Slashdot Mirror


User: norminator

norminator's activity in the archive.

Stories
0
Comments
823
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 823

  1. VoIP is an interesting example... on Senators, ISPs, and Network Neutrality · · Score: 1

    As a case in point I share a house with 5 others, people use VOIP, people browse pages and I personally play a lot of online games.

    You mention VoIP, but are you aware that Comcast has been known to reduce the bandwidth available for other VoIP providers that their subscribers use... in the areas where Comcast offers IP phone service? I use Comcast cable internet, and I use Vonage, and I'm fine because for now, Comcast doesn't offer phone service in my area. But as soon as they start offering it, I'm likely to be screwed because they will throttle my Vonage packets, and advertise their own phone service, which will magically be guaranteed 100% compatible with Comcast Internet, unlike those other VoIP companies.

    Anti-net neutrality might seem to make sense, until you consider the fact that it's a way for the ISPs to knock out proven, dependable content providers in order to provide their own services with no competition. They don't have to offer quality service, they just have to make it more accessible than the competition. Just wait until your ISP decides that enough money is up for grabs in online gaming. They'll strike some deals with one service or another (Microsoft, Sony, Blizzard, or whoever), and when you use their services, you get great latencies. Any others, though, and you're screwed.

    Now that we've recovered from the dotcom bust, companies have created serious business models around the Internet. But when Verizon, SBC, et al decide they can compete in new markets without having to work as hard to develop good products because they can quickly and easily render their competition's products useless, it's not going to help the economy any. If you care about your ability to use any internet services, from whatever providers you want, then neutrality is important.

  2. Nintendo fan after all? on How Nintendo Could Win It All · · Score: 2, Insightful

    I dont know about some of you but I've beat almost every nintendo DS title in less than a week. It took me 2 days to beat the new Super Mario Bros, and i was playing at my spare time at work (spent 3rd day unlocking secret levels).

    For someone who complains about Nintendo a lot, you've sure spent plenty of time playing their games.

  3. DVD != HD on How Nintendo Could Win It All · · Score: 3, Insightful

    No DVD player supports HD. The HD support on the PS3 is for Blu-Ray, and Microsoft will have an HD-DVD addon for the XBox 360, but HD-DVD isn't really DVD anyhow. The Wii will support 480p, which is as much as you can say about any DVD player. Whether or not it supports HD has nothing to do with whether or not a DVD player is included.

    Some people are saying that unlike when the PlayStation2 came out, everyone has a DVD player now, so noone needs that functionality. Well my DVD player (first one I've owned, besides my DVD-ROM drive) is making all sorts of funny noises, and may be on its way out. So if I can get a sweet game console that includes a DVD player, but is only as big as 3 DVD cases stacked, then that sounds like a great deal. I'd guess I'm not the only one in need of a DVD player replacement.

  4. Re:By name alone I have a feeling blu-ray will die on Sony's Obsession with Proprietary Formats · · Score: 1

    When it comes time to buy a new DVD player which do you think she'll pick? HD-DVD or Blu-Ray?
    Of course she'll pick the HD-DVD because it sounds like it will work with her system.


    But for people looking for the biggest, newest thing, does the HD-DVD sound like just an extension of regular DVD? I know it's technically not just a modification or an extension of the existing DVD format, but will people think they're being tied to the past with it? Blu-Ray sounds futuristic, both in the spelling and the sound of the words. After all, every product is better with Blue LEDs, right?

    I don't know that people will worry about Blu-Ray not being compatible with their system, but I do think people will worry about it not being compatible with their existing content. But if Sony markets it correctly, and points out that you can still play all of your existing DVDs/CDs, then I think they might have an advantage in their name.

    For no really good reason I'd like to see Sony *lose* this format war. I don't know that things would be any better for consumers with HD-DVD (is managed copy really an advantage, since it is still DRM-encumbered?), but I don't really want to see Sony win anything right now.

  5. Predicted? on AppleBerry Predicted? · · Score: 1

    Appleberry Predicted?

    Since when to you question whether something was predicted? Either someone thought about it and told people, or he didn't.

