Domain: nih.gov
Stories and comments across the archive that link to nih.gov.
Comments · 5,290
-
Extremely interesting....This is something that is really, truly interesting. I am curious as to what they will consider a "human crafted" organism. I work in a virology lab and in the field there are often "frankenstein" viruses that are created to preform certain tasks. I know many people do not consider viruses to be living, but you are getting pretty darn close. Also, the viruses that are created (actually quite often) are usually combinations of parts of DNA sequence from a variety of viruses. Literally just last week I created an engineered virus that will insert the DNA that codes the protein USP18 into human cell cultures (huh-7.5 cells... modified human hepatoma 7 cells). The goal is actually to support or detract from the conclusion of the linked paper. The virus in question is basically a highly modified form of HIV. It has certain elements that are exactly the same as HIV but there are large portions (the parts that make it really pathogenic) that are removed and other things are added (promoters and insertions sites to allow the USP18 -or whatever- to be inserted).
The long and short of it is. These "life forms" are significantly different from their naturally occuring cousins. They are this way by nature of human engineering. This argument can also be extended to bacteria that have been highly modified. There are laboratory strains of almost every bacteria that we know of that are significantly different from wild type bacteria. I am curious as to where they will draw the line. From the article is appears that they are paring down mycoplasma to the barest bones.
The other question is, once you have the DNA how do you kickstart the process. They appear to be inserting it into and E. coli with the nucleus removed. This means that the cellular machinery of the E. coli will be used to translate the DNA into protein and eventually a new synthetic cell. Does this mean that it is human created if we use naturally occuring cellular machinery?
I don't mean to detract from the research in any way because it is highly interesting and will tell us a lot about how life works on the most basic level, BUT there are a lot of questions out there and I hope that people keep them in mind as we see this field develop over the next several years.
-
Dont like evolution, deny germ theory too
What has become clear to me is that: 1) Most people do not understand evolution in general, if polls are any indication. Even fewer people understand molecular evolution which is what many of the findings being recognized are. A failing of our education system to stand up to the political pressure of the Fundies?. Perhaps. 2) The basic religious objection to evolution is that the religious folk do not wish to be related to apes because man is divine (made in gods image). Being related to every other organism in the natural world would somehow sully the notion of Man's divinity. 3) Religion = belief based on faith 4) Science = testable hypothesis Religion = belief & faith I believe the car is red. (Or if you prefer "I believe that man and apes did share a common ancestor )." You will still believe the car is red even if science proves beyond a reasonable doubt that the car is white and that the owner only drives it during brilliant red sunsets. It is a matter of faith, the car is red. Objective & verifiable observation-based reality has little bearing on the matter. Science = testable hypothesis I postulate that the car is red. In order test this red color hypothesis I will scrape off some of the paint and test the the paints light absorption and reflective properties. Further, I will dissolve the paint and subject it to a mass-spectrophotometer in oder to determine the chemical make up of the paint. I will compare the properties of the experimental sample to the properties of known paints and pigments. As my knowledge increases about cars, paint pigments, and light over time, I will revisit my old results too see if they agree with my new results. And if not, why. As for evolution, thousands of scientists world wide test, expand, and retest evolutionary theory everyday. Evolution has yet to prove false. Humans and the chimpanzee are evolutionary cousins, a blink of an eye away on the evolutionary tree. If you doubt it, go to http://www.ncbi.nlm.nih.gov/. Look up the scientific papers reporting the chimp and human genomes in pubmed. Do a little bit of background reading on homology searches. Prove to yourself the relationships between organisms by doing a your own homology searches using blast & clustal. Build a evolutionary tree. You do not have to be a scientist to do this, although you will have to do more background reading than a scientist would. The tools and information are all there in the public data bases. The power of comparative genomics is awesome.
-
Ask GoogleHmm... I went to Google.com, and typed in "What should I eat for lunch?" I hit the "I'm Feeling Lucky" button, and it sent me here....
Does Google know something I don't know?
-
my favorite gene
Maybe it's because i'm french, but I like http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db
= protein&val=4505225 "ménage à trois". Who said scientist don't have a sense of humour... -
Project gutenberg?
I'm surprised they have it. Out of curiosity, what made you think to look there for genetic sequence data? I would have tried genbank first, or tigr.
ftp://ftp.ncbi.nih.gov/genomes/ -
Re:...and here come the scepticsIndustrial and cigarette smoke have both been found to cause lung cancer, so yes it is affected.
-
Needle Park> If the drugs were legal, they shoudl be cheaper...so robery and mugging shouldn't be too much of an issue.
You might think legalization of drugs would prevent many of the ills associated with them. I had wondered that myself. So did the government of Switzerland. So they basically tried it, legalizing most things related to drugs in Needle Park.
It failed. Badly.
Treating drug addiction like a disease, with hardcore users given their drugs under medical supervision seems to be more helpful for society and for the users themselves.
The libertarian notion of "less laws means better living!" is very appealing. It's also very naive. -
Disregard Please.The BBC has the worst science writers on the planet for any major publication.
The BBC article doesn't even mention the actual article, which I assume is this article, or perhaps this one.
Here are some of the juicy conclusion which I assume the craptacular BBC writer honed in on for his/her craptastic masterpiece.
The results support a role for infectious exposures in glioma aetiology that may act preferentially in certain geographical areas.
Or this beauty.
In conclusion, these findings are consistent with common, possibly infectious, aetiological mechanisms...
Emphasis mine.
In science parlance those type of conclusions can be translated into, "we have no clue, but here's a guess."
-
Disregard Please.The BBC has the worst science writers on the planet for any major publication.
The BBC article doesn't even mention the actual article, which I assume is this article, or perhaps this one.
Here are some of the juicy conclusion which I assume the craptacular BBC writer honed in on for his/her craptastic masterpiece.
The results support a role for infectious exposures in glioma aetiology that may act preferentially in certain geographical areas.
Or this beauty.
In conclusion, these findings are consistent with common, possibly infectious, aetiological mechanisms...
Emphasis mine.
In science parlance those type of conclusions can be translated into, "we have no clue, but here's a guess."
