Slashdot Mirror


Should DNA be Patentable?

nexex writes: "This story seems brings the patent debate home; specifically, should a company or person be able to 'own' your DNA? Obviously researchers want to profit from their discoveries, thus funding new research. But critics counter they are profitting at the expense of our health, citing restrive screening licenses for things such as breast cancer and Alzheimer's. Citing a figure from a UK activist group, 500,000 gene or gene sequence patents have been applied for worldwide. Another excellent article on this issue from Salon.com was from a couple years ago."

257 comments

  1. too late by dal3 · · Score: 3, Insightful

    If someone tries to patent my DNA, shouldn't I be able to provide them with lock of hair as an example of prior art?

    1. Re:too late by buzban · · Score: 1

      indeed...this may be a very good summary of the way U.S. patent law works in reality. Prior use. ;)

    2. Re:too late by Anonymous Coward · · Score: 0

      If not, I hereby patent the genomes of all our congresscritters & anything else remotely simian (or even human :)

      Then, when they decide to grant patents, I will be able to charge usage fees :) Or should that be "extort"? Oh well, close enough...

  2. Hmm... by Anonymous Coward · · Score: 0

    Well, I don't want people to clone me, so I'd patent myself :)

  3. Too late? by Anonymous Coward · · Score: 0

    I am guessing that it is too late to stop this. Given the incredible number of DNA patents already granted, it will be nearly impossible to turn back the clock. The article does talk about patents of a different scope, but the cat is out of the bag. Corporations will drive and drive ahead to make this happens because it means money. Now, should you own your own DNA? Sure. And your vagina and penis too!

    1. Re:Too late? by www.sorehands.com · · Score: 1
      Though a patent is granted, it may not be enforcable. Laws could rule certain patents unenforcable. Even if you have a patent, it only is tested in court -- the PTO is not the final arbiter.


      I patented sex, so you you don't pay you aren't screwed.

  4. NO! by koekepeer · · Score: 2, Insightful

    DNA should not be patentable. It would be morally wrong, since the discovery of a gene is exactly that: nothing new and unique has been created, it's just finding something that was there already.

    Patents should protect new ideas, not entities that are already present in nature and are waiting to be found.

    However, when you can put a piece of DNA to use in any way, the methodology your technique follows should be patentable. A new method for application of a certain DNA sequence is something that can be new and innovative.

    1. Re:NO! by Anonymous Coward · · Score: 0

      Who owns the patent for water?

    2. Re:NO! by Anonymous Coward · · Score: 0

      You can't protect a bare idea under current federal law. Instead you must protect a concrete manifestation, a document -copywrite- or tangiable thing -patent. In some states (California), statutes have been promulgated to protect novel ideas, which is probably the way the things go.

      In response to the this oversight, people who have invested their labor into something like deciphering the genome must protect their work through stringing off current law.

      Really all patenting a gene sequence is is the protection of the idea that this paticular code means something specific.

      Interestingly the focus on protecting the manifest object rather than the intangiable idea favors industries. What is the political effect of protecting not the idea that makes a movie novel and interesting, but the actual product?

    3. Re:NO! by koekepeer · · Score: 1

      Please note:

      A sequence is *not* the same as an idea about what the application of such a sequence could be.

      The difference between the two is hard work and (hopefully) innovative ideas. For example: a gene can have multiple functions in an organism. These functions could be related, but not neccesarily. When one could patent a gene, this would mean that one would patent all possible future applications of such a gene, including those unforseen at the moment one function of the gene was discovered. When one would patent a possible application of a gene, other means of making money from the DNA sequence would be possible, and wouldn't be locked out by some big pharmaceutical companies who "bought" the gene.

      Lots of more small fish for everyone all of the sudden, which is something big companies will always try to prevent from happening.

      My personal idea about this is that patented genes should never be allowed and all genetic information should be in the public domain. Free flow of information will always be more productive than locking up information for years, waiting for it to become slightly usefull. But it seems that things don't work this way... unfortunately.

      Regarding the 2nd part of your comment (protecting ideas vs.objects), I'll repeat myself:

      McDonalds, Pepsi, Nike, etc rule the world already. Political effects are generated by big comapnies that know how to lobby and very effectively expand their influence by indeed focussing on "protecting the manifest object rather than the intangiable idea".

      Wake up and don't let this happen to genetic research, if you're at al worried about the influence genetics will have on your everyday life.

    4. Re:NO! by nerdlyone · · Score: 1
      Everything you say is correct, and the current state of the law. You can't just patent a DNA sequence, so that anyone who has that sequence owes you money. That is what everyone rants against, and it isn't happening that way. You are also right that since a gene exists in nature, you can't patent the gene for that reason.

      And finally you are exactly right that methodologies for identifying and isolating DNA are patentable, and are the subject of what is typically called a "gene patent."

    5. Re:NO! by nerdlyone · · Score: 1
      You can't protect a bare idea under current federal law. Instead you must protect a concrete manifestation, a document -copywrite- or tangiable thing -patent. In some states (California), statutes have been promulgated to protect novel ideas, which is probably the way the things go.

      You are incorrect on this I believe. An idea can be patented, and an actual reduction to practice (i.e., making the thing) is NOT necessary for the granting of a patent. Ideas are PRECISELY what are protected by patent law.

      Really all patenting a gene sequence is is the protection of the idea that this paticular code means something specific.

      That is not at all what it means. The effect or eventual expression of a gene has nothing to do with the patent. The patents are invariably on isolation and identification techniques, or fabricating the necessary chemicals to manipulate or study a gene. Granted, these patents effectively exclude others from accesing a gene if the patented techniques of studying the gene are the only known ones. But the technique would not exist anyway had it not been for the inventor/patent holder in the first place.

      Eliminate patent ownership and you poison biotech research. It would be great if industry ran on altruism but that is not the case.

  5. Patent AIDS, Herpes, Malaria... by Calle+Ballz · · Score: 4, Funny

    Put a patent and a copyright on the strands that make up diseases like AIDS, Herpes, Malaria & the common cold. I'm tired of catching a cold, and I sure as hell don't want to get any terminal diseases in the near future. If you think about it, DNA is really a kind of software, it is intellectual property that's been unclaimed. Well dammit someone should claim that IP and protect it's right to not be copied unless specifically authorized by the rightful owner and in compliance with the DMCA!

    1. Re:Patent AIDS, Herpes, Malaria... by hrics · · Score: 1

      would that mean if i contracted Malaria i would then be in violation of copyright?

    2. Re:Patent AIDS, Herpes, Malaria... by Calle+Ballz · · Score: 2

      No, the person or entity that allowed you to contract the disease (i.e. The person, elephant poop, tse tse fly...) would be held liable for violation of copyright and patent infringement. Your rights would be protected as that particular strain of DNA© was illegally copied onto your platform (body).

    3. Re:Patent AIDS, Herpes, Malaria... by Anonymous Coward · · Score: 0

      Actually this is quite common. There are a ton of patents issued for gene sequences derived from diseases...most issued because the products of the gene sequences elicit an immune response of some kind. If [insert big pharma here] were to discover a vaccine or therapeutic that targets the patented gene sequence, the owner of the patent would stand to profit handsomely.

      Patenting of genes should only be allowed when the patent demonstrates a workable knowledge of gene function and explicit, limited claims as to the gene's application. Saying that I patent the sequence AGGTC..TCT because it might be important is too vague to be meaningful...and I have a feeling that many of the proteomics firms out there feel that the US Patent Office might feel the same way in a year or two.

    4. Re:Patent AIDS, Herpes, Malaria... by Anonymous Coward · · Score: 0

      >>DNA is really a kind of software
      In that case, shouldn't God be the holder of
      the copyright?

    5. Re:Patent AIDS, Herpes, Malaria... by BlueUnderwear · · Score: 2

      No, you could sue the copyright owner because their property (the Malaria virus) damaged your body.

      --
      Say no to software patents.
    6. Re:Patent AIDS, Herpes, Malaria... by wondercat2 · · Score: 1

      Malaria Virus? I think not, malaria is caused by an organism more resembling an amoeba. I cannot be sure, but I think it's called a plasmodium. This particular organism lives in your bloodstream, and lunches on your red blood cells.

  6. Alan Thick (DNA expert) DEAD. by Alan_Thicke · · Score: -1
    I just heard the sad news on CBC radio. Comedy actor/writer Alan Thicke was found dead in his home this morning. Even if you never watched his work, you can appreciate what he did for 80's television. Truly a Canadian icon.
    He will be missed :(



    Show me That Smile (The Growing Pains Theme Song):

    Show me that smile again.
    Ooh show me that smile.
    Don't waste another minute on your crying.
    We're nowhere near the end.
    We're nowhere near.
    The best is ready to begin.

    As long as we got each other
    We got the world
    Sitting right in our hands.
    Baby rain or shine;
    All the time.
    We got each other
    Sharing the laughter and love.

    --
    Alan Thicke's Journal
    My Slashdot ads say "
  7. They can patent my DNA... by NecroPuppy · · Score: 1

    When they take it from my cold, dead body!

    Oh, wait....

    --
    I like you, Stuart. You're not like everyone else, here, at Slashdot.
  8. first post loving? No? yes? by Anonymous Coward · · Score: -1, Troll

    FIRST POST? OR WHAT? WEENT

  9. Depends on patent length by Kjella · · Score: 2, Insightful

    I do realize medical research is a huge money sink, but depending on the disease, if you get the right patents you can get a limited monopoly in a marked where there are *no* substitute treatment, and that people can't do without (aka they would die). Those together let you set whatever price you want on your drugs/services, and people will just have to pay. Or, your medical insurance would but it'd still be passed on to us as increased premiums. On the other hand, if there's not enough money to find the cure in the first place the entire thing is pretty moot.

    Kjella

    --
    Live today, because you never know what tomorrow brings
    1. Re:Depends on patent length by Znork · · Score: 2

      If and when we get to the point that more people die due to patent issues than would die from lack of publicly developed treatments, then it's time to just junk the idea of a privately held medical research sector. It's not as if it's impossible to do the research on public funding, and then you can even deduct those costs from public health insurance and other society costs.

      The medical industry should be allowed to make money, but not at the cost of human life or human suffering. The companies can benefit society, but they're not irreplacable, and as it is today they're very close to becoming unwelcome parasites.

  10. Cool be neat.. by Tha_Zanthrax · · Score: 1

    I don't think that the patenting op particular sequence should be possible.

    It would be cool, you could sue your brother(s)/sister(s) for having their DNA look to much like yours.
    Be mindfull of your parents not doing the same...

  11. Patent Infringement by CaptCanuk · · Score: 1

    Time for illegitamately born children or unwanted pregnancies to get sued by... their parents.
    This all goes back to that episodoe of Superman where Lex Luthor clones Superman and Bizarro is what results. We should learn our lesson from cartoons.

    --
    ---- The geek shall inherit the Earth.
    1. Re:Patent Infringement by pmc · · Score: 2

      We should learn our lesson from cartoons.

      OK - you stand under the 16ton weight first then.

    2. Re:Patent Infringement by Anonymous Coward · · Score: 0

      Are you sure that Bizarro was a clone? I thought that he came from a paralell universe?

    3. Re:Patent Infringement by Herr_Nightingale · · Score: 1

      I hear ya brother! It's time to bring back DarkWing Duck :O)
      Patenting of DNA is ridiculous, in the same way that patenting a particular sequence of dominos is crazy. How can one patent a sequence of genetic material??
      More importantly, how does one enforce that patent if a person/organism/sasquatch (or whatever) later expresses that sequence????!!?
      Truly your American laws are a just a little daft..

    4. Re:Patent Infringement by nerdlyone · · Score: 1
      Patenting of DNA is ridiculous, in the same way that patenting a particular sequence of dominos is crazy. How can one patent a sequence of genetic material??

      They can't, at least not in the USA. Your concept of what is being patented is a little off.

      More importantly, how does one enforce that patent if a person/organism/sasquatch (or whatever) later expresses that sequence????!!?

      That is the point. No one can enforce such a patent, no one can even HOLD such a patent. Your question is moot.

      Truly your American laws are a just a little daft..

      It is only your misunderstanding of them that makes you think this.

  12. Flying penguins... by Anonymous Coward · · Score: 0

    U.S. patent attorneys say they will have more luck trying to teach penguins to fly.

    Pfft. What do they know about flying penguins.

    1. Re:Flying penguins... by The+Pi-Guy · · Score: 1

      I'd agree - didn't Linus have a penguin fly at him at over 100mph?

      --joshua

  13. Patenting therapies, not the gene by HEbGb · · Score: 5, Informative

    Two requirements of a patent are the existance of an 'inventive step' and another is 'novelty'.

    Patenting a gene itself (if that's what's done) is nothing more than patenting a transcription of an already-existing structure. It won't hold up - there is no novelty, and no invention - you're just writing down what already exists.

    However, an inventive, novel step could be the application of the knowledge contained in the gene for specific therapies which were developed. These can and are patented, and I don't see anything wrong with this.

    I think there's a common misconception that these companies are patenting genes themselves-I think that with few exception, this isn't the case - they're patenting applications of the knowledge to new therapies, much like someone who has studied the physiology of the body can patent a drug to treat an illness. You're not patenting the mechanism of the body, you're patenting a tool based on that knowledge.

    1. Re:Patenting therapies, not the gene by AnalogBoy · · Score: 2

      So.. Could I patent my process of splicing firefly and baboon genes into human DNA, to make someone's butt glow technicolor-like whenever they're excited?

    2. Re:Patenting therapies, not the gene by drcln · · Score: 2, Insightful

      No one patents genes; no one patents life. These people are just silly. More precisely, the research companies are patenting a newly isolated and described chemical compound. It is also possible to patent a method for using such a chemical compound; although it is tough to get therapy patents when there is no record that the therapy usually works. You have to show that you know what to do with a chemical compound before you can patent it.

      In this case, the patented chemical compound is a piece of DNA or RNA which is useful for a number of things. You can use it to detect DNA with a complementary sequnce from a patient's tissue sample. Thus, it is a research tool just as you might patent a clever electronic spectrophotometic tool. The highly indignant researcher from Penn was using a patented research tool which was very expensive to invent and perfect. Myriad and the other research companies have just as valid a right to ask to be paid for its efforts as HP or Lucent's Bell Labs.

      --
      your gravity fails and negativity don't pull you through
    3. Re:Patenting therapies, not the gene by Vornzog · · Score: 1

      As the parent to this pointed out, the patent has to have an inventive step or some other novelty, or (straight from the first article), must be "novel," "nonobvious" and "utilitarian."

      The idea of a gene has been around since the 1800's, thanks to one Gregor Mendel, and the knowledge of where those genes were and how they were stored has been around since ~1950, due to the work of Watson, Crick, and a few others who never get any credit. Methods to sequence the DNA has been around almost as long as we have understood what DNA was. There is nothing novel about finding a gene.

      It's time to look at what patent law was originally meant to do. It was never meant to stop research and innovation - it's supposed to protect innovation by allowing people who discover something new to benefit from it. I would consider methods of treatment for genetic diseases to be fertile ground for innovation and patents galore by this standard of what is patentable.

      Finding a gene is not new or nonobvious in any way. We all know the genes are there. Make the gene sequences public, but keep treatments patentable. This ensures that research and innovation are allowed to go forward, but innovations in treatment are rewarded. This is the way the system was supposed to work, and would still work if the supreme court ever stopped to think about the law they are supposed to be upholding, instead of being impressed by the big name lawyers biotech companies hire every time this ends up in court.

      If the US sets an example, it will have a big impact on the international community as well. Don't hinder the research community, as their efforts will benefit the global community. Do allow patenting of treatments, so that it is still possible to profit from a good idea.

      -V-

      --

      -V-

      Who can decide a priori? Nobody.
      -Sartre

    4. Re:Patenting therapies, not the gene by WillWare · · Score: 4, Insightful
      an inventive, novel step could be the application of the knowledge contained in the gene for specific therapies which were developed. These can and are patented, and I don't see anything wrong with this

      Patenting genes that occur in nature would be an obviously questionable practice, and it worries me that this issue has been kicking around unresolved for at least two years. But the thing you are describing here also worries me: it sounds like you're saying that the genetic information is properly unpatentable, but having sequenced it, I could apply for a patent controlling ANY useful application of that information. I would prefer to see patents limited to controlling a specific application of the information.

      But the obviously worst-case scenario would be where any fool could operate a sequencer for a couple weeks, and patent whatever he gets, regardless of whether an application is apparent at the time of filing.

      --
      WWJD for a Klondike Bar?
    5. Re:Patenting therapies, not the gene by Alik · · Score: 2

      What you describe is the exception, not the rule. Most patents *are* on the expressed sequence of the gene itself (or the amino acid sequence of the protein, which is informationally equivalent in most cases), not on some test kit or therapeutic regimen. The described utility is generally one that has been found through computational homology studies: you screen the gene against a database of knowns, and then declare it to have functionality equivalent to that of the closest match.

      As you pointed out, there's supposed to be some novelty here. The trick is that the expressed sequence isn't how the gene exists in your body: in your body, there are unexpressed intervening sequences (comments, sort of), proteins attached to the strand at various points, and other modifications. Courts have held that since the pure expressed sequence isn't the form found in nature, it's a new compound and is patentable.

      I agree that the specific applications of genetic discoveries should be patentable and patented, but that ain't what we're arguing here.

      Shameless self-promotion: I wrote a primer on gene patents (PDF format) for the American Medical Student Association about a year ago that goes into a lot more detail on the issue.

    6. Re:Patenting therapies, not the gene by pmc · · Score: 2

      Two requirements of a patent are the existance of an 'inventive step' and another is 'novelty'

      Well, close. In simple terms, the three requirements of a patent are

      1) Specific Utility
      2) Novel
      3) Non-obvious

      These simple concepts do get complicated (what did you expect - there's lawyers about), but that's the jist of it.

      Now, where the drug companies are paying fast and loose is that they are patenting gene sequences and their expressions (so the DNA and the protein) without any clear idea of what they (the genes and proteins) are doing. Effectively they are ringfencing a gene and trying to control any medicines/drugs/treatments that depend on their effectiveness for that gene. So person A invents a medicine that blocks protein P from doing damage in a cell (and P may well be an expressed cancer gene). Then because company C has a patent on the gene, A has to pay C royalties/licence fees to use the gene/protein.