    Baseless predictions do get old fast, though. I think the Tommy Boy take would go something like this:

    I could tade a dump in a box and stamp it Predicted, but then all you'd have is a predicted piece of crap

  6. does 1MB == 1,000,000 bytes for those ISPs? on Nintendo President Talks Wii/DS Hookup · · Score: 1

    The oligopoly situation in e.g. Australia and New Zealand, combined with the limited bandwidth on and off the continent, has allowed residential "broadband" providers to get away with billing per megabyte over the first 3000 in a month.

    Just a question, because I honestly don't know... in countries like those you mentioned, do the ISP's measure 1MB as 1,000,000 bytes?

  7. Re:Part of the sequence: on Human Genome Sequencing Completed · · Score: 1

    ACGATCGTACATsorryCGCGTAGTAGCTAAATCGCCAforTCGCTCGAT CGAGGTATGCtheTAGTAGCTAGTGTAAATCGCCATCinconvenience GCGCCTCTC

  8. Spaceballs: on UK Government Wants Private Encryption Keys · · Score: 4, Funny

    My encryption key is:

    1.....2.....3.....4.....5

  9. Is this before or after Apple switches to Windows? on John Dvorak's Eight Signs MS is Dead in the Water · · Score: 1

    Dvorak is the same guy who not very long ago said that Apple will ditch Mac OSX for Windows... But if Apple adopted Windows, wouldn't that make Windows almost the only desktop OS used by non-geeks? (I'm not saying anything bad about Linux/*BSD geeks, I'm just saying the general population doesn't use or understand the atlernative OSes.) It just seems to me that it's a contradiction to claim that almost all desktop machines will be running Windows, then say that MS is dead in the water...

    Bytheway, I don't, and wouldn't ever, believe that Apple would ever use Windows, I'm just stating what his claim was

  10. I prefer "Revolution" on Nintendo Revolution Renamed 'Wii' · · Score: 1

    I think "Revolution" would actually be a better name for the released product. Maybe Wii whould have been the pre-release code name. I think they got it all backwards.

    Now not only will Wii have worse pronunciation issues than Intel's Viiv has (according to the Nintendo site, it's pronounced "we"), but it will have negative connotations attached to the as yet unsuccesful Viiv. Who approved this name? Maybe the President of Nintendo was on a roller coaster when someone asked him what the name should be and he just happened to be saying "weeeeeeeeeeeeeee!"

  11. Saves money on legal expenses, too on Netflix Suing Blockbuster for Patent Infringement · · Score: 1

    1) Patent "the process of exchanging goods or services for finiancial reimbursement"

    2) Sue the entire world, muahahahaha

    3) Profit!


    Then you can sue your lawyers for trying to get reimbursement for their services, and you won't ever have to pay them! Sweet!

  12. Re:Conventions should move to private property on Good Riddance To Booth Babes · · Score: 1

    From my understanding, according to this article: http://news.com.com/Sexy+booth+babes+banned+at+gam e+show/2100-1043_3-6030517.html?tag=nefd.top it's not the convention center or the government that's doing the banning & fining, but the E3Expo organization. They have a right to do that, it's their show. They are trying to create an atmosphere that doesn't have that type of distraction. The organization already has plenty of rules that exhibitors have to abide by, it's their right as the organizers of the show to make the rules.

  13. Now my head hurts on Both Parties Ignore the Facts · · Score: 1

    I'd like to say I agree with all of that, but my brain doesn't know if it's already too biased to know if it's all true.

  14. Dial-up for security... don't count on it on Is Obsolescence Good Computer Security? · · Score: 2, Informative

    I've had my computer get infected while downloading security updates over dial-up after a fresh installation of XP. I should have downloaded all the updates, or SP2 at the very least, from work and brought them home to install them.

    One problem with dial-up is that you probably won't have a hardware firewall/router between your computer and the internet. Many folks with broadband access have some type of a router with a firewall/NAT built-in. Not everyone does, but some do, especially people with wireless setups, although that introduces its own security troubles.

    The point is, if you think about security (which means you have to be aware of all the types of security threats to begin with, not just focusing on one or two that your friend told you about), you'll be able to take proactive steps to make your computer(s) more or less secure. Otherwise, you're leaving yourself open to becoming a zombie just as much as the other millions of computer users out there.