-
Fun things to do with the Fat Free Version
The little known health benefits of eating junk food...
Severe 2,3,7,8-tetrachlorodibenzo- p-dioxin (TCDD) intoxication: kinetics and trials to enhance elimination in two patients.
In spring 1998, two women were diagnosed with severe 2,3,7,8-tetrachlorodibenzo- p-dioxin (TCDD) intoxication. Over the following 3 years, TCDD levels were monitored under various attempts to enhance its elimination, and the half-lives were evaluated. Olestra, a non-digestible, non-absorbable dietary fat substitute, was continuously administered to the patients either as pure substance or in potato-chips...As previously reported, administration of olestra was found to be effective in increasing the fecal excretion of TCDD.
PubMed Link -
Re:It's happened before... R. G. Serle
One of the biggest problems is that aspartame is trashed so frequently on the internet... posting an anecdotal report about how your "near photographic memory" is now gone simply makes you look like a quack.
Funny. Another problem on the internet is people calling someone else a "quack" after doing little more than a summary perusal of the literature themselves.
Many of the studies referenced in the document you provided are severely lacking in experimental design. For example, while headaches from aspartame frequently come the day after consumption, a study was presented in which aspartame and placebo are switched every 24 hours, and then the placebo was shown to cause more headaches. This was provided as the sole and primary source of evidence that aspartame does not cause more headaches than a placebo, yet it did not actually test what is commonly experienced.
As in the example of the Merck research, and in the case of some aspartame research, there is a significant problem with research being funded and directed by the food and drug companies that stand to profit from the results of the research. We are experiencing a significant problem with the quality of research performed in this way, and a change is required.
It is known that aspartame's primary ingredient, phenylalanine, crosses the blood brain barrier and significantly disrupts normal neural function. This effect can be directly measured. For a slightly more extended summary perusal of the literature, you can start here or here.
You'll find that studies exist which indicate significant caution about aspartame is warranted, with results such as seisures and headaches.
If you pay attention, you'll also find that many of the other "studies" in the literature are far from impartial. For example, here's a nice flowery "scientific review" of the safety of aspartame, except that if you check the author affiliations, you'll find that they work for NutraSweet. Oh, and if you're paying a lot of attention, you'll even notice that S.S. Schiffman, the author of the study I was complaining about above that was used by the EU to "show" that aspartame doesn't cause headaches, is on that list of the authors working for NutraSweet.
Please question your sources of information a little more carefully before you go throwing around the "quack" label next time. -
Re:It's happened before... R. G. Serle
One of the biggest problems is that aspartame is trashed so frequently on the internet... posting an anecdotal report about how your "near photographic memory" is now gone simply makes you look like a quack.
Funny. Another problem on the internet is people calling someone else a "quack" after doing little more than a summary perusal of the literature themselves.
Many of the studies referenced in the document you provided are severely lacking in experimental design. For example, while headaches from aspartame frequently come the day after consumption, a study was presented in which aspartame and placebo are switched every 24 hours, and then the placebo was shown to cause more headaches. This was provided as the sole and primary source of evidence that aspartame does not cause more headaches than a placebo, yet it did not actually test what is commonly experienced.
As in the example of the Merck research, and in the case of some aspartame research, there is a significant problem with research being funded and directed by the food and drug companies that stand to profit from the results of the research. We are experiencing a significant problem with the quality of research performed in this way, and a change is required.
It is known that aspartame's primary ingredient, phenylalanine, crosses the blood brain barrier and significantly disrupts normal neural function. This effect can be directly measured. For a slightly more extended summary perusal of the literature, you can start here or here.
You'll find that studies exist which indicate significant caution about aspartame is warranted, with results such as seisures and headaches.
If you pay attention, you'll also find that many of the other "studies" in the literature are far from impartial. For example, here's a nice flowery "scientific review" of the safety of aspartame, except that if you check the author affiliations, you'll find that they work for NutraSweet. Oh, and if you're paying a lot of attention, you'll even notice that S.S. Schiffman, the author of the study I was complaining about above that was used by the EU to "show" that aspartame doesn't cause headaches, is on that list of the authors working for NutraSweet.
Please question your sources of information a little more carefully before you go throwing around the "quack" label next time. -
AspartameI'm not trying to minimize your symptoms: aspartame does have effects on people. I'm also not trying to defend Searle. The approval process for aspartame was pretty damned sketchy, with a very uncomfortable number of high-ranking people changing jobs back and forth between Searle and the FDA during and immediately after the approval process. It wasn't just Rumsfeld, it was also Ronald Reagan and Arthur Hayes who essentially ramrodded the approval process.
With that said, aspartame *can* break down into methanol, but usually only does so at extreme pH or temperature. Warm water alone very slowly hydrolyzes aspartame. I'm trying to find some good kinetics studies; this one indicates 90% hydrolysis after 53 days at 25 degrees C which is a good argument for only drinking refrigerated pop.
But the sheer amount you'd have to drink to produce blindness is astounding. I once calculated that with 100% hydrolysis, it would take 20 cans of pop per hour to build up and maintain harmful concentrations of methanol in the blood. EPA studies have indicated that 0.5g/kg/day doesn't result in observable health problems. There are (Google calculator r00lz) 0.014g of methanol per can of 100% hydrolyzed Coke. Hm, so that indicates that you probably don't want to drink more than 35 cans per day or you'll be above the no-observed-adverse effect level.
The official Materials Safety Data Sheet for methanol lists "Carcinogenicity: Methyl Alcohol - Not listed by ACGIH, IARC, NIOSH, NTP, or OSHA." That doesn't mean it's not carcinogenic, but it does mean that none of them has ever found any evidence for it being carcinogenic, as opposed to things like the nitrites in bacon, which have definite carcinogenic activity. The point being: we're eating things that are probably orders of magnitude more carcinogenic than the released methyl alcohol in aspartame; our bodies produce more methyl alcohol and its metabolites naturally than any but the most aggressive pop drinker will ever experience.
