Should DNA be Patentable?
nexex writes: "This story seems brings the patent debate home; specifically, should a company or person be able to 'own' your DNA? Obviously researchers want to profit from their discoveries, thus funding new research. But critics counter they are profitting at the expense of our health, citing restrive screening licenses for things such as breast cancer and Alzheimer's. Citing a figure from a UK activist group, 500,000 gene or gene sequence patents have been applied for worldwide. Another excellent article on this issue from Salon.com was from a couple years ago."
If someone tries to patent my DNA, shouldn't I be able to provide them with lock of hair as an example of prior art?
Well, I don't want people to clone me, so I'd patent myself :)
I am guessing that it is too late to stop this. Given the incredible number of DNA patents already granted, it will be nearly impossible to turn back the clock. The article does talk about patents of a different scope, but the cat is out of the bag. Corporations will drive and drive ahead to make this happens because it means money. Now, should you own your own DNA? Sure. And your vagina and penis too!
DNA should not be patentable. It would be morally wrong, since the discovery of a gene is exactly that: nothing new and unique has been created, it's just finding something that was there already.
Patents should protect new ideas, not entities that are already present in nature and are waiting to be found.
However, when you can put a piece of DNA to use in any way, the methodology your technique follows should be patentable. A new method for application of a certain DNA sequence is something that can be new and innovative.
Put a patent and a copyright on the strands that make up diseases like AIDS, Herpes, Malaria & the common cold. I'm tired of catching a cold, and I sure as hell don't want to get any terminal diseases in the near future. If you think about it, DNA is really a kind of software, it is intellectual property that's been unclaimed. Well dammit someone should claim that IP and protect it's right to not be copied unless specifically authorized by the rightful owner and in compliance with the DMCA!
He will be missed
Show me That Smile (The Growing Pains Theme Song):
Show me that smile again.
Ooh show me that smile.
Don't waste another minute on your crying.
We're nowhere near the end.
We're nowhere near.
The best is ready to begin.
As long as we got each other
We got the world
Sitting right in our hands.
Baby rain or shine;
All the time.
We got each other
Sharing the laughter and love.
Alan Thicke's Journal
My Slashdot ads say "
When they take it from my cold, dead body!
Oh, wait....
I like you, Stuart. You're not like everyone else, here, at Slashdot.
FIRST POST? OR WHAT? WEENT
I do realize medical research is a huge money sink, but depending on the disease, if you get the right patents you can get a limited monopoly in a marked where there are *no* substitute treatment, and that people can't do without (aka they would die). Those together let you set whatever price you want on your drugs/services, and people will just have to pay. Or, your medical insurance would but it'd still be passed on to us as increased premiums. On the other hand, if there's not enough money to find the cure in the first place the entire thing is pretty moot.
Kjella
Live today, because you never know what tomorrow brings
I don't think that the patenting op particular sequence should be possible.
It would be cool, you could sue your brother(s)/sister(s) for having their DNA look to much like yours.
Be mindfull of your parents not doing the same...
Time for illegitamately born children or unwanted pregnancies to get sued by... their parents.
This all goes back to that episodoe of Superman where Lex Luthor clones Superman and Bizarro is what results. We should learn our lesson from cartoons.
---- The geek shall inherit the Earth.
U.S. patent attorneys say they will have more luck trying to teach penguins to fly.
Pfft. What do they know about flying penguins.
Two requirements of a patent are the existance of an 'inventive step' and another is 'novelty'.
Patenting a gene itself (if that's what's done) is nothing more than patenting a transcription of an already-existing structure. It won't hold up - there is no novelty, and no invention - you're just writing down what already exists.
However, an inventive, novel step could be the application of the knowledge contained in the gene for specific therapies which were developed. These can and are patented, and I don't see anything wrong with this.
I think there's a common misconception that these companies are patenting genes themselves-I think that with few exception, this isn't the case - they're patenting applications of the knowledge to new therapies, much like someone who has studied the physiology of the body can patent a drug to treat an illness. You're not patenting the mechanism of the body, you're patenting a tool based on that knowledge.
I've always been confused by this - if I tried to patent my own DNA, couldn't someone use me as an example of prior work?
"What we have here, is a failure to communicate." - Cool Hand Luke
OHH YAH!
aaaggctccatgccgcctcgactaggaaggccacctactatcatattcgt
t gg
t gg
g ga
c at
a cc
a gc
a tt
c cg
g ag
c tg
a at
c ca
g gt
t gc
t cc
t tc
t aa
g tc
t ct
t aa
t ac
t tt
t cg
t tg
g cc
c tc
g ga
a gc
t aa
g gc
a gt
c aa
g cg
t tt
c ct
g aa
c ac
g cc
t tc
t ac
g ga
a tc
t ga
t ta
c ct
a ga
c aa
c tc
t ag
t ta
t at
g tg
t ta
a cc
t ct
a cg
g gg
a at
c tc
g ac
g gg
c ca
t tt
c tc
t ac
c at
a cg
a aa
t ac
g ca
c ta
a cg
t cg
c aa
t tt
t ac
c cc
t tc
a tt
g ct
g ac
c tt
c ct
g tg
a ct
c tc
t cc
a cg
c ca
a ac
t tt
a gg
g ta
g tc
g ac
c cg
g ct
a ta
c cg
a ta
g at
a ct
a gg
t ct
c ca
c cc
c ta
t ga
g ta
g gg
t ca
a cc
g cc
g gg
g ta
a ta
g gt
a gg
t cg
g cg
c ct
c ta
a aa
g tt
ggccggttaggagattatgcgcggcaagtaacctacgaaaggggttc
tggaatcaagtcgcacttttgttaaacttaggtacatcgggtgtatc
cgagttgcgtgggtgtcaccgatagctcagtgtcttgacagccaacg
gacagatagacgggtatagcgtaaactctcttcggttttaaatgacg
atgggccagagggctagtttgcagctgggatacacagatcagttgct
