Oh, Puhhleeeze! Everyone knows how HD manufacturers rate hard drive capacities. Why shouldn't they do this? They do in fact say that they define 1MB as 1000 KB (or at least they used to). Really, do you really miss those few "extra" GB on modern HDs? It's not like they are expensive these days. Want more space? Buy another. Be thankful that you can buy such huge capacities.
Audio salespeople have been doing this sort of thing for many, many years without encountering such legions of litigious twits. One can still buy a battery powered boombox with, wait for it... 50, nay, 100W quoted output power. Per Channel!... "Ah, that's the peak instantaneous power when traveling downhill with a tail wind, sir. The actual RMS value is perhaps 1W if you are lucky". (*)
I sincerely hope this frivolous lawsuit is thrown out of court. I could think up many more examples where manufacturers trump up their statistics to promote sales (CPU clock frequencies comes to mind as one).
Caveat Emptor, Caveat Emptor.
(Rant mode off) (*) Disclaimer: The numbers quoted are for example's sake. Perhaps the claims are not quite that wild, but they approach it.
Remember, once you got an aircraft carrier, you really somebody, you got status! People will no longer think you are a pickled herring salesman, nossir!
(Showing my age, with apologies to de voice of John Bird, played by de honorable Idi Amin Esq.)
Take 'em apart and use the magnets as fridge magnets. They hold up an enormous amount of paper, although they do tend to nip one's fingers occasionally:)
(I had to use 31337 Amino acid speak though, and used Q for O and V for W. Perhaps the organism using this sequence will speak with an Eastern European accent:-)
I see they have antimatter at $450,000,000.00 per liter. Such a deal! And only 12 liters could destroy the entire planet! Maybe I can afford a microliter or so and use it to power a really powerful potato gun?
It seems to me that this must be prone to leaks and hence unreliable. If the pump and chips are in the main body of the machine and the heat exchanger in the display part, somewhere there has to be a flexible tube carrying the water or some arrangement with O rings. (to allow for opening the display/lid). An irritating thing about flexible tubes is that with repeated flexing, they crack. O rings are even worse!
All those jokes about leaky laptops may not be so far off the mark...
Interesting the way "Matrox" and "Maxtor" ar anagrams of each other:-) Kind of like "melon" and "IBM"^H^H^H^Hlemon"
Seriously though - the warning came a little too late for me and I now have 4 75GXP drives that I purchased partially on basis of the IBM reputation (and the fact that our supplier couldn't get Maxtors at that time) but now dare not trust on a production machine. Seagate produces some nice 7200 rpm drives and I am switching to these and of course Maxtors! Maxtor appears to be the leader in higher capacities, at laset. Nice drives.
I forsee that anthrax will kill off snail mail just as effectively as letter bombs have... i.e.. not at all.
As for email taking over from snail mail, I don't see that happening for many, many years to come. At least not while a large part of the population cannot even correctly operate things as simple as ATMs.
As fas as I can see from a cursory glance at the article, the problem is that the railroad companies do not own "subsurface rights" and therefore were not allowed to let the telcos dig a trench to bury their fibers.
So the solution is apparent: The telcos should donate the existing fiber to the landowners and lay new fiber in a surface conduit. Which I think they should make nice and big and paint fluorescent lime green with orange polka dots:P
I see a nascent demand for downconverting proxies: Those that will pretend to be the latest whizz-bang browsers and strip out all the incompatible stuff before passing it on... Oh, and while they're at it they can remove all the ads and popups, too:-)
(Before anyone suggests that I look at Junkbuster, I already use it!)
I'd just like to point out that 10,700 MW of California's generating capacity was taken off line "for maintenance" by the generating companies just as the present crisis started, and is still off line. If that's not manipulating the market, I don't know what is.
The CA power crisis appears to be artificially induced with the aim of forcing the state to construct more capacity. The Internet has little
to do with it. Whereas I agree that CA should construct more capacity, I feel that trashing the economy this way is not a good method of achieving the desired results. It will be interesting to see developments over the next month or so...
I perceive there are (at least) 2 major problems with internet ads seen today.
(1) A large proportion are animated. It is highly distracting to see little flickerings going on all over the page.
(2) Many ads seriously slow down loading of the page I want to view, even on a high-speed connection. All it takes is one slow image server.
For these and other reasons, I'm really thankful for the existence of Junkbuster and the like. Perhaps if the ad companies were to make the ads a little less obnoxious and faster to deliver, people like me would actually look at them!
Wow! It's great to see what close attention the Slashdot editorial team pay to the discussions. I first saw this news item this morning, and the link was incorrect. Now it is evening and it's ***STILL*** incorrect on the main/. page.
I'll bet the guy with the Cobalt is REALLY PLEASED about this. It must be stress testing his server perfectly.
Slashdot Mirror
Hey, I planted one of those too. Mine has started growing - the young plant looks surprisingly mushroom-like at present, but who knows?
> Next Microsoft will be selling cube shaped PCs
:-)
Apple already tried this, it didn't work! - All you had to do was to put a book on top and... Fzzzzt!.