I'm not defending aspartame's use, but if you're going to attack what the FDA did when they certified it for use, attack it on other grounds, like your observed reaction to it, rather than because of methanol.
-
IGF2RAccording to build 35.1 of GenBank and version 124 of dbSNP, the following 66 genetic polymorphisms have been found to occur within the 48 exons of IGF2R in humans:
rs_number|alleles|position (on chromosome 6)
rs8191692 C/T 160360652
rs2975115 C/G 160360684
rs2975116 C/G 160360687
rs8191704 A/G 160382749
rs11759563 C/T 160416104
rs8191746 C/T 160416109
rs8191753 A/G 160418673
rs8191754 C/G 160418735
rs8191758 A/G 160421034
rs8191763 C/T 160424152
rs1570070 A/G 160424389
rs13198308 C/T 160432052
rs8191776 A/C 160434644
rs6413489 A/G 160434696
rs894817 A/G 160434700
rs8191797 A/G 160437232
rs1050004 A/G 160437257
rs8191798 A/G 160437267
rs998075 C/T -160438689
rs6413491 A/G 160438720
rs8191808 C/G 160439921
rs8191809 A/G 160439953
rs8191810 A/G 160439956
rs8191819 A/G 160441967
rs8191820 C/T 160441987
rs8191840 C/T 160452138
rs8191842 C/T 160453003
rs8191843 A/G 160453053
rs8191844 C/G 160453340
rs2274850 C/G 160450541
rs2230043 A/C 160454948
rs8191859 A/G 160455901
rs8191860 A/G 160455961
rs2230048 A/T 160459759
rs8191869 A/G 160459815
rs8191881 C/T 160463358
rs8191886 A/G 160464245
rs2230044 A/G 160464245
rs629849 A/G 160464820
rs11552587 C/T -160465339
rs1050005 C/G 160465360
rs8191904 A/G 160471039
rs8191905 A/G 160471123
rs8191906 C/T 160471223
rs8191908 A/G 160471609
rs2230049 C/T 160471684
rs614754 C/G -160475610
rs1805075 A/G 160475618
rs8191933 C/T 160487883
rs3190229 C/T 160487892
rs1803989 C/T 160487892
rs8191955 C/T 160496427
rs8191956 C/T 160496750
rs8191957 C/T 160496859
rs8191958 A/G 160496868
rs8191959 A/G 160497049
rs8191960 -/ACAC 160497143
rs8191961 A/G 160497202
rs3832385 -/TTTG -160497316
rs8191962 -/ACAA 160497322
rs8191963 C/T 160497586
rs1050015 A/C 160497591
rs8191964 C/T 160497662
rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665
rs8191966 A/G 160497672
rs14531 G/T 160497919
(Sorry about the formatting; the lameness filter forced me to make it look like that.)
Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.
The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:Interestingly, M6P/IGF2R in mice is imprinted in all tissues except for the brain where both alleles are expressed. It is highly expressed in neurons of the forebrain, with the highest expression in the pyramidal cells, the polymorphic layers of the hippocampus, and the granule cell layer of the dentate gyrus; regions involved in emotional behavior, information processing, and memory formation. These findings indicate that M6P/IGF2R may assist in the development of these brain functions. This postulate is reinforced by the identification of M6P/IGF2R as the first putative "IQ gene." By comparing children with an IQ of 160 or higher to those with an average IQ, M6P/IGF2R was shown to be linked with general cognitive ability ("g"). The role of this receptor in the development of cognitive function can now be systematically assessed with M6P/IGF2R conditional knockout mice.
Tissue-Specific Inactivation of Muri
-
Re:p=?Another subject not discussed, apparently, is that a gene could presumably affect rate of development or growth, rather than eventual intelligence (this may be much more plausible, for example).
Yeah, no frikin' kidding - a growth factor receptor just might be related to development.
Here's a paper linking a mutation in IGF2R to differences in rate of growth and height from birth to 7 years. There's also a bunch of studies in mice regarding its imprinting and role in development (incidentally, one mentions that it's regulated so that the paternal allele is repressed, so the gene is maternally expressed).
Also seems it's been implicated as a tumor suppressor; though that's kinda irrelevant.
-
Re:Why bother?
Actually, thats part of a cow protein.
Here's a real rat brain sequence. Look it up on BLAST, I'm sure you'll find the results amusing. (After Format, scroll down below the chart for matches).
ttaggtcgtt aggagaactt actgtgaaca ggctctttta tttcttcaaa agatgtctcc
catttcaagc aaggagcacc catggctgag ggttccctcc cggcatctct ttctcagtca
ccttgagtct ggcctaatca aagactgagg ttatgaagtc gatcctagat ggccttgcag
acaccacctt ccgtaccatc accacagacc tcctctacgt gggctcgaat gacattcagt
atgaagatat caaaggagac atggcatcca aattaggata cttcccacag aaattccctc
taacttcctt caggggtagt cccttccaag aaaagatgac cgcaggagac aactccccgt
tggtcccagc aggagacaca acaaacatta cagagttcta taacaagtct ctctcgtcgt
tcaaggagaa tgaggagaac atccagtgtg gggagaactt tatggacatg gagtgcttta
tgattctgaa tcccagccag cagctggcca tcgctgtact gtccctcaca ctgggcacct
tcacggttct ggagaaccta ctggtgctgt gtgtcatcct gcactcccgc agtctccgat
gcaggccttc ctaccacttc atcggcagcc tggcagtggc cgacctcctg ggaagtgtca
tttttgtgta cagctttgtt gacttccatg tattccaccg taaagacagc cccaatgtgt
ttctgttcaa actgggtggg gttacagcct ccttcacagc ttctgtgggc agcctgttcc
tcacagccat cgacaggtac atatccattc acaggcctct ggcctataag aggatcgtca
ccaggcccaa ggccgttgtg gccttttgcc tgatgtggac tatcgcaata gtaatcgctg
tgttgcctct cctgggctgg aactgcaaga agctgcaatc tgtttgctcg gacattttcc
cactcattga cgagacctac ctgatgttct ggattggggt gaccagtgtg ctgctgctgt
tcattgtgta cgcgtacatg tacattctct ggaaggctca cagccacgcg gtccgcatga
ttcagcgtgg gacccagaag agcatcatca tccacacgtc agaagacggc aaggtgcagg
tgacccggcc tgaccaagcc cgcatggaca ttaggctggc caaaaccctg gttctgatcc
tggtggtgtt gatcatctgc tggggccctc tgcttgcgat catggtgtat gacgtcttcg
ggaagatgaa caagcttatc aagacggtgt ttgccttctg cagtatgctc tgcctgctga
actccaccgt gaaccccatc atctatgctc tgaggagcaa ggacctgaga catgctttcc
gaagcatgtt cccttcgtgc gaaggcaccg cacagcctct agacaacagc atgggggact
cagactgcct gcacaagcac gccaacaaca cagccagcat gcacagggcc gcggagagct
gcatcaagag caccgttaag atcgcgaagg tgaccatgtc tgtgtccaca gacacgtccg
ccgaggctct gtgagcctgc tgcttttgtg gc -
Re:The Essential Missing Ingredient
Nothing at all here about conducting interactions with honesty.