ccaccgtccagtttagtgacgtcggctgtcaggcacagcggtgtacg
gtggagctactctcaacatctgctggagattctactccggccgtggt
atcgtggcccttttgtccaatgtcccggacattgagagatatccccg
atgattggaggcgggcgaagcaataagcgacggtgccaagacctagt
ccaaattgttgaactgtgaaagccagatttccgactcgtaccatact
cttaggaaggtgacaacgcaaatcttcctttcggaaccgcactgagt
acagtgccggaatacgtgcggagaatgtcgagcgctgtggatgtgca
tcgaacaacgaaagggcaagtgtattgtaagggattctgacctgccg
aaatagtgcgagggttgataaattttgagccagtgtacgtctaaaac
agcgctactcccaagtaacgtatgggctaaatagcggggtaagaacc
aggtctaataacgtgatgttgcagggtggcgtagaggtagacgagtt
ttacaccataggaggtctgaaatgtccgtctgggcaatctcatcgag
acttttactgcgtcttcccctaacgtcttagacaccgcagttgggat
tcagcccggccacagcactcaccccgaatggccgcacgcgtcacccc
tccgagtttaacttaggcgcgccagaaatcttgggctcttcttagct
tcggtcggcgatcgagtattggatgcacgtaaagatcgctgtacgga
ctccaattcacttgtgctactccttatagctgatgttcagggcgagg
cggcagcgtcacagcggtcctcaccgactcgattcctactggctcat
ttctcgtgccggccgatcgtgagaaattttctacggccgtatgcaga
// This is the clever part to create five fingers
tctagctagcgcctaacgctaaagcctagcagtatagtaaaccttac
agagacggcgttttacggatagtcgacgggagccgtttctgaggtgg
aacgctcgtgatctgcgcgcattaccaggctaatccatgtacgtaac
aaataccctgagcccctctcacgctggatgatttctcccgagtgtgg
gaactatatggcacgccgcatcgctccgtgagctatctggttgtcca
atatacacgataaccaggattcgcatctgtggagcatggatcggcac
tatgctgggcacggcagatcgattatcccccgcggccagtattgaga
ggcggcggtaacgagttcgggtcagggcacttgttgcacttacctaa
gccactccgcgaaggaaatacggcagtataatagagagacggtcgag
tgctcttataattatttttgaaggacgtcttatcgtacgtaacctcc
ttaggatgtaacgtcggcgcttcttttgaaccaacggaccagtatgg
gccaggtaatatgggcaacggccccaagattctgtagaggccagtag
atgaacataccaactagaggggcgtaacgtgcaacacgttatttgga
// Unknown glucose-generation sequence
agaatcgattcgcgtttggactaatgcccgggcctggtatcaccact
tgtttcactcactaatgcaccaattaataacgtccaggtactccgca
acggggccagtgtagtacgcctgttcctgaaccaacacgtctcttgg
// This is clearly redundant
aaggaccacagtagtttccgttgggtgacttgccccagcatcgacat
cacgccccgtgcagtctgttacttgacatggcaaccgtgttgcatga
attccgcgcctagtcttaaaaagcagatggtgtccgctcatatgaat
agtgccggaacgggagggttgcacacaaggcatctcgtaacgaggga
tatcgtgtttctctgtgatcgttctaatccttccgatcgtccaactt
aatcctgcgctctggaccctcatgaaaggggaagggccatgcagggc
tactctcggaaaaacggactttgtctgatgacggtgcgtcgagtaca
agtcaggctccaaggtggccactaataggccaatgctaggacgctgc
// CTGGGA would have been a better endcap terminator here
attcgagtagtcgtcccgataaagggacgagatgtcccatagctacg
tcgccctggccaggggacgttggcgctgcgtcgcgagcgctttgcac
ttcggaggcactccttaactgaaggccccatgcattacctatgcccc
cggcagtcggtgatggccgcgtgcccgtgggttcggttcctgttgga
ccaggtaccaaagggcacatttcttgaagcgaatggagcgttgctat
attgcacaattgcgtgagctcggtttcttataagtcgtgcgcagcaa
ccacatacttgaatattcgtagaactttacaatttcctactttcgat
agagacgtagtacgtcaatttgggcaccaaaatcagcttgagaaaac
gtgtgttgaccatgtcgtgtacaaccagccggtatatgacaaactgc
ccgctactttcttggtacattcctcacagatcatccagtactaggag
gaaaccctgcccataagaacggcttagacagcctggtaggcggtccc
// Compare to monkey DNA, clearly this is similar
catatccactcgcatcatgcgcagcacattgcccagcaactggaaga
aggtgtgggtcttcgtactacgagaactactgaaagcaggaaggcct
// Patent #41847593 here
taggtattctccacctaaactcatacaaccttggcacgagttcggtt
tcggggagtcgcgacgtgaacgagcgttggtagatcgtcaatcagag
tgtcatttccttataatgtagctcactaggtctacggcgagaggggc
cattagtctccatgtaaggcggcagtgctaatcgtcacttgacaacc
ccccgaacggaaaggaaacgccaaagaaatacagcttagacgcgaca
taggagggttggttatattctgaacaccttctatcgctgggcggaag
cccagccatggccttatcgtccctgtgcccctcaccgtgtggtcacc
agacctaggatgggttttacggtcacaaaccccggttacctccgaca
gatcaatcaccaagtaagcgctgagagtccgggaacatagggttggg
gacttgtctacaggagacacgttaacatgaactggtgcagcaagata
tttgaaaacagaacgatcgtgaacccggattccaccctcctacaatg
ttatgacagaggggcgatagcgtcacccgacaggtttctatagatgt
agcttatatcttggtgcttcttcatatccaagcactccggcagtttg
aattccacttcagcttgctacacttttactgggcgtccatgaagtca
ccttgtgtggtccagatcacgctccagaaatcactgctgttcgattt
tcatacgtaattatggacaatcctcgtgccgacgggtgtacgcgatg
cggtgatcccgatcatatttagtggcatggtccccgaccgatacctc
aaaaaagatgagcggcaacaacacgcacattgccacgctcgatacct
ccgaaaactgagactgagagtacagtcttgaaggccgactgcctcga
taagatcggcaaagctatattattctgctacctctgggaaccttctc
gtacggtgacacgagtccggacttagggatagctaccacggacgggg
attaccgttagcgggctactctagttctattgggagatgccccccag
// Inefficient but clever
ctcgaaacacgtggtccaattgctacacggtcttcgtctgacccagg
cgggcaattggttaaggtgaatcaaacgggtttccgttaaaggctga
agcttccgtcgcgatgctccggcgttggatatcccataccctatgca
cggtcgggtgtccttctctcacaatgagtagcaagatgggggcgtat
tgtttggctaaacaataaactgagacgctcctgaacaacggaggcgt
// Heh!
gagtacacgtgtctgcaaacctggtacacacttcgtcggcatccatg
gattcctttgtcgtattccctagagaaaccaacgagtgtttgtgcgc
atcacggggccattgtttacgtaatcaatgctcactcaccctgatga
tccatataacgaattatccgcaactgttacagagtcgtaacagagtg
taacggctcagtaggtcgtgttctagccgagttgaagtccccggctt
atgaaagcaggtgaataaaattgattttgtcccaaaaatttgctaga
agtttcatttcctagaaattgtagcaatagcttatattgccctatac
ggccctatgtgttttcatctaaatggaaccgtaaggcgatcgttgtc
ccgccttctcagcgggtactaagggagtggcttcattccatgactag
tcaacccgtgtttggagacttctgcgttctctcgctcgacctcgctt
tggtctttgcgcggacattgaatctgtgccaaaaggcttttatgtct
// DNA sequence is questionable here
acgtgttgaagtgtatataagttgcggaaagtgaaactattgatcag
ggttcactagacaattcttttataaaatctaacacccgggagctggt
aaggagctattggagtttcagtgctgtatgtctaagccgtatcgttt
acggagctatatggtatgacccctcccgggggaggtaaatccctaat
aacactcgttggttcgccgcgatcaacccttctttgttctggacgga
atcaccgacaagcacatcaacctcccacccgaaccagagaactccca
ctataaccagtctggtggcaatgtgtcgaaatcgctattcctcctat
acgtctagttggtacccgtaatactaaaagaggatcgtggtagggaa
// A rather elegant protein generation chain
tgttttttattggacaagcgcgggtgccactagaaatagtccgtatc
aactactacacgcagtaaccctgccaacgtacgatactgcccattat
agacctacaggctgataaccacctcggttgcaaagtccgctttgatc
ggggtatcagtacgactagttgcaaacatcacctgggataacatacg
taaaactgaaatcatcgcccctgtcctttgcacctgcttttcgcttg
cgattgtgacgaaatctgctaaactgatggctaccgttgtcgcatga
tggcgaagagtcagcctatgcgttaacataacttcttacgctagcga
caagagcaatggcgtgtgtcgcttagggtcaaaacaattggagctgt
attgtacatattcgatgtttgcaagaaaggtctgccctttgtagttg
gcaacgtcccccctgagttcagcgccgaccggggcggttcccgtaat
// Not known
ggtgccatcggacggcgggctatattgcaggcagtacgacctccgag
// Patent #49491845 here
ggtcgatggatctgcgtacaatttcacgccccgtaaagcagccatcg
aggtcatttgcgctgcctcttagtgttatatttgggtcacctcaggg
// Not a bad choice
ggctcttacctgtccatcccgccgtacggcgtgacgtcttcccctcg
agttttcctaaattacggggttagtaaactgttggccgcataggact
tgcgatcaataccacgatgctacgtggatttacataccctttagata
gtgtgcacggcatagcaaatacttcaactgtaagcggcatagttctg
next week:
* Should the Internet be shut down?
