Slashdot Mirror
Vibrating Controller Alert
mgibbs writes: "According to this article at the BBC, all those game consoles with vibrating controllers can be hazardous to your health. This would have been nice to know before all those hours killing The Flood in HALO; and here I thought all those pins and needles were from the exciting game play."
WARNING: The Surgeon General (in conjunction with Jocelyn Elders) has determined that masturbation, while an enjoying, normal and healthy activity, can cause carpal tunnel syndrome in practiced too frequently with the arm and wrist in a non-ergonomic position.
Mark my words; I'll bet we see that someday...
Karma: Excellent Birds (mostly as a result of listening to Laurie Anderson)
If you're playing video games 7 hours a day, you deserve whatever happens to you...
theewse gammesss alll the ttimme anddd I'mmm ffine.
I better use my own, 100% natural joystick.. ;)
<^>_<(ô ô)>_<^>
Filthy. Now I want to borrow friends' computers even less. Now I just don't have to worry about keyboards and mice, but joysticks, too - I thought joysticks were safe, that they were just symbols for other things... now they're... eww.
Anyone with RSI will say "no sh*t! of course vibrating controllers hurts your hands!!!"
I remeber playing Defender on the Atari 2600 for quite a few hours. After a short while I could open my right hand. But it took a bit before anything besides my thumb could move on my left hand.
Have you read my journal today?
You do anything other then sleep for seven hours a day and it is bound to have adverse effects. I'm sure quite a few people here have sat in a chair coding for seven hours and felt the pain afterwards.
You're not supposed to shove them up your ass!
TtttThhhhhiiiiisss iiiiIssss BbbBbbulllssshhhiiittt...... Iiiiiiiiii fffeeeeeeellll ffffffiiiiiinnnnnneeee.... Uuuuggggghhhhh.... Mmmmmuuuuussssttttt ggoooo bbbaack ttttooooo sssssssooooaaaaakkkkkiiiiinnnnnngg mmmmmyyyy hhhhaaaaaaaannnnnnddss...
-- Dan
Never mind what I read the first time I saw this headline!
"In the event of a dildo, the company always refers to it as "a dildo", never "your dildo"". - fight club
Anyways, I have been playing my beautiful Xbox for two months now and my wrists don't hurt.
If your child is spending 7 hours a day in front of a console I really think you need to work on your parenting skills. A TV isn't a baby sitter. Let them spend hours and hours staring blankly at a screen when they become old enough to know better.
- Jimbob
Doctors are calling for vibrating computer game controllers to carry health warnings after a teenager developed a painful condition known as hand-arm vibration syndrome.
They are basing this freaking out on one single case??? Perhaps a study is in order, anyone want to get paid to play games all day?
I Am My Own Worst Enemy
why don't you just use tin?
Perhaps this kid should have been doing other things than just playing video games. And maybe he should have been a bit more intelligent. Let's see:
1) He spent SEVEN hours per day playing games. Apparently for upwards of two years. This seems to indicate psychological issues in addition to physical ones. This should have been a warning sign, and someone (his parents, maybe?) should have gotten him to go do something else occasionally.
2) He waited TWO FULL YEARS before seeking medical help. If you've got a problem like that, I could see waiting a month; after all, it could just be a fluke. But two years?
Sorry folks, the kid's an idiot, and his parents aren't paying enough attention to keep him from hurting himself, possibly permanently. Keep this in mind: stupidity can be harmful to your health.
-Carik
Does anyone else remember how the old Atari joystick's base would cause a blister in the left hand? In my case caused by too many hours playing their crappy Pacman clone.
This isn't really anything totally new. If you are playing video games for 7 hours a day you're pretty likely get RSI (often called Joystick thumb when talking about badly designed controllers) anyhow from just hitting the buttons, this vibration thing is just a bit extra. Most companies know about RSI now and have all these expensive chairs, keyboards etc to prevent this. Most importantly they HAVE REST BREAKS!!!
Another thing to think about is all those people who use tools that vibrate all day (Jackhammers etc.) I think they should be far more worried than a little vibration from a joypad.