  15. MythTV on The Engineer Behind Microsoft's TV Strategy · · Score: 1

    I've been interested in MythTV for a while now, and have been planning on setting it up on some cheap hardware (with a hardware encoding tuner card). I've heard that in some ways it handles HDTV better than Win MCE, which won't really affect me for a while still, because I don't as yet have any interest in HDTV, or an HD capable TV.

    But I've installed it on my laptop, which doesn't have a tuner, just for the sake of poking around the menus, checking out the program guide, it's really quite nice, I like it a lot. Hopefully I'll be able to get my hands on the hardware I need to build a real myth box soon.

  16. Re:the unspoken battle on The Engineer Behind Microsoft's TV Strategy · · Score: 1

    That's why an update to the mini is in order: 3.5" hard drives, faster processors, TV tuner with hardware encoding, and digital adio out. It's probably already going to get an Intel dual-core processor and Front Row. The rest could happen, too. It's a lot to cram into that small of a space, but I think they could do it.

  17. Re:buttons buttons BUTTONS. on The Engineer Behind Microsoft's TV Strategy · · Score: 2, Interesting

    The buttons could easily function like this:

    Menu Navigation: 1) Up, 2) Down, 3) Left, 4) Right, 5) Select, 6) ?

    Live TV: 1) Volume Up, 2) Volume Down, 3) Channel Down, 4) Channel Up, 5)?, 6) Menu

    Recorded Videos: 1) Skip Ahead, 2) Skip Back, 3) Rewind, 4) Fast Forward, 5) Play/Pause, 6) Menu

    It's the overloaded buttons you're talking about, but it can be done very intuitively. I don't know how they do it on the iMac, but I think it could work farily well for DVR purposes, too. The iPod uses its wheel for scrolling through menus, adjusting volume, seeking through songs, and even various functions in the simple games it has onboard. Overloading doesn't have to be bad. If it can be done in an obvious way, it's better than having a remote with 40 buttons, 30 of which have absolutely no function most of the time. I hate the MS Media Center remotes. There's not only a button for the main menu, but buttons for each of the main activities, which can all be easily accessed from the main menu. Five buttons where one would work fine.

  18. Mac Mini + Front Row on The Engineer Behind Microsoft's TV Strategy · · Score: 4, Insightful

    The mini doesn't come with Front Row, only iMac's do.

    Until next week that's true, but one of the main predictions for MacWorld is a Mac Mini with a TV Tuner and Front Row software.

    It's amazing to me how the iPod came into its market, took over and completely dominates. Electronics manufacturers are building entire product lines from low-end to very high-end accessories, specifically to capitalize on the iPod's success. Most major high-end distributed audio systems now support directly connecting to the iPod to allow it as a source for whole-house audio.

    The Mac Mini has been used as a cheap but solid music server by many custom electronics installers. Apple is not only winning with general consumers, but for very high-end applcations (read: rich people's houses and very nice commercial installations).

    It's funny to me that Microsoft has been pitching the Media Center for a few years now, and it's starting to come around for expensive custom installs now, too, but I think it's too much. Too much complexity trying to give people stuff they didn't know they want, and not allowing the real control people need.

    At work I see a lot of hype about Windows Media Center, and although the menu animations look smooth and almost fancy, and it would be nice to have full Tivo-like capabilities from my PC, I think it's too bulky, trying to be the great all-purpose PC, and give you Tivo functionality, too. I think Microsoft misunderstands a lot of the higher-end market they're trying to get into, because of their arrogance and assumptions that they can just enter any market they want. At the same time, Win MCE isn't really for alot of middle class people either, because those people mostly just want to check their e-mail and browse the internet.

    I won't be surprised at all to see Apple provide an inexpensive Mac Mini-based solution that consumers from low-middle class to the very rich will be excited to own and use. I think Microsoft, even though they've been in the game for a relatively long time already, should be getting ready to have their lunch handed to them. I've never owned a Mac or an iPod, but I think I might be holding my own 6-button remote soon.

  19. List of trusted computing devices on ISP Restrictions Based on Hardware/Software? · · Score: 1

    http://trustedcomputing.org/ , click on products.