      The whole problem is that the patents of genes lack specific utility - that are not for something, they are almost the equivalent of land deeds.

      I think there's a common misconception that these companies are patenting genes themselves

      Sadly, it isn't a misconception. The companies are patenting the genes themselves (or, to be more exact, gene sequencies. The genes they are patenting aren't even complete in some cases). The criteria for patentability is that the gene should be capable of being cloned, and their function defined.

      Cloning is straightforward, working out the function is too vague - the function of a gene is make a protein. OK - the patent application says gene Y makes protein X. What does X do? They don't have to know to get the patent.

      I think the idea is wrong - genes and proteins are not, at a fundamental level, useful for the treatment of disease. Sure, you have to know what they are to design drugs to work on them but it is the drug that is the invention, not the protein.

      The drug companies argument is that inventing these drugs is an expensive business, and they need the protection of a patent on the gene so that they will be the only people that can benefit from a drug that works with the protein that is expressed by the gene. Otherwise nobody would take the risk of developing these drugs and society would be worse off.

      The whole question about these patents comes down to this - "Would a company take the risk of trying to develop a specific treatment for a protein if another company could beat them to market with a different treatment?". I think this is called competition, and it so far has worked well - I see no reason to change the rules just because the stakes are increasing.

    7. Re:Patenting therapies, not the gene by Jtf · · Score: 1

      the big question is. If I eat some toast, would i be subject to royalties for the various DNA sequences for the wheat, bread, etc. Would I also be required to pay royalties for the part my DNA has in digestion of this food? (which would be a rather big role).

    8. Re:Patenting therapies, not the gene by curunir · · Score: 2

      This would certainly make it easier to pick up girls at bars (since you're looking there anyways).

      --
      "Don't blame me, I voted for Kodos!"
    9. Re:Patenting therapies, not the gene by pmc · · Score: 2

      If I eat some toast, would i be subject to royalties for the various DNA sequences for the wheat, bread, etc

      No. The patents are only ludicrously, not insanely, broad. The patents cover genotypical but not phenotypical effects. Which means that anything that can be directly associtated with that gene is covered, but not concerted effects.

      For example, the gene sequence covers the protein and the use of that protein in fighting, say cancers, as cancer is a direct effect of a (malfunctioning) gene.

      Blue eyes, on the other hand, are the result of lots of complex interactions between lots of genes (and lots of other chemicals) then even if the gene patented is involved in these effects blue eyes are not covered.

      (It may seem daft to talk about blue eyes being patentable, but both are parts of the body - the only difference is scale).

      This is the way I think that it works based on common sense - none of this has been to court yet, so it is anybody's guess what will happen. It may yet come to pass that someone, somewhere, will get what amounts to be a patent on blue eyes. The system is that broken.

    10. Re:Patenting therapies, not the gene by mpe · · Score: 2

      Finding a gene is not new or nonobvious in any way. We all know the genes are there. Make the gene sequences public, but keep treatments patentable.

      Maybe patents (or even copyright) should only apply to a gene which is either artificial or substantially modified. With the onus on the creator to demonstrate originality.
      Such things as moving genes between species should not be patentable only if they develop some new technique for doing it.

    11. Re:Patenting therapies, not the gene by Artagel · · Score: 2

      "inventive step" is the phraseology used in the Patent Cooperation Treaty context, and is the better translation for what many countries use. (For instance, Germany, even though Germans don't use English terminology.)

      This reaction was part of Congress' overruling a judge-made "flash of genius" test for patentability. If you work really, really hard, but aren't a genius, you can patent the results of your work, in this country. (It got rid of the distinction of "non-obvious because of intellectual barriers versus non-obvious because nobody wanted to do the 1 billion iterations of a testing and experiment scheme to get the right answer.

      Arguably, inventive step would do a better job of excluding most gene patents than our present concepts of non-obviousness.

    12. Re:Patenting therapies, not the gene by the+gnat · · Score: 3, Interesting

      The highly indignant researcher from Penn was using a patented research tool which was very expensive to invent and perfect.

      See, this is what bugs me so much about scientific discussions on Slashdot- for every expert in the field, there's always one idiot who makes a forceful argument based on a complete lack of understanding.

      Anyway, you need to read up on DNA testing, PCR, gene expression, genome analysis, and gene finding. I'm guessing the genetic test the Penn researcher was doing was for a defective form of a certain gene- could be just a single polymorphism. This could be done from a simple tissue sample, probably, and wouldn't require use of Myriad's "invention" or "perfection". Anyone can get the proper homologous sequences for detection made up with the right amount of money- my university has it's own center for this.

      Secondly, gene finding is more a matter of hard work than of genius or innovation- hardly meeting the "non-obvious" requirement. There are many methods, but right now it could be as simple as this:

      - run a gene-finding program against the raw sequence
      - find matches to suspected genes in protein databases

      and in some cases you can have an almost certain functional identification of the given gene this way- and you can do it all by computer. This isn't like some super-drug that took teams of researchers years to synthesize, it's a natural product that's relatively easy to find and characterize, with a huge probability of multiple independent discovery.

      The real problem is that these genes aren't inventions at all- they are no more than discoveries, however much the biotech corps try to twist definitions. An invention might be something like a human-modified gene that when expressed yields a desireable product. But in this case the protein product would be the better target for a patent.

      This is the real indignity- biotechs aren't coming up with useful products, they're just patenting genes like mad in the hope of coming up with a product later. In the case that someone else independently makes a product, they're besieged by lawyers. Myriad couldn't come up with a use for their patented gene, but they're willing to sue a publically-funded researcher to prevent her from performing a valuable medical service that doesn't even require their data. They're parasites, pure and simple, and the single largest reason why we need projects like the HGP. I think the public research centers should begin patenting every new gene and licensing it free of charge, just to keep companies like Myriad from screwing real scientists.

    13. Re:Patenting therapies, not the gene by BlueUnderwear · · Score: 2
      ...non-obviousness.

      But what about non-novelness? Those genes have been in existence for millions, if not billions of years, and have not be created by the self-proclaimed "inventor". If anybody could get a patent on it, it would be God ;-)

      It's akin to some "inventive" software company disassembling the code of XP, and try to get patents on any functions that they disassembled in such a way. Obviously , nobody is doing this, as Micro$oft would sue the shit out of them, and rightfully so...

      Or it's as if Amazon disassembled Netscape and IE, and tried to patent the functions and methods that manage cookies. Oh wait...

      --
      Say no to software patents.
    14. Re:Patenting therapies, not the gene by Anonymous Coward · · Score: 0

      Actually there has been a bit of a fuss over this a couple of years ago. Seems there are companies patenting gene sequences that they discover, even though they have no idea what they are for.

      In my opinion, if you didn't make it, you can't patent it. That really should be part of the rules. Ummm... Isn't it already?

    15. Re:Patenting therapies, not the gene by Artagel · · Score: 1

      Novelty requires that the exact, precise thing being patented not have been done before. This is construed very narrowly in most legal systems including the U.S. Once you get into the details of what is being claimed, the "expressed" sequences being patented are not occurring as they do in nature.

      For example, I want to patent "brilliant" cut diamonds. Diamonds exist in nature. Those diamonds even have weaknesses of cleavage in the locations of the eventual facets of the diamond. However, the brilliant cut diamond itself is not in nature even though it is waiting to be chiseled out of the diamond.

    16. Re:Patenting therapies, not the gene by BlueUnderwear · · Score: 2

      The problem here is that some biotech labs do indeed intend to patent the underlying sequences themselves, rather than some modified versions thereof. Also, cutting a diamond, and cutting an excerpt out of a book is not really the same thing. If you quote a largish excerpt of a book, the original author (i.e. in our case the metaphorical "God") still retains copyright.

      --
      Say no to software patents.
  14. How can you patent something that already exists? by jfrumkin · · Score: 2, Funny

    I've always been confused by this - if I tried to patent my own DNA, couldn't someone use me as an example of prior work?

    --

    "What we have here, is a failure to communicate." - Cool Hand Luke
  15. jhfjhfg by Anonymous Coward · · Score: -1, Offtopic

    OHH YAH!

  16. Patent this by Greg's+Trolling+Acct · · Score: -1, Offtopic

    aaaggctccatgccgcctcgactaggaaggccacctactatcatattcgt
    ggccggttaggagattatgcgcggcaagtaacctacgaaaggggttct gg
    tggaatcaagtcgcacttttgttaaacttaggtacatcgggtgtatct gg
    cgagttgcgtgggtgtcaccgatagctcagtgtcttgacagccaacgg ga
    gacagatagacgggtatagcgtaaactctcttcggttttaaatgacgc at
    atgggccagagggctagtttgcagctgggatacacagatcagttgcta cc
    ccaccgtccagtttagtgacgtcggctgtcaggcacagcggtgtacga gc
    gtggagctactctcaacatctgctggagattctactccggccgtggta tt
    atcgtggcccttttgtccaatgtcccggacattgagagatatccccgc cg
    atgattggaggcgggcgaagcaataagcgacggtgccaagacctagtg ag
    ccaaattgttgaactgtgaaagccagatttccgactcgtaccatactc tg
    cttaggaaggtgacaacgcaaatcttcctttcggaaccgcactgagta at
    acagtgccggaatacgtgcggagaatgtcgagcgctgtggatgtgcac ca
    tcgaacaacgaaagggcaagtgtattgtaagggattctgacctgccgg gt
    aaatagtgcgagggttgataaattttgagccagtgtacgtctaaaact gc
    agcgctactcccaagtaacgtatgggctaaatagcggggtaagaacct cc
    aggtctaataacgtgatgttgcagggtggcgtagaggtagacgagttt tc
    ttacaccataggaggtctgaaatgtccgtctgggcaatctcatcgagt aa
    acttttactgcgtcttcccctaacgtcttagacaccgcagttgggatg tc
    tcagcccggccacagcactcaccccgaatggccgcacgcgtcacccct ct
    tccgagtttaacttaggcgcgccagaaatcttgggctcttcttagctt aa
    tcggtcggcgatcgagtattggatgcacgtaaagatcgctgtacggat ac
    ctccaattcacttgtgctactccttatagctgatgttcagggcgaggt tt
    cggcagcgtcacagcggtcctcaccgactcgattcctactggctcatt cg
    ttctcgtgccggccgatcgtgagaaattttctacggccgtatgcagat tg

    // This is the clever part to create five fingers

    tctagctagcgcctaacgctaaagcctagcagtatagtaaaccttacg cc
    agagacggcgttttacggatagtcgacgggagccgtttctgaggtggc tc
    aacgctcgtgatctgcgcgcattaccaggctaatccatgtacgtaacg ga
    aaataccctgagcccctctcacgctggatgatttctcccgagtgtgga gc
    gaactatatggcacgccgcatcgctccgtgagctatctggttgtccat aa
    atatacacgataaccaggattcgcatctgtggagcatggatcggcacg gc
    tatgctgggcacggcagatcgattatcccccgcggccagtattgagaa gt
    ggcggcggtaacgagttcgggtcagggcacttgttgcacttacctaac aa
    gccactccgcgaaggaaatacggcagtataatagagagacggtcgagg cg
    tgctcttataattatttttgaaggacgtcttatcgtacgtaacctcct tt
    ttaggatgtaacgtcggcgcttcttttgaaccaacggaccagtatggc ct
    gccaggtaatatgggcaacggccccaagattctgtagaggccagtagg aa
    atgaacataccaactagaggggcgtaacgtgcaacacgttatttggac ac

    // Unknown glucose-generation sequence

    agaatcgattcgcgtttggactaatgcccgggcctggtatcaccactg cc
    tgtttcactcactaatgcaccaattaataacgtccaggtactccgcat tc
    acggggccagtgtagtacgcctgttcctgaaccaacacgtctcttggt ac

    // This is clearly redundant

    aaggaccacagtagtttccgttgggtgacttgccccagcatcgacatg ga
    cacgccccgtgcagtctgttacttgacatggcaaccgtgttgcatgaa tc
    attccgcgcctagtcttaaaaagcagatggtgtccgctcatatgaatt ga
    agtgccggaacgggagggttgcacacaaggcatctcgtaacgagggat ta
    tatcgtgtttctctgtgatcgttctaatccttccgatcgtccaacttc ct
    aatcctgcgctctggaccctcatgaaaggggaagggccatgcagggca ga
    tactctcggaaaaacggactttgtctgatgacggtgcgtcgagtacac aa
    agtcaggctccaaggtggccactaataggccaatgctaggacgctgcc tc

    // CTGGGA would have been a better endcap terminator here

    attcgagtagtcgtcccgataaagggacgagatgtcccatagctacgt ag
    tcgccctggccaggggacgttggcgctgcgtcgcgagcgctttgcact ta
    ttcggaggcactccttaactgaaggccccatgcattacctatgcccct at
    cggcagtcggtgatggccgcgtgcccgtgggttcggttcctgttggag tg
    ccaggtaccaaagggcacatttcttgaagcgaatggagcgttgctatt ta
    attgcacaattgcgtgagctcggtttcttataagtcgtgcgcagcaaa cc
    ccacatacttgaatattcgtagaactttacaatttcctactttcgatt ct
    agagacgtagtacgtcaatttgggcaccaaaatcagcttgagaaaaca cg
    gtgtgttgaccatgtcgtgtacaaccagccggtatatgacaaactgcg gg
    ccgctactttcttggtacattcctcacagatcatccagtactaggaga at
    gaaaccctgcccataagaacggcttagacagcctggtaggcggtcccc tc

    // Compare to monkey DNA, clearly this is similar

    catatccactcgcatcatgcgcagcacattgcccagcaactggaagag ac
    aggtgtgggtcttcgtactacgagaactactgaaagcaggaaggcctg gg

    // Patent #41847593 here

    taggtattctccacctaaactcatacaaccttggcacgagttcggttc ca
    tcggggagtcgcgacgtgaacgagcgttggtagatcgtcaatcagagt tt
    tgtcatttccttataatgtagctcactaggtctacggcgagaggggcc tc
    cattagtctccatgtaaggcggcagtgctaatcgtcacttgacaacct ac
    ccccgaacggaaaggaaacgccaaagaaatacagcttagacgcgacac at
    taggagggttggttatattctgaacaccttctatcgctgggcggaaga cg
    cccagccatggccttatcgtccctgtgcccctcaccgtgtggtcacca aa
    agacctaggatgggttttacggtcacaaaccccggttacctccgacat ac
    gatcaatcaccaagtaagcgctgagagtccgggaacatagggttgggg ca
    gacttgtctacaggagacacgttaacatgaactggtgcagcaagatac ta
    tttgaaaacagaacgatcgtgaacccggattccaccctcctacaatga cg
    ttatgacagaggggcgatagcgtcacccgacaggtttctatagatgtt cg
    agcttatatcttggtgcttcttcatatccaagcactccggcagtttgc aa
    aattccacttcagcttgctacacttttactgggcgtccatgaagtcat tt
    ccttgtgtggtccagatcacgctccagaaatcactgctgttcgatttt ac
    tcatacgtaattatggacaatcctcgtgccgacgggtgtacgcgatgc cc
    cggtgatcccgatcatatttagtggcatggtccccgaccgatacctct tc
    aaaaaagatgagcggcaacaacacgcacattgccacgctcgataccta tt
    ccgaaaactgagactgagagtacagtcttgaaggccgactgcctcgag ct
    taagatcggcaaagctatattattctgctacctctgggaaccttctcg ac
    gtacggtgacacgagtccggacttagggatagctaccacggacggggc tt
    attaccgttagcgggctactctagttctattgggagatgccccccagc ct

    // Inefficient but clever

    ctcgaaacacgtggtccaattgctacacggtcttcgtctgacccaggg tg
    cgggcaattggttaaggtgaatcaaacgggtttccgttaaaggctgaa ct
    agcttccgtcgcgatgctccggcgttggatatcccataccctatgcac tc
    cggtcgggtgtccttctctcacaatgagtagcaagatgggggcgtatt cc
    tgtttggctaaacaataaactgagacgctcctgaacaacggaggcgta cg

    // Heh!

    gagtacacgtgtctgcaaacctggtacacacttcgtcggcatccatgc ca
    gattcctttgtcgtattccctagagaaaccaacgagtgtttgtgcgca ac
    atcacggggccattgtttacgtaatcaatgctcactcaccctgatgat tt
    tccatataacgaattatccgcaactgttacagagtcgtaacagagtga gg
    taacggctcagtaggtcgtgttctagccgagttgaagtccccggcttg ta
    atgaaagcaggtgaataaaattgattttgtcccaaaaatttgctagag tc
    agtttcatttcctagaaattgtagcaatagcttatattgccctatacg ac
    ggccctatgtgttttcatctaaatggaaccgtaaggcgatcgttgtcc cg
    ccgccttctcagcgggtactaagggagtggcttcattccatgactagg ct
    tcaacccgtgtttggagacttctgcgttctctcgctcgacctcgctta ta
    tggtctttgcgcggacattgaatctgtgccaaaaggcttttatgtctc cg

    // DNA sequence is questionable here

    acgtgttgaagtgtatataagttgcggaaagtgaaactattgatcaga ta
    ggttcactagacaattcttttataaaatctaacacccgggagctggtg at
    aaggagctattggagtttcagtgctgtatgtctaagccgtatcgttta ct
    acggagctatatggtatgacccctcccgggggaggtaaatccctaata gg
    aacactcgttggttcgccgcgatcaacccttctttgttctggacggat ct
    atcaccgacaagcacatcaacctcccacccgaaccagagaactcccac ca
    ctataaccagtctggtggcaatgtgtcgaaatcgctattcctcctatc cc
    acgtctagttggtacccgtaatactaaaagaggatcgtggtagggaac ta

    // A rather elegant protein generation chain

    tgttttttattggacaagcgcgggtgccactagaaatagtccgtatct ga
    aactactacacgcagtaaccctgccaacgtacgatactgcccattatg ta
    agacctacaggctgataaccacctcggttgcaaagtccgctttgatcg gg
    ggggtatcagtacgactagttgcaaacatcacctgggataacatacgt ca
    taaaactgaaatcatcgcccctgtcctttgcacctgcttttcgcttga cc
    cgattgtgacgaaatctgctaaactgatggctaccgttgtcgcatgag cc
    tggcgaagagtcagcctatgcgttaacataacttcttacgctagcgag gg
    caagagcaatggcgtgtgtcgcttagggtcaaaacaattggagctgtg ta
    attgtacatattcgatgtttgcaagaaaggtctgccctttgtagttga ta
    gcaacgtcccccctgagttcagcgccgaccggggcggttcccgtaatg gt

    // Not known

    ggtgccatcggacggcgggctatattgcaggcagtacgacctccgaga gg

    // Patent #49491845 here

    ggtcgatggatctgcgtacaatttcacgccccgtaaagcagccatcgt cg
    aggtcatttgcgctgcctcttagtgttatatttgggtcacctcagggg cg

    // Not a bad choice

    ggctcttacctgtccatcccgccgtacggcgtgacgtcttcccctcgc ct
    agttttcctaaattacggggttagtaaactgttggccgcataggactc ta
    tgcgatcaataccacgatgctacgtggatttacataccctttagataa aa
    gtgtgcacggcatagcaaatacttcaactgtaagcggcatagttctgg tt

  17. rhetorical questions by Christopher+H · · Score: 2, Interesting

    next week:

    * Should the Internet be shut down?