* Should Open Source be illegal?
If I discover a new comet, should any astronomer that wants to look at it through a telescope have to pay me royalties?
It's rediculous. And that's an example of something that doesn't effect human health (Unless the comet is going to smash into earth I guess).
I cannot see how this could be construed as anything other than choosing money over humanity. It's repulsive.
One time I threw a brick at a duck.
Well, I have prior art with my particular set of genes so they can p**s off.
You can read about it here. Hopefully, the outcome would be much different if it were to be tried under the American court system.
They do not Patent DNA. They did not invent DNA.
THey can patent specific genes for a specific purpose.
So if they discover a gene that permits them to do something interesitng, like grow you a third arm... they can patent that.
If they discover a gene that will make you smarter... they can patent that.
They cannot patent genes until they have a use for them.
Patents that attempt to cover general applicability of properties of nature are invalid and the courts that uphold such patents in error.
Seastead this.
Use a spell checker already!
Come and patent my ass!
I'm going to patent light. And while I'm at it the entire electromagnetic spectrum! ::Evil laugh::
Someone ever tries to kill you, you try to kill them right back!
Jesus, what a horrible idea. The US Patent Office's record of granting patents in the IT world shows they have NO grasp of technology, how on earth would they handle something as complex as DNA?
So what happens if you patent DNA and then a human being is produced in violation of that patent? Will this person simply be destroyed? Even if they're a baby or 10 years old, or whatever?
To patent something, it is supposed to be a real discovery, not something anyone with the tools of the trade would find out anyhow.
With gene sequencing machines becoming more and more common, I don't see that DNA sequences can be called real discoveries anymore. (And probably hasn't been the last few years.) Finding DNA sequences is an almost mechanical operation which shouldn't be awarded with patents.
But then again, the patent system has become so fucked these days, who cares? The patent system has to be reinvented, and all the obvious patent squatters must pay for their sins.
Let the biotechs patent actual medicins based on genetic research, not the genes themselves, because that would be stealing.
I always assumed that a patent was intended to cover a new or uniquely contrived object. Were these geneticists to be patenting recombinant DNA, I would be alright. When they begin to patent DNA that they discover, it becomes a travesty of science. Not only do they have no rights to that DNA, but it impedes scientific progress. Of course, most modern geneticists aren't working for the benefit of man. Some work for their own good first and last, Monsanto, while others work for their own good first but hope to benefit civilization in the process. Even academic research is beginning to fall under the latter category. In both examples, progress is stifled by greed and gluttony.
Pax Digitalia
Why would a company that makes billions each year off selling AIDS drugs want to cure it?
When money wins wars, governments can't even turn the cheek to help the public good.
Then we have Microsoft, who works along the same lines as selling drugs for the benefit of the United States.
Patent DNA? Sure, fine whatever, laws are already fubar.
God spoke to me
It shouldn't.
The problem is, some (not all) biotech companies are enforcing their IP like some (not all) software companies do - sue first and ask questions later.
Now, I'm sure I'll get flamed by the Slahdot crowd that thinks everything should be "Open Source", but there are fundamental differences between computer science and genetic science.
---------------
Vpered na Mars!
atc gca tga cta cta ccg tca cat cgc gcg cgc gac gat acg atc gcg cat cga tcg cgt
FP!
eeee-haa!
On and U if we can start patenting RNA.
Then if we got the codon's, I'll patent the amino acids and start/stops.
Hahahha, everyone who wants to use DNA, has to pay me royalties now!
God spoke to me
Knowing my luck, one day my doctor will tell me "I'm sorry, but we just noticed the DNA for your mitochondria is patented. I've been told that the patent holder is filing under the DMCA that you've illegally been copying their intellectual property since conception and you must either cease operations immediately or remove all offending material."
*sigh*
Give patents for all naturally occuring DNA sequences to God. Then assume he allows free, open development on his intellectual property. If this bothers God, he can take people to court.
Some men spend their entire lives trying to kill themselves for having been born. --Ross MacDonald
The space of all-possible-digital-information maps directly onto the space of integers. Asking for a patent on a chunk of digital information (DNA, object code, what have you) is the same as asking for a patent on an integer. The claim that "oh, but it's a very large integer" is specious. Patents are for inventions not facts-of-math.
Copyright is only slightly more reasonable.
-- MarkusQ
An American patent lasts only 17 years, and if you allot a good seven years or so to get the thing out of the lab, then you're looking at a useful lifetime of maybe ten years.
Copyrights, on the other hand, are really scary. Originally they were to last 75 years, but recent lobbying by the Hollywood crowd has resulted in legislation under which it is not clear that copyrights will ever expire. If DNA were copyrighted, then you'd have some real cause for complaint.
I am releasing my DNA under the GPL license.
http://www.kubuntu.org/
How can you patent something that could concievably be created by nature? Let's say that I patent the gene for neon green eyes, and somewhere down the road, some kid in Chicago is born with a mutation that gives him neon green eyes. Is he in violation of the patent? Must his parents pay our company because his body utilizes our patented gene?
--I hate big sigs.
Lets say I get a gene implant by a company that makes me smarter. I pay them however much they want, and go about my way. But then, lets say I have a kid, and that kid inherites the DNA that makes him or her smart, does the company still try to collect? Lets say they do, and I refuse to pay. Its not like they can take the genes back. Or what if I have a couple of bastard kids, how would they even know that they even have the genes?
If you ask me, any step closer to patenting DNA is a step closer to the world of William Gibson with blackmarket medical shops.
--theKiyote
Caveats:
:)
a) I know nothing about genetics or law myself. I learned all this from the genetics law expert I sat next to on a plane last week.
b)The duration of the explanation was part of a flight from Salt Lake to Seattle
c) I had a first class upgrade and took full advantage of the free Heinekens. That is to say, I hope I'm remembering this right.
Goes like this. It's illegal to patent an object, right? But a sequence of DNA in addition to containing the gene you're interested in, is always full of random and irrelevant pairs. So what they want to patent is not the gene as it naturally occurs, with all the junk DNA in it, but a cleaned-up version containing only those bits which are relevant to the patent. This is not a naturally occuring sequence, and so is patentable. So to answer the fellow who says "wait, I have that gene, every cell of me is prior art," no, you don't have that exact gene, yours contains different randomness. Yes, this sounds like a legalistic dodge to me too, and the expert acknowleged the point, but there it is.
A further wrinkle is that they patent the transcriptase necessary to make the cleaned-up gene, not the gene itself, though I had a sufficient buzz by that point in the conversation that I was ready to talk about football.
I am a genetic and legal laymen. So here is a "typical citizen" question: Can you patent scientific discovery?
Examples:
Could Albert Einstein patent the Theory of Relativity?
Could Galileo patent the stars he found?
How, again to a laymen, are these any different than discovering certain DNA sequences?
There is no longer anything that can be done with computers that is nontrivial and clearly legal. -- Paul Phillips
That was funny. Please mod it up.
