 (NM_006579) flamebait-binding protein (sterol isomerase); 3-beta-hydroxysteroid-troll a-8,delta-7-isomerase; Chondrodysplasia goatse.cx-2, X-linked dominant (Troll syndrome) [You are a Homo] ref|XP_010190.2| (XM_010190) similar to emop..., mRNA sequenceg agagggagagcggcgctgttgccatggagat ggccgcgttctttgtcgctgccgggttacgtcagcagtgcgcgacccggc tgc ctgggctgggcgctgagcggggctg gcggtcagttggttcctggtgtgcgccggggtgcacggggtgctcgg gggtacttcagcctgcggcaccgggagctgcccgccgacacggggctgct ggccgacgtctggaaggac gagcgatgacttcacggtggccatggagacggtgacggcgg gggccccctcagcttcctcaccttcctcgccttcctgtgccgtcatcccg cccgctttgtgcg acatcctctacttcgccacggaggcgcg
cgagcggtgcggtgagcgacNNNaagactcgcctgcgca
cgccggcgcacccctat
gcagtgcgcaggcgcagtggcggcggcgggggcggggcttctggc
gagcggagcgccgcccggcgcct
a
atacgccaaagccgacagccgctacatga
tgggctt
tgcagctcatcgtctccctcggacagctctatggg
A new troll order is coming...
To wit, I submit this business plan:
1. Troll
2. ???
3. Troll!!!
Crack smokes moderators!
50% of packets NOT being lost at 66.35.212.174!
The Fix - In Soviet Russia, the channel changes YOU!
... Bargain! Creative Writing A Thousand Pardons Damned if you do... Yankee ... road. ...
What's inside? Who do you think's in the burger? Pop
www.the-fix.org/oldlist.php - 99k - Cached - Similar pages
In Soviet Russia... Oh fuck you, Yakov Smirnov
... Hell, you?d need it to steady your nerves when you?ve a nine-foot skateboarding ...
gorilla standing over your shoulder, breathing its foul, stale, hot breath
bastardsons.the0rem.net/articles/dating.shtml - 49k - Cached - Similar pages
2002 In Soviet Russia, The Coils Build You! Aw, screw the rebuttal.
www.kevinsblog.com/nullified/archives/001743.ht
kuro5hin.org || Comments || In Soviet Russia, Kuro5hin reads YOU
... In Soviet Russia, Kuro5hin reads YOU | 12 comments (12 topical, editorial, ... 1 - 21k - Cached - Similar pages
0 pending). Suicide (en tea) (3.50 / 2) (#1) by leviramsey
www.kuro5hin.org/comments/2002/8/5/152124/5411/
Soviet Union Nerd: In Soviet Russia, Internet Surfs You! ...
10 September 2002 Ever since assassination of Gorbachev in 1984,
life in Russia has been great. Except for the fact that we all
www.nerdusa.com/index_ussr.shtml - 3k - Cached - Similar pages
In order to show you the most relevant results, we have omitted some entries very similar to the 7 already displayed.
If you like, you can repeat the search with the omitted results included.
Stephan Kingsky found ALIVE in dascha this morning.
Reply Trollers and Their Art
Section One: Choosing Your Target
Like most successful trollers, I have found that choosing the best target is the first step towards creating a good trollerism. This may include singling out an OSS freak, someone who plays Everquest any other eccentric. Pretty much anyone with 'geek' tendencies will suffice.
Section Two: Analysing Your Target
If you plan to troller your target, you need to define his or her weaknesses. The first step of this process was already taken care of when you chose your target based on being a 'geek'. You must now investigate the target of your trollerism in more depth. If your target has a username on a forum, there's a good chance a bio or homepage link is available to the troller (you) to read and be more comfortable. In a way, this is like "getting to know your enemy", except this schmuck is just a target of a trollerism, not your enemy LOLZ. Previous posts of the trollerism target are also a good reference; they provide valuable insight into the trollerism target. If there is no extra research to be done on a target, and unless the trollerism target is of exceptional magnitude characteristically in posts, it would be wise to resign efforts against the trollerism target.
Section Three: Troller The Fool
So you've got a lot of information on your target. It's time to proceed with the festivities. Compose your reply to the target in a manner which appears benign; your target begins reading your reply post. He or she doesn't realise you're going to be trollering them in a paragraph or so, because your reply is composed largely of relevant and pertinent information. When drawing near to the conclusion of the paragraph, try to work an insult to something which the trollering target finds dear. For example, if part of the post is about "Star Trek", call it Star Wars mid-way through and mention some studies you've heard before about science fiction fans. You'll be well into the task of really trollering this sucker by now. Continue to troller him or her by subtly attacking other favourite topics of the trolleree throught the reply.
Section Four: Wait for it.......
Ah, the big payoff of your trollering efforts. This sucker replies with a point-by-point rebuttal which at least doubles the length of your reply. If you obtain similar or smaller reply-to-rebuttal ratios, you're doing very well!
Section Five: The Classic Troller Final
So your trollerism target has replied, you've won the game. Submit yet another reply with "YHBT HAND" or an encoded variant; e.g. "Young Hens Bleed Thoroughly, Hold A Necklace Dear". This adds extra wit to your troller, because the trollerism target will be very upset after deciphering the riddle! Good luck trollering!
Reply Trollers and Their Art Section One: Choosing Your Target Like most successful trollers, I have found that choosing the best target is the first step towards creating a good trollerism. This may include singling out an OSS freak, someone who plays Everquest any other eccentric. Pretty much anyone with 'geek' tendencies will suffice. Section Two: Analysing Your Target If you plan to troller your target, you need to define his or her weaknesses. The first step of this process was already taken care of when you chose your target based on being a 'geek'. You must now investigate the target of your trollerism in more depth. If your target has a username on a forum, there's a good chance a bio or homepage link is available to the troller (you) to read and be more comfortable. In a way, this is like "getting to know your enemy", except this schmuck is just a target of a trollerism, not your enemy LOLZ. Previous posts of the trollerism target are also a good reference; they provide valuable insight into the trollerism target. If there is no extra research to be done on a target, and unless the trollerism target is of exceptional magnitude characteristically in posts, it would be wise to resign efforts against the trollerism target. Section Three: Troller The Fool So you've got a lot of information on your target. It's time to proceed with the festivities. Compose your reply to the target in a manner which appears benign; your target begins reading your reply post. He or she doesn't realise you're going to be trollering them in a paragraph or so, because your reply is composed largely of relevant and pertinent information. When drawing near to the conclusion of the paragraph, try to work an insult to something which the trollering target finds dear. For example, if part of the post is about "Star Trek", call it Star Wars mid-way through and mention some studies you've heard before about science fiction fans. You'll be well into the task of really trollering this sucker by now. Continue to troller him or her by subtly attacking other favourite topics of the trolleree throught the reply. Section Four: Wait for it....... Ah, the big payoff of your trollering efforts. This sucker replies with a point-by-point rebuttal which at least doubles the length of your reply. If you obtain similar or smaller reply-to-rebuttal ratios, you're doing very well! Section Five: The Classic Troller Final So your trollerism target has replied, you've won the game. Submit yet another reply with "YHBT HAND" or an encoded variant; e.g. "Young Hens Bleed Thoroughly, Hold A Necklace Dear". This adds extra wit to your troller, because the trollerism target will be very upset after deciphering the riddle! Good luck trollering!
and his name is Adam Smith, D-Wash.
That post was not wide at all.
That is exactly the same percentage of Chinese citizens who are infected with AIDS.