    * Should Open Source be illegal?

    1. Re:rhetorical questions by t_allardyce · · Score: 2

      Open source is a cancer that destroys intellectual property and the Internet is used only by terrorists and pedophiles. Shut it down! Shut it all down!

      - Signed: the people who patented all the DNA - lol :)

      --
      This comment does not represent the views or opinions of the user.
  18. analogy? by cowscows · · Score: 3, Interesting

    If I discover a new comet, should any astronomer that wants to look at it through a telescope have to pay me royalties?

    It's rediculous. And that's an example of something that doesn't effect human health (Unless the comet is going to smash into earth I guess).

    I cannot see how this could be construed as anything other than choosing money over humanity. It's repulsive.

    --

    One time I threw a brick at a duck.

    1. Re:analogy? by Anonymous Coward · · Score: -1, Offtopic

      Just how in the hell is this offtopic? Time to METAMODERATE!

  19. First post.. by Anonymous Coward · · Score: -1

    Well, I have prior art with my particular set of genes so they can p**s off.

  20. This has already been tested in Japanese courts... by Anonymous Coward · · Score: -1, Offtopic

    You can read about it here. Hopefully, the outcome would be much different if it were to be tried under the American court system.

  21. Please understand.. by mindstrm · · Score: 4, Insightful

    They do not Patent DNA. They did not invent DNA.

    THey can patent specific genes for a specific purpose.

    So if they discover a gene that permits them to do something interesitng, like grow you a third arm... they can patent that.
    If they discover a gene that will make you smarter... they can patent that.

    They cannot patent genes until they have a use for them.

    1. Re:Please understand.. by 0123456789 · · Score: 1

      I'm not sure I understand you; how, by examining human DNA can a researcher claim to have invented the gene that they discover? It was already there waiting for them.

      If the researcher in question generates an entirely synthetic gene, fair enough. However, the cases in question here deal with gene discoveries in existing DNA. It's kind of like claiming that, because you've 'discovered' you can use an AOL CD as a frisbee, that you can claim a patent on CDs.

    2. Re:Please understand.. by Terry+Dignon · · Score: 1
      did someone invent scientific forumulas? it doesnt matter if it's "invented", only if the person is responsible for bringing it to everyone elses attention. when they patent it, they are not going to charge you monthly because you were born with such a gene, only for operations that might occur (such as growing you a third arm). i am not for/against the whole process, i just dont think its an open and shut topic. (i hope that made at least some sense)

    3. Re:Please understand.. by iphayd · · Score: 1

      "If they discover a gene that will make you smarter... they can patent that."

      But, if it's found that I contain that very gene, can I claim prior art?

      If not, can they get royalties from my parents?

    4. Re:Please understand.. by Wire+Tap · · Score: 2

      I hate to tell you this, but no one has patents on formulae. Do you think Newton patented his laws of motion?

      I can just see it now:

      Soldiers are laying seige to a castle, using a trebuchet and a dead cow.
      Newton: Hey! What are you guys doing over there!
      Soldiers: We are launching this cow over the castle wall to poision their well!
      Newton: I forbid this! I have patent number 2098724-01282 on the law of motion you are invoking! You must stop your illegal activities now, or pay royalties.

      Or, even better:

      The sun starts to shine on a darkened Germany.

      Einstein, shouting to the heavans: Hey! What do you think you are doing!
      Sun: I'm giving light to the citizens of the world!
      Einstein: You can't do that! I patented the formula the describes the motion under which light moves! Pay me my royalties!

      I don't think so... Come on people... you are smarter than this.

      --

      Man is born free; and everywhere he is in chains.

    5. Re:Please understand.. by sam_handelman · · Score: 5, Informative

      All of what you say is, or ought to be, true.

      However, Biotech companies are interpreting these patents in a very broad way, as you can see from the article.

      The more sophisticated the biotech you're trying to develop is, the more burdensome these low level, frankly not-very-clever patents become.

      By analogy in software, imagine how difficult it would have been to write Kazaa if quick sort, merge sort and the binary search were all patented. Supposing you needed all of them (and that bubble sort wouldn't do, but stay with me), you'd need to enter into negotations with each of three different parties who hold the patents, and get permission from each of them, before you could finish Kazaa. Now, Kazaa, even though it maps to the set of integers, is a legitimate achievement; the people who wrote it deserve protection of their coding investment. Merge Sort, while a cute idea, is NOT. There is a qualitative difference between the two.

      The biotech patents that are being issued are, likewise, so basic, and generated on such an industrial scale - companies just churn them out as fast as they can - that they are begining to hamper innovation.

      These biotech companies often won't enter into negotations about selling their intellectual property. They're flush with cash, by and large, and if they don't know what their property is worth, why would they sell it?

      When you're trying to develop something really new and sophisticated (the biotech equivalent of a complete piece of software) you may need literally dozens of tiny processes which someone has patented. Even if none of these patents will hold up in court, the risk that not one but several parties could sue you to defend their interests - usually in different jurisdictions! - makes the legal risks of implementing such a procedure prohibitive, even if none of these patents would really stand up in court.

      I have to add that Columbia university, where I am a graduate student, makes more money from patents (in particular one, rather basic, biotechnology patent) than any other University in the world, including the combined patent income of the Universities of California (my BS & BA are from UCSC). That money is what pays my stipend.

      --
      The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
    6. Re:Please understand.. by Terry+Dignon · · Score: 2, Interesting
      the "forumula" to a medecinal, pharmaceutical (yep, i cant spell), and other products are patented although they did not "invent" these, just mix them together. =)

    7. Re:Please understand.. by Anonymous Coward · · Score: 0

      Wouldn't Einstein speak in German?

    8. Re:Please understand.. by the+eric+conspiracy · · Score: 2

      Biotech companies are interpreting these patents in a very broad way, as you can see from the article.

      Thats quite irrelevant. What is important is how the courts interpret the patents.

    9. Re:Please understand.. by sam_handelman · · Score: 2, Insightful

      I hate to be cynical, but it is not irrelevant.

      To a University, which is a very conservative institution, most of the time, the risk of being sued, and losing, is simply untenable. Especially when you consider the staggering damages that might potentially be awarded - how much is something private "worth," if it has been released into the public domain at no profit for the party releasing it?

      The same is true of venture capitalists. If I have a good idea, my ability to get backing is in a lot of danger if there are people waiting in the wings with lawsuits. Backing a biotech venture is pretty risky business anyway - adding in a 5% chance that, even if my method is teneable, it is going to be nuked, or the profits all siphoned off, in the courts, is not helpful; if you take into account the chance of potentially ruinous additional delay is more like one in three, well, it is a serious issue.

      It is very naive to say that only the final decisions which courts reach are relevant.

      --
      The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
    10. Re:Please understand.. by the+eric+conspiracy · · Score: 2


      It is very naive to say that only the final decisions which courts reach are relevant.

      Hardly. Patents are litigated all the time. It is not that rare, and lawyers working at companies pay attention to case law. If they try to shake down a deep pocket organization for a patent infringement that is on weak ground, they are risking a countersuit, big time.

    11. Re:Please understand.. by Senior+Frac · · Score: 1

      I hate to tell you this, but no one has patents on formulae. Do you think Newton patented his laws of motion?

      So glad to hear it. I'll be happy to tell that to Rivest, Shamir, and Adleman for you.
    12. Re:Please understand.. by Wire+Tap · · Score: 1

      You go ahead and do that. You link didn't lead to anything relevant.

      --

      Man is born free; and everywhere he is in chains.

    13. Re:Please understand.. by Kwil · · Score: 2

      Hardly. Patents are litigated all the time. It is not that rare, and lawyers working at companies pay attention to case law. If they try to shake down a deep pocket organization for a patent infringement that is on weak ground, they are risking a countersuit, big time.

      Which is fine.. so long as you're a deep pocket organization. What about the smaller universities?

      --

      That Jesus Christ guy is getting some terrible lag... it took him 3 days to respawn! -NJ CoolBreeze

    14. Re:Please understand.. by Daniel+Dvorkin · · Score: 2

      Wow, you are spectacularly missing the point.

      The point is that if patent laws had been as absurdly broad in Newton's day as they are now (actually, I'm not even sure that patent laws existed back then -- anyone know?) he could, in fact, have patented his laws of motion, and then successfully sued and collected damages from anyone who built any kind of device that operated according to those laws, or any university that did research on the applications or implications of those laws, or ... Which would have made Newton a very rich man for a while, but from a historical perspective it's hard to argue that the world would be better off.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    15. Re:Please understand.. by T.+Will+S.+Idea · · Score: 1
      A lot of people are using analogies to muddy the situation. Let's dispense with the analogies and talk about the specific facts mentioned in the articles.

      Doctor: We need to run some tests to see if your unborn child has Canavan disease. You have your choice, the expensive test or the cheaper test.

      Patient: What's the difference between the tests?

      Doctor: They're the same test but with the expensive test we charge $12.50 extra and send that money to the people who discovered the genetic marker in the first place.

      Patient: And if I choose the cheaper test?

      Doctor: Then the people who did the original research get screwed. But hey, if they had wanted to recoup any of their investment in research they should have kept it a secret.

      That's the real choice here. Do the people who did the original research get paid, or do they get screwed?

      --
      If electricity is produced by electrons is morality produced by morons?
    16. Re:Please understand.. by mpe · · Score: 2

      THey can patent specific genes for a specific purpose.

      That's part of the problem. Allowing patenting the gene as opposed to only patenting the doing something with the gene. Whilst the DNA sequence itself remains in the public domain

      So if they discover a gene that permits them to do something interesitng, like grow you a third arm... they can patent that

      Such genes are likely to actually be fairly "general purpose", but only useful in combination with other genes
      Someone patenting genes which enable extra limbs could well affect using some (or all) of the same genes in something like improving healing of injuries.

    17. Re:Please understand.. by mpe · · Score: 2

      To a University, which is a very conservative institution, most of the time, the risk of being sued, and losing, is simply untenable

      Unless you have deep pockets being even being sued and winning can be a problem.

    18. Re:Please understand.. by mpe · · Score: 2

      did someone invent scientific forumulas? it doesnt matter if it's "invented", only if the person is responsible for bringing it to everyone elses attention.

      You can't patent mathematics and you can't patent a language.
      Sequencing DNA isn't in itself innovation. A specific way of doing it might be, though.

    19. Re:Please understand.. by Wire+Tap · · Score: 1

      Hmmm, well, you are right, I did miss the point, spectacularly at that. I didn't see it like that. Of course, I agree with you - the laws are a joke. I don't think that these products of nature, regardless of the humans it took to elucidate them, should be property - they should be free.

      Now, for more about what I think about the researchers, check out my reply to the other post (below yours).

      --

      Man is born free; and everywhere he is in chains.

    20. Re:Please understand.. by Wire+Tap · · Score: 1

      Why should the researchers choose from the two situations? They DO get money, as far as I know. Doesn't the institution for whom they worked pay them WHILE they are working? I don't belive that patents like these should exist... they make trouble for people in the long run (well, 25 years, or whatever the time frame is). The point is, the researchers should be compensated, but only during the work. After that, if their work is saving lives, why not just bask in the glow of adding to the advancement of the species?

      And, the institution will be looked on favorably, too. "Hey Mom! I want to go to that school that hired the research team that discovered the cure for cancer!".

      It could very well be a win win sitution, and not part of a zero-sum game.

      --

      Man is born free; and everywhere he is in chains.

    21. Re:Please understand.. by the+eric+conspiracy · · Score: 2

      Which is fine.. so long as you're a deep pocket organization. What about the smaller universities?

      The fact is that even a small university is going to be bigger than most biotech companies.

    22. Re:Please understand.. by T.+Will+S.+Idea · · Score: 1

      It could very well be a win win sitution, and not part of a zero-sum game.

      It is already a win win situation. Patients pay a little bit of extra money. This money is sent to the research institutions with a proven success record. They in turn sink this money back into more research. It's a positive feedback loop. If you produce things that people need, you get paid more and most of that money goes back into the research.

      --
      If electricity is produced by electrons is morality produced by morons?
    23. Re:Please understand.. by zcat_NZ · · Score: 2
      Doctor: We need to run some tests to see if your unborn child has Canavan disease. The test costs $3002.50 and if we don't diagnose it early, your child will die or at least be crippled for life.

      Patient: But why is the test so expensive?

      Doctor: Well, the test itself costs is really simple and only costs $2.50 The other $3000 goes to the great grandson of the researcher who stumbled onto the gene that the test looks for almost 120 years ago. He gets away with charging $3000 because it's a life-or-death diagnosis, and since he owns the worldwide patent on it nobody's allowed to make a cheaper test.

      --
      455fe10422ca29c4933f95052b792ab2
    24. Re:Please understand.. by Wire+Tap · · Score: 1

      Are the prices fair enough as to not prevent these services from getting to the people who really need them, and don't have endless pockets?

      --

      Man is born free; and everywhere he is in chains.

    25. Re:Please understand.. by jjon · · Score: 1

      > You can't patent mathematics You can. The RSA or Diffie-Hellman encryption algotithms are/were patented, and both of them are simple maths. You can also patent a whole list of mathematics operations (an "algorithm"), such as LZW compression (used in GIF).

    26. Re:Please understand.. by T.+Will+S.+Idea · · Score: 1
      I appreciate your use of hyperbole. But it might help to inject some facts into the discussion.

      fact 1: The figure $12.50 is taken from the article itself. This is the real number. So before you start complaining about outrageous licensing fees maybe you should do a little bit of digging to see just how outrageous those fees actually are.

      fact 2: Patents expire 17 years from date of issue or 20 years from date of filing. So 120 years is a bit silly.

      Look, I could object to Aibo hacking on the grounds that somebody might develop an attack Aibo that will be programmed to roam the streets, ripping people throats out. But let's try to get a grip, shall we?

      --
      If electricity is produced by electrons is morality produced by morons?
    27. Re:Please understand.. by T.+Will+S.+Idea · · Score: 1
      No, of course not. But the same could be said of food, and that is relatively cheap and abundant. If we can't manage to adequately feed everyone, how do we expect the pharmeceutical companies to provide them all with the latest wonder drug?


      One of the true tragedies of our modern day health care system is that it is exponentially cheaper to treat many diseases with drugs than with surgery. However, the government will pay for the surgery but not for drug therapy. In my opinion it is the governmental health support programs for the needy (medicare/medicaid) that are responsible for poor people going without drugs. Poor people couldn't afford AZT even from the cheapest generic drug supplier.

      --
      If electricity is produced by electrons is morality produced by morons?
    28. Re:Please understand.. by zcat_NZ · · Score: 2
      fact 2: Patents expire 17 years from date of issue or 20 years from date of filing. So 120 years is a bit silly.

      Granted, i'm just being an ass and didn't even read the article, but are you -sure- this point is invalid? What was the original term of copyright, and what is the current one? And how did that happen? :)

      --
      455fe10422ca29c4933f95052b792ab2
    29. Re:Please understand.. by Duckz · · Score: 1

      Lets say they patent growing a third arm, and I purchase this for my so called 'son', if his offspring has a third arm when he has children, would the company who holds the patent be able to sue him?

      --
      Todd

  22. Properties of Nature by Baldrson · · Score: 3, Insightful
    Properties of nature are not patentable. Specific applications of properties of nature are patentable.

    Patents that attempt to cover general applicability of properties of nature are invalid and the courts that uphold such patents in error.

    1. Re:Properties of Nature by abe+ferlman · · Score: 2

      An ordering of bits on a disk is a property of nature.

      You'll have to be more specific.

      --
      microsoftword.mp3 - it doesn't care that they're not words...
    2. Re:Properties of Nature by fferreres · · Score: 0

      Ok, here is such an application:

      "point your telescope to vector(3,6,9), look thought it, see OUR comet...pay!".

      Here's how to solve it:

      Patents should be kept secret for about one or two years (that is, everyone should know there is a patent for doing "something" or whatever the patent is covering but not know the exact application o process).

      Then, if someone else patents OR EVEN uses a similar process before final patent granting, then that/those patents should be dropped. Or they should allowed for a really narrow timeframe.

      Economic reasoning: if more that one company patents the same thing in so little time, then the patent claim was not innovative or was an obvious thing to do. Today what we are arguing is that obvious things to patent are patented. And that is stiffles innovation because at some point, REAL (non obvious) innovations with PRACTICAL applications will need to rely on those OBVIOUS and THEORETICAL applications...

      That being say, good luck!

      --
      unfinished: (adj.)
  23. Speak n Spell by Anonymous Coward · · Score: 0

    Use a spell checker already!

  24. Patent my ass! by Evil+Inside · · Score: -1

    Come and patent my ass!

  25. Hey guys... by jasamaman · · Score: 0, Offtopic

    I'm going to patent light. And while I'm at it the entire electromagnetic spectrum! ::Evil laugh::

    --
    Someone ever tries to kill you, you try to kill them right back!
    1. Re:Hey guys... by Anonymous Coward · · Score: 0

      Mod parent up. + 1 Funny.

  26. No way, think about the patent office's record! by Anonymous Coward · · Score: 0, Redundant

    Jesus, what a horrible idea. The US Patent Office's record of granting patents in the IT world shows they have NO grasp of technology, how on earth would they handle something as complex as DNA?