I think I'll release my origin code under the GPL. That'll fix 'em. At least until my kids can't get paid for working under the derivative works clause.
Current patent lists(in pdf)for
(hu)man
or
mouse
I think at some point, an international summit for "Things that belong to mankind" should be held and agreed upon.
Profit at the expense of public health has always been considered "wrong." But this is generally when it's a company unwilling to keep the air, water or land clean and safe for human habitation. But in cases such as patented AIDS drugs being suppressed when a far greater good could be served?
When mankind cannot 'afford' to be healthy or to survive, there is something very BROKEN in the way we are thinking. I'm not a communist, but get real... should one person DIE simply because he can't afford to live? It's all around us and no one is willing to say I'm wrong about that. But who is willing to actually step up to the plate and actually give to mankind rather than profit from its needs?
I'm gonna put my DNA under the same license as Windows XP! That ought to make sure nobody copies it! I wonder though.. did my parents call M$ to get their copy of me activated? And what if I decide to rigorously upgrade my hardware at some point during my lifetime? Hmm.. what if I'm just a 120-eval. copy??? Scary!
Learn from the mistakes of others. There isn't enough time to make them all yourself.
You came very close to saying what I wanted to post.
I think the issue of patenting DNA is similar to that of software patents, to which I disagree. In fact, DNA *is* our software and the software of all life (as we know it). That little robosome machine that transcribes our software could be viewed as a sort of execution unit.
If someone writes a cool new app in C++, they might want to patent it (or some part of it). These days (at least in the US), they'd stand a good chance of being awarded a patent. Imagine a bio-engineer who "wrote" a cool new app in DNA, say, a cholesterol eating bacterium. Seems to me he's got a similar right to protect his intellectual property, which in my opinion, is none.
Unfortunately, very few genetic discoveries thus far enjoy the certainty-of-use you describe. Most gene patents claim a slight correlation to a certain condition (eg, people born with this gene have a 3% greater chance of developing an ulcer), etc. They are far from providing specific applications. What they represent is the protection of a costly process of discovery (ie, the ability to sequence DNA using expensive equipment) and scientific experimentation (eg, when generations of mice are bred without this gene, how do they act?)
The above process is very expensive, and some would argue that the results arrived at need to be protected, no matter how weak the actual patent claims. As far as I can see, this would be similar to early 20th century atomic researchers "patenting" the heavier elements and their isotopes along with their applications ("this patented Uranium isotope, when struck with a neutron, be made to fission...") Certainly these researchers required enormous resources to detect, isolate, and understand the elements that they were working with. That does not mean that they (or the governments and corporations they worked for) should necessarily enjoy a long-term monopoly on their discoveries simply because they were the first with the right equipment to examine natural processes.
Unfortunatly, in the global drug and medical industires, money talks.
Those who wish to be granted monopolizing patents in order to extract wealth out of the rest of the world, will get what they need, as long as everything is driven by money. (It takes money to make money.)
Ethics? Pfft.
Anyone who considers arithmetical methods of producing random numbers is, of course, in a state of sin.-John von Neumann
They should patent the dna genes, of course.
much like others patented the star formations in the sky to find their way home.
while you're at it, patent warm water too.
Looking for people to chat about multicopters, coding, music. skype: gtsiros
..but halting research in progress due to restrictive "licensing" of a gene is something else. According to the article:
In Philadelphia, for instance, a university stopped testing 700 anxious women a year for a genetic predisposition to breast cancer because its lab was accused of violating a biotechnology company's patents.
IMO, this is complete ignorance. The stoppage of viable, in progress scientific testing by these companies is irresponible and neglectful of the people they are supposedly tring to "help".
I don't see much of a problem in patenting a particular gene sequence, but I don't think companies should be permitted to enforce a patent until a viable cure or product of that sequencing is made available. For instance:
I patent a gene sequence that will, arguably, allow for the 100% early detection and prevention of Down's Syndrome. While modern science may already know the gene sequence involved, work continues to isolate and test, sans patent restrictions. Once a viable procedeure has been validated and accepted, then and only then should patent restrictions be allowed to come into play.
Pros:
-Current research continues without worry or stoppage.
Cons:
The researchers of these projects would receive NO recognition for their work because it would immedeately be scooped up by the patent holder upon release.
But only the inventor could patent something. So, are we saying that only God could patent it? Adam or Eve? And what about the Atheists among us? Some cro-magnon in that case? Were cro-magnons even smart enough?
Food for thought...
--joshuapi
OFFTOPIC??!!@#$ What kind of crack have you moderators been smoking?
Jesus...
Then presumably we want companies to research such techniques. But companies will only research them if they're profitable. If the product of the research is easily reverse-engineered and copied companies won't be motivated to do GE research unless they are protected by patent. So I guess the original question boils down to "Do you want the products of genetic engineering?"
-- SIGFPE
Right, wrong, or morally questionable ... like most others have said, it's too late to do anything about granting these patents.
Some of these discoveries were made by studying defective material from the sick and dying... opportunistic at best. People who donated material for altruistic purposes should form a class action suit against the companies who are engaging in such restrictive contracts. In so doing, they can seek an injunction against these companies, temporarily stopping them from interfering. Any money from the suit can then be rolled into a fund for financial assistance to bring the total cost of screening down to an affordable level.You are not allowed to patent fact, in my small understanding. For example, c^2=a^2+b^2 can not be patented, since it is taken as fact. Another more simple example is you can't patent the fact that we see the sky is blue. In the case of DNA, it too is fact. You can patent the process to finding DNA, but that should be all. Clinton opened the flood gates when he allowed the patenting of DNA. It was like opening up the west to homesteaders. All of a sudden this relm of fact could now be patented, though only a small area of it.
Some conspiracy theorists see this as a move by the US, which holds much of the capability to find DNA combinations, to try and corner the lucrative market of owning this fact. The US holds a lot of power with its patent office and most of the world regards it as the gate keeper as well as fear the Patent Office since the US holds a big stick to protect it's patent system.
The patenting of fact looks much like the DMCA when held up to the light.
they can document the functionality down to the level that computer code is now
The functionality is one that is not previously existing or discovered in nature.
a unique combination of features where the majority of the code is new work. The thought here is that Ford company probably could not patent a new engine unless they owned the patents on the component parts and technologies. But there are an indefinite number of ways to build car engines.
Thus one probably could not patent a fire breathing dragon, but could patent the various implementations of the various subsystems.
patenting huge random chunks of DNA, hoping that something practical will come out of it is not the way to go.
"It is a greater offense to steal men's labor, than their clothes"
Obviously researchers want to profit from their discoveries
Since when did scientists become so profit oriented? When the DNA was discovered it was celebrated by all as the triumph of mankind.. Now most of the genetic engineering research is done in secrecy and everyone seems to have a stake. I think it's time for an ODF (Open DNA Foundation).
if someone patents my dna, I guess I become property of the patent holders...hmmm, sounds like slavery to me. That would suck. Well, unless you're into that sort of thing.
Should DNA be Patentable?
No.
Ok, whats the next ridiculous question...
If a corporation insists it owns me (Via DNA), I will have no choice but to surrender my life by starting a revolution to utterly wipe that corporation off the face of the planet.
:P
:) Which means I can go back to reading Slashdot and not having to worry about hearing a CEO saying, "Only our patented DNA.", and then me having to shoot said CEO in the head, while saying something along the lines of, "Dodge this." (Which is good, because I really do *not* look good in tight leather.. Not with my beer gut.)
;P)..