Isn't doing ANYTHING for seven hours straight every single day hazardous to your health? This is more of a fact of life than a problem with video game systems.
Oh no!
I guess I shouldn't jack off with the controller anymore.
PayPal $$ if you sign up for free offers (eBay, cred cards, e
So, this kid plays his video games for seven hours a day and people blame his hands on the controllers? Why would he be allowed to play those games for seven hours? I didn't think that HALO took that long to beat?
aa a a lloooaaadd d d of f f ccccraaappp p p .. . . II I pllayy y PPP PP PSS22 aall ll tthee tiiimme. .. Nnnoo pp prrooobllemms ss s hhhhhherrree ... .. ..
This article is just an annoying reminder of how the media spins and distorts issues. Why don't they have the courage to run this article with a little different slant and a headline such as "Another child injured by parental neglect -- lazy parents allow son to play video games seven hours daily"?
How soon can we expect the multi-million dollar lawsuit on this one?
a 15 year old girl who used the vibrating controller for an equal length of time suffered no apparent injury and in fact, had a rosy glow to her cheeks and a skip in her step.
A while back, a group of Japanese scientists conducted a test that showed that hi-tech maps of the mind show that computer/video games are damaging to the brain development and could lead to children being unable to control violent behaviour.
The article can be found here and is a good read.
"The ones who dont do anything are always the ones who try to pull you down" -- Henry Rollins
What RSI problems do I have?
If you could be told what you can see or read, then it follows that you could be told what to say or think - BoC
I just finished beating off for the 6th time today, theres still plenty of time in the day though.
There's an upside to this story: Spend 7 hours coding, immediately followed by 7 hours playing video games, and watch your vibrating hands syndrome cancel out your Carpal Tunnel syndrome!
;)
Ahh... good vibrations...
Reading this:
;o)
Dr John Sallis, who treated the boy at Liverpool's Alder Hey Hospital, said: "It was quite clear this boy had major problems.
After reading this:
The 15-year-old boy spent seven hours a day playing computer games (emphasis mine)
I'd say, yes, but the problem with his hands is only the beginning.
Some of my former co-workers with whom I have kept in touch have been consulting lawyers in the area in the hopes of "demonstrating" that the vibrating controllers and other ergonomic no-nos committed in our workplace are grounds for getting some quick cash through the legal system. Because of the very nature of this sort of damage - that it is very difficult to prove whether or not somebody is feeling pain in their arm - they believe that it will be an open-and-shut case and that most companies will want to settle quickly to avoid further damage to stock prices and profits.
I don't wholehartedly condone this sort of behavior, but some companies have such an atrocious employee relations record that they almost deserve the misery...
will
like most things in the news today, this is complete bullshit. Blaming the companies for this kid's problem is not the solution. It's his OWN damn fault. He has MAJOR problems. Seven hours or more is HIS risk. Too much of a good thing can be a bad thing.
Recently, there was a post on penny-arcade that addressed a certain story: a kid accidentally shot his brother while re-enacting a scene from time crisis 2. Not the games fault, more like "stupid parents raise stupid kids."
What kind of moron would keep his gun accessable to his kid?
PayPal $$ if you sign up for free offers (eBay, cred cards, e
I think this is a little more than just the vibration. What about, for example, people who mow lawns for a living - that's a shitload more vibration than a measly little 2v DC motor with a off-centre lead weight. Not only that, but think of all the guys in the 'old days' operating vibrating machinery.
I think that it's the whole concept of keeping his hands wrapped in the same position all day, using only the same muscles that caused it. Think of the stress on his eyes, staring at a TV all day. It's nothing but a wakeup notice that he should get a life.
Oh, yeah, it vibrates...feels like I'm really in the game.
No, wait, no it doesn't. Not unless the game involves riding a bicycle over railroad ties, or jamming a vibrator in somewhere.
They were a dumb idea from the start.
You would think there would be hundreds of cases of this effecting ...."other" regions on some porn starlets.