    So what happens if you patent DNA and then a human being is produced in violation of that patent? Will this person simply be destroyed? Even if they're a baby or 10 years old, or whatever?

  27. A patent presupposes a real discovery by yggdrazil · · Score: 1

    To patent something, it is supposed to be a real discovery, not something anyone with the tools of the trade would find out anyhow.

    With gene sequencing machines becoming more and more common, I don't see that DNA sequences can be called real discoveries anymore. (And probably hasn't been the last few years.) Finding DNA sequences is an almost mechanical operation which shouldn't be awarded with patents.

    But then again, the patent system has become so fucked these days, who cares? The patent system has to be reinvented, and all the obvious patent squatters must pay for their sins.

    Let the biotechs patent actual medicins based on genetic research, not the genes themselves, because that would be stealing.

    1. Re:A patent presupposes a real discovery by Anonymous Coward · · Score: 0

      Patent Lottery.
      I believe a cancer marker project patented 1000 or so hot leads, 'discoveries', then trimmed it back as it eliminated things one by one., so it could win by a couple of days in the paper chase. As for the tests to detect THAT sequence, well derrr is obvious.
      Patents for 'statistically speaking' type observations should get nothing.
      When someone knows 'why' then consideration should be given.

  28. For shame by Digitalia · · Score: 3, Insightful

    I always assumed that a patent was intended to cover a new or uniquely contrived object. Were these geneticists to be patenting recombinant DNA, I would be alright. When they begin to patent DNA that they discover, it becomes a travesty of science. Not only do they have no rights to that DNA, but it impedes scientific progress. Of course, most modern geneticists aren't working for the benefit of man. Some work for their own good first and last, Monsanto, while others work for their own good first but hope to benefit civilization in the process. Even academic research is beginning to fall under the latter category. In both examples, progress is stifled by greed and gluttony.

    --
    Pax Digitalia
    1. Re:For shame by Anonymous Coward · · Score: 0

      Digitalia? Is that like, Genitalia? Pax Genitalia?

    2. Re:For shame by Anonymous Coward · · Score: 0

      Of or pertaining to the fingers. It's latin. You know, the digitals from digitus. They're the things you have up your arse.

  29. Same problems with selling Drugs vs Cure by CrazyJim0 · · Score: 1

    Why would a company that makes billions each year off selling AIDS drugs want to cure it?

    When money wins wars, governments can't even turn the cheek to help the public good.

    Then we have Microsoft, who works along the same lines as selling drugs for the benefit of the United States.

    Patent DNA? Sure, fine whatever, laws are already fubar.

  30. No by Anonymous Coward · · Score: 0

    It shouldn't.

  31. Thorny subject for more reasons than one.... by Fenris2001 · · Score: 2
    The article makes the point towards the end:
    "It's not just the patents themselves. It's how these patents are being enforced," said Michael Watson
    Information may or may not want to be free, but it costs a lot of money to do this kind of research. Patenting gene sequences and describing their function as intellectual property offers a way to recoup the high cost of R&D.

    The problem is, some (not all) biotech companies are enforcing their IP like some (not all) software companies do - sue first and ask questions later.

    Now, I'm sure I'll get flamed by the Slahdot crowd that thinks everything should be "Open Source", but there are fundamental differences between computer science and genetic science.
    --
    ---------------
    Vpered na Mars!
    1. Re:Thorny subject for more reasons than one.... by Anonymous Coward · · Score: 0

      Now, I'm sure I'll get flamed by the Slahdot crowd that thinks everything should be "Open Source", but there are fundamental differences between computer science and genetic science.

      Why? Isn't the purpose of science to *further* human knowledge--for *all* humans? Why should a cost be associated with *any* science?

      I can answer that, but probably with a different answer than you would. The answer is: for all their protestations about R&D costs requiring the controlled dissemination of their discoveries, today's scientists are little more than whores to their capitalist masters; they are in it for the money first and the science second. It could be argued that they've *always* been that way, but the modern manifestation of this creature is singularly beholden to his corporate-state overseers.

      True science, the pursuit of knowledge for its own sake, is so rare today that it might as well be German measles.

    2. Re:Thorny subject for more reasons than one.... by nomadic · · Score: 2

      Now, I'm sure I'll get flamed by the Slahdot crowd that thinks everything should be "Open Source", but there are fundamental differences between computer science and genetic science.

      I don't think "everything" should be open source; hell, I don't even think all software should be. I do, however, think it's contemptible to allow the patenting of DNA. I mean, I really don't give a damn about the cost-effectiveness of the R&D department of a large biotech firm. If it costs too much to find new genes, then don't; the Universities, government, and non-profit groups will eventually get to it, even if it takes a little longer.

  32. if you can't run with the big dogs, by Anonymous Coward · · Score: -1

    atc gca tga cta cta ccg tca cat cgc gcg cgc gac gat acg atc gcg cat cga tcg cgt

    FP!

    eeee-haa!

    1. Re:if you can't run with the big dogs, by Pastor+Fluff · · Score: 1

      Did you know if you read that out loud, you'd sound like Gilbert Gottfried?

      --
      Bubble, bubble, toil and trouble... can't we just go to Starbuck's for coffee?
  33. I patent G,C,T, and A, do I win? by CrazyJim0 · · Score: 1

    On and U if we can start patenting RNA.

    Then if we got the codon's, I'll patent the amino acids and start/stops.

    Hahahha, everyone who wants to use DNA, has to pay me royalties now!

  34. Patent my DNA? by Stormshadow · · Score: 2, Funny

    Knowing my luck, one day my doctor will tell me "I'm sorry, but we just noticed the DNA for your mitochondria is patented. I've been told that the patent holder is filing under the DMCA that you've illegally been copying their intellectual property since conception and you must either cease operations immediately or remove all offending material."

    *sigh*

  35. Patents to God by nesneros · · Score: 1

    Give patents for all naturally occuring DNA sequences to God. Then assume he allows free, open development on his intellectual property. If this bothers God, he can take people to court.

    --
    Some men spend their entire lives trying to kill themselves for having been born. --Ross MacDonald
    1. Re:Patents to God by Anonymous Coward · · Score: 0

      as it has been seen before, in germany you can sue people for such rights infringments without being the rights holder.
      So someone could sue them over there in behalf of god.
      If god is recognised by such courts, it would be possible.
      (I've heard of strange country where commercial entities are recognised as natural being, so every stupid idea is possible nowadays).

    2. Re:Patents to God by Anonymous Coward · · Score: 0

      AHA!!!
      Now we understand why the church tells us to pay 10% of our income...

      :-D

  36. My position by MarkusQ · · Score: 3, Insightful
    Digital information should not be patentable, period.

    The space of all-possible-digital-information maps directly onto the space of integers. Asking for a patent on a chunk of digital information (DNA, object code, what have you) is the same as asking for a patent on an integer. The claim that "oh, but it's a very large integer" is specious. Patents are for inventions not facts-of-math.

    Copyright is only slightly more reasonable.

    -- MarkusQ

    1. Re:My position by roybadami · · Score: 1
      Digital information should not be patentable, period. ... Patents are for inventions not facts-of-math.
      But only for inventions that can't be described by means of digital media (say, text, pictures, sounds, movies)?

      Oh wait, if it can be described in a patent application then it can be described by means of words and diagrams alone.

      Oh dear, those are representable by means of digital media. Therefore they shouldn't be patentable.

      Methinks it is your argument that is specious.

    2. Re:My position by gnovos · · Score: 2

      But only for inventions that can't be described by means of digital media (say, text, pictures, sounds, movies)?

      You missed his point. He wasn't refering to inventions that can be described digitally, instead he was talking about "invertions" that consist of digital information.

      --
      "Your superior intellect is no match for our puny weapons!"
    3. Re:My position by praksys · · Score: 1

      This is wrong for a couple of reasons.

      (1) For legal and practical purposes they are not asking for a patent on a number. They are asking for a patent on a chemical which can be used to generate DNA with a certain sequence. The patent is only violated if you make the chemical that is used to make the DNA sequence.

      True the DNA sequence can be represented as a number, but they are not patenting a representation let alone a number. (If we were talking about copyright then it would be a different story).

      If you think the two are the same thing then just ask yourself, "which number is being patented?" The answer depends on the mapping function. Different function, different number, so obviously the mapping function is doing a lot of work here.

      If all this still doesn't persuade you then try asking yourself whether you would be happy if you asked God for a summary of all his knowledge, in digital form, and he handed you a printout of the set of all integers.

      My point here is just that, even if you have an integer which can be mapped back to a particular DNA sequence, you still need to know two more things before you can make any use of it. You need to know the mapping function, and you need to know that the number represnts a DNA sequence.

      (2) Your argument rules out all patents (maybe that is what you wanted, but I got the impression that you were trying to draw a line between legitimate patents and illegitimate ones).

      The objects of all patents are capable of finite description. Thus the objects of all patents can be represented as integers. So if we accept your argument then it looks like nothing can be patented.

    4. Re:My position by MarkusQ · · Score: 2
      First a quip:

      If all this still doesn't persuade you then try asking yourself whether you would be happy if you asked God for a summary of all his knowledge, in digital form, and he handed you a printout of the set of all integers.

      Actually, he did a little better than that. He also said, by way of a hint, "Some of these things are not like the others..."

      Ok, now seriously again:

      They are asking for a patent on a chemical which can be used to generate DNA with a certain sequence. The patent is only violated if you make the chemical that is used to make the DNA sequence.

      That is not my understanding. I would agree that they would be entitled to a patent for some technique for making DNA, but 1) I would not agree that a "chemical" is a "technique", and 2) they seem to be seeking a patent on a particular sequence regardless of how it is constructed. This sounds much more like what should have been a copyright, but even there I maintain that it is more of a "discovery" than a "creation."

      Different function, different number, so obviously the mapping function is doing a lot of work here

      This does not follow. If I measure something in feet instead of meters, I get a different number--that doesn't mean that my measuring stick was "doing a lot of work" or that I should be able to patent that particular distance, preventing anyone from using 2.7385 meters without my permission.

      Your argument rules out all patents

      Not so (as someone has already explained on this thread).

      -- MarkusQ

    5. Re:My position by roystgnr · · Score: 2

      You missed his point. He wasn't refering to inventions that can be described digitally, instead he was talking about "invertions" that consist of digital information.

      You missed his point. All inventions consist of digital information. For example, want to guess what percentage of patented mechanical ideas can be completely specified with a CAD file? In general, anything I can communicate to you can be completely communicated digitally (that's why this "Internet" thing is so useful), and anything patentable has to be communicated to the patent office.

    6. Re:My position by MarkusQ · · Score: 2
      missed his point. All inventions consist of digital information.

      No, gnovos got my point. There is a world of difference between trying to patent an invention (even if that invention can be expressed digitally) and trying to "patent" the digital representation itself. In general, what is/was/should be patentable are working inventions and tangible embodiments of techniques, not discoveries, facts, numbers, formulas, etc. and certainly not the representations of these things, digital or otherwise. If I come up with a clever machine that runs on ear wax, I should be able to patent it; if I come up with a clever way of spelling "ear wax" I should get a trade mark; if I write something new about ear wax I should be able to copyright what I have writen.

      But if I measure the melting point of ear wax, or determine it's molecular weight or average denisty, all I should expect is the joy of increasing human understanding of this oft ignore substance. I certainly shouldn't expect to own ear wax itself, no matter how well I quantify it.

      -- MarkusQ

      P.s. Pardon the higher than normal typo rate. My 8-week old son is helping me.

    7. Re:My position by QuantumFTL · · Score: 1

      This makes no sense. Taken to the extreme (as you appear to be doing...) it leads us to the idea that anything which can be mathematically described in discrete detail can be mapped to the integer space. Imagine, if you will, that any invention that can be created in our 3 dimensions has some representation in a computer (CAD design, verbal description, whatever). Now, that's digital information, and thus mapping directly to an absurdly (and incontemplatably) huge integer.

      So that leads us to the idea that anything that can be described in a quantitative way with finite detail should not be patentable. Or, rather, the numbers themselves which contain the information (along with all suffiently similar numbers) should not be allowed to be patented. I think that every invention ever made falls in this catagory (unless you can come up with a USEFUL invention that requires infinite detail of some kind, or cannot be described by either math or language).

      I really hate how the patent system is sometimes abused, and I agree that the whole issue of Intellectual Property needs to be debated and rethought, however, what you are saying is clearly rediculous, because you're abstracting away the notion of an idea to the point that it's simply a number which the idea is encoded in, and thus not patentable.

      Nice math, poor reasoning.

      (This is not an attack on you, however I have no idea how you got modded up to +4 insightful.)

    8. Re:My position by MarkusQ · · Score: 2
      *sigh* Some people seem to have gotten the point of what I was saying, and others seem to have missed it, which most likely means that I wasn't as clear as I should have been. One last try:

      you're abstracting away the notion of an idea to the point that it's simply a number which the idea is encoded in, and thus not patentable

      My whole point is that they are doing this; they are not saying "we have this invention, and we'd like to patent it" but instead are saying "this digital code (under some representation scheme) represents something that has some properties, and we'd like to patent the digital code (in this case DNA, but my point is more general) as if we'd actually invented something with the same properties."

      So that leads us to the idea that anything that can be described in a quantitative way with finite detail should not be patentable

      Not at all. I'm just saying that the patent should cover the invention not the representation. Suppose that there is some common illness and some small fraction of the people in the world have a natural immunity coded by DNA sequence XYZ. If you discover this and invent some treatment (based on your discovery) to cure people, fine, I'd grant a patent on the treatment. But there is no logic to giving you a patent on the sequence which may well: 1) occur naturaly in some segment of the population, which would then be in violation of your patent, 2) occur in other contexts (in humans, in plants, etc.) with some other effect or combination of effects (this is quite common), or (getting absurd to make a point) 3) sound just like some Metalica song if played with the right codec, or look like Micky Mouse when viewed with the proper image viewer or who knows what else?

      Patents were originally restricted to working devices to prevent just this sort of over-broad nonsense. The patent should cover the device, technique, etc., that you invented, not the description of it or the math behind it or the colour of the chair you were sitting in or anything else you might like to throw in there.

      -- MarkusQ

    9. Re:My position by QuantumFTL · · Score: 1

      Excellent response. I wish you would have said this originally, as it makes much more sense and is also much more reasonable.

      Sure, I'll agree then that patents should be not be applied to digital representations, however I also feel that sufficiently complex algorithms or software concepts should be allowed to be patented. (No, I don't mean one-click buying, that's just common sense there, I'm talking about things like a codek or something). I think, of course, that such things need to have mechanisms to prevent their abuse (once again, look to one-click).

      Anyways thanks again for the response, I appreciate the clarification.

    10. Re:My position by praksys · · Score: 1

      They are asking for a patent on a chemical which can be used to generate DNA with a certain sequence. The patent is only violated if you make the chemical that is used to make the DNA sequence.

      That is not my understanding. I would agree that they would be entitled to a patent for some technique for making DNA, but 1) I would not agree that a "chemical" is a "technique", and 2) they seem to be seeking a patent on a particular sequence regardless of how it is constructed. This sounds much more like what should have been a copyright, but even there I maintain that it is more of a "discovery" than a "creation."

      They are trying to patent a particular sequence, but as you note this is not legally possible, so they do the next best thing. They patent the only pratical method for generating DNA with that sequence. And again, whether the sequence is a discovery or an invention has nothing to do with whether you can use an integer to represent it.

      Different function, different number, so obviously the mapping function is doing a lot of work here

      This does not follow. If I measure something in feet instead of meters, I get a different number--that doesn't mean that my measuring stick was "doing a lot of work" or that I should be able to patent that particular distance, preventing anyone from using 2.7385 meters without my permission.

      Actually your measuring stick is doing almost *all* of the work here. The bare number is absolutely useless without the units. I agree that you should not be able to patent numbers, or distances. My point was merely that they are not the same thing.

      You claimed that patenting DNA sequences amounted to patenting numbers. It quite clearly does not. It does not amount to patenting distances either (or any other simple number+unit combination). So if you want to show that DNA sequences should not be patented then you will need another argument. The integer stuff doesn't do it.

      Your argument rules out all patents

      Not so (as someone has already explained on this thread) (link deleted).

      That is just someone getting confused in the same way that you were getting confused. They recognise that there is a difference between the representation, and the thing being represented, but then make the mistake of supposing that people are trying to patent the representation.

      Just to make this clear. No one wants to patent a sequence of letters that represent a DNA sequence (digital information). What they want to (indirectly) patent is the DNA sequence itself (a particular chemical).

  37. Remember, it's only 17 years. by Anonymous Coward · · Score: 0

    An American patent lasts only 17 years, and if you allot a good seven years or so to get the thing out of the lab, then you're looking at a useful lifetime of maybe ten years.

    Copyrights, on the other hand, are really scary. Originally they were to last 75 years, but recent lobbying by the Hollywood crowd has resulted in legislation under which it is not clear that copyrights will ever expire. If DNA were copyrighted, then you'd have some real cause for complaint.

    1. Re:Remember, it's only 17 years. by mpe · · Score: 2

      An American patent lasts only 17 years, and if you allot a good seven years or so to get the thing out of the lab, then you're looking at a useful lifetime of maybe ten years.
      Copyrights, on the other hand, are really scary. Originally they were to last 75 years, but recent lobbying by the Hollywood crowd has resulted in legislation under which it is not clear that copyrights will ever expire.


      Originally copyrights and patents in the US lasted about the same length of time. 75 years was already a huge extension of term.

  38. Open Source by DeadBugs · · Score: 4, Funny

    I am releasing my DNA under the GPL license.

    --
    http://www.kubuntu.org/
    1. Re:Open Source by King+Of+Chat · · Score: 2

      Does that mean anyone can modify it? Do you live near Yucca Mountain?

      --
      This sig made only from recycled ASCII
    2. Re:Open Source by Robber+Baron · · Score: 2

      You mean you've sprayed it all over your keyboard...

      --

      You're using her as bait, Master!

    3. Re:Open Source by Anonymous Coward · · Score: 0

      Be careful where you aim that thing! Point it away from the screen. We don't need any more viruses propagating ;-)

    4. Re:Open Source by pyramid+termite · · Score: 3, Funny

      I am releasing my DNA under the GPL license.

      My wife's patented mine with a marriage license.