Yeah well, the tooth hurts, doesn't it ...sorry, that was a bit too much, even if it was incisive. Worth sixpence though.
I don't know where he gets the nerve, really, and to crown it all, there is going to be a dentin his finances.
And there ya go... money really is the root of all evil.
Sorry, there is no way I can get periodontal membrane to fit here.
-
Pubmed
I had this idea a while ago. Probably every science major does. Anyways, dictionary files are simple, just the word followed by an endline. So all you need is a good database. A good one for biology is pubmed over at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=
P ubMed&itool=toolbar They offer a way to download all their abstracts. Most are spell checked, and they should, in culmination, include most every biological word. So, download their abstracts (i think they are in xml) parse them (delete duplicates and words in a normal dictionary... maybe words with numbers) and put them into a txt file followed by an endline. Done. -
Re:I'd like to see this go to a jury.
umm you are prolly thinking narcolepsy, sleep apnea is when you are asleep and stop breathing, narcolepsy is to be brief falling asleep some what randomly and abruptly. http://www.ninds.nih.gov/disorders/narcolepsy/nar
c olepsy.htm http://www.ninds.nih.gov/disorders/sleep_apnea/sle ep_apnea.htm -
Re:I'd like to see this go to a jury.
umm you are prolly thinking narcolepsy, sleep apnea is when you are asleep and stop breathing, narcolepsy is to be brief falling asleep some what randomly and abruptly. http://www.ninds.nih.gov/disorders/narcolepsy/nar
c olepsy.htm http://www.ninds.nih.gov/disorders/sleep_apnea/sle ep_apnea.htm -
News for Joe Blow. Stuff that's wrong.
Why does Slashduh keep insisting on trying to report on the life sciences when it (the editors and story submitters) are so obviously clueless about the topic?
To begin with, why the fuck is there a link to totally idiotic misinterpretations in the popular mainstream media instead of a link to an abstract of the original article in Journal of Psychoneuroendocrinology?
Needless to say, the Yahoo!/Reuters article was awful.
"The powerful emotions that bowl over new lovers are triggered by a molecule known as nerve growth factor (NGF), according to Pavia University researchers."
No! The researchers said no such thing at all!
They said that they have shown that there's a high plasma level of NGF in subjects who have recently fallen in love. That is all, and it's not surprising or ground breaking. We already know that love (and other emotions) are associated with varying levels of growth factors in general and neurotrophins in particular, along with a host of other changes in our chemistry. For example, here is a study showing that kissing affects immune responses by way of NGF. NGF is no "love molecule" any more than it is a "stress molecule" or a "healing molecule". NGF does not cause love or kissing! Quit being sensationalistic retards!
Slashdot supposedly reports "news for nerds, stuff that matters". Then why is it OK to report laymen's misconceptions about "love molecules", when it would be unacceptable to propagate e.g. laymen's misconceptions in the mainstream media about "hackers", or calling a harddisk a "virus device" (only because it can also store computer viruses)?
Why is it OK to post biology news from Yahoo! instead of from the original source, when a submission containing just as vague, dumbed down and incorrect news from Yahoo! about e.g. the Linux kernel would never get published here (other than for comedic effect)?
I humbly suggest that Slashduh should quit reporting on other sciences than technology. You'll obviously never get it right or even know what actually is the stuff that matters in those news. -
News for Joe Blow. Stuff that's wrong.
Why does Slashduh keep insisting on trying to report on the life sciences when it (the editors and story submitters) are so obviously clueless about the topic?
To begin with, why the fuck is there a link to totally idiotic misinterpretations in the popular mainstream media instead of a link to an abstract of the original article in Journal of Psychoneuroendocrinology?
Needless to say, the Yahoo!/Reuters article was awful.
"The powerful emotions that bowl over new lovers are triggered by a molecule known as nerve growth factor (NGF), according to Pavia University researchers."
No! The researchers said no such thing at all!
They said that they have shown that there's a high plasma level of NGF in subjects who have recently fallen in love. That is all, and it's not surprising or ground breaking. We already know that love (and other emotions) are associated with varying levels of growth factors in general and neurotrophins in particular, along with a host of other changes in our chemistry. For example, here is a study showing that kissing affects immune responses by way of NGF. NGF is no "love molecule" any more than it is a "stress molecule" or a "healing molecule". NGF does not cause love or kissing! Quit being sensationalistic retards!
Slashdot supposedly reports "news for nerds, stuff that matters". Then why is it OK to report laymen's misconceptions about "love molecules", when it would be unacceptable to propagate e.g. laymen's misconceptions in the mainstream media about "hackers", or calling a harddisk a "virus device" (only because it can also store computer viruses)?
Why is it OK to post biology news from Yahoo! instead of from the original source, when a submission containing just as vague, dumbed down and incorrect news from Yahoo! about e.g. the Linux kernel would never get published here (other than for comedic effect)?
I humbly suggest that Slashduh should quit reporting on other sciences than technology. You'll obviously never get it right or even know what actually is the stuff that matters in those news. -
Can you hear me... Can you hear me now...