Injuries associated with the use of computers or their accessories include joystick digit, mouse elbow and central palmar blister on the inside of the hand.
Joystick digit? Mouse elbow? This stuff is hilarious! How about CTRL-ALT-DEL-overextended-finger?
Work isn't supposed to be fun, and the companies who thought it should have been are doomed to fail in a capitalist society.
It's called Raynaud's Syndrome, and there areh er /raynaud.htm
many other causes besides vibration.
http://www.nhlbi.nih.gov/health/public/blood/ot
when i wax our cars or boats, i use the little orbital buffer we have. after a while, I get this stinging sensation in my forearms and hands. is this anything like what this syndrome is? if so, i feel sorry for the kid because its uncomfortable as hell. i guess thats what you get for playing games 7 hours a day.
Another 15-year old boy suffered mild bruises after repeatedly hitting himself in the head with a rock. A proposal is also in the works that requires all rocks to carry warning labels.
There is a better link here.
--Metrollica
- Zdnet (weird link, I know)
- ThisIsLondon
But then if I know my health experts, and I think I do (cough...eggs...cough), next year they'll tell us how vibrating controllers are good for us.I think this is another example, albeit a not terribly important one, of how journalists try to report on too many different things while only knowing anything about a pitifully few.
"Sony, which manufactures the top-selling Playstation games, said it had never received any feedback or complaints about hand-arm vibration syndrome after 61 million sales world-wide of Playstations I and II.
It stressed that there was occasional, but no constant vibration during either game."
Either game? Either british usage is a little different in this respect, or whoever was summarizing Sony's position doesn't own either one.
I'm not a gamer, but when I was a teenager living in the suburbs playing videogames took most of my time because of the lack of anything else going on. Yes, I did my homework and all that fun stuff, but when you're a teenager (a the person in the article is) you've got free time coming out the ass.
I don't think its a sign of bad parenting to let your kids do something they enjoy. Sure videogames are truly a time waster but finishing that RPG on my Master System or whatever was fun and rewarding.
There is no statistically valid reason to conclude that the boy's condition is caused by the use of a vibrating game controller. That boy is a sample of one. Of course the idiotic media love to dig up the slightest piece of bad news and blow it out of proportion.
What you need is random sampling of many game players to see whether there is a statistical correlation between use of a vibrating controller and the health symptoms related to vibration. And of course, even given a correlation, you have not determined cause-and-effect; when two findings are correlated, they could have some hidden common cause.
I don't know about this kid, but when I was 15, I was in school and most certainly did not have 7 hours a day in which to play video games! (And if I did have 7 hours a day of free time, my mom, despite being a single mother who works full time, would make sure that I wasn't spending that time parked in front of the TV.)
It seems to me that parental boundaries could have solved this before it got to this point.
Beer, now there's a temporary solution -- Homer Jay S.
Does this mean Apple will have to stop selling their iBrator?
--Metrollica
Major problems include: PLAYING VIDEO GAMES SEVEN HOURS PER DAY!
quis custodiet ipsos custodes - Juvenal
Exactly the kind of person who does not deserve to reproduce. Child kills himself, problem solved. Now if only the state would make it illegal for that particular person to adopt another child......
Don't these controllers vibrate when you crash your car, or get shot, or do something else that you shouldn't have?
Seems to me that if you didn't suck at the game, the vibration injuries would not be a problem. One the other hand, you could look at the injury being better than being in a real car crash or being shot!
This is getting more and more disturbing. I know I probably get modded down for this, but do we REALLY need to save people from themselves? Why bother?
Playing video games for 7 hours/day caused a problem. I say the problem was there before that. What's next? A label on coffee saying that drinking more than 8 liters will probably kill you? If you're interested, it's about 18 liters for WATER.
I think that we can proove the existence of evolution now (It is still technically a theory). We can see what happens to human race right now. We no longer need to fight for food, survival. We, as a species, live a sheltered life. More than that - we are now forced to protect people from THEMSELVES!
Right now I am ashamed to be human.
I do believe that Nintendo already packages such a warning. It is in that booklet that no one reads.