The only corporation which may even dare to approach owning me is my credit card company - and they are quite limited to owning my credit. They actually (Hard to believe, I know) treat me right and keep lowering my interest rate, so I'm happy with them.
..On the plus side, I have no doubt that any corporation trying to claim ownership of a person would be laughed handily out of courts.
However, there's still the ever fun idea that corporations will sue other corporations for 'curing' certain types of problems. Tell me, how many diseases might be cured by tweaking DNA? How many disorders?
Could this cure sight disorders? Oh, those are non life threatening.. So perhaps, not the best example. How about a person born with an actual life threatening disorder (Say, they were born with their head up their arse or something.
If one profit-mongering corporation wishes to keep the genetic code for head-up-the-ass disorder a secret so they can make money off of it, yet another corporation can already treat it save for fear of lawsuit.. Should not a parent have the right to have their child born without an anal-cranial inversion?
There's been rumors that the cure for the common cold has been floating around for years - only - the owners of Tylenol/Aspirin/NyQuil/etc. don't want it out. Think of the profits they'd lose if the common cold was gone!
Profits be damned. I think it's time to push for legislation regulating the hiding of medical discoveries that could aid mankind. I think it's time to value human life more than dollars (Aids drugs/South America, anyone?)..
And though, right now, it may be the aforementioned NyQuil talking...
*raises hand* They can have my DNA when they pry it from my cold dead fingers!
Comment removed based on user account deletion
How do you put a corporate logo on a chromosome?
You can't paint DNA. You need something that replicates along with the normal process of cell division. Rationally designed junk DNA could perhaps force chromosomes to fold into the shapes of corporate logos. DNA is pretty monochromatic under a microscope, so perhaps junk DNA could bind to little molecule thingies hanging off the double-helix that give color to the logos.
This, gentlemen, is the compelling question of our age, upon which future generations will judge us.
WWJD for a Klondike Bar?
This could have far reaching implications that we may not see. What if I have children? Do I have to pay a licensing fee because they would contain my DNA? What if they have children? Is this a violation of the patent? How far can this go?
Trying is the First Step to Failing --Homer Simpson
So all those poor parents that can't have kids and opt for the invetro will really have more money to pay if a said hospital owns the right to any strand of the DNA. Think about it-the fertilization happens in the said hospital, baby is "grown" for lack a simplicity, and they _OWN_ the baby, for it's whole life.
Maybe I'm think too far out, but it is possible. Remeber IBM thought Bill Gates was a sucker, and Bill Gates thought Open source could never be a threat.
This SIG pulled due to lack of funding. (This damn war is costing too much!)
The biggest problem I see is that the Patent process will undoubtedly end up skewing the discovery process. Companies will change their discovery and research policies to make patentable discoveries, as opposed to objective discoveries. You will also see that that companies that gear their entire research process to patents will have a big club to drive out other methods of discovery. Whenever lawyers are involved the quality of life will deteriorate.
There's a primer on gene patents (PDF file) that I wrote about a year ago. It explains the generally-accepted patent criteria and how genetic material has been interpreted to meet those criteria. The arguments for and against patentability of genes are presented, although the bias is against strict patentability; my personal viewpoint is that applications of genetic information are fair game, but the raw sequence itself should be off-limits.
The law allows for "inventions" to be patented, but you cannot patent a "discovery".
Thus if you find that a particular gene exists in the human body, you have not "invented" anything. One the other hand, if you take a piece of DNA and use it in a particlar process that is not naturally occuring, then you can patent the novel aspects of the process. DNA is just a chemical , and it is protected in exactly the same way as less complex chemicals.
This is exactly the same as patents for chemical reagents. You cannot patent phosphorus, but if you find a novel way to combine it with other elements to make something new, then you can patent that. For example, if you combine it with a piece of DNA that allows you to "mark" the DNA in certain ways, then you can patent that process if nobody has done it before.
If that happens to be the only way to diagnose a human disease, then you can and should reap a big financial reward from your patent.
Now, it very well be that the PTO is granting patents that aren't legally valid. We knew that already and it has nothing to do with the biological arena, it has a lot to do with complete incompetence and a political process that is broken.
Why not just make it so you can't patent anything which occurs naturally?
You patent the proccess by which you can synthesize it, sure, but how the hell are you supposed to patent something which occurs naturally anyway? Isnt it not 'non obvious' if it's already there?
This would be like some archeologist finding a scroll detailing how an obolisk could be raised by a single person and patenting the method: He did not come up with it, he should not get the patent
-- 'The' Lord and Master Bitman On High, Master Of All
Why shouldn't DNA be patentable? It's merely a chemical compund, an arrangement of base pairs in a double helix structure.
From a fundamental viewpoint it's no different from a chain based caprolactam built by a ring opening polymerization, or vinyl addition polymerization.
If you give DNA some special status as not being patentable, while ANY other chemical compound is, what is next? Do we deny patents to all biologically active molecules? All organic molecules????
It's not like these patents are causing any great distortion of our daily lives, AND the fact is that patents have a quite short lifetime in the grand scheme of things. Already many of the original biotech patents are expiring. My guess is that the time needed to develop and commercialize a DNA based product will average longer than a patent lifetime anyway.
20 years from now the debate over DNA patenting will be laughed at as pure silliness.
The whole idea of patenting anything should be re-thought from the ground up. It was designed before DNA, code, and the internet and is long out of date. You can't expect a civilisation to grow, if their own laws prohibit it and give ownership of technology to single individuals. Its one thing for a company to sue another for copying an idea for profit, but when you start leveraging royalties from people for breathing because you have a patent on "oxygen hemoglobin transfer" you have issues.
This comment does not represent the views or opinions of the user.
I am a genetic researcher at the Oklahoma Medical Research Foundation. Anybody there reading this will know who I am.[1]
</background>
I'd just like to make it clear, that if the project I've worked so hard on ends up patenting any one of our gene discoveries, I'll be submitting my letter of resignation within a day.
You and I both know if I left, the study would be in serious trouble.
I hope there's a serious debate, if not outright ban on such activities as banning naturally occurring DNA, RNA, mDNA, amino acid, or other sequences.[2] In any case, I'm another chip you can through on the cons side of the scale.
---------
[1] It wouldn't take long to note my style of footnotes in emails and
[2] I don't care if you clean it up for the patent office and remove the introns, etc. It's the same damn thing.
35 USCS 101 governing issuance of patents does not embrace every discovery, nor is it without limit, laws of nature, physical phenomena and abstract ideas are not patentable; discoveries that are manifestations of nature free to all men and reserved exclusively to none are not patentable. Diamond v Chakrabarty (1980) [101, n 38]
Most of the patents are for use of DNA sequences in diagnotics assays. A general assay procedure itself might be patentable, but I'd think the hybridization of DNA or it's related biological functions would be considered manifestations of nature.
If a company invents a treatment they should patent that.
Someone needs to take these greedheads to court.