Severe to profound losses range from PTAs of 75 dB and greater. At this level, hearing aids provide limited benefit and consideration of cochlear implants is generally given. Statistics about Hearing Disorders, Ear Infections, and Deafness
-
Re:Income tax misnomerWhat bothers me about the parent is that I fully expect him to crawl back here as soon as he gets into any medical trouble over there.
You should know that I can not do that. Having become a non-resident of Canada, I can't simply return and be covered. I'd have to (and be allowed to temporarily) purchase private health insurance until the third month after my return (so a wait of 60 to 90 days). And, if I had a serious pre-existing condition, I would not be able to obtain such insurance, even for 90 days.
I have personal experience with people paying high taxes all their lives for Canada's health care, and then were denied a lousy $20k surgery (AAA repair: $US19,985 +/- 7396 for endovascular or US$12,546 +/- 5944 for open repair reference) that was a death sentence for them. Oh, and if you're over 65 in the U.S., Medicare reimburses about US$19k of that. (AAAs are typically a condition of the elderly, though they can strike the young as well).
I now know of another relative that needs this surgery and is not getting it. Tick, tick, tick.
If anything, once I obtain U.S. citizenship, I'll likely renounce my Canadian citizenship -- one can not serve two masters.
But, your comment is telling of the desparation among Canadians -- every one wants what they think they are entitled to, but no one else who may also be entitled should get it. This attitide and behavior where quite prominent when I lived in Markham, and Whitby, Ontario, for a while. It is typical of a fight over scarce resources, and reminided me of rats on a sinking ship.
-
A few more details, re: homebrewing etc.
The acid catalyst they are talking about replacing is liquid Sulphuric Acid. Most homebrewers of biodiesel, like those using an "open source" Appleseed type reactor, are not using both an acid and base catalyst, only the base being Potassium Hydroxide or Sodium Hydroxide (along with Methanol or Ethanol).
With higher Free Fatty Acid feedstock, such as really used grease, the acid cataylst helps convert those FFAs. You can read a little more on the chemistry of
the news item here:
http://www.greencarcongress.com/2005/11/inexpensiv e_eff.html
Nature abstract:
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd= Retrieve&db=pubmed&dopt=Abstract&list_uids=1628102 6&query_hl=3
Another abstract:
http://www.researchsea.com/html/article.php/aid/34 0/cid/2/research/green_chemistry__efficient_cataly st_for_making__biodiesel_.html>
Seems this process is five times more reactive than other solid catalysts, but still 50% that of the liquid acid - however sepearation afterward would be much
easier. -
I get paid to run Slack
I help manage ~700 linux machines all running Slackware. Actually it's a very customized Slack-based distro but that's part of Slack's beauty, how easy it is to modify for specific needs.
FWIW I work here:
http://www.ncbi.nlm.nih.gov/ -
Re:Does this violate the terms of the DMCA?
regrettably a recent study has shown that the one thing that 'duct' tape is really not good for, is repairing ducts... (heating ducts anyway, the glue melts)
It's apparently good for warts though -
Whoa giddy.
They have a tiny oven which can:
While other miniature PCR devices exist, they are limited in the rate at which they can change temperature, Grover said. "Our first prototype has demonstrated that we can expose the sample to the required temperatures at unprecedented rates," he said.
Now, lets look at just whats needed to do the PCR reaction (just one of the variations taken from here:
If you are using DNA Thermal Cycler (TCI, the DNA Thermal Cycler Model 4800 or any thermal cycler requiring light mineral oil overlay.
* Place the tubes in the thermal cycler and begin thermal cycling as follows:
* For the first cylce only, ramp to 96 C for 1-5 minutes to completely denature DNA template then proceed with sequencing PCR steps.
* Rapid thermal ramp to 96C
* 96C for 30 seconds
* Rapid thermal ramp to 50C
* 50C for 15 seconds
* Rapid thermal ramp to 60C
* 60C for 4 minutes
* Repeat Step 2 for 25 cycles
* Rapid thermal ramp to 4C and hold. Samples can be started in the evening and purified the next day if necessary
* Proceed with Purifying Extension Products.
They might be able to change temperature quicker, but they haven't invented a new way to perform the reaction.
minor upgrade, no digg. -
pub med link for ADH
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd
= Retrieve&db=PubMed&list_uids=2511595&dopt=Abstract /
and
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd= Retrieve&db=pubmed&dopt=Abstract&list_uids=8986205 &query_hl=3/
http://www.annals.org/cgi/content/full/127/5/376/
This is a fairly well known fact. To absolutely corect would have been better to say that some Asians often have a copy of the ADH gene that doesn't function (essentially),as compared to ethnic caucasians. There are some racial differences in drug metabolism. See also G6P metabolism in people of Afican and mediterrainian descent - certain drugs used to prevent malaria caused a hemolytic anemia (red cells burst). -
pub med link for ADH
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd
= Retrieve&db=PubMed&list_uids=2511595&dopt=Abstract /
and
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd= Retrieve&db=pubmed&dopt=Abstract&list_uids=8986205 &query_hl=3/
http://www.annals.org/cgi/content/full/127/5/376/
This is a fairly well known fact. To absolutely corect would have been better to say that some Asians often have a copy of the ADH gene that doesn't function (essentially),as compared to ethnic caucasians. There are some racial differences in drug metabolism. See also G6P metabolism in people of Afican and mediterrainian descent - certain drugs used to prevent malaria caused a hemolytic anemia (red cells burst). -
Re:There is no such thing as a Lie Detector.All these machines can test is for signs of nervousness, even an MRI machine. It's not some sort of magical probe where you can read what a person is thinking.
What else is an MRI machine other than a magical probe that reads what a person is thinking?