I think we've passed the point where product liability ends individual responsibility takes over. Perhaps they should have a warning label because little Johnny spends so much time on his PS2 that he doesn't eat properly, and that's bad for his health as well.
Robotiq.com is heavily tested on animals
I noticed that the rattle on the GameCube seemed a little wimpy. (And had read that it was more significant a factor on the XBox, and put to good use in "Halo"). I wouldn't be terribly surprised if it was a bit of a deliberate ergonomic decision on Nintendo's part. (Or maybe it just ties in to have a relatively smaller controller anyway.)
SO YOU'RE GOING TO DIE: The Comic for Dealing with Death
Is the more interesting news on BBC News. BBC News story about old classic games coming to the GBA. Regarding this vibration thing, the problem is with the parents letting him play computer games for 7 hours a day. They should have forced him to do something else, like help tidy up the house, dig up the garden or join a gang. And why wasn't he at school?
You get so many more stares going into "The Locked Door" or whatever your local adult store is than going into toys r us and picking yourself up a playstation controller.
The parent post is in fact funny. To the dumb shit who moderated it as a troll: do you know what the hell a troll is? Jesus.
python -c "x='python -c %sx=%s; print x%%(chr(34),repr(x),chr(34))%s'; print x%(chr(34),repr(x),chr(34))"
Wired News carries a similar story to the BBC story. A good read.
Do you get the CTRL-ALT-DEL-overextended-finger. Otherwise you so get the ps x strained eye on UNIX systems with an impulse to type kill -9.
Karma whorin' since 1999
I agree, if parents let their children derive enjoyment from staring at CRT screens, they may become computer scientists or some other type of undesireable ;-)
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
Once upon a time there was a young boy. The boy loved to spend his days and nights in front of a television playing video games. His favorite game was "Shaky Jim's Chainsaw Simulator". A game that very accuratly replicated the events that the modern lumberjack encounters. Even down to a violently vibrating controller.
One day, as the boy was playing his favorite game, the Ghost of Christmas Future paid him a visit. "Ugh", the ghost said as he pointed to a newspaper. The headline read, "YOUNG BOY GROWS OLDER, HANDS ARE GOOFY BECAUSE OF VIBRATION CONTROLLERS, PANIC SWEEPS CITY". This struck fear into the boy's heart. The ghost then gave the boy a new controller.
The new controller used drugs and electro-shock to simulate real-life encounters in video games. Before his eyes, the young boy saw the newspaper headline change to read, "YOUNG BOY GROWS OLDER, HANDS ARE LOOKIN' GOOD, PANIC SWEEPS CITY".
First Punxsutawney Phil (it's groundhog day!), then the techs (it's backend day!), then MS (it's clean code day!), then the robots (it's judgement day!), and now this...
What's next?
Studies have shown live organisms are statistically more prone to dying than other organisms
Jack sez: "on a long enough time frame, the survival rate drops to zero."
No, seriously, I just come here for the articles.
Not only that but it is well written, intelligent, has no visible spelling errors and no profanity.
That makes this a troll? Is va_willy trolling the trolls?
Maybe someone without a clue and too many mod points is running amuck tonight.
Seven hours of any activity is hazardous to my health? Phew! I only get 5 hours of sleep a day, looks like I wont be getting those sleep disorders at this rate :)
What about the degenerative effect on the brain? Cranial Tunnelvision Syndrome...
Weeks of coding saves hours of planning.
For the first 18 years after I finished school, I cut grass in the summer and wood in the fall and winter. Most nights, I could still feel the vibration from the handle on the lawn mower or from the chainsaw. I'm 73 now, and I don't have any major problems with my hands. You don't hear about lumberjacks and yardmen with these sort of problems. It sounds like these kids just like to whine.z
If you are spending in excess of 7 hours per day playing video games, you seriously are not going to find a girlfriend or anything. I think its safe to say most girls are not into the sort of guy who spends that much time playing video games. Go outside, get some fresh air, try to find a girlfriend or something. Life is just a little too short to spend most of it playing video games.