Sue first and ask questions later? That leads to the impasse defined in the third couplet of my 1992 poem:
N A. html
http://www.magicdragon.com/EmeraldCity/Poetry/D
THE TWILIGHT OF GENETIC ENGINEERING
by
JONATHAN VOS POST
Jungle-floor bacteria devour helicopters after war;
ripped human corpses thaw, screaming, in battle zone
Smog-sucking moss evolves to grow on auto bumpers;
gas-tank tapeworm writhes: blind premium dreams
Heavy weaponry of corporate wars, intractable
ultimatum when lawyers subpoena their own DNA
Cockroaches skitter: dust of broken televisions;
lay phosphorescent eggs between commercials
Reunification pressures force abandonment of immortality;
death substitutes for taxes: final cost of doing business
Skinned headless lizard throbs, shoved into your chest:
replicant replaces your broken-once-too-often heart
Time & nucleotide
wait for no man
2300-2320
15 Sep 1992
Patenting genes seems to be common business practice in agriculture. Patented rice and grain seeds with special properties (like resistance to a specific herbicide) are sold all over the world already to Farmers more or less licensing the stuff. There are some problems with this aproach:
How can we be sure that the patented genes really came out of some laboratory, and were not found in some countries where people already knew about the specific properties of the stuff (maybe because they cultivated it over thousands of years). Some corporations are accused of doing just that with rice varieteys in 3rd world countries (where the farmers probably couldn't even pay the flight to USA, when dragged before a court there). We haven't even begun to catalog all species on earth, let alone their genetic diversifications, but maybe there should be a puplicly accessible database of genetic material from particularly successful or common crop sorts all over the world that are not yet patented, to be able to prove prior art.
Another problem is, that unlike music, films, books, software and whatnot life has it's own builtin copy-mechanism, in fact, once it's out it's sometimes hard to stop it from replicating or crossing borders. I remember a case, where a Farmer had to pay license fees, because grain from seeds his neighbour (who had planted patented stuff) blew on his fields and grew there. How could that man have prevented that, short of burning down his own corn? We already know to what ends the rights holders struggle for getting each and every use of IP paid led us in the case of copyrights. What will we see now? Genes with builtin DRM schemes (like if you don't spray your crop with a specific shortlived virus it won't survive the next month)?
--
"By the way if anyone here is in advertising or marketing... kill yourself." -- Bill Hicks
... are the people who hold the patent going to pay me royalties? Probably not.
Is ANAL COX planning to patent his COCK?
STOP ME BEFORE I POST AGAIN!
Maybe in order to understand mankind, we have to look at the word itself: "Mankind". Basically, it's made up of two separate words - "mank" and "ind". What do these words mean? It's a mystery, and that's why so is mankind.
-Jack Handey
But on a serious note it is the abuse of patents for pharmaceuticals that is putting a excessive burden on our medical system. The cost of patented drug to hospitals is taking a larger percent of Medicare funds and that accounts for only a small percentage of drugs sales, persciptions have to be covered by the individual and their drug insurance if they have any. Pharmaceutical companies are the most profitable companies in the world, but the industry is controled by a few different companies. There are companies other than MS that have dangerous control over our lives, but if one is healthy they don't think about this issure. Now that putting patents on DNA and medical procedures become more popular we have to ask our selves is our social health important to us or just economic health.
This sort of research should be publicly funded and controled. If these companies want all the profits coming from a monopoly on certain drugs or dna than they should pay full price for education and research information and funding that they have recieved directly or indirectly through our universities and gov fund research organizations.
Fact: If it wasn't for companies, many things about genes that we know today, we wouldn't know. We'd learn them sooner or later, but it'd take a while longer.
Let's assume companies working on genes help us advance genetic research twice as fast. So, after 25 years of research, we've done 50 years-worth of publicly-funded research.
In 25 years, when current patents expire, we'll be exactly where we'd be in terms of publicly available knowledge (at a smaller cost to the public), but we'll have pushed science by an extra 50 years of knowledge (which will be still patented). 25 years later, we'll be 50 years ahead in publicly avaialble knowledge compared to where we'd be, if companies couldn't hold patents and wouldn't invest in genetic research.
I'm against patents on genetic research, but if you really think about it, maybe breast cancer tests wouldn't be available today if companies didn't spend on genetic research, so we're not really losing anything...
It is very cold of them to withhold some much-needed research from the public, though.
m
I vote for open source! Genetic code should be GPL'ed!
If not M$ will soon have an effective monopoly here too.
I can see why patents should be granted on tests for paticular genetic problems but now why sequences of genes themselves are patentable as they weren't invented by the person that transcribed the sequence. The reasoning the corporations have for patenting the DNA itself is that they can prevent others testing for that gene at all - therefore preventing alternative inventions that have the same benefit.
Every person, by the very definition of 'ownership', owns his own DNA and the rights to use it. The Declaration of Independence reaffirms this, as all men and women have a right to life, liberty, and pursuit of happiness: DNA is a matter of life.
Furthermore, the US constitution prohibits slavery as well: creating people for the purpose of using them in some capacity without their consent is the very definition of Generational Slavery.
Not that all this matters. The biotech industry will buy the republican party just as Enron and the rest of big oil has, and change such laws to allow them whatever experimental rights they want.
Here is a link to the US Patent Office Guidelines on Determining Utilitity, especially for gene patents.
Note that the 'responses to public comments' are more interesting than the guidelines themselves. But in short, they are supposed to have a specific, known utility before allowing a gene sequence to be patented.
Guidelines
It starts halfway in the first page. (pdf)
NO, NO, NO, NO If DNA becomes patentable then the patent for my DNA should default to me and anyone who wants to use it should have to buy from me. But this discussion shouldn't even be a fucking topic of discussion, talk about violating human rights at the lowest level you can get. Anyone tries to patent anything I was born with and collect they better have a fucking army at their disposal. AND I REPEAT NOOOOOOOOOOOOOOOOOOOOOO
Pre-existing DNA sequences are not like software. Software is an algorithm developed to perform a specific function or to solve a problem. DNA is more like a computer language. Even then, the computer language was developed by someone or a group of people, unlike DNA which existed before people discovered it. Software is more like a process for producing something. However though it processes data, or produces information, it is not likely to produce anything physical. Software is an intellectual or artistic work and can be protected by copyrights. The Technology/process used to produce or develop software may be patented. You can patent a Process or Invention, not discoveries.
... as things I discovered, just like the research labs, doctors, and lawyers are doing when they discover gene combinations. Even though this is obviously wrong, it is being done because of an interpretation of a ruling that allows scientists, reseach labs, laweres, or just about anyone, to patent viruses and bateria that they create to do specific things such as using bacteria to produce insulin, or using a modified virus for injecting an immune system into infants born without one. The patent office concluded that the only way to protect the bacteria and viruses that they had been created was to patent the DNA, and I agree to some extent; however, we are talking about patenting the invention which happens to be the DNA sequence that was probably discovered for the immune system, and was combined with an existing DNA sequence--in my example, the basic virus or bacteria.
If they were to follow the patenting of discoveries to its logical conclusion, then I could patent air, the sun, stars, the moon, gravity,
As far as intellectual property goes, there are a plethora of things that fall under common knowledge, such as "for loops" or sorting routines, that can't be copyrighted.
Finally there is the idea that somethings will do or currently does the world so much good that it can't be copyrighted with the intent of making money, or impeding its use. This would include "air-bags", and vaccines for such things as polio. We see this in the software field with "Open Source" or "Copy Lefted" copyrights.
Patents are for thing that may contain DNA, or for DNA sequences which are original works. The problem with "original works", is of course proving it, thus giving more weight to the argument of excluding DNA from Copyrighting/Patenting.
Since when did scientists get to patent their discoveries in relation to genetic research on the human genome? I thought this was a global research project in order to understand our own genome and better the life of humankind, not some crock where scientists are going to make money at the expense of other people's happiness! So these scientists are going to attempt to charge for tests on DNA screenings, if not already? Well, it definately appears they're more concerned about personal profit and recognition than putting the discovery to some applicable use, in which it was originally being researched on in the first place. They're given grant money to do this type of research, why should they need to profit on the discovery? GRRRRRRR! I hate it when scientists attempt to do this. Research in the medical field that is AIMED towards the entire human race, should be AVAILABLE to the entire human race; not patented, copyrighted, and sealed away from everyone who can't afford it, or in places where it's in demand too much. It's disgusting to see where this society is driving itself sometimes...