;) Ok, ok: What else is an MRI machine other than a magical probe that detects levels of blood oxygenation correlated with their thoughts? I don't think it is at all unreasonable to think that MRI or some yet-uninvented brain imaging technology would yield remarkable predictive power for detecting lies. Here is an excerptabstract from an article which asserts that fMRI can be used to detect lies:The relative salience of the task cues affected the net activation associated with lie in the superior medial and inferolateral prefrontal cortices. Lie was discriminated from truth on a single-event level with an accuracy of 78%, while the predictive ability expressed as the area under the curve (AUC) of the receiver operator characteristic curve (ROC) was 85%. Our findings confirm that fMRI, in conjunction with a carefully controlled query procedure, could be used to detect deception in individual subjects. Salience of the task cues is a potential confounding factor in the fMRI pattern attributed to deception in forced choice deception paradigms.
Prefrontal cortex is associated with planning complex tasks and with personality, so it seems reasonable to think that activity in this region could be used to detect lies.
-
Re:Xylitol gumYou said xylitol "will kill all the good bacteria in your intestines." That does not seem to be the case, firstly because people who eat it do not drop dead, and secondly because these PubMed abstracts reports measurements of faecal flora after xylitol dosing that do not seem to be consistent with a killing off of all of the good gut bacteria:
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD= search&DB=pubmed&term=xylitol+intestinal+floraAll animals were capable of adapting to 20% dietary xylitol and an accompanying enhancement of the ability of caecal and faecal flora to utilize xylitol was observed.
-
"Teach Yourself UNIX in a week" - by same authorThe same author also wrote "Teach Yourself UNIX in a Week".
But he's way behind on speed. The current record holder is "Teach Yourself UNIX in 10 minutes".
You may also need "Advanced Speed Typing" and Carpal Tunnel Syndrome Treatment.
-
Re:CCR 5 Delta 32 Gene
FYI,
a mutant allele of CCR5, CCR5 delta 32 is frequent in populations of European origin. Homozygotes for the delta 32 allele exhibit a strong, although incomplete, resistance to HIV infection, whereas heterozygotes display delayed progression to acquired immunodeficiency syndrome (AIDS). http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd= Retrieve&db=pubmed&dopt=Abstract&list_uids=1240250 6 -
Re:The 1957 influenza epidemic
'The influenza virus in the 1957 influenza epidemic may have actually been considerably worse than that in the 1918 epidemic.'
There's been a lot of speculation about relative virulence of the 1918 virus, but thanks to some very recent research we can now look at this directly:
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd= Retrieve&db=pubmed&dopt=Abstract&list_uids=1621053 0&query_hl=2
It turns out that the (reconstructed) 1918 virus is indeed exceptionally virulent (at least in lab mice): "In fact, no other human influenza viruses that have been tested show a similar pathogenicity for mice 3 to 4 days after infection." This isn't the same as studying a human infection, of course, but it certainly lends weight to the theory that H1N1 1918 was unusually nasty. -
Re:It's not surprising
Both attack the same T cells in the immune system, and both even bind to the same CD4 receptor of the T cells. Thus, mutations in the CD4 receptor that are still functional to the organism but disallow the binding by the pathogen would create a form of immunity.
I heard about some research that claims that this is the case
http://www.abc.net.au/science/k2/moments/s714968.h tm
So if you're from N Europe, have upto a 14% chance of immunity to Aids.
Interestingly enough there's an analogue to African restistance to malaria -
http://www.ncbi.nlm.nih.gov/disease/sickle.html
Sickle cell anemia is obviously not a good thing to have, but it does give you some resistance to malaria.
Makes you wonder what the downside to not having CCR5 proteins is. -
Re:Sweet mother of brain implants.
They don't work well. I was involved in artificial vision implant work a few years ago, and the current spread from the electrodes is too large to stimulate the small numbers of neurons necessary to give anything other than a "light blob". The lab put a grid of 5x5 electrodes in a human eye and the human reported on what they could perceive from current applied to it: the surgery was only done on people about to have their eye removed anyway for medical reasons, to be at little risk of hurting a good eye.
If the electrodes could be improved, with work like that of David Edell at http://www.ninds.nih.gov/funding/research/npp/sow/ N01-NS-2-2347SOW.pdf, then it might become possible to actually provide the shape of a letter to an artificial eye. But not even tapping the brain directly will get past the need to localize current for the nerves, and fascinating things happen around smaller and smaller electrodes that make it very tough. It's also delicate, expensive work, with lots of need for using lab animals and careful data and record keeping to be sure you're measuring what you think you're measuring. The concept of giving someone a neural jack that provides high-bandwidth computer data of any sort is, and remains, utter fiction.
Surprisingly, the implants for artifical hearing work very well: having the auditory nerve laid out, low frequency to high frequency, along the bony tube of the cochlea helps localize the current to just the nerves you want to hit with each electrode. -
Re:Intelligent design IS proveable.I think you don't know what ID actually is. ID does not say that life could be designed, it says that life MUST be designed -- that there's no other way it could have come about. Therefore, ID MUST explain ALL intelligence/complexity (except for the supernatural).
You may recall we were talking about making ID a scientific theory. So modification of the theory, that you think is ID, is allowed. This part would be discarded because it is unscientific.
Trying to prove ID by using the example of humans as intelligent designers is useless, because it fails to prove that the humans themselves couldn't have become complex and intelligent through some other mechanism, such as evolution.
But it does indicate that ID does happen and hence is a relevant point.
Perhaps you should try to come up with an argument that isn't lame yourself, eh?
I think I addessed your concerns.
[...] The more complex the problem, the greater the intelligence, because complex problems require complex reasoning to solve.
That's why intelligence is inherently complex.
But does complex reasoning require complex physical structures? For example, turing machines can encode all possible deterministic processes (including intelligent ones) in a very simple theoretical structure. A genuinely intelligent program might be rather large (relative to other turing machine programs), but I don't see that this is necessary. For example, maybe we can build a short program that when given an arbitrary and fairly general problem assembles another program for generating a useful solution to the problem. Ie, reasoning facilities are built as needed.
Further, there is a flaw with this definition of intelligence. For example, one of the key problems facing life is entering new ecosystems. Bacteria has solved this problem virtually everywhere on Earth even appeared deep underground in some oil fields, in hot springs, or in anartic ice fields.