I've always found the vibrating controllers annoying, and always turn off the feature in the games that I play. Sure, the novelty was great at first, but your hands feel weird when you leave it going for too long.
Has it struck anyone else here, reading slashdot, that the british papers have entirely become the equivelent of the American National Enquirer. I.E. Useless?
You're forgetting the social aspects. On the whole, playing 'outside' meant I was generally involved with some of the neighborhood kids. Inside playing video games was essentially a solitary endeavour, even when you'd go to a friend's place to play the latest games. Those games (Atari VCS, etc) were almost always single player (excepting Combat, Warlords and a couple others).
Especially in any arcade that has the 'Addams Family Generator' game, which has some pretty wicked vibrations...
Just because you can mod me down, doesn't mean you're right. Shoes for industry!
Yeah...its the ac again....i already screwed myself, so you dont have to screw me...
"Well, seriously speaking, I wonder what kind of long term damage vibrators could cause to... certain body parts..."
Well if you turn it up too high. "Free Willy" could end up being more than just a movie.
What about a vibrating woman?
Apparently "work the phones" took on an added meaning when that employee came on board.
Damn! Well there goes my career at:
http://mypleasure.com/
"Sony, which manufactures the top-selling Playstation games, said it had never received any feedback or complaints about hand-arm vibration syndrome after 61 million sales world-wide of Playstations I and II.
:-/
It stressed that there was occasional, but no constant vibration during either game."
Thanks, Sony, I'm glad knowing that your two games, the Playstation 1 and Playstation 2, are the safest games I can own. Where is my Dreamcast copy of Playstation 2? I see the kids in the picture enjoying it!
The research in this article (one extreme case among millions leading to warnings) is astounding. Then again, they do have "WARNING: HOT" on coffee nowadays. Have to protect the public from themselves
--
Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
"Another thing to think about is all those people who use tools that vibrate all day (Jackhammers etc.) I think they should be far more worried than a little vibration from a joypad."
Damn! You just killed the entire sex industry.
Way to go!
"(oh I can feel the karma draining away on this one...)"
Are you sure that's "karma"?
WARNING: Reading slashdot 7 hours a day will cause
you to go into spasmotic shock everytime you encounter the word "CowBoy Neal".
>Sony, which manufactures the top-selling Playstation games, said it had never received any feedback or
>complaints about hand-arm vibration syndrome after 61 million sales world-wide of Playstations I and II.
>
>It stressed that there was occasional, but no constant vibration during either game.
Dude, like, I was playing a mean game of PlayStation II all night. I can't wait to see how it ends.
http://www.justvibrators.com/Vibes/Strap-on/index. html
;)
Sure it doesn't
Or maybe she doesn't have a lover.
I guess his future career in the video game industry is shot.
I think the acid test in this case is to ask the question "If a warning label were placed on the product, would it have prevented the injury?" In this case, I believe it is a resounding NO. The kid had a serious gaming addiction. A warning in the Playstation documentation, assuming he read it, would not have prevented this kid from sitting in front of the tube and playing for hours on end.
This is your brain:
This is your brain experiencing withdrawel symptoms after going outside:
AAAAAIIEEEEEEEEEEEEEE.
"Dr Sallis is advising children to exercise caution and moderation when using these vibrating games."
:-)
If properly disected and put into the appropriate context, I believe the good doctor has two excellent pieces of advise here for two drastically different segments of the population...
First, we have the excellent suggestion of "[A]dvising children to exercise..." I believe this recommendation to be spot-on in the case of all children - but especially applicable in this specific scenario. Any individual (child or otherwise) whom invests seven hours a day playing video games DEFINITELY needs some exercise. Hey kid, drop the joystick and the twinky. Ya know that bright light outside, it is called the sun...go outdoors and see what it looks like!!!
The second golden nugget of advise contained within the noted quote is for women. "[E]xercise caution and moderation when using these vibrating games"...this, of course, is in reference to what my wife likes to call "BOB" - her battery operated boyfriend. I have never personally seen the device (nor do I want to...), but this may be good advise for her during my extended business trips. For god sakes, I would hate to have her chip a tooth!!!