The research cost to pharmaceutical companies is often cited as justification for their subsequent profiteering. It's worth noting that these companies spend twice as much on advertising as they do on research.
Maybe I can patent my fingerprints.. That way no one can use it and I would be able to take legal action against anyone who tried to identify my fingerprints at the scene of a crime..
some enterprising group in taiwan will set up a web site to download any sequence you like - for only a dollar!
Well it could be worse.
If DNA is thought of as the combinations of the four possible letters, ATCG, representing the nucleotide bases with the names adenine (A), thymine (T), cytosine (C) and guanine (G), then it would seem reasonable that you could cover gene sequences with copyright. In the Copyright Claimed on Telephone Tones story , someone did just that for all possable phone numbers.
To get a copyright the bar is much lower; my father-in-law gets royalties on songs copied from the dictionary and laundry tickets. http://www.stuie.net/lfrecord.html At least patents run out in a reasonable length of time , as opposed to copyright which seems to keep getting extended such that anything copyrighted after Mickey Mouse will never go into the public domain.
Almost all DNA tests use completely standard and widely known technology. Furthermore, the genetic sequence associated with a disease is a simple fact of nature. Patenting genetic tests is therefore not much different from if we were to allow patenting diagnosis of a disease, say, from the visual appearance of a rash that's examined with a magnifying glass or Wood's light. The argument that DNA tests take time and money to develop doesn't hold much either: reliable diagnosis from any kind of symptom requires extensive experience and, ultimately, scientific studies.
If you can patent DNA, too bad a wealthy philanthropist couldn't step in and get as many DNA sequences patented as possible AND release them under some GPLish Copyleft type scheme. I Could live with a future where all genetic enhancement were in the public domain. Just a thought. . .
Copyright??!! just by living i believe im copying so much of their DNA every second. It would be horrible to be born with a $500 copyright infringement fee on top of your head. viral RNA on the other hand... i dont see why they cant patent that... see how much cash they can twist out of virii and the like. So they want to patent something they didnt invent... certainly a turn up for the books... rivalling the patenting of the word millennium. Individual patenting of genes may be acceptable if they are used in non-human context - i.e. fatter pigs and whatnot. Hey ma... i invented a new end restrictase! "sorry dear, but theyve patented Guanine... does it have any of that in there?" Only a 1/4 of it or so... Stay away from free software... unless you know of a way to get back your free time.
0xC3
When I spray my DNA over her, I can claim its my IP and then she'll have to pay me for it.
To think I used to beg her for a BJ, and now she has to pay ME for it!
Do we live in a great country or what?
Notwithstanding the fact that your point was funny, you give a great example of why it's dangerous and unfortunate that we apply the vocabulary of physical property to the concept of "intellectual property".
it is intellectual property that's been unclaimed
...as if intellectual property is part of a landscape you want to stake your claim to, instead of being part of the creative process. Sigh. If only we could discuss it differently, as a means instead of an end, or a journey more than a destination.
We understand your point but your belief that is OK to patent a gene, is wrong. Basic Definition of the word gene as taken from Dictionary.com A hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and determines a particular characteristic in an organism. Genes undergo mutation when their DNA sequence changes. More detailed info from ...
The Columbia Encyclopedia, Sixth Edition. 2001.
gene
the structural unit of inheritance in living organisms. A gene is, in essence, a segment of DNA that has a particular purpose, i.e., that codes for (contains the chemical information necessary for the creation of) a specific enzyme or other protein. The strands of DNA on which the genes occur are organized into chromosomes . The nucleus of each eukaryotic (nucleated) cell has a complete set of chromosomes and therefore a complete set of genes. Each gene provides a blueprint for the synthesis (via RNA) of enzymes and other proteins and specifies when these substances are to be made (see nucleic acid ). Genes govern both the structure and metabolic functions of the cells, and thus of the entire organism and, when located in reproductive cells, they pass their information to the next generation. 1
Chemically, each gene consists of a specific sequence of DNA building blocks called nucleotides. Each nucleotide is composed of three subunits: a nitrogen-containing compound, a sugar, and phosphoric acid. Geometrically, the gene is a double helix formed by the nucleotides. Gene loci are often interspersed with segments of DNA that do not code for proteins; these segments are termed "junk DNA." When junk DNA occurs within a gene, the coding portions are called exons and the noncoding (junk) portions are called introns. Junk DNA makes up 97% of the DNA in the human genome, and, despite its name, is necessary for the proper functioning of the genes. 2
Each chromosome of each species has a definite number and arrangement of genes. Alteration of the number or arrangement of the genes can result in mutation. When the mutation occurs in the germ cells (egg or sperm), the change can be transmitted to the next generation. Mutations that affect somatic cells can result in certain cancers. 3
The scientific study of inheritance is genetics . The genetic makeup of an organism with reference to its set of genetic traits is called its genotype. The interaction of the environment and the genotype produces the observable attributes of the organism, or its phenotype. The sum total of the genes contained in an organism's full set of chromosomes is termed the genome. Scientists are working toward identifying the location and function of each gene in the human genome (see Human Genome Project). The decoding of the first free-living organism (a bacterium, Hemophilus influenza) was completed in 1995 by J. Craig Venter and Hamilton Smith. 4
See also gene therapy; genetic engineering.
You can patent a method of manipulating or turning off/on genes. You can even patent the new technology or processes that you developed to discover the gene, but as previously stated, scientist, reseachers, ...etc, can discover a particular gene, but it is not an original process or something original that they created or developed. Now, pehaps if they created a completely new gene or sequence of DNA, and could prove it, they might have something, but it would probably fall under copyrights, not patents.
The whole idea of introducing patents into an area that brings so many benifits to all is wrong. Also, advancement in this field of study relies on the sharing of information. Many of the private companies which are patenting genes have used the publicly developed and shared information, including techniques, to attain their gene discoveries.
Also some things that are invented are too important to mankind to put a price on, though I do believe in giving credit where credit is due.
Check out the stories at CBS NEWS. Search for DNA Patent
If you grant patents for discoveries relating to the function, interaction etc. of DNA then why not allow patents on "newly discovered" objects in the universe, say a solar system, and not allow anyone else to look at it or fly their XWing fighter through it?
DNA has "always been there." Patenting an understanding of its functions makes just as much sense as what i've just mentioned. That solar system has always "been there" but Hubble finally got a day that wasn't too cloudy and grabbed a nice snap shot.
Is science to be driven solely by greed and the desire to make money, not the desire to, for example, discover information which will result in health improvements, and, not the least, science for its own sake?
Not much of a world to live in.