A rather complex problem would be to find a niche off the Earth. And frankly, that is close to happening. Human beings are somewhere around 10% bacteria by mass and the human controlled environment is friendly to a number of bacteria.
I would in fact consider the world population of bacteria and other microbes to be a strong candidate for the role of "intelligent designer(s)". First, bacteria contain information in the form of RNA and DNA, information exchange occurs, bacteria clearly has had a profound evolutionary impact on all life (ID isn't incompatible with evolution), and these bacteria would have had a long time to manipulate species evolutionary. We might have an intelligence that operates on the timescale of thousands or even millions of years. While bacteria intelligence would be difficult to detect, it's definitely can be made into a scientific ID theory.
Even if bacteria turns out to be unintelligent, they have solved the space flight problem in three billion years or less.
-
Re:independent thought
Anyway it's a strange view that, if it's in the genes, it's OK, but if it's caused by the environment, it's somehow less real. Would we convert left-handers to right-handers if we found out it's an enviromental factor that determined their chiral preference?
I'd worry; lefties will be a convenient target for genetic screening
... all in the name of better public health, of course.Quite the contrary, 36.7% of children of LHI were left-handed, while 7.3% children of RHI happen to be left-handed (P < 0.00025).
Being a lefty is an inherited trait.
http://www.canoe.ca/Health0007/06_hands.html
Study finds gays more likely to be left-handed than straights
...
But exposure to sex hormones and environmental factors such as pollutants and stress during pregnancy can alter the genetic blueprint, contributing to left-handedness.
"There's something that happens early in development that can shift development towards a left-side bias," says Lalumiere.
In turn, those blips may also be a factor in determining homosexuality.
"This study is one more piece of evidence that suggests sexual orientation is at least partly determined in-utero," says Blanchard.So, whether you're a lefty or gay or both, you can say you were born that way.
Other risk factors of being left-handed include being more likely to suffer post-traumatic stress disorder http://www.acpmh.unimelb.edu.au/research/summary20 03.html
n a provocative preliminary study, Chemtob et al. hypothesized that deviations from normal hemispheric dominance may increase risk (Chemtob & Taylor, 2003). They examined hand preference in 118 right-handed male veterans. PTSD prevalence was lowest for respondents reporting a consistent hand preference and right handed parents (44%) and highest for those reporting both mixed laterality and a left handed parent (100%). Moderately high PTSD rates were observed in veterans reporting either a mixed lateral preference or left handed parent (70%). These findings suggest that an imbalance in hemispheric dominance for processing threatening and/or emotional information may increase vulnerability to PTSD following trauma.
- Chemtob, C. M., & Taylor, K. B. (2003). Mixed lateral preference and parental left-handedness possible markers of risk for PTSD. Journal of Nervous and Mental Disease, 191(5), 332-338.Higher risk of schizophrenia if you're a leftie
...http://www.schizophrenia.com/sznews/archives/00 2346.htmlWhen this was noted in the data, it was found that they had higher STA scores than those who had not been forced to switch. Also it was found that "males who were non-right handers, and who presumably had mixed-handedness, having significantly higher STA scores than full right-handers" (PsychiatryMatters.MD).
These results support the claim that left-handedness and being ambidextrous was a risk factor for schizophrenia symtoms.Diabetes: http://www.diabeteshealth.com/read,1009,2592.html
Our results: people with diabetes are three times more likely to be left-handed than the general population.
Other connections:
-
Re:You are only hurting yourself you know....
"Also, exactly how unlikely is "mathematically unlikely"? Is there any credible calculation of this probability anywhere?"
Simulating evolution by gene duplication of protein features that require multiple amino acid residues.
Also, biologists agree that the search space for a viable protein is extremely small. Only 1 in 10^11 randomly generated proteins are active _at all_ (not necessarily _usefully_ active, just active at all -- as in have a binding site for ATP).
Functional proteins from a random-sequence library.
Likewise, Dembski has done some work regarding such search spaces in his book No Free Lunch and the online paper Searching Large Spaces.
"The thing is, the Earth is a very large system, and it spans a very long timeframe."
The timeframe proposed is actually very short for the kinds of changes required by evolution.
"Just about anything can be done with enough time and resources"
This is actually false. It is based on a misreading of the probability formula. The classic probability formula is for looking at the probability of independent events. Since all biological reactions are equilibrium reactions, the probabilities are drastically smaller (if not 0) than otherwise examined.
"Indeed, since I am here arguing about it, something must obviously have worked, and thus we set out to find that something."
You are assuming that matter and motion are all that exists. ID states that not all of reality is reducible to matter and motion. If it were, then choice would be an invalid concept.
"And even more finally, even if "accidental" or "random" evolution is shown to be very unlikely, it means only that."
Scientifically, it does. That's exactly what "error bars" are for in science. What you are saying is error bars are unnecessary in science, because it's possible that whatever we are looking at beat the probabilities. So, not only did you abandon testability for evolution, you have simultaneously removed it from all of science. -
Re:You are only hurting yourself you know....
"Also, exactly how unlikely is "mathematically unlikely"? Is there any credible calculation of this probability anywhere?"
Simulating evolution by gene duplication of protein features that require multiple amino acid residues.
Also, biologists agree that the search space for a viable protein is extremely small. Only 1 in 10^11 randomly generated proteins are active _at all_ (not necessarily _usefully_ active, just active at all -- as in have a binding site for ATP).
Functional proteins from a random-sequence library.
Likewise, Dembski has done some work regarding such search spaces in his book No Free Lunch and the online paper Searching Large Spaces.
"The thing is, the Earth is a very large system, and it spans a very long timeframe."
The timeframe proposed is actually very short for the kinds of changes required by evolution.
"Just about anything can be done with enough time and resources"
This is actually false. It is based on a misreading of the probability formula. The classic probability formula is for looking at the probability of independent events. Since all biological reactions are equilibrium reactions, the probabilities are drastically smaller (if not 0) than otherwise examined.
"Indeed, since I am here arguing about it, something must obviously have worked, and thus we set out to find that something."
