Slashdot Mirror


User: SIInudeity

SIInudeity's activity in the archive.

Stories
0
Comments
55
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 55

  1. Hitachi? Whatever on Hitachi Developing Reactor That Burns Nuclear Waste · · Score: 1

    Hitachi had a contract for welding boilers on a South African coal plant. They couldnt even get that right. Delayed the project by 2 years and added a couple of hundred million dollars onto the cost.

  2. Sinudeity on Left 4 Dead 2 Banned In Australia · · Score: 2, Funny

    Man, you suck at rugby, and now you cant even play L4D2... My heart breaks for you guys.

  3. Re:Microtransaction = Cheating on Cryptic's Roper Explains Microtransactions For Champions Online · · Score: 1

    What about the guys, who play wow 24/7, while Im at work/having a social life etc. Isnt that considered cheating then?

  4. As a South African on South African Minister Locks Horns With Microsoft · · Score: 1

    FUCK YOU MICROSOFT!!!
    When Shuttleworth started Ubuntu, it was to not the South African people deal with your bullshit anymore. Take your shit, and get the fuck out of my country. You attention-starved, bi-polar, ex-convict!

  5. Re:fortunately on P2P Fans Pound Comcast In FCC Comments · · Score: 1

    Dang, didn't know Australia had the same problem as South Africa with regards to telecomm monopolies. Cheers.

  6. The 5th and 6th nucleotide! on Artificial Bases Added to DNA · · Score: 1

    X-files :)

  7. As a South African... on How SBC (AT&T) Pillaged South Africa's Economy · · Score: 1

    Its funny to read all these comments from Americans, who dont know shit about whats going on here, regarding Telecomms. Telkom is an evil bastard. The quicker they die, the better it will be for South Africa.

  8. Re:Nothing but ignorant drivel on Africa - Offline And Waiting for the Web · · Score: 1

    But I thought most of the kids moved to digg? Are they trying to win the numbers back?

  9. Nothing but ignorant drivel on Africa - Offline And Waiting for the Web · · Score: 1

    Reading comments from I'm assuming mostly Americans... You have no right on assuming what is best for Africa. Africa needs more internet connectivity. A global voice to tap into. A lot of comments about Nigerians and 419ers as well. You only assume that is what its going to be used for, and assume that Africans cannot help themselves. My only comment about internet already available, is that its too expensive. $60 a month for a 3gig account, line rental etc. pathetic. Which is mostly to blame on privatized companies running it for profit or share prices. Public enemy nr. 1 being Telkom http://www.telkomsa.net/.

  10. Free marketting... on Wal-Mart Asked to Drop Christian Video Game · · Score: 1

    Everyone here is playing right into the Christians hands...

  11. Wish I installed... on Oblivion Takes Top Honor At Spike VGAs · · Score: 1

    Gothic III, so that I could have added a meaningful comment here.

  12. New World Order on Richest 2% Own Half the World's Wealth · · Score: 1

    I wonder who sits at the top of the 2% pyramid.

    James, fetch me my sporting tinfoil hat please.

  13. Is it just me? on Microsoft Cheaper For Web Serving? · · Score: 1

    But these TCO reports have never made sense to me. Microsoft works out cheaper in the long run? Because of the new power saving features in the OS? Does this TCO report run over a period of 20 years?

    Cause, and the thing that boggles me...
    LAMP is Free!

  14. The secret... on Breakthrough In Human Genetics · · Score: 2, Funny

    gtagcgtagatagctctagctagcttaggagcttagaggcgcttagatcg cgatcga

  15. Some of my recent favourites... on Best 2+ Player Video Games? · · Score: 1

    Starcontrol
    Battle for middle earth
    Fight night
    Rockstars Tabletennis
    Command and Conquer Generals
    Unreal Tournament
    Call of Duty

    And if you have the time...
    Civilization IV

  16. How long till... on First Company Logo Visible From Space · · Score: 1

    Coca Cola puts up a HUGE billboard on the visible side of the moon?

  17. Re:Haha on Microsoft Announces TV and Movies for Xbox Live · · Score: 1

    So, for someone who doesn't own a 360, nor play games... You just wanted first post right?

  18. Shuttleworth... on Make Linux "Gorgeous," Says Ubuntu Leader · · Score: 1

    You're so smart Shuttleworth...

  19. 2nd nerd in space on Microsoft's Charles Simonyi to be 1st Nerd in Space · · Score: 1

    Shuttleworth did it! Shuttleworth did it!

  20. I post this with every Ubuntu related article... on Ubuntu 6.10 is Out · · Score: 1

    Shuttleworth is the man! Wish more South Africans rocked like he did.

  21. I'll see this movie 5 times... on Halo Film Still On Track · · Score: 1

    Purely just because of Blomkamp, and as a proud South African.

  22. I'll pay to see the movie 5 times... on Fox And Universal Say Goodbye To Halo Movie · · Score: 1

    Cause it will be produced by a South African.

  23. Top 100 PC games of the century?! on The Top 100 Best-Selling PC Games of the Century · · Score: 1

    That list is TERRIBLE!!! Survivor, the game?! C&C Renegade?!

  24. Why? When a cure is already available on First Phase of AIDS Vaccine Trials Successful · · Score: 1
  25. Re:SA owned on TiVo Wins Permanent Injunction Against EchoStar · · Score: 1

    Unfortunately this is whats currently happening in South Africa. A silent genocide on the white people, farm murders, brutal robberies. And the ANC is doing nothing about it. Silently agreeing to the principles, and the non-actment to crime. Theres only so far you can push us. And if a revolution happens, good luck to you.