    5. Re:Open Source by Bios_Hakr · · Score: 3, Funny

      More of a license to your copyrighted material. I'm guessing that exposure of said copyrighted material to a third party is grounds for termination of beforementioned license.

      --
      I'd rather you do it wrong, than for me to have to do it at all.
    6. Re:Open Source by shaunak · · Score: 1

      Noooooo.
      The GPL is very restrictive towards people who want to clone me. I'd rather release it under the BSD style licence.
      Besides, who would want a viral licence associated with their DNA? (Viral RNA?)

      That's it.
      My DNA is now released under the BSD licence.

      --
      -Shaunak.
    7. Re:Open Source by jbf · · Score: 2

      Since the source code is the preferred form of making modifications, what's the preferred form of making modifications to your DNA?

    8. Re:Open Source by hyrdra · · Score: 2

      Then we would have lots of geeky OSS programmers trying to 'improve' on it...

      It doesn't look pretty.

      --


      "I'll just chip in a bit for RedHat: I actually have that installed on my university machine." - Linus, '95
  39. Patenting quasi-randomness. by beowulf_26 · · Score: 1

    How can you patent something that could concievably be created by nature? Let's say that I patent the gene for neon green eyes, and somewhere down the road, some kid in Chicago is born with a mutation that gives him neon green eyes. Is he in violation of the patent? Must his parents pay our company because his body utilizes our patented gene?

    --

    --I hate big sigs.
  40. How would they collect? by theKiyote · · Score: 1

    Lets say I get a gene implant by a company that makes me smarter. I pay them however much they want, and go about my way. But then, lets say I have a kid, and that kid inherites the DNA that makes him or her smart, does the company still try to collect? Lets say they do, and I refuse to pay. Its not like they can take the genes back. Or what if I have a couple of bastard kids, how would they even know that they even have the genes?

    If you ask me, any step closer to patenting DNA is a step closer to the world of William Gibson with blackmarket medical shops.

    --theKiyote

  41. Legal argument for why genes are patentable by TekkonKinkreet · · Score: 5, Informative

    Caveats:
    a) I know nothing about genetics or law myself. I learned all this from the genetics law expert I sat next to on a plane last week.
    b)The duration of the explanation was part of a flight from Salt Lake to Seattle
    c) I had a first class upgrade and took full advantage of the free Heinekens. That is to say, I hope I'm remembering this right.

    Goes like this. It's illegal to patent an object, right? But a sequence of DNA in addition to containing the gene you're interested in, is always full of random and irrelevant pairs. So what they want to patent is not the gene as it naturally occurs, with all the junk DNA in it, but a cleaned-up version containing only those bits which are relevant to the patent. This is not a naturally occuring sequence, and so is patentable. So to answer the fellow who says "wait, I have that gene, every cell of me is prior art," no, you don't have that exact gene, yours contains different randomness. Yes, this sounds like a legalistic dodge to me too, and the expert acknowleged the point, but there it is.

    A further wrinkle is that they patent the transcriptase necessary to make the cleaned-up gene, not the gene itself, though I had a sufficient buzz by that point in the conversation that I was ready to talk about football. :)

    1. Re:Legal argument for why genes are patentable by Vornzog · · Score: 1

      An interesting argument, and probably the one that gets used in court. It has one major flaw in it, though. The sequence in question, the one with all the relevant info, does occur naturally. Not in the DNA, but in the mRNA. DNA is copied to mRNA, and the mRNA is spliced to form the cleaned up version. Using a reverse transcriptase to turn it back into DNA is cool, but not novel, and not all reverse transcriptases are patented.

      The 'randomness', or introns, are not actually part of the gene, so the legalistic dodge should end up full of holes if anyone bothers to ask their friendly neighborhood biochemist or molecular biologist.

      -V-

      --

      -V-

      Who can decide a priori? Nobody.
      -Sartre

    2. Re:Legal argument for why genes are patentable by mpe · · Score: 2

      An interesting argument, and probably the one that gets used in court. It has one major flaw in it, though. The sequence in question, the one with all the relevant info, does occur naturally. Not in the DNA, but in the mRNA. DNA is copied to mRNA, and the mRNA is spliced to form the cleaned up version. Using a reverse transcriptase to turn it back into DNA is cool, but not novel, and not all reverse transcriptases are patented.

      Most likely the reason that the "no interons" is used in court is that judges don't actually know that much about how it works. Maybe if they catch on the next step will be to work out a way to use tRNA to read an amino acid sequence, produce some mRNA from that. Since the "genetic code" isn't quite one to one base triplet to amino acid you might well end up with a DNA sequence which dosn't exist in nature.

    3. Re:Legal argument for why genes are patentable by Anonymous Coward · · Score: 0

      A cleaned up sequence - crap.
      Some would call this noise removal, or a purifying process, or even fuzzy logic. I understand they - genes, have preamble and start bits.
      take a rat, an monkey, and a human, and figure this itty bitty sequence is common to all three, say, blue eyes. now design or modify some magnet marker to stick to this sequence, again a well understood process, akin to an IF mixer and amplifier.
      So we end up with glorified patten matching, and linking this with and association - blue eyes

    4. Re:Legal argument for why genes are patentable by Skuld-Chan · · Score: 1

      What gets me about this arguement - although it may be legal etc. Is that no matter what you believe your genes came from either A) god or B) they evolved somehow.

      Its almost like they want to patent all the hard work they put into finding a the sequence.

    5. Re:Legal argument for why genes are patentable by fferreres · · Score: 0

      Who the hell gives a fuck of what the legal argument for why genes are patentable is? What we need is an economic argument of why genes are patentable.

      After all, patents exist(ed) to promote technological advance by making it profitable. It seems though that the patents law is becoming the worst instrument ever to promote technological advance. Patenting has become a bussines on it's own where companies conduct carefull research of what is patentable and what are the probabilities that certain patent may be profitable in certain time scope, where the investor does not care to research any further down that line of thought if the said patent will allow him to claim important revenues on anything derived from it. Like iPIX patenting "making a 360 photo from a fisheye lens". Right, fisheye lens existed well before their patent and mapping pictures is older than the alphabet (probably).

      Today, it's more important to have lawers than scientists to make a profit.

      All i could ask is: please don't try to export you revenue diverting schema to other regions of the world. If you want to halt innovation, do it to your own country! (i know what i mean and yes, the US wants to export their illegal patents to each and every country they can put pressure on).

      --
      unfinished: (adj.)
    6. Re:Legal argument for why genes are patentable by BlueUnderwear · · Score: 2
      wait, I have that gene, every cell of me is prior art," no, you don't have that exact gene, yours contains different randomness.

      Shouldn't that actually cut both ways? What if a compteting company based a therapy not on that exact gene, but a slight variation thereof? If those patent lawyers were in any way consisten with themselves, they should grant the comptetitor that permission, as he would actually not be using that exact gene that was patented, but one containing "different randomness" instead. Oh, and while we're at it, why not extend this to other kinds of intellectual property? Just flip one bit in Windows XP (for instance, in an error message), and presto, you'd have a copy free of copyright!

      Basically, being too picky about what is, and what is not prior art will (or rather: should) actually make their patent much weaker, because the same arguments could be turned against them by any infringer...

      A further wrinkle is that they patent the transcriptase necessary to make the cleaned-up gene, not the gene itself, though I had a sufficient buzz by that point in the conversation that I was ready to talk about football. :)

      If they patented the transcriptase, wouldn't competitors still be able to use konwledge of the gene itself, if they gained it without using that transcriptase?

      To take a computer analogy: let's consider a company specialized in forensic data recovery (reading back data from crasshed disks). They may very well have some patented tools to read data from disks in such bad condition. But that doesn't automatically give them intellectual property rights to data that they recover using their patented tools.

      --
      Say no to software patents.
  42. Patents on Discovery? by tshak · · Score: 1, Redundant

    I am a genetic and legal laymen. So here is a "typical citizen" question: Can you patent scientific discovery?

    Examples:

    Could Albert Einstein patent the Theory of Relativity?

    Could Galileo patent the stars he found?

    How, again to a laymen, are these any different than discovering certain DNA sequences?

    --

    There is no longer anything that can be done with computers that is nontrivial and clearly legal. -- Paul Phillips
  43. That was funny. Please mod it up. by Anonymous Coward · · Score: 0


    That was funny. Please mod it up.

  44. Open Source Human by stinky+wizzleteats · · Score: 1

    I think I'll release my origin code under the GPL. That'll fix 'em. At least until my kids can't get paid for working under the derivative works clause.

  45. pdf list of current patents by hambone_p · · Score: 1

    Current patent lists(in pdf)for

    (hu)man

    or

    mouse

  46. Things that belong to "MANKIND" by erroneus · · Score: 3, Interesting

    I think at some point, an international summit for "Things that belong to mankind" should be held and agreed upon.

    Profit at the expense of public health has always been considered "wrong." But this is generally when it's a company unwilling to keep the air, water or land clean and safe for human habitation. But in cases such as patented AIDS drugs being suppressed when a far greater good could be served?

    When mankind cannot 'afford' to be healthy or to survive, there is something very BROKEN in the way we are thinking. I'm not a communist, but get real... should one person DIE simply because he can't afford to live? It's all around us and no one is willing to say I'm wrong about that. But who is willing to actually step up to the plate and actually give to mankind rather than profit from its needs?

    1. Re:Things that belong to "MANKIND" by Kwil · · Score: 2

      The fundamental problem with arguments such as yours is that they miss a major point that motivates innovation:

      The Motive for Profit (aka greed, being a meanie, etc).


      And the fundamental problem with your argument is that profit has absolutely no connection to making people healthy.

      Which is more profitable, a single pill that cures Parkinson's disease, or a chemical cocktail that Parkinson's disease sufferers have to take for the rest of their lives? Never assume that pharmaceutical companies are in the business of curing disease. They're in the business of making us take pills - if it happens to cure a disease or two along the way, well that's great.

      Drug companies will tell you how hard it is to research, develop, implement, test, study, test, study, and finally sell a drug. It is a vastly expensive operation - usually returns on new drugs are measured over the period of 10-20 years or more.

      Which is interesting considering that there's a few studies out there showing that the big Pharmacomps spend as much or more money on both marketing and administration as opposed to R&D.

      I'd say government funding except that the government is a terrible researcher and very bad at coming up with new things.

      Does it? You have facts for this or is it just the prevailing opinion? Even if it is, it certainly doesn't have to be. After all, it's not the management and marketing sections of a corporation that produce the drugs, it's the R&D people. If you assume the same benefits, pay, and penalties if nothing productive is come up with, how will an R&D person working for the government be any less effective than that same R&D person working for a corporation?

      In addition, the government doesn't have a need (though it usually does, I'll admit) to provide things like lavish CEO perks or bribes/donations to politicians for things like patent rights.

      Maybe we could do something like "waive your international patents and you pay no federal taxes" for the drug companies.

      Unfortunately, most Pharmacomps pay no taxes anyway. It's all written off long before the feds get to them.

      --

      That Jesus Christ guy is getting some terrible lag... it took him 3 days to respawn! -NJ CoolBreeze

    2. Re:Things that belong to "MANKIND" by _Spirit · · Score: 1

      Eehm, I remember reading somewhere (I know this isn't very scientific ;-) ) that 70+% of cost in the industry is MARKETING. Just plain being nice to your doctor to entice him to give you their drugs. If most of their money was spent on development you argument might be valid, but as it is, I think any drug that needs that much money spent just to be used, isn't worth the money to be developed.

      --

      beauty is only a light switch away

    3. Re:Things that belong to "MANKIND" by Peter+Greenwood · · Score: 1
      should one person DIE simply because he can't afford to live? ... who is willing to actually step up to the plate and actually give to mankind rather than profit from its needs?

      You perhaps? Try the Cancer Research Campaign for example. However, I doubt you personally can "afford" the R&D to save even one person from dying from a currently-incurable disease.

      --
      freedom, n. Allowing people you don't like to do things you disapprove of.
    4. Re:Things that belong to "MANKIND" by Lips · · Score: 1

      If a drug company spends billions to create a new drug, and then that drug is approriated by third-world nations, the US government, or other governments, it often results in that drug being a net financial loss for the corporation.

      If the third world country can't afford to pay for it in the first place and thus doesn't buy it, where is the financial loss? Why not license the drug to a poor country for no money or a very small fee?

    5. Re:Things that belong to "MANKIND" by fferreres · · Score: 0

      We in effect subsidize drug development and distribution for many third-world nations.

      In rare cases. Only when the same exact disease is present in the poor country. There is no real cure for Malaria, as you don't have the disease in the US, for example...

      AIDS vacines are targeted at USA/Europe stripes not African stripes, so they are relatively usefull in Africa.

      Etc.

      Also, what good is a drug if you can't afford it (unless you can pirate it without suffering economic penalties from the 1st world).

      --
      unfinished: (adj.)
    6. Re:Things that belong to "MANKIND" by sql*kitten · · Score: 2

      After all, it's not the management and marketing sections of a corporation that produce the drugs, it's the R&D people

      Who are expensive, and need lots of time and expensive equipment. Where does all that resource come from?

      Let me give you an example, I don't have the reference to hand, but I believe the article was in HBR and the company in question was Pfizer. Their lab had developed a great new antihistamine, but it had the side effect of drowsiness, and they were going to abandon it because no-one would buy an allergy medicine that meant they couldn't carry on their day as normal - the point of most of the medicines on the market. One of the "suits" came up with idea that they could sell it as a medicine to help allergy sufferers get a good night's sleep - and it was a great success.

      I know it's cool for "geeks" to think that only "geeks" produce value and that "suits" are a waste of time and space, but it simply isn't true. Ultimately, 1 brilliant manager will make more difference than 100 ordinary scientists.

    7. Re:Things that belong to "MANKIND" by sql*kitten · · Score: 2

      I'm not a communist, but get real... should one person DIE simply because he can't afford to live? It's all around us and no one is willing to say I'm wrong about that. But who is willing to actually step up to the plate and actually give to mankind rather than profit from its needs?

      The thing is, even in a Communist society, you do need something like money, even as an abstract concept to keep a track on where the finite resources of your society are going and being used. If you are using more resource than you are generating, then this is obviously an unsustainable situation.

      How long would it be in a Communist society before the People decided that some of the People weren't contributing as much as they should, or were taking more than they should? History shows that the People will turn on their own in a heartbeat.

      The same situation can of course arise in a Capitalist society, but it will be objective, is person A costing our society more economic value, measured in dollars, than he contributes? Expand that to, are group A consuming more resource than groups B, C and D are creating and you have the questions that are being asked today.

      I know some of this may sound callous, but there is a universal economic law, you cannot have your cake and let your brother eat it.

  47. A legitimate use for M$'s new licensing scheme! by Beetjebrak · · Score: 1

    I'm gonna put my DNA under the same license as Windows XP! That ought to make sure nobody copies it! I wonder though.. did my parents call M$ to get their copy of me activated? And what if I decide to rigorously upgrade my hardware at some point during my lifetime? Hmm.. what if I'm just a 120-eval. copy??? Scary!

    --
    Learn from the mistakes of others. There isn't enough time to make them all yourself.
  48. It's similar to software patents by RatOmeter · · Score: 1

    You came very close to saying what I wanted to post.

    I think the issue of patenting DNA is similar to that of software patents, to which I disagree. In fact, DNA *is* our software and the software of all life (as we know it). That little robosome machine that transcribes our software could be viewed as a sort of execution unit.

    If someone writes a cool new app in C++, they might want to patent it (or some part of it). These days (at least in the US), they'd stand a good chance of being awarded a patent. Imagine a bio-engineer who "wrote" a cool new app in DNA, say, a cholesterol eating bacterium. Seems to me he's got a similar right to protect his intellectual property, which in my opinion, is none.

  49. Not so certain by dachshund · · Score: 2
    So if they discover a gene that permits them to do something interesitng, like grow you a third arm... they can patent that.

    Unfortunately, very few genetic discoveries thus far enjoy the certainty-of-use you describe. Most gene patents claim a slight correlation to a certain condition (eg, people born with this gene have a 3% greater chance of developing an ulcer), etc. They are far from providing specific applications. What they represent is the protection of a costly process of discovery (ie, the ability to sequence DNA using expensive equipment) and scientific experimentation (eg, when generations of mice are bred without this gene, how do they act?)

    The above process is very expensive, and some would argue that the results arrived at need to be protected, no matter how weak the actual patent claims. As far as I can see, this would be similar to early 20th century atomic researchers "patenting" the heavier elements and their isotopes along with their applications ("this patented Uranium isotope, when struck with a neutron, be made to fission...") Certainly these researchers required enormous resources to detect, isolate, and understand the elements that they were working with. That does not mean that they (or the governments and corporations they worked for) should necessarily enjoy a long-term monopoly on their discoveries simply because they were the first with the right equipment to examine natural processes.

  50. Profit by AntipodesTroll · · Score: 1

    Unfortunatly, in the global drug and medical industires, money talks.

    Those who wish to be granted monopolizing patents in order to extract wealth out of the rest of the world, will get what they need, as long as everything is driven by money. (It takes money to make money.)

    Ethics? Pfft.

    --
    Anyone who considers arithmetical methods of producing random numbers is, of course, in a state of sin.-John von Neumann
  51. good work by gTsiros · · Score: 1, Funny

    They should patent the dna genes, of course.

    much like others patented the star formations in the sky to find their way home.

    while you're at it, patent warm water too.

    --
    Looking for people to chat about multicopters, coding, music. skype: gtsiros
  52. A patent is one thing... by MontytheMooch · · Score: 1

    ..but halting research in progress due to restrictive "licensing" of a gene is something else. According to the article:

    In Philadelphia, for instance, a university stopped testing 700 anxious women a year for a genetic predisposition to breast cancer because its lab was accused of violating a biotechnology company's patents.

    IMO, this is complete ignorance. The stoppage of viable, in progress scientific testing by these companies is irresponible and neglectful of the people they are supposedly tring to "help".

    I don't see much of a problem in patenting a particular gene sequence, but I don't think companies should be permitted to enforce a patent until a viable cure or product of that sequencing is made available. For instance:

    I patent a gene sequence that will, arguably, allow for the 100% early detection and prevention of Down's Syndrome. While modern science may already know the gene sequence involved, work continues to isolate and test, sans patent restrictions. Once a viable procedeure has been validated and accepted, then and only then should patent restrictions be allowed to come into play.