You are assuming that matter and motion are all that exists. ID states that not all of reality is reducible to matter and motion. If it were, then choice would be an invalid concept.
"And even more finally, even if "accidental" or "random" evolution is shown to be very unlikely, it means only that."
Scientifically, it does. That's exactly what "error bars" are for in science. What you are saying is error bars are unnecessary in science, because it's possible that whatever we are looking at beat the probabilities. So, not only did you abandon testability for evolution, you have simultaneously removed it from all of science. -
Re:Speciation?
Speciation can be observed in the lab with yeast. I even have a refereed article to prove it! The article hails from Science. 2002 Nov 29;298(5599):1773-5. and is entitled Hybrid speciation in experimental populations of yeast.
A child of the parent post seems to think that we have no clear definition of how two species are different, but in fact we do for sexually reproducing species. Any two specimines that can produce viable offspring (that is, offspring that may reproduce aswell to produce new offspring) are considered to be of the same species. If this is not the case, they are of differing species and it is the task of biologists to determine where they branch from eachother.
So that takes care of the speciation argument against evolution. -
Lack of public access to scientific literature
One day I wanted to send good review describing why ID is wrong. But most of scientific literature require expensive subscription and can not be reproduced freely. So public get this free crap. Anyway, for those who have access:
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd= Retrieve&db=pubmed&dopt=Abstract&list_uids=1452730 0 -
Re:Where's the science?
A quick search on arxiv.org for 'International Space Station' yields four papers.
For comparison, a search for 'Hubble Space Telescope' gives over 200 papers.
On the other hand a quick search on MedLine http://www.ncbi.nlm.nih.gov/entrez/query.fcgi for "International Space Station" gives 511 papers, whereas a search for "Hubble Space Telescope" only gives 70 papers.
The low number of papers found at arxiv.org is probably related to a selection bias from that site. In particular, medical sciences seems not to be represented. Similarly, papers related to the Hubble Space Telescope is not well represented in MedLine. -
Evidence> supporters of Evolution are unwilling to admit to any kind
> of dichotomy between macro and micro evolution.Define "macro" and "micro".
Speciation? Evidence is out there.
Gross physiological changes, like many-legs (centipede) to 6-legs (ant)? Found the gene
There's a pretty good transitional fossil record for several species showing many steps of macroevolution, such as horses (gradual change from multi-toed and small to single-external-toed and large) and humans, so there is reasonably strong fossil evidence for macroevolution, as well as the above predictive and experimental evidence.
Hence, since there does exist this reasonably strong evidence that macroevolution can and does occur, it becomes reasonable to ask what evidence suggests that it does not occur. Do you know of any?
> That bad ideas are good ideas if none better can be foundWhy is macroevolution a priori a bad idea? If it fits the observed data (it does) and has demonstrated predictive power (it does) and is supported by experimental evidence (it is), then why is it bad? (It may indeed be, but that's a claim you'll need to substantiate.)
> How would data pointing to an intelligent designer differ
> from data pointing to randomness?Quality of the resulting designs.
Standard examples are the human eye (the retina would not need a blind spot if it were installed the other way around; it's inefficient compared to the reflective-coated eyes of cats and other animals, etc.), the appendix, the prostate gland (prone to infection and dangerously constricts the urinary tract when that happens), and so on.
Some would interpret bad designs like these as evidence of "whatever works first" randomness, rather than careful and intelligent crafting of a pinnacle of creation.
Read the first link I gave - there is strong experimental evidence for speciation in the "reproductive isolation" sense. Macroevolution has pretty strong evidence in favour of it; I don't see why that's a challenge to your faith, though. Does it really matter whether the earth is 6000 or 5 billion years old? Does it really matter if animals were created in a day or an eon? Does it really matter if man was created in an instant or over millenia? Are those the really important questions that faith addresses?Not if you're Christian, they're not. Christ didn't talk a whole lot about where the earth and animals came from, but he did speak at length about how we should interact with each other, and with God. Those who hold doggedly to a literal interpretation of the Bible while glossing over the actual content of Jesus's message would likely get much the same treatment as the Pharisees---which is to say, quite the surprise in the afterlife. Something to consider.
-
Re:bans?
The link you post to shows one refutation of a 1993 review article, and doesn't mention any of the other more recent reviews and research articles that say the same thing.
So, if you want to base your beliefs on science, then please reference more than one source!
-
Re:bans?
The link you post to shows one refutation of a 1993 review article, and doesn't mention any of the other more recent reviews and research articles that say the same thing.
So, if you want to base your beliefs on science, then please reference more than one source!
-
Re:AJAX is just an acculmulation of failures
Java web applications are slow to load even on a fast machine over broadband.
I am a research chemist, a number commercial chemistry service online providers use Java 2D drawing applets as front ends to their databases and numerical engines. These apps though they work are slow and clunky.
Pubchem a chemical database provided by the National Library of Medicine (NLM) has developed a 2D web drawing tool that apparently uses AJAX techniques for its instantaneous update:
http://pubchem.ncbi.nlm.nih.gov/edit/index.html
It far superior to any of the equivalent Java applets. -
Could someone please post accomplishments?
I'm trying hard to find a solid list of scientific accomplishments for the mission. So far, I'm finding a handful of research articles on microgravity-related changes in human physiology. Hopefully there's more.
I hope the major accomplishment of the ISS isn't just keeping it in orbit. -
Re:Other warm-blooded "cold-blooded" creatures
Or did I miss something?
You did. Thermodynamically, extra effort is extra effort, even if that extra effort involves burning calories to produce a special behavior rather than burning calories to feed a special organ. Evolutionarily, it doesn't really matter--in fact it makes sense--that many different mechanisms evolved toward the same general end. A species that already accomplishes a particular goal in one manner probably won't evolve toward a different method unless some other advantage comes with it.
More interesting than the sharks in the article, I think, is the eye-heating organs that marlin and sailfish have evolved. The last theory I read is that helps them see more clearly, for hunting, in the deep cold water. They evolved just enough to accomplish the goal and no more. Give them a couple of centuries of much colder water, and I'm sure they'd end up heating their whole blood supply, too.