Beer is proof that God loves us and wants us to be happy. -- Benjamin Franklin
Dope-slap the parents AND the kid.
And get a christless life.
Two years of pain from an ELECTIVE activity?
I suggest a sublethal category for the Darwin awards. Oxymoronic, but necessary.
Only saving grace is that this slob will likely never be given the occasion to reproduce.
"Win treats sysadmins better than users. Mac treats users better than sysadmins. Linux treats everyone like sysadmins."
Hmm, the picture has nothing to do with the article. The DC's controllers don't have the PuruPuru/Jump/Rumble pack in 'em, and the only ergo problem I see is the way they are seated. I'd break my neck like that. TV's too small, too, they're gonna kill their eyes.
LOL.
--joshua
I'm not a doctor, but my copy of Repetitive Strain Injury by Pascarelli and Quilter describes what this kid has as probably "RSD." RSD is more serious than symptoms such as tingling, numbness, discomfort, and pain mostly related to carpel tunnel syndrome, tendonitis, and so forth.
Once you have RSD, your nerves are damaged; and they either don't heal or heal very, very, very slowly--taking much longer than tendons and ligaments. With soft tissue injuries, it is a prolonged road to recovery in the first place because these tissues are being used all the time. Imagine if the kid has a runny nose, and he has to use his hands to blow/wipe his nose. I have "only" RSI and sometimes, with a lot of hours on the computer, even opening doors is painful to my wrists.
Symptoms of RSI should not be ignored; people who suffer from RSI, including myself, often feel stupid for ignoring the initial warning signs their body sends. Unfortunately, this isn't a case of "no pain, no gain." Even seasoned trainers say "train with your mind, not with your ego." I'm pretty sure this kid no longer feels invincible. What a bad wake-up call.
The 15-year-old boy spent seven hours a day playing computer games and particularly enjoyed those using the vibration mode on the control device.
The BBC editors seemed to have left this tidbit out:
'The boy, known only to the media as 'Cowpoke Neal', is said to be the younger sibling of a well-known online personality. It is unknown whether or not the family member suffers from the same condition.'
Anything that vibrates against your body, with enough intensity will definitely desensitize the nerves in the area. How do you think back-massagers work? =)
The biggest trick the devil pulled was letting lawyers become politicians so they can write the laws.
Funny, I had this rejected yesterday...same story. This also happened with my first submission...I send it and days later it appears under someone else's name. Anyway...I'll enjoy my negative karma. Peace.
TV Repairman
You post currently has a score of 2, but there's a single mod on it of -1 Troll : Is it a discontinuity thing with Slash? Just seems weird, unless you can post starting at 3 somehow.
Very nicely done.
If he has 7hrs a day free to play games, that's like he has enough time to sleep eat and play games. Maybe shower every 2nd day?
I wonder what the parents were doing every day not noticing maybe he should spend some time doing something else.
Geez this is like the 7th moderation complaint under this story: Get over it! Seriously, there's dumb moderators out there and you just have to laugh and chuckle it off: Remember that any monkey spanking, pimple popping, mad at the world zealot out there might one day find themselves with mod points, and many try to "make a point" with them, even if it's a retarded point.
I didn't think so when I was a teenager, as a result, I am now blind!
"HALO"? You mean you bought a Borg Box?
"This would have been nice to know before all those hours killing The Flood in HALO."
Alright... time for a class action suite against nintendo's game cube then. That thing comes with controllers that have built-in rumble packs...
[Something witty and intelligent should have appeared here.]
{Traicovn}
They said 'seven hours' as though it was an excessive amount of time.. i spent more than that on just one game some days. The first time i turned on the vibrator (PS2) i started feeling funny after a few hours of gaming - my grip felt weak, and i sometimes had pins & needles. Now i'm turning it off for everything. Now atleast i know my theory was right. Maybe i should get out more... But i can't beat police down with a baseball bat and then pump them full of lead in real life.. :(
This comment does not represent the views or opinions of the user.