    Pros:
    -Current research continues without worry or stoppage.

    Cons:
    The researchers of these projects would receive NO recognition for their work because it would immedeately be scooped up by the patent holder upon release.

    1. Re:A patent is one thing... by davecb · · Score: 1
      MontytheMooch wrote According to the article In Philadelphia, for instance, a university stopped testing 700 anxious women a year for a genetic predisposition to breast cancer because its lab was accused of violating a biotechnology company's patents.

      Ontario was approached by the same company, asking for payments for all persons tested in the province. The request was (very) publicly rejected as an improper attempt to license a scientific discovery.

      Interestingly, the company didn't actually sue... so it my have only been a threat to do something that wouldn't stand up in court.
      --
      davecb@spamcop.net
    2. Re:A patent is one thing... by mpe · · Score: 2

      Ontario was approached by the same company, asking for payments for all persons tested in the province. The request was (very) publicly rejected as an improper attempt to license a scientific discovery.

      Maybe they didn't sue because Canadian judges appear to have a more common sense attitude to their job than their US peers.

  53. Hmm by The+Pi-Guy · · Score: 1

    But only the inventor could patent something. So, are we saying that only God could patent it? Adam or Eve? And what about the Atheists among us? Some cro-magnon in that case? Were cro-magnons even smart enough?

    Food for thought...
    --joshuapi

  54. Re:This has already been tested in Japanese courts by Anonymous Coward · · Score: -1, Offtopic

    OFFTOPIC??!!@#$ What kind of crack have you moderators been smoking?

    Jesus...

  55. Do we want the products of genetic engineering? by SIGFPE · · Score: 2

    Then presumably we want companies to research such techniques. But companies will only research them if they're profitable. If the product of the research is easily reverse-engineered and copied companies won't be motivated to do GE research unless they are protected by patent. So I guess the original question boils down to "Do you want the products of genetic engineering?"

    --
    -- SIGFPE
    1. Re:Do we want the products of genetic engineering? by mpe · · Score: 2

      If the product of the research is easily reverse-engineered and copied companies won't be motivated to do GE research unless they are protected by patent.

      If the product of the research is a complete organism then copying is very much taken for granted. A mitosis inhibited bacterium isn't that much use. Problem is that when patents were though up the idea of a self replicating "product". Also organisms tend to swap their genes around. Bacteria use plasmids. Many organisms (including those which biotech companies are often interested in) use meiosos and sexual reproduction to increase the genetic diversity of the species.
      Existing laws already lead to utter daftness where farmers who's crops are contaminated by GM crops are treated as stealing "IP". When the plants are just doing what comes naturally. In many cases the required crop is either a fruit or seed (sometimes a flower), so mess around with the plant's reproductive system and you don't have anything worth growing for agriculture in the first place.

    2. Re:Do we want the products of genetic engineering? by Chris+Johnson · · Score: 2
      That's an interesting point.

      Will _people_ research techniques to save their own lives of the lives of their loved ones for altruistic reasons, or simply reasons other than cash profit motive?

      Why is it always 'well, companies will'?

      If companies are not capable of the full range of motives and drives that humans have, despite having the same rights (or more) under the law, then maybe the problem is with the companies, not with humans or with the law.

  56. Reverse engineering and breach of contract by randal_hicks · · Score: 1

    Right, wrong, or morally questionable ... like most others have said, it's too late to do anything about granting these patents.

    Some of these discoveries were made by studying defective material from the sick and dying... opportunistic at best. People who donated material for altruistic purposes should form a class action suit against the companies who are engaging in such restrictive contracts. In so doing, they can seek an injunction against these companies, temporarily stopping them from interfering. Any money from the suit can then be rolled into a fund for financial assistance to bring the total cost of screening down to an affordable level.
  57. It isn't supposed to be... by ManDude · · Score: 2, Insightful

    You are not allowed to patent fact, in my small understanding. For example, c^2=a^2+b^2 can not be patented, since it is taken as fact. Another more simple example is you can't patent the fact that we see the sky is blue. In the case of DNA, it too is fact. You can patent the process to finding DNA, but that should be all. Clinton opened the flood gates when he allowed the patenting of DNA. It was like opening up the west to homesteaders. All of a sudden this relm of fact could now be patented, though only a small area of it.

    Some conspiracy theorists see this as a move by the US, which holds much of the capability to find DNA combinations, to try and corner the lucrative market of owning this fact. The US holds a lot of power with its patent office and most of the world regards it as the gate keeper as well as fear the Patent Office since the US holds a big stick to protect it's patent system.

    The patenting of fact looks much like the DMCA when held up to the light.

  58. patentable only if by Alien54 · · Score: 4, Insightful
    DNA should be patentable only if

    they can document the functionality down to the level that computer code is now

    The functionality is one that is not previously existing or discovered in nature.

    a unique combination of features where the majority of the code is new work. The thought here is that Ford company probably could not patent a new engine unless they owned the patents on the component parts and technologies. But there are an indefinite number of ways to build car engines.

    Thus one probably could not patent a fire breathing dragon, but could patent the various implementations of the various subsystems.

    patenting huge random chunks of DNA, hoping that something practical will come out of it is not the way to go.

    --
    "It is a greater offense to steal men's labor, than their clothes"
    1. Re:patentable only if by mpe · · Score: 2

      Thus one probably could not patent a fire breathing dragon, but could patent the various implementations of the various subsystems.

      Just as well Anne McCaffrey didn't invent a Pern patent office :)

  59. When did the attitude of scientists change? by UPi · · Score: 1

    Obviously researchers want to profit from their discoveries

    Since when did scientists become so profit oriented? When the DNA was discovered it was celebrated by all as the triumph of mankind.. Now most of the genetic engineering research is done in secrecy and everyone seems to have a stake. I think it's time for an ODF (Open DNA Foundation).

    1. Re:When did the attitude of scientists change? by the+eric+conspiracy · · Score: 2

      Since when did scientists become so profit oriented?

      Since about when people started buying technology based products. Edison I guess was the prototype.

    2. Re:When did the attitude of scientists change? by praksys · · Score: 1

      Galileo spent quite a bit of time trying to sell his method for detemining longitude at sea.

      Newton spent a lot of his time tring to turn lead into gold.

      Arcimedes was on a royal commission when he had his "eureka" moment.

      The truth is that almost all great scientists have been motivated by money to some degree or another.

      This debate about whether scientists should be motivated by the search for truth, or the search for financial gain, goes all the way back to the very earliest days of philosophy (and thus science as well). Socrates claimed that he was better than the sophists because they were in it for the money, while he worked for free. Notably both Plato and Aristotle (his two greatest intellectual descendants) both charged fees. In other words the debate was also settled a very long time ago. Even accademics have to eat, and there is no reason why great scientists (and philosophers) can't make a buck along the way.

  60. no by psyco484 · · Score: 1

    if someone patents my dna, I guess I become property of the patent holders...hmmm, sounds like slavery to me. That would suck. Well, unless you're into that sort of thing.

  61. Easy Question. by SubtleNuance · · Score: 1, Flamebait

    Should DNA be Patentable?

    No.

    Ok, whats the next ridiculous question...

    1. Re:Easy Question. by Anonymous Coward · · Score: 0

      He's right, you know.

  62. No. by Anonymous Coward · · Score: 0

    If a corporation insists it owns me (Via DNA), I will have no choice but to surrender my life by starting a revolution to utterly wipe that corporation off the face of the planet.

    The only corporation which may even dare to approach owning me is my credit card company - and they are quite limited to owning my credit. They actually (Hard to believe, I know) treat me right and keep lowering my interest rate, so I'm happy with them. :P

    ..On the plus side, I have no doubt that any corporation trying to claim ownership of a person would be laughed handily out of courts. :) Which means I can go back to reading Slashdot and not having to worry about hearing a CEO saying, "Only our patented DNA.", and then me having to shoot said CEO in the head, while saying something along the lines of, "Dodge this." (Which is good, because I really do *not* look good in tight leather.. Not with my beer gut.)

    However, there's still the ever fun idea that corporations will sue other corporations for 'curing' certain types of problems. Tell me, how many diseases might be cured by tweaking DNA? How many disorders?

    Could this cure sight disorders? Oh, those are non life threatening.. So perhaps, not the best example. How about a person born with an actual life threatening disorder (Say, they were born with their head up their arse or something. ;P)..

    If one profit-mongering corporation wishes to keep the genetic code for head-up-the-ass disorder a secret so they can make money off of it, yet another corporation can already treat it save for fear of lawsuit.. Should not a parent have the right to have their child born without an anal-cranial inversion?

    There's been rumors that the cure for the common cold has been floating around for years - only - the owners of Tylenol/Aspirin/NyQuil/etc. don't want it out. Think of the profits they'd lose if the common cold was gone!

    Profits be damned. I think it's time to push for legislation regulating the hiding of medical discoveries that could aid mankind. I think it's time to value human life more than dollars (Aids drugs/South America, anyone?)..

    And though, right now, it may be the aforementioned NyQuil talking...

    *raises hand* They can have my DNA when they pry it from my cold dead fingers!

  63. Comment removed by account_deleted · · Score: 3, Insightful

    Comment removed based on user account deletion

  64. Corporate logos by WillWare · · Score: 1
    Obviously the end-game here is that every segment of every chromosome will become the property of some corporation, and will therefore need a logo, just like any NASCAR racer. So the really meaty question before us becomes apparent.

    How do you put a corporate logo on a chromosome?

    You can't paint DNA. You need something that replicates along with the normal process of cell division. Rationally designed junk DNA could perhaps force chromosomes to fold into the shapes of corporate logos. DNA is pretty monochromatic under a microscope, so perhaps junk DNA could bind to little molecule thingies hanging off the double-helix that give color to the logos.

    This, gentlemen, is the compelling question of our age, upon which future generations will judge us.

    --
    WWJD for a Klondike Bar?
  65. Implications by LinuxOnHal · · Score: 1

    This could have far reaching implications that we may not see. What if I have children? Do I have to pay a licensing fee because they would contain my DNA? What if they have children? Is this a violation of the patent? How far can this go?

    --
    Trying is the First Step to Failing --Homer Simpson
  66. You thought they were your kids! by Martigan80 · · Score: 1

    So all those poor parents that can't have kids and opt for the invetro will really have more money to pay if a said hospital owns the right to any strand of the DNA. Think about it-the fertilization happens in the said hospital, baby is "grown" for lack a simplicity, and they _OWN_ the baby, for it's whole life.

    Maybe I'm think too far out, but it is possible. Remeber IBM thought Bill Gates was a sucker, and Bill Gates thought Open source could never be a threat.

    --
    This SIG pulled due to lack of funding. (This damn war is costing too much!)
    1. Re:You thought they were your kids! by t_allardyce · · Score: 2

      I'm sorry, your babies DNA license as expired. The infant will be collected tomorrow by Microsoft Corp. Thank you for using the rent-a-baby service.

      (c) Microsoft Corporation, DNA-DRM version 3

      --
      This comment does not represent the views or opinions of the user.
  67. Patents skewing research by yintercept · · Score: 1

    The biggest problem I see is that the Patent process will undoubtedly end up skewing the discovery process. Companies will change their discovery and research policies to make patentable discoveries, as opposed to objective discoveries. You will also see that that companies that gear their entire research process to patents will have a big club to drive out other methods of discovery. Whenever lawyers are involved the quality of life will deteriorate.

  68. For a more detailed explanation... by Alik · · Score: 3, Informative

    There's a primer on gene patents (PDF file) that I wrote about a year ago. It explains the generally-accepted patent criteria and how genetic material has been interpreted to meet those criteria. The arguments for and against patentability of genes are presented, although the bias is against strict patentability; my personal viewpoint is that applications of genetic information are fair game, but the raw sequence itself should be off-limits.

  69. The law isn't as messed up as people think by bwt · · Score: 2

    The law allows for "inventions" to be patented, but you cannot patent a "discovery".

    Thus if you find that a particular gene exists in the human body, you have not "invented" anything. One the other hand, if you take a piece of DNA and use it in a particlar process that is not naturally occuring, then you can patent the novel aspects of the process. DNA is just a chemical , and it is protected in exactly the same way as less complex chemicals.

    This is exactly the same as patents for chemical reagents. You cannot patent phosphorus, but if you find a novel way to combine it with other elements to make something new, then you can patent that. For example, if you combine it with a piece of DNA that allows you to "mark" the DNA in certain ways, then you can patent that process if nobody has done it before.

    If that happens to be the only way to diagnose a human disease, then you can and should reap a big financial reward from your patent.

    Now, it very well be that the PTO is granting patents that aren't legally valid. We knew that already and it has nothing to do with the biological arena, it has a lot to do with complete incompetence and a political process that is broken.

    1. Re:The law isn't as messed up as people think by mpe · · Score: 2

      One the other hand, if you take a piece of DNA and use it in a particlar process that is not naturally occuring, then you can patent the novel aspects of the process. DNA is just a chemical , and it is protected in exactly the same way as less complex chemicals.

      The parts which make up DNA are not especially complex chemicals. They can be made fairly easily.
      DNA has the unusual property that it can be copied, duplicating the entire molecule. Also a slightly different type of copying of DNA creates mRNA.
      Stick DNA in the appropriate part of a biological organism and it will automatically be copied. This is the problem with attempting to apply patent laws to genetically modified organisms they simply don't make sense.

  70. Why not..? by Lord+Bitman · · Score: 1

    Why not just make it so you can't patent anything which occurs naturally?
    You patent the proccess by which you can synthesize it, sure, but how the hell are you supposed to patent something which occurs naturally anyway? Isnt it not 'non obvious' if it's already there?
    This would be like some archeologist finding a scroll detailing how an obolisk could be raised by a single person and patenting the method: He did not come up with it, he should not get the patent

    --
    -- 'The' Lord and Master Bitman On High, Master Of All
  71. Is DNA Patentable? by the+eric+conspiracy · · Score: 1, Flamebait

    Why shouldn't DNA be patentable? It's merely a chemical compund, an arrangement of base pairs in a double helix structure.

    From a fundamental viewpoint it's no different from a chain based caprolactam built by a ring opening polymerization, or vinyl addition polymerization.

    If you give DNA some special status as not being patentable, while ANY other chemical compound is, what is next? Do we deny patents to all biologically active molecules? All organic molecules????

    It's not like these patents are causing any great distortion of our daily lives, AND the fact is that patents have a quite short lifetime in the grand scheme of things. Already many of the original biotech patents are expiring. My guess is that the time needed to develop and commercialize a DNA based product will average longer than a patent lifetime anyway.

    20 years from now the debate over DNA patenting will be laughed at as pure silliness.

    1. Re:Is DNA Patentable? by Anonymous Coward · · Score: 1, Interesting

      The issue comes about if somebody patents a cure to a disease or similar.

      This, IMHO, is very bad. In fact, patenting a cure for a fatal disease should be considered corporate murder (they know that people will die if they don't get the cure, patenting it means they control it, and if they weren't intending to withhold it from some people and thus kill them, they wouldn't need that control)

      Then they wouldn't do the research and we'd never find the cure? Nuh-uh, because not researching such a cure if you have the capability to would ALSO be corporate murder.

  72. Stupid Patenting by t_allardyce · · Score: 2

    The whole idea of patenting anything should be re-thought from the ground up. It was designed before DNA, code, and the internet and is long out of date. You can't expect a civilisation to grow, if their own laws prohibit it and give ownership of technology to single individuals. Its one thing for a company to sue another for copying an idea for profit, but when you start leveraging royalties from people for breathing because you have a patent on "oxygen hemoglobin transfer" you have issues.

    --
    This comment does not represent the views or opinions of the user.
    1. Re:Stupid Patenting by the+eric+conspiracy · · Score: 2

      You can't expect a civilisation to grow, if their own laws prohibit it and give ownership of technology to single individuals.

      Patents were developed as a concept in law because companies who discovered technology were keeping it secret. Granting a limited exclusive right to a technology is far better than having it kept totally secret.

      Its one thing for a company to sue another for copying an idea for profit, but when you start leveraging royalties from people for breathing because you have a patent on "oxygen hemoglobin transfer" you have issues.

      Now you are making up stuff. No person has ever been sued for engaging in normal body functions as a violation of patent law, and none ever will be.

    2. Re:Stupid Patenting by t_allardyce · · Score: 1

      If someone keeps a technology secret, thats fine. As long as someone else can develope the same technology and not keep it secret and not worry about beeing sued.

      Now you are making up stuff. No person has ever been sued for engaging in normal body functions as a violation of patent law, and none ever will be.

      Don't be too sure

      --
      This comment does not represent the views or opinions of the user.
  73. A note to my employer by Anonymous Coward · · Score: 0


    I am a genetic researcher at the Oklahoma Medical Research Foundation. Anybody there reading this will know who I am.[1]
    </background>

    I'd just like to make it clear, that if the project I've worked so hard on ends up patenting any one of our gene discoveries, I'll be submitting my letter of resignation within a day.

    You and I both know if I left, the study would be in serious trouble.

    I hope there's a serious debate, if not outright ban on such activities as banning naturally occurring DNA, RNA, mDNA, amino acid, or other sequences.[2] In any case, I'm another chip you can through on the cons side of the scale.

    ---------
    [1] It wouldn't take long to note my style of footnotes in emails and /. postings.
    [2] I don't care if you clean it up for the patent office and remove the introns, etc. It's the same damn thing.

    1. Re:A note to my employer by Anonymous Coward · · Score: 0

      Okla-homie!

      Lets see if you can dig this:

      OOOOOOOOOOOOO OAK! La home-uh where the wind comes sweepin' down the plain. And the wavin' wheat, can sure smell sweet when the wind comees right behind the plaaaaaaain!

      Anyway, I lived in Oklahoma for a summer at Ft. Sill many years ago. Worst experience of my life. I imagine for a researcher, it would be a great place to work because there sure isn't any...ANY distractions there.

      Say. Did that Univerisy you work for get accredited yet?

  74. Manifestations of nature...not patentable by Fn0rd · · Score: 2, Insightful

    35 USCS 101 governing issuance of patents does not embrace every discovery, nor is it without limit, laws of nature, physical phenomena and abstract ideas are not patentable; discoveries that are manifestations of nature free to all men and reserved exclusively to none are not patentable. Diamond v Chakrabarty (1980) [101, n 38]

    Most of the patents are for use of DNA sequences in diagnotics assays. A general assay procedure itself might be patentable, but I'd think the hybridization of DNA or it's related biological functions would be considered manifestations of nature.