I know this isn't the same issue, but almost all maps are copyrighted... there are probably hundreds of maps of the US that are all uniquely copyrighted. There are several local map book companies that publish map books that are the same size.
there are several things to note here.
the quid-quo-pro of the patent system is disclosure for _limited time_ monopoly. by offering patents, we incentive people to discover and reveal literally life-saving things about them in exchange for being able to solely exploit this knowledge for 20 years. 20 years later, anyone can exploit the knowledge.
it is unfortunate if strict licensing agreements prohibit some people from affording detection of breast cancer, but this must be balanced against the alternative that without the promise of patent protection, the knowledge underlying the screen might still be unknown.
prior art of the form "my cell contains this" is not relevant here. the patents most people are shooting are "composition of matter" patents, which are relevant to natural products that are purified or isolated from their natural state. in other words, public policy recognizes that finding a needle in a natural haystack and understanding the functional importance of the needle constitutes a genuine advance in the state of human knowledge. otherwise many things (industrial chemicals, drugs, etc.) which can be found in nature _if you know where to look_, would not be patentable.
finally, many of the early patents on genes were actually patents on cDNA, which is an image of the gene as cleaned up by the cell (think of it as an executable that has had strip run on it). these patents are neither considered very strong or very valuable, and companies (e.g. incyte) that pursued a patent heavy strategy are now struggling to find the value and are invariably moving towards more interesting achievements (aka advancing up the drug development chain). to some degree, the patent system is GIGO.
are there some harms associated with granting patent monopolies? yes. are there goods associated with granting patent monopolies? yes. the patent is a compromise.
Yeah, but you sure don't want to know what you need to do to get the source code...
Xix.
"Everything is adjustable, provided you have the right tools"
Comment removed based on user account deletion
Comment removed based on user account deletion
see subject
DO I collect a royalty fee or get stuck with a licence charge for every day I live?
T Money
World Domination with a plastic spoon since 1984
Comment removed based on user account deletion
What if someone put a patent on the cold virus, could I sue if I got the virus?
;-}
I didn't ask for it, they gave it to me without my permission!!
I feel so violated!
My damages and emotional distress are so severe, that I need AT LEAST $5 Billion to feel safe again.
Yup, set for lifetime and then some.
Where ever you go, There you are
What does DNA have to do with it? If someone finds a new sequence (the information) that does something cool, why shouldn't they be able to patent it? On the other hand, they have quite a lot of prior art to contend with. So if they can come up with a truely unique arrangement of DNA, they should have the rights. However, this excludes patenting sequences present in a living being that they merely 'discovered'.
http://www.masturbateforpeace.com/
DNA should be patentable, it should say you own it right on your birth certificate
Cogito Eggo Sum, I think therefore I'm a waffle
If someone gets a patent on genes, I want the patent on Oak Trees and Duckbill Platypuses, because I can look at thier genes and remove any irrelevant pairs, and say that the sequence does not occur in nature. Of course, I wouldn't do this because I feel it it just plain wrong to try to patent a fundamental piece of nature. But someone thinks otherwise...
--- At my sig, unleash hell.
I remember reading somewhere that there were issues with people trying to patent elements on the periodic table years ago. They were, of course, denied under the reasoning that elements belong to everyone. If we can say that about elements, then surely we can say that DNA belongs to everyone as well.
This is definitely the crux of the issue, but I think it's slightly more complicated. Imagine that the patent system had been invented before the discovery of the lever (ok, just for the sake of argument). Should a person be able to patent the lever? Did they discover the lever, or invent it?
Given the laws of physics, there is the potential for the existence of a lever, and lever-like objects can exist even if human hands did not make them. Therefore, it might be argued that the lever was discovered, not invented.
On the other hand, you can also argue physically that levers in general cannot exist without intelligent design. In order to really be a "lever," an object must not only have lever-like characteristics, but there must also be a source of input force, and an object to which the output force is transferred. Thermodynamically, this combination is highly unlikely, and you might argue that a lever-like object is not a lever unless an intelligent being uses it as such. Therefore, the lever was invented, not discovered.
Now, look at DNA. You can claim that since DNA existed before humans, it cannot be patented since it was not discovered. But you can also argue that, pre-humanity, DNA had no actual "purpose," since only humans create "purpose" and lower forms of life do not (this is a controversial statement). Therefore, by finding new "purposes" for DNA, such as the curing of diseases and other non-natural uses, we are "inventing," in a way. Therefore perhaps DNA can be patentable.
To boil it down to an archetypal example: suppose a team of scientists discover a gene in a rare species of dung beetle that can be spliced into human DNA to give increased resitance to ultraviolet radiation. Should the team of scientists be able to patent this use of the gene? Note that this is a patent for a specific "use" of the gene, not the gene itself.
I think that if a team of people has put in the effort, time, and frustration to discover something like that, they should be allowed to benefit from their research. As long as DNA patents are patents on "uses" and not the genes themselves, it doesn't bother me much.
DNA patenting ensures that if i invest money in finding a relation between an illness and a certain strand of DNA (which is quit difficult), i'm entitled to earn some money from it. If you want those discoveries to be available in the open domain, then provide universities etc with more money.
We'd better get all IP on our own DNA quick.
And you better not get any DNA treatments without checking the fine print.
Coz if you ever have kids, some corporation may sue you for unauthorised reproduction of their "intellectual property".
There shouldn't be such a thing as intellectual property. Because if you try to scale, it can end up this way:
"I own this thought, so you can't think of it without my permission".
Because in a possible future, thoughts, brains, machines, computers could be intertwined.
That said, lying is still wrong: e.g. saying "I thought of this first" when you didn't. This rule scales.
Lately, I've been asking myself, why does everyone expect the software industry to give everything away for free and open source all the time and other industries rarely if ever do? Has there ever been pharmaceuticals released open source or something similar? I know you can't really hack out new drugs when you come home from work like you could with code, but still, some companies in the software world find ways to release their work as public domain, so why can't the pharmaceutical industry? I can't help thinking that us developers are simply suckers. We give away for free what most other sane people would make money from. Are software developers merely like employees in the Ferrengi Rules of Aquisition? "Employees are merely rungs on the ladder of success, never hesitate to step on them to get ahead"
Economics knows the answer as it is a very simple on: harvest the demand curve.
Translated:
Bill Gates has cancer? pay the FULL price (production+reseach coverage) if you want to live. Maria Teresa de Calcuta has cancer? Pay the cost of production only. Giving her the drug at production cost doesn't make Bill Gates or the company worst than if she it left to die.
Profit lost: $0
Oh, wait! Maybe it does... how about the goverment pay for her life? Cool, now everyone pays royalties (taxes anyone?).
Result: everyone in a poor country MUST die. US goverment health care costs are prohibiting.
What is the problem with the solution?
Being able to survive while others poor bastards die of that same thing is important so that the affording guys agree on paying the normal price. Else, they would rant and try to avoid paying or will try to prove they can't afford it and things like that. After all, the American Dream is about the comunism of prices.
Anyway, the USA labs are stating to realize this makes sense. Some (very few) vacines are being sold in Africa at production cost while they are charged full price in the USA. Why? Not because it makes sense, but because (for example) South Africa stated they will copy/pirate any patent their poors can't afford.
Note: i am NOT a communist, read the post again if you think so.
unfinished: (adj.)
Or the editor (board owner) holds the copyrights, in which case he may do whatever he wants with the contributions, but he is also responsible for any laws that may get violated.
Shouldn't it be the same in biotech: if a company is stoopid enough to patent the genetic sequence of AIDS, shouldn't it be then forced to also accept legal responsibility for AIDS. I.e. face "wrongful death" lawsuits from each and every victim of AIDS. And if the company maliciously withheld treatment, or sold that treatment too expensively, add blackmail and murder to the list of accusations...
Say no to software patents.
Correct me if I'm wrong, but one can patent only one's intellectual property. If somebody discoveres a gene, that doesn't mean he invented it. If he makes a synthetic gene, it's OK to patent it, but it probably will be useless. We, humans, have all genes that defines us as being humans, adding some synthetic genes most likely will turn us in something... weird...
If people were allowed to hold IP rights on their genes, would I have to pay licensing fees to my parents?