Do they really KNOW he was playing games for all 7 hours? Maybe he just hit puberty and was trying to blow his own trumpet, choke the chicken, strangle the monkey...
Bleh bleh bleh. There should be a warning, there should be a law. Doesn't this kind of crap, and the idiots who promote it -- as if they're servering in some useful capacity to society -- bore you to death ? It certainly bores me. How about if I make a press release about my totally significant discovery that if you brush your teeth to freqently, for say a mere 7 hours a day, you can utterly destroy the enamel on your teeth ? Will you guys help me lobby Washington to pass a lawing forcing Crest and Colgate to carry a warning label of these dire conseqences ?
http://www.penny-arcade.com/view.php3?date=2001-12 -03
PayPal $$ if you sign up for free offers (eBay, cred cards, e
I played doa2 on ps2 for 6 hours with 2 friends to determine if the match number would go from 99 to 0 or to 100. We got headaches, and we were switching off everytime someone lost. Of course, my hands feel fine. (and it does go to 100)
This is a transparent attempt by the gaming industry to bring media attention to another poorly-selling product.
Whenever an article appears about "concern over product X", unless the concern is valid (which in this case it certainly is not, since anyone playing games for 7 hours straight forfeits all health and safety boundaries) then product X gets free advertising. Good publicity, bad publicity, it's still publicity.
And guess what, it worked! We're all talking about them here, and they are in the front of a lot of peoples' minds now.
Take for example the case of IBM's "Peace Love and Linux" spraypainting campaign. If they weren't caught and taken to court over it, then one city would know about the campaign. Now the world knows about it.
This is Marketing for the '00s
.
.
"Nine times out of ten, starting a fire is not the best way to solve the problem." - my wife
How bad? Let me tell a small story...
In October 2000, I helped set up a demo of a pulsejet engine given by Mark Pauline and Co (of SRL) - the demo was to show off the pulsejet, which was of a valveless design, and could thus run for a long period of time, and didn't have parts that would wear out (unlike typical pulsejet engines, which use a spring metal valve system).
Anyhow, this engine was loud - actually, that doesn't do justice to how loud the engine was - it was bone-shaking loud. When it was running, it was like your entire body - bones and tissue, all - was buzzing with its energy - which, it was!!!
Mark only ran the engine for a few minutes each time, when he was tuning it, or demoing it. He told us (the crew who was helping set up for the demo, which was meant to presage the Ultraviolence show in Phoenix, which never happened because the SFFD contacted the PFD, and...) a story about pulsejets, and why you never want to let one run for a long time, and be around it...
He said he worked on one engine a while back, and ran it for a long time, all the time making adjustments, etc - tuning the engine, basically. He said he ran it for 30 minutes to an hour, and then when he shut it down, he felt numb all over - something like having your entire body being "asleep" (imagine the prickly pins all over your body). He layed down to rest, thinking it was all temporary - eventually the prickly sensation went away - but what came afterward was much, MUCH worse - his nerves were hypersensitised.
Simply moving, or small noises, or puffs of air on his skin, would cause intense waves of pain. He said the condition lasted for a couple of days, then went away. Needless to say, he doesn't run his engines for long times any more.
I thought it was an interesting story. Could a vibrating game controller cause the same reaction? I doubt it, but they can't be good for you if left vibrating for long periods (and unless the motor was stuck on, why would that occur?)...
Reason is the Path to God - Anon
This is one of my long-standing rants: the need for America to constantly cater to the stupid and incompetant. Our judicial system has a very low definition of "common sense", which is what allows us to sue over hot coffee that we bought, sue because we decide to play vibration-enhanced games for 50% of our waking day and our hands start to go numb, etc. It's totally ridiculous. I think it's retarded that everywhere I look there are 50 stupid stickers and warning labels telling me not to ingest plastic bags, avoid sticking metal things into electrical outlets, not to drink household cleaners, etc.
If you ask me, a gene pool is improved by allowing people to do the things only they are stupid enough to do. We definitely need to jack up the definition of "common sense" in our legal system to something a bit more common sense.