    If a company invents a treatment they should patent that.

    Someone needs to take these greedheads to court.

    1. Re:Manifestations of nature...not patentable by the+eric+conspiracy · · Score: 2

      Diamond v Chakrabarty (1980) [101, n 38]

      Chakrabarty won his case and was awarded a patent.

    2. Re:Manifestations of nature...not patentable by Fn0rd · · Score: 1

      So? The ocean is wet.

      Chakrabarty engineered a new non-naturally occuring strain of bacterium.
      The question at hand is whether (naturally-occuring) DNA, genes should be patentable.

      Again, from Diamond v Chakrabarty (notice the use of the word "not"):
      This is not to suggest that 101 has no limits or that it embraces every discovery. The laws of nature, physical phenomena, and abstract ideas have been held not patentable. See Parker v. Flook, 437 U.S. 584 (1978); Gottschalk v. Benson, 409 U.S. 63, 67 (1972); Funk Brothers Seed Co. v. Kalo Inoculant Co., 333 U.S. 127, 130 (1948); O'Reilly v. Morse, 15 How. 62, 112-121 (1854); Le Roy v. Tatham, 14 How. 156, 175 (1853). Thus, a new mineral discovered in the earth or a new plant found in the wild is not patentable subject matter. Likewise, Einstein could not patent his celebrated law that E=mc2.; nor could Newton have patented the law of gravity. Such discoveries are "manifestations of . . . nature, free to all men and reserved exclusively to none." Funk, supra, at 130.

      Funk Brothers Seed Co. v. Kalo Inoculant Co.:
      ...For patents cannot issue for the discovery of the phenomena of nature. The qualities of these bacteria, like the heat of the sun, electricity, or the qualities of metals, are part of the storehouse of knowledge of all men. They are manifestations of laws of nature, free to all men and reserved exclusively to none. He who discovers a hitherto unknown phenomenon of nature has no claim to a monopoly of it which the law recognizes. If there is to be invention from such a discovery, it must come from the application of the law of nature to a new and useful end.

  75. lawyers subpoena their own DNA by jonathanpost · · Score: 2, Interesting

    Sue first and ask questions later? That leads to the impasse defined in the third couplet of my 1992 poem:

    http://www.magicdragon.com/EmeraldCity/Poetry/DN A. html

    THE TWILIGHT OF GENETIC ENGINEERING
    by
    JONATHAN VOS POST

    Jungle-floor bacteria devour helicopters after war;
    ripped human corpses thaw, screaming, in battle zone

    Smog-sucking moss evolves to grow on auto bumpers;
    gas-tank tapeworm writhes: blind premium dreams

    Heavy weaponry of corporate wars, intractable
    ultimatum when lawyers subpoena their own DNA

    Cockroaches skitter: dust of broken televisions;
    lay phosphorescent eggs between commercials

    Reunification pressures force abandonment of immortality;
    death substitutes for taxes: final cost of doing business

    Skinned headless lizard throbs, shoved into your chest:
    replicant replaces your broken-once-too-often heart

    Time & nucleotide
    wait for no man

    2300-2320
    15 Sep 1992

  76. Patented Genes in Agriculture by gotan · · Score: 3, Interesting

    Patenting genes seems to be common business practice in agriculture. Patented rice and grain seeds with special properties (like resistance to a specific herbicide) are sold all over the world already to Farmers more or less licensing the stuff. There are some problems with this aproach:

    How can we be sure that the patented genes really came out of some laboratory, and were not found in some countries where people already knew about the specific properties of the stuff (maybe because they cultivated it over thousands of years). Some corporations are accused of doing just that with rice varieteys in 3rd world countries (where the farmers probably couldn't even pay the flight to USA, when dragged before a court there). We haven't even begun to catalog all species on earth, let alone their genetic diversifications, but maybe there should be a puplicly accessible database of genetic material from particularly successful or common crop sorts all over the world that are not yet patented, to be able to prove prior art.

    Another problem is, that unlike music, films, books, software and whatnot life has it's own builtin copy-mechanism, in fact, once it's out it's sometimes hard to stop it from replicating or crossing borders. I remember a case, where a Farmer had to pay license fees, because grain from seeds his neighbour (who had planted patented stuff) blew on his fields and grew there. How could that man have prevented that, short of burning down his own corn? We already know to what ends the rights holders struggle for getting each and every use of IP paid led us in the case of copyrights. What will we see now? Genes with builtin DRM schemes (like if you don't spray your crop with a specific shortlived virus it won't survive the next month)?
    --

    --
    "By the way if anyone here is in advertising or marketing... kill yourself." -- Bill Hicks
    1. Re:Patented Genes in Agriculture by mpe · · Score: 2

      Another problem is, that unlike music, films, books, software and whatnot life has it's own builtin copy-mechanism, in fact, once it's out it's sometimes hard to stop it from replicating or crossing borders.

      Also remember that with quite a lot of crops the bit of the plant which is important is tied up with the plant's reproduction. All cereals are seeds, for example.

      What will we see now? Genes with builtin DRM schemes (like if you don't spray your crop with a specific shortlived virus it won't survive the next month)?

      They's have a tough time patenting this technique, Jurassic Park would qualify as "prior art".
      Also all this would do is mean that any plant which mutated not to need the virus symbiote would do well at spreading it's genes around.

  77. So, if my genes are patented ... by pyramid+termite · · Score: 2

    ... are the people who hold the patent going to pay me royalties? Probably not.

  78. Heh by Serial+Troller · · Score: 0, Flamebait

    Is ANAL COX planning to patent his COCK?

    --

    STOP ME BEFORE I POST AGAIN!

  79. mankind... by fenix+down · · Score: 1

    Maybe in order to understand mankind, we have to look at the word itself: "Mankind". Basically, it's made up of two separate words - "mank" and "ind". What do these words mean? It's a mystery, and that's why so is mankind.
    -Jack Handey

  80. Sorry but God already has that one by RodeoBoy · · Score: 1

    But on a serious note it is the abuse of patents for pharmaceuticals that is putting a excessive burden on our medical system. The cost of patented drug to hospitals is taking a larger percent of Medicare funds and that accounts for only a small percentage of drugs sales, persciptions have to be covered by the individual and their drug insurance if they have any. Pharmaceutical companies are the most profitable companies in the world, but the industry is controled by a few different companies. There are companies other than MS that have dangerous control over our lives, but if one is healthy they don't think about this issure. Now that putting patents on DNA and medical procedures become more popular we have to ask our selves is our social health important to us or just economic health.
    This sort of research should be publicly funded and controled. If these companies want all the profits coming from a monopoly on certain drugs or dna than they should pay full price for education and research information and funding that they have recieved directly or indirectly through our universities and gov fund research organizations.

    1. Re:Sorry but God already has that one by the+eric+conspiracy · · Score: 1, Flamebait

      it is the abuse of patents for pharmaceuticals that is putting a excessive burden on our medical system.

      The issue is far more complicated than that. Suppose xyz Pharma develops a cure for breast cancer. People pay all sorts of money for the drug because it's very effective and HORRORS patented. xyz does well off the discovery and everyone complains about the profits xyz is making. Well, dammit, why shouldn't they be profitable? They took the risk and funded the development of this drug. People wouldn't be buying it if it didn't work. Presumably the benefit of the drug (longer life, no painful death frm cancer) far outweighs the cost.

      Now people start complaining that the drug is putting an excessive burden on the Heath Care system bacsue it's so effective. OK, don't buy the drug, and let the people die instead. Ooops that's not politically acceptable. Is it xyz's fault that they came up with something that cures a horrible disease? Not hardly.

      THE FAULT IS THAT PEOPLE WANT EVERYTHING FOR FREE. Sorry, by the laws of thermodynamics are not going away anytime soon.

      Pharmaceutical companies are the most profitable companies in the world

      That is not even CLOSE to being correct. No pharmacuetical company is in the top ten list of moist profitable companies. There are two in the top 20, at 18 and 19.

      Take a look at the list for yourself:

      http://www.fortune.com/cache/ns_list_most_profit ab le.html

      The Pharms don't rank very high in terms of profit margin percentage, either. Techs like Microsoft, Intel and Oracle do much better.

    2. Re:Sorry but God already has that one by T.+Will+S.+Idea · · Score: 1
      Pharmaceutical companies are the most profitable companies in the world

      Apparently your high school teachers never bothered to explain capitalism to you. Let me try.

      Is your health important to you? That's a rhetorical question, of course it is. In a capitalist society industries that are important to us should make the most profit. If the pharmaceutical business did not make money, nobody would invest in it. No investment means no research, no innovation, no new products, no miracle cures. Is that what you want?


      In a capitalistic society, companies that make useful products are supposed to be profitable. If they aren't then the whole system breaks down.


      This sort of research should be publicly funded and controled.

      Well, that would be socialism. Luckily I don't even have to argue with you there. If you want socialism, you're in the wrong country for it (assuming that you are American or from one of the many other capitalistic countries out there, my apologies if this is incorrect). You claim that pharmaceutical companies should be government controlled because they are so important. I say that my health is too important to hand it over to the government for control. I'd rather have those greedy scientists who think that they can make a quick buck by saving my life over a bunch of government bureaucrats.

      --
      If electricity is produced by electrons is morality produced by morons?
  81. Maybe patents don't change much by Mike_K · · Score: 1

    Fact: If it wasn't for companies, many things about genes that we know today, we wouldn't know. We'd learn them sooner or later, but it'd take a while longer.

    Let's assume companies working on genes help us advance genetic research twice as fast. So, after 25 years of research, we've done 50 years-worth of publicly-funded research.

    In 25 years, when current patents expire, we'll be exactly where we'd be in terms of publicly available knowledge (at a smaller cost to the public), but we'll have pushed science by an extra 50 years of knowledge (which will be still patented). 25 years later, we'll be 50 years ahead in publicly avaialble knowledge compared to where we'd be, if companies couldn't hold patents and wouldn't invest in genetic research.

    I'm against patents on genetic research, but if you really think about it, maybe breast cancer tests wouldn't be available today if companies didn't spend on genetic research, so we're not really losing anything...

    It is very cold of them to withhold some much-needed research from the public, though.

    m

  82. open source! by atlep · · Score: 1

    I vote for open source! Genetic code should be GPL'ed!
    If not M$ will soon have an effective monopoly here too.

  83. Patent Tests not DNA by terrymr · · Score: 1

    I can see why patents should be granted on tests for paticular genetic problems but now why sequences of genes themselves are patentable as they weren't invented by the person that transcribed the sequence. The reasoning the corporations have for patenting the DNA itself is that they can prevent others testing for that gene at all - therefore preventing alternative inventions that have the same benefit.

    1. Re:Patent Tests not DNA by the+eric+conspiracy · · Score: 1

      but now why sequences of genes themselves are patentable

      It's a hoot to read the responses to this article. Never have I such a total lack of understanding or knowledge by the users of Slashdot.

      THE FACT IS THAT DNA SEQUENCES ARE NOT PATENTABLE

      Take a look at the patent archive, and the USPTO criterea for biotech patents. There are NO patents of genetic sequences per se. The patents cover the use of particular sequences to do things like test for diseases, etc.

      YOU are not going to become a slave, or be sued for infringement because your body contains a genetic sequence.

      Ridiculous.

    2. Re:Patent Tests not DNA by terrymr · · Score: 2, Insightful

      No you missed the point ....

      If the test uses a novel method to detect the presence of something fine patent it. But to allow a patent which basically describes itself as "A test for the presence of this sequence ..." then you preclude any improvement in the technology because any new method would violate the patent - this isn't what patents are about.

    3. Re:Patent Tests not DNA by the+eric+conspiracy · · Score: 2

      If the test uses a novel method to detect the presence of something fine patent it. But to allow a patent which basically describes itself as "A test for the presence of this sequence ..." then you preclude any improvement in the technology because any new method would violate the patent - this isn't what patents are about.

      The type of patent you are describing could simply be avoided by finding a different test for the same sequence. The only way you could tie up a DNA sequnce in a test is by patenting a test for a sequence as a marker for some property, beneficial or not. And even then it's weak because the only value of the patent is the use of the presence of the DNA as a marker - that is the use of the DNA sequence as an indicator. Any other use of the sequence is open for other applications.

      On another note, I am quite upset at the moderation that is going on in this topic. It appears some real goons are loose hacking at anyone with anything like a counter opinion. It doesn't effect me particularly because my karma is so high it no longer gets changed by moderation, either way, but it really detrimental to Slashdot to see perfectly valid discussion get tromped on like this.

  84. Every man owns, at the very least, himself. Now. by Anonymous Coward · · Score: 1, Interesting

    Every person, by the very definition of 'ownership', owns his own DNA and the rights to use it. The Declaration of Independence reaffirms this, as all men and women have a right to life, liberty, and pursuit of happiness: DNA is a matter of life.

    Furthermore, the US constitution prohibits slavery as well: creating people for the purpose of using them in some capacity without their consent is the very definition of Generational Slavery.

    Not that all this matters. The biotech industry will buy the republican party just as Enron and the rest of big oil has, and change such laws to allow them whatever experimental rights they want.

  85. US PTO guidelines on gene patent utility by QuantumET · · Score: 1

    Here is a link to the US Patent Office Guidelines on Determining Utilitity, especially for gene patents.

    Note that the 'responses to public comments' are more interesting than the guidelines themselves. But in short, they are supposed to have a specific, known utility before allowing a gene sequence to be patented.

    Guidelines
    It starts halfway in the first page. (pdf)

  86. NO by Anonymous Coward · · Score: 0

    NO, NO, NO, NO If DNA becomes patentable then the patent for my DNA should default to me and anyone who wants to use it should have to buy from me. But this discussion shouldn't even be a fucking topic of discussion, talk about violating human rights at the lowest level you can get. Anyone tries to patent anything I was born with and collect they better have a fucking army at their disposal. AND I REPEAT NOOOOOOOOOOOOOOOOOOOOOO

  87. DNA patents by o0oo · · Score: 2, Insightful

    Pre-existing DNA sequences are not like software. Software is an algorithm developed to perform a specific function or to solve a problem. DNA is more like a computer language. Even then, the computer language was developed by someone or a group of people, unlike DNA which existed before people discovered it. Software is more like a process for producing something. However though it processes data, or produces information, it is not likely to produce anything physical. Software is an intellectual or artistic work and can be protected by copyrights. The Technology/process used to produce or develop software may be patented. You can patent a Process or Invention, not discoveries.

    If they were to follow the patenting of discoveries to its logical conclusion, then I could patent air, the sun, stars, the moon, gravity, ... as things I discovered, just like the research labs, doctors, and lawyers are doing when they discover gene combinations. Even though this is obviously wrong, it is being done because of an interpretation of a ruling that allows scientists, reseach labs, laweres, or just about anyone, to patent viruses and bateria that they create to do specific things such as using bacteria to produce insulin, or using a modified virus for injecting an immune system into infants born without one. The patent office concluded that the only way to protect the bacteria and viruses that they had been created was to patent the DNA, and I agree to some extent; however, we are talking about patenting the invention which happens to be the DNA sequence that was probably discovered for the immune system, and was combined with an existing DNA sequence--in my example, the basic virus or bacteria.

    As far as intellectual property goes, there are a plethora of things that fall under common knowledge, such as "for loops" or sorting routines, that can't be copyrighted.

    Finally there is the idea that somethings will do or currently does the world so much good that it can't be copyrighted with the intent of making money, or impeding its use. This would include "air-bags", and vaccines for such things as polio. We see this in the software field with "Open Source" or "Copy Lefted" copyrights.

    Patents are for thing that may contain DNA, or for DNA sequences which are original works. The problem with "original works", is of course proving it, thus giving more weight to the argument of excluding DNA from Copyrighting/Patenting.

  88. Patent this! by himay_dude · · Score: 1

    Since when did scientists get to patent their discoveries in relation to genetic research on the human genome? I thought this was a global research project in order to understand our own genome and better the life of humankind, not some crock where scientists are going to make money at the expense of other people's happiness! So these scientists are going to attempt to charge for tests on DNA screenings, if not already? Well, it definately appears they're more concerned about personal profit and recognition than putting the discovery to some applicable use, in which it was originally being researched on in the first place. They're given grant money to do this type of research, why should they need to profit on the discovery? GRRRRRRR! I hate it when scientists attempt to do this. Research in the medical field that is AIMED towards the entire human race, should be AVAILABLE to the entire human race; not patented, copyrighted, and sealed away from everyone who can't afford it, or in places where it's in demand too much. It's disgusting to see where this society is driving itself sometimes...

    1. Re:Patent this! by Daniel+Dvorkin · · Score: 2

      A couple of misconceptions need to be cleared up here:

      1) It's not the scientists who are filing these patents. It's the suits who run the biotech corporations (and, increasingly, university research labs) who are doing it. Scientists, by and large, want to do science -- if they'd wanted to spend time in court, they'd have become lawyers or MBA's.

      2) The human genome project, in its original form, was about sequencing human DNA. Gene discovery from sequence data is an almost entirely different process, and a much lengthier one. Raw sequence data is like a map of the world that shows only the outlines of the continents -- interesting, and potentially useful, but not much practical good to anyone until you've filled in all the rivers and mountain ranges and political boundaries.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
  89. Cost of Research by Anonymous Coward · · Score: 0

    The research cost to pharmaceutical companies is often cited as justification for their subsequent profiteering. It's worth noting that these companies spend twice as much on advertising as they do on research.

  90. Oooh.. Can I patent my FingerPrints!!! by Anonymous Coward · · Score: 0

    Maybe I can patent my fingerprints.. That way no one can use it and I would be able to take legal action against anyone who tried to identify my fingerprints at the scene of a crime..

  91. Not to worry... by Anonymous Coward · · Score: 0

    some enterprising group in taiwan will set up a web site to download any sequence you like - for only a dollar!