    Just a note on the GP's post, According to the Trusted Computing Group's website, TC does not directly support and is not intended for the implementation of DRM, and is completely opt-in for the user. Of course, opt-in doesn't mean much if your ISP forces you to use it, and if they build a framework that lets other software implement DRM easily, then it might as well be DRM itself. Stallman calls it "Treacherous Computing." Bruce Schneier's point of view on TC was that it could be bad, but it's not inherently evil, and that the Trusted Computing Group's reccomendations for implementing TC looked alright, but when Microsoft released their own Best Practices documentation, it left them a lot more room for abuse. That's just my 2 cents from what I've read.

  20. There really is a market for this on CD Ripping Services Compared · · Score: 1

    There is no way you need your entire collection instantaneously. So all these "I have better things to do with my time" people just don't seem to be using their brains about how they're likely to use that MP3 player.

    There are people for whom this is useful, but it's not your average Slashdot reader. Wealthy people pay hundreds of thousands of dollars to have people set up their home theaters and whole-house audio systems. The professionals that set these up will often install mp3-based music servers such as the AudioReQuest http://www.request.com/ or the Escient Fireball http://www.escient.com/. These installers will usually pre-load the music servers for their clients. A CD ripping service would be very useful for them, but not for the average slashdotter.

  21. Re:You're kidding, right? on Apple Holding Back the Music Business? · · Score: 1

    The only difference between the iPod and the "other" players out there, is that the others got behind Microsoft with the WMA DRM "Plays for Sure". Microsoft came up with a very un-open format to compete in digital music, and since Microsoft doesn't make players themselves, the other player manufacturers rallied behind them. It's not that the others are more open, it's just that they've all embraced the same closed format. That format is sold at more online music stores, but who needs to buy music from more than one store? (at least, as far as the average consumer goes... They all charge $1 per song, and I doubt there's that much variation in the quality or the variety of music available between Napster, MSN, Rahpsody, and Apple.)

    And it's still not a lock in to their stores, because most people are going to put more music on the player from their pre-existing CD collections than from iTunes downloads, I would guess. How much does 30 GB of music at any online store cost, anyway (at $1.00 per song)?

  22. It was a PhD student, no less on Sony's SunnComm DRM Patch a Security Risk · · Score: 1

    Remember, this is the same company that tried suing someone for putting on their web site "Hold the shift key down while inserting a copy protected CD to prevent the DRM software from being installed."

    And don't forget, it wasn't just some random guy that got sued, it was a Princeton PhD student who was doing research based on this. They didn't start to backpedal until they realized how bad it looks to sue someone doing academic research, especially when the "shift key" conclusion is such an obvious hole in their product.

    What jerks. Of course they and Sony feel free to sue people who do things that hurt them, but carry on selling products that are secretly damaging their own users' computers, then releasing patches that damage them more. Here's a case where I'd love to see what goes around comes around, but I'm guessing they won't be hurt too badly by it... unfortunately.

  23. Actually, practical and interesting on PlayStation Touch Screen for Your Linux Box · · Score: 1

    Actually, a touchscreen is also very useful on a wall-mounted display, like one for a home or commercial building automation control system. And Linux could make a fine platform for that purpose.

  24. That's upgrade pricing, not new install pricing on Dell's Open Source Desktop Systems · · Score: 1

    I have heard OEM license numbers as low as $30 for XP Home. It retails for $99

    Isn't $99 the retail price for the upgrade version? I'm pretty sure the new install version of Win XP Home is $199, while the new install version of Win XP Pro is $299. The upgrade versions are $100 cheaper on each.

  25. Re:Supply and Demand on IPv6 Still Hotly Debated · · Score: 1

    In case of ISP is the only one giving you IP addresses that means it's monopoly and in monopolies supply and demand curves do not exist. And price is completely inelastic.

    Why does everyone like to use the word "monopoly" so much around here? What you say would be true if there was only one ISP, and in some places that may be the case. Many other places have multiple ISPs. In my area, I have my Comcast cable internet, but I could also choose from any one of many DSL providers, or one of several other broadband providers, or even more dial-up providers. So there is competition between ISPs.