Picard never though of that
Oh, Puhhleeeze! Everyone knows how HD manufacturers rate hard drive capacities. Why shouldn't they do this? They do in fact say that they define 1MB as 1000 KB (or at least they used to). Really, do you really miss those few "extra" GB on modern HDs? It's not like they are expensive these days. Want more space? Buy another. Be thankful that you can buy such huge capacities.
Audio salespeople have been doing this sort of thing for many, many years without encountering such legions of litigious twits. One can still buy a battery powered boombox with, wait for it... 50, nay, 100W quoted output power. Per Channel!... "Ah, that's the peak instantaneous power when traveling downhill with a tail wind, sir. The actual RMS value is perhaps 1W if you are lucky". (*)
I sincerely hope this frivolous lawsuit is thrown out of court. I could think up many more examples where manufacturers trump up their statistics to promote sales (CPU clock frequencies comes to mind as one).
Caveat Emptor, Caveat Emptor.
(Rant mode off)
(*) Disclaimer: The numbers quoted are for example's sake. Perhaps the claims are not quite that wild, but they approach it.
Assuming medium cat=14 lb and medium dog=40 lb, and a 1:1 ratio of cats to dogs, one small cloud weights about 20,000 cats and dogs :-)
The storm cloud would be about 44 million cats and dogs! Much more impressive than the elephants...
Ahh, now I see.
We have Brittany Spears because a record company invested millions of dollars in creating her
:-)
Ha! I knew it. I always suspected she was a clone
You know, if Maxwell Smart can talk into his shoe, I can certainly talk into my watch. :-)
(Showing my age, with apologies to de voice of John Bird, played by de honorable Idi Amin Esq.)
I believe the Unabomber has the patent on the original postal based DOS...
Take 'em apart and use the magnets as fridge magnets. They hold up an enormous amount of paper, although they do tend to nip one's fingers occasionally :)
CATGAACTTCTTCAAGTTCAACGTCTTGATTAA
(I had to use 31337 Amino acid speak though, and used Q for O and V for W. Perhaps the organism using this sequence will speak with an Eastern European accent
Wonderful! A metallic Furby! (Pre-orderable to boot)
Just what I've been waiting for... I can see it now:
Da-loo-laah, C3PO {whistle whistle} Hmmmm... No..see..you! {launches into twee little song}
Techno-Polly eat your heart out.
I see they have antimatter at $450,000,000.00 per liter. Such a deal! And only 12 liters could destroy the entire planet!
Maybe I can afford a microliter or so and use it to power a really powerful potato gun?
The army trained my father to use these as anti-personnel weapons in an emergency. The trick was not to open the can before starting the heater...
All those jokes about leaky laptops may not be so far off the mark...
My dentist does not like to be bit at all, at all. Where you findin' all these multiply bit dentists??? :-)
Interesting the way "Matrox" and "Maxtor" ar anagrams of each other :-) Kind of like "melon" and "IBM"^H^H^H^Hlemon"
Seriously though - the warning came a little too late for me and I now have 4 75GXP drives that I purchased partially on basis of the IBM reputation (and the fact that our supplier couldn't get Maxtors at that time) but now dare not trust on a production machine. Seagate produces some nice 7200 rpm drives and I am switching to these and of course Maxtors! Maxtor appears to be the leader in higher capacities, at laset. Nice drives.
I forsee that anthrax will kill off snail mail just as effectively as letter bombs have... i.e.. not at all.
As for email taking over from snail mail, I don't see that happening for many, many years to come. At least not while a large part of the population cannot even correctly operate things as simple as ATMs.
So the solution is apparent: The telcos should donate the existing fiber to the landowners and lay new fiber in a surface conduit. Which I think they should make nice and big and paint fluorescent lime green with orange polka dots :P
YYUR YYUB ICURYY4Me
Disclaimer: This is not original!
(Before anyone suggests that I look at Junkbuster, I already use it!)
The CA power crisis appears to be artificially induced with the aim of forcing the state to construct more capacity. The Internet has little to do with it. Whereas I agree that CA should construct more capacity, I feel that trashing the economy this way is not a good method of achieving the desired results. It will be interesting to see developments over the next month or so...
(1) A large proportion are animated. It is highly distracting to see little flickerings going on all over the page.
(2) Many ads seriously slow down loading of the page I want to view, even on a high-speed connection. All it takes is one slow image server.
For these and other reasons, I'm really thankful for the existence of Junkbuster and the like. Perhaps if the ad companies were to make the ads a little less obnoxious and faster to deliver, people like me would actually look at them!
Why is this news? Madonna has had such nose-cone lasers installed in her bras for years
Considering that Al Gore invented the internet, I don't see where BT are getting off saying that they own hyperlinks on it :-)
Wow! It's great to see what close attention the Slashdot editorial team pay to the discussions. I first saw this news item this morning, and the link was incorrect. Now it is evening and it's ***STILL*** incorrect on the main /. page.
:-)
I'll bet the guy with the Cobalt is REALLY PLEASED about this. It must be stress testing his server perfectly.
Mind you, the thing is holding up nicely...