  92. It could be worse by HughsOnFirst · · Score: 1

    Well it could be worse.
    If DNA is thought of as the combinations of the four possible letters, ATCG, representing the nucleotide bases with the names adenine (A), thymine (T), cytosine (C) and guanine (G), then it would seem reasonable that you could cover gene sequences with copyright. In the Copyright Claimed on Telephone Tones story , someone did just that for all possable phone numbers.
    To get a copyright the bar is much lower; my father-in-law gets royalties on songs copied from the dictionary and laundry tickets. http://www.stuie.net/lfrecord.html At least patents run out in a reasonable length of time , as opposed to copyright which seems to keep getting extended such that anything copyrighted after Mickey Mouse will never go into the public domain.

  93. patenting DNA tests doesn't make much sense by markj02 · · Score: 2

    Almost all DNA tests use completely standard and widely known technology. Furthermore, the genetic sequence associated with a disease is a simple fact of nature. Patenting genetic tests is therefore not much different from if we were to allow patenting diagnosis of a disease, say, from the visual appearance of a rash that's examined with a magnifying glass or Wood's light. The argument that DNA tests take time and money to develop doesn't hold much either: reliable diagnosis from any kind of symptom requires extensive experience and, ultimately, scientific studies.

  94. DNA under Copyleft? by James+Spencer · · Score: 1

    If you can patent DNA, too bad a wealthy philanthropist couldn't step in and get as many DNA sequences patented as possible AND release them under some GPLish Copyleft type scheme. I Could live with a future where all genetic enhancement were in the public domain. Just a thought. . .

  95. Fine then i'm patenting time. by Ironfist_ironmined · · Score: 1

    Copyright??!! just by living i believe im copying so much of their DNA every second. It would be horrible to be born with a $500 copyright infringement fee on top of your head. viral RNA on the other hand... i dont see why they cant patent that... see how much cash they can twist out of virii and the like. So they want to patent something they didnt invent... certainly a turn up for the books... rivalling the patenting of the word millennium. Individual patenting of genes may be acceptable if they are used in non-human context - i.e. fatter pigs and whatnot. Hey ma... i invented a new end restrictase! "sorry dear, but theyve patented Guanine... does it have any of that in there?" Only a 1/4 of it or so... Stay away from free software... unless you know of a way to get back your free time.

    --
    0xC3
  96. My girlfriend will have to pay bigtime by Anonymous Coward · · Score: 0

    When I spray my DNA over her, I can claim its my IP and then she'll have to pay me for it.

    To think I used to beg her for a BJ, and now she has to pay ME for it!

    Do we live in a great country or what?

  97. The dangers of terminology. by caduguid · · Score: 3, Insightful

    Notwithstanding the fact that your point was funny, you give a great example of why it's dangerous and unfortunate that we apply the vocabulary of physical property to the concept of "intellectual property".

    it is intellectual property that's been unclaimed

    ...as if intellectual property is part of a landscape you want to stake your claim to, instead of being part of the creative process. Sigh. If only we could discuss it differently, as a means instead of an end, or a journey more than a destination.

  98. Re:Please underst... We get it. Premiss False. by o0oo · · Score: 0, Redundant

    We understand your point but your belief that is OK to patent a gene, is wrong. Basic Definition of the word gene as taken from Dictionary.com A hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and determines a particular characteristic in an organism. Genes undergo mutation when their DNA sequence changes. More detailed info from ... The Columbia Encyclopedia, Sixth Edition. 2001. gene the structural unit of inheritance in living organisms. A gene is, in essence, a segment of DNA that has a particular purpose, i.e., that codes for (contains the chemical information necessary for the creation of) a specific enzyme or other protein. The strands of DNA on which the genes occur are organized into chromosomes . The nucleus of each eukaryotic (nucleated) cell has a complete set of chromosomes and therefore a complete set of genes. Each gene provides a blueprint for the synthesis (via RNA) of enzymes and other proteins and specifies when these substances are to be made (see nucleic acid ). Genes govern both the structure and metabolic functions of the cells, and thus of the entire organism and, when located in reproductive cells, they pass their information to the next generation. 1 Chemically, each gene consists of a specific sequence of DNA building blocks called nucleotides. Each nucleotide is composed of three subunits: a nitrogen-containing compound, a sugar, and phosphoric acid. Geometrically, the gene is a double helix formed by the nucleotides. Gene loci are often interspersed with segments of DNA that do not code for proteins; these segments are termed "junk DNA." When junk DNA occurs within a gene, the coding portions are called exons and the noncoding (junk) portions are called introns. Junk DNA makes up 97% of the DNA in the human genome, and, despite its name, is necessary for the proper functioning of the genes. 2 Each chromosome of each species has a definite number and arrangement of genes. Alteration of the number or arrangement of the genes can result in mutation. When the mutation occurs in the germ cells (egg or sperm), the change can be transmitted to the next generation. Mutations that affect somatic cells can result in certain cancers. 3 The scientific study of inheritance is genetics . The genetic makeup of an organism with reference to its set of genetic traits is called its genotype. The interaction of the environment and the genotype produces the observable attributes of the organism, or its phenotype. The sum total of the genes contained in an organism's full set of chromosomes is termed the genome. Scientists are working toward identifying the location and function of each gene in the human genome (see Human Genome Project). The decoding of the first free-living organism (a bacterium, Hemophilus influenza) was completed in 1995 by J. Craig Venter and Hamilton Smith. 4 See also gene therapy; genetic engineering. You can patent a method of manipulating or turning off/on genes. You can even patent the new technology or processes that you developed to discover the gene, but as previously stated, scientist, reseachers, ...etc, can discover a particular gene, but it is not an original process or something original that they created or developed. Now, pehaps if they created a completely new gene or sequence of DNA, and could prove it, they might have something, but it would probably fall under copyrights, not patents. The whole idea of introducing patents into an area that brings so many benifits to all is wrong. Also, advancement in this field of study relies on the sharing of information. Many of the private companies which are patenting genes have used the publicly developed and shared information, including techniques, to attain their gene discoveries. Also some things that are invented are too important to mankind to put a price on, though I do believe in giving credit where credit is due. Check out the stories at CBS NEWS. Search for DNA Patent

  99. Patents for DNA Absurd by marktwain · · Score: 1

    If you grant patents for discoveries relating to the function, interaction etc. of DNA then why not allow patents on "newly discovered" objects in the universe, say a solar system, and not allow anyone else to look at it or fly their XWing fighter through it?

    DNA has "always been there." Patenting an understanding of its functions makes just as much sense as what i've just mentioned. That solar system has always "been there" but Hubble finally got a day that wasn't too cloudy and grabbed a nice snap shot.

    Is science to be driven solely by greed and the desire to make money, not the desire to, for example, discover information which will result in health improvements, and, not the least, science for its own sake?

    Not much of a world to live in.

  100. Maps are copyrightable by Anonymous Coward · · Score: 0

    I know this isn't the same issue, but almost all maps are copyrighted... there are probably hundreds of maps of the US that are all uniquely copyrighted. There are several local map book companies that publish map books that are the same size.

  101. patenting DNA by pmineiro · · Score: 2, Interesting

    there are several things to note here.

    the quid-quo-pro of the patent system is disclosure for _limited time_ monopoly. by offering patents, we incentive people to discover and reveal literally life-saving things about them in exchange for being able to solely exploit this knowledge for 20 years. 20 years later, anyone can exploit the knowledge.

    it is unfortunate if strict licensing agreements prohibit some people from affording detection of breast cancer, but this must be balanced against the alternative that without the promise of patent protection, the knowledge underlying the screen might still be unknown.

    prior art of the form "my cell contains this" is not relevant here. the patents most people are shooting are "composition of matter" patents, which are relevant to natural products that are purified or isolated from their natural state. in other words, public policy recognizes that finding a needle in a natural haystack and understanding the functional importance of the needle constitutes a genuine advance in the state of human knowledge. otherwise many things (industrial chemicals, drugs, etc.) which can be found in nature _if you know where to look_, would not be patentable.

    finally, many of the early patents on genes were actually patents on cDNA, which is an image of the gene as cleaned up by the cell (think of it as an executable that has had strip run on it). these patents are neither considered very strong or very valuable, and companies (e.g. incyte) that pursued a patent heavy strategy are now struggling to find the value and are invariably moving towards more interesting achievements (aka advancing up the drug development chain). to some degree, the patent system is GIGO.

    are there some harms associated with granting patent monopolies? yes. are there goods associated with granting patent monopolies? yes. the patent is a compromise.

  102. Source code? by xixax · · Score: 2

    Yeah, but you sure don't want to know what you need to do to get the source code...

    Xix.

    --
    "Everything is adjustable, provided you have the right tools"
  103. Comment removed by account_deleted · · Score: 2

    Comment removed based on user account deletion

  104. Comment removed by account_deleted · · Score: 2

    Comment removed based on user account deletion

  105. yes, but only &deity. by Aussie · · Score: 1

    see subject

  106. If they patent my DNA...... by MoneyT · · Score: 1

    DO I collect a royalty fee or get stuck with a licence charge for every day I live?

    --
    T Money
    World Domination with a plastic spoon since 1984
  107. Comment removed by account_deleted · · Score: 2

    Comment removed based on user account deletion

  108. Could I sue?? by wolf2q · · Score: 1

    What if someone put a patent on the cold virus, could I sue if I got the virus?
    I didn't ask for it, they gave it to me without my permission!!
    I feel so violated!
    My damages and emotional distress are so severe, that I need AT LEAST $5 Billion to feel safe again.

    Yup, set for lifetime and then some. ;-}

    --
    Where ever you go, There you are
  109. Why is this an issue? by jasno · · Score: 2

    What does DNA have to do with it? If someone finds a new sequence (the information) that does something cool, why shouldn't they be able to patent it? On the other hand, they have quite a lot of prior art to contend with. So if they can come up with a truely unique arrangement of DNA, they should have the rights. However, this excludes patenting sequences present in a living being that they merely 'discovered'.

    --

    http://www.masturbateforpeace.com/
  110. Yes by Mr.Coffee · · Score: 1

    DNA should be patentable, it should say you own it right on your birth certificate

    --
    Cogito Eggo Sum, I think therefore I'm a waffle
  111. Yea, um... by stuffman64 · · Score: 2

    If someone gets a patent on genes, I want the patent on Oak Trees and Duckbill Platypuses, because I can look at thier genes and remove any irrelevant pairs, and say that the sequence does not occur in nature. Of course, I wouldn't do this because I feel it it just plain wrong to try to patent a fundamental piece of nature. But someone thinks otherwise...

    --
    --- At my sig, unleash hell.
  112. This has happened before by Gerbil912 · · Score: 1

    I remember reading somewhere that there were issues with people trying to patent elements on the periodic table years ago. They were, of course, denied under the reasoning that elements belong to everyone. If we can say that about elements, then surely we can say that DNA belongs to everyone as well.

  113. Complicated question by pclminion · · Score: 2
    A lot of people are arguing that DNA should not be patentable because it is a natural object, and has existed longer than humanity, and therefore cannot be an invention.

    This is definitely the crux of the issue, but I think it's slightly more complicated. Imagine that the patent system had been invented before the discovery of the lever (ok, just for the sake of argument). Should a person be able to patent the lever? Did they discover the lever, or invent it?

    Given the laws of physics, there is the potential for the existence of a lever, and lever-like objects can exist even if human hands did not make them. Therefore, it might be argued that the lever was discovered, not invented.

    On the other hand, you can also argue physically that levers in general cannot exist without intelligent design. In order to really be a "lever," an object must not only have lever-like characteristics, but there must also be a source of input force, and an object to which the output force is transferred. Thermodynamically, this combination is highly unlikely, and you might argue that a lever-like object is not a lever unless an intelligent being uses it as such. Therefore, the lever was invented, not discovered.

    Now, look at DNA. You can claim that since DNA existed before humans, it cannot be patented since it was not discovered. But you can also argue that, pre-humanity, DNA had no actual "purpose," since only humans create "purpose" and lower forms of life do not (this is a controversial statement). Therefore, by finding new "purposes" for DNA, such as the curing of diseases and other non-natural uses, we are "inventing," in a way. Therefore perhaps DNA can be patentable.

    To boil it down to an archetypal example: suppose a team of scientists discover a gene in a rare species of dung beetle that can be spliced into human DNA to give increased resitance to ultraviolet radiation. Should the team of scientists be able to patent this use of the gene? Note that this is a patent for a specific "use" of the gene, not the gene itself.

    I think that if a team of people has put in the effort, time, and frustration to discover something like that, they should be allowed to benefit from their research. As long as DNA patents are patents on "uses" and not the genes themselves, it doesn't bother me much.

    1. Re:Complicated question by Mourice · · Score: 1

      I think what would be better than the scientists in the example patenting the gene would be allowing them patent the procedure. If another team came up with another, better way to do the same thing, patenting the use would be hindering the people using the second team's discovery. I think the first one is anti-competitive. We need to keep costs down on gene-splicing technologies. We, the consumers, will benefit from it.

      --

      No excellent soul is exempt from a mixture of madness. --Aristotle
  114. if i discovered a new island, could i be king? by Anonymous Coward · · Score: 0

    DNA patenting ensures that if i invest money in finding a relation between an illness and a certain strand of DNA (which is quit difficult), i'm entitled to earn some money from it. If you want those discoveries to be available in the open domain, then provide universities etc with more money.

  115. Unauthorised reproduction... by TheLink · · Score: 2

    We'd better get all IP on our own DNA quick.

    And you better not get any DNA treatments without checking the fine print.

    Coz if you ever have kids, some corporation may sue you for unauthorised reproduction of their "intellectual property".

    There shouldn't be such a thing as intellectual property. Because if you try to scale, it can end up this way:

    "I own this thought, so you can't think of it without my permission".

    Because in a possible future, thoughts, brains, machines, computers could be intertwined.

    That said, lying is still wrong: e.g. saying "I thought of this first" when you didn't. This rule scales.

    --
  116. something i've thought about recently by ziaz · · Score: 1

    Lately, I've been asking myself, why does everyone expect the software industry to give everything away for free and open source all the time and other industries rarely if ever do? Has there ever been pharmaceuticals released open source or something similar? I know you can't really hack out new drugs when you come home from work like you could with code, but still, some companies in the software world find ways to release their work as public domain, so why can't the pharmaceutical industry? I can't help thinking that us developers are simply suckers. We give away for free what most other sane people would make money from. Are software developers merely like employees in the Ferrengi Rules of Aquisition? "Employees are merely rungs on the ladder of success, never hesitate to step on them to get ahead"

  117. SIMPLE by fferreres · · Score: 0

    Economics knows the answer as it is a very simple on: harvest the demand curve.

    Translated:

    Bill Gates has cancer? pay the FULL price (production+reseach coverage) if you want to live. Maria Teresa de Calcuta has cancer? Pay the cost of production only. Giving her the drug at production cost doesn't make Bill Gates or the company worst than if she it left to die.

    Profit lost: $0

    Oh, wait! Maybe it does... how about the goverment pay for her life? Cool, now everyone pays royalties (taxes anyone?).

    Result: everyone in a poor country MUST die. US goverment health care costs are prohibiting.

    What is the problem with the solution?

    Being able to survive while others poor bastards die of that same thing is important so that the affording guys agree on paying the normal price. Else, they would rant and try to avoid paying or will try to prove they can't afford it and things like that. After all, the American Dream is about the comunism of prices.

    Anyway, the USA labs are stating to realize this makes sense. Some (very few) vacines are being sold in Africa at production cost while they are charged full price in the USA. Why? Not because it makes sense, but because (for example) South Africa stated they will copy/pirate any patent their poors can't afford.

    Note: i am NOT a communist, read the post again if you think so.

    --
    unfinished: (adj.)
  118. Libel laws... by BlueUnderwear · · Score: 2
    As anybody who runs an online forum knows, intellectual property is a two-edged sword. Either the author holds the copyright to his comments, in which case only the author is responsible for its contents, and any law that it infringes (libel, slander), but the board owner may not use those comments in a different context.

    Or the editor (board owner) holds the copyrights, in which case he may do whatever he wants with the contributions, but he is also responsible for any laws that may get violated.

    Shouldn't it be the same in biotech: if a company is stoopid enough to patent the genetic sequence of AIDS, shouldn't it be then forced to also accept legal responsibility for AIDS. I.e. face "wrongful death" lawsuits from each and every victim of AIDS. And if the company maliciously withheld treatment, or sold that treatment too expensively, add blackmail and murder to the list of accusations...

    --
    Say no to software patents.
    1. Re:Libel laws... by nerdlyone · · Score: 1
      Shouldn't it be the same in biotech: if a company is stoopid enough to patent the genetic sequence of AIDS, shouldn't it be then forced to also accept legal responsibility for AIDS. I.e. face "wrongful death" lawsuits from each and every victim of AIDS. And if the company maliciously withheld treatment, or sold that treatment too expensively, add blackmail and murder to the list of accusations...

      Yeah, and all those biotech companies right now that haven't yet come up with a cure for AIDS should be held responsible for millions of murders. After all, it is our right to have these companies make cures for us. And once they invest their millions, the product of their research should belong to the public, not the company. That way many more companies will doubtless join the biotech industry! Wouldn't you?

    2. Re:Libel laws... by Anonymous Coward · · Score: 0

      What the fuck are you talking about? You make no sense whatsoever.

    3. Re:Libel laws... by nerdlyone · · Score: 1
      What the fuck are you talking about? You make no sense whatsoever.

      Yes, I know sarcasm is hard to understand. You see, it all starts when someone says one thing, but they mean the literal opposite of what they said. I agree, it can be confusing.

      The point of my particular sarcasm was to disagree with the earlier post, which I quoted. Again, I know this kind of thing is hard to follow. You see, I overtly AGREED with what that person had posted, while also stating a ridiculous analogy to their reasoning. By stating the ridiculous analogy, I was hoping to alert people that my own opinion differed from what I was actually saying. That is the sarcasm part. Again, if it makes your head hurt, just go back to sleep or drooling on your keyboard or whatever it is you are doing.

  119. genetic engineering? by BorosAttila · · Score: 1

    Correct me if I'm wrong, but one can patent only one's intellectual property. If somebody discoveres a gene, that doesn't mean he invented it. If he makes a synthetic gene, it's OK to patent it, but it probably will be useless. We, humans, have all genes that defines us as being humans, adding some synthetic genes most likely will turn us in something... weird...

  120. fees by Anonymous Coward · · Score: 0

    If people were allowed to hold IP rights on their genes, would I have to pay licensing fees to my parents?