Slashdot Mirror


Patent Cases Hurting Small Businesses

smudge writes "An Information Week article states that multiple small businesses with Web presence are being sued by PanIP LLC. The claims in these patents being asserted in the lawsuits refer to 'a computerized system for selecting and ordering a variety of information, goods and services' and 'an automatic data-processing system for processing business and financial transactions between entities from remote sites.'"

220 of 320 comments (clear)

  1. Vague? by Manhigh · · Score: 5, Insightful

    I'd think any patent that uses phrases like "a variety of" is too vague.

    --
    "Open the pod by doors, Hal" > "I'm afraid I can't do that, Dave" sudo "Open the pod bay doors, Hal" > alright
    1. Re:Vague? by g4dget · · Score: 5, Funny

      Obviously, they didn't have a good patent attorney. Good patent attorneys know that they should say "a plurality of"--it makes the patent sound more serious.

    2. Re:Vague? by Anonymous Coward · · Score: 1, Funny
      Moderated as "Funny" !?

      It's true (IMHO), but surely not Funny.

      There's something wacky about the moderations happening these days.

    3. Re:Vague? by krazyninja · · Score: 4, Interesting

      Actually, there are many patents out there which extend their claims this way. And having come across several patent lawyers myself, it looks like its standard procedure. All patents end with phrases like "experts well versed in this field would know that this invention is not limited to (whatever the patent mentions) but also to related fields". I am forced to believe it now :(
      I have a list of such patents here

      --
      "Do something man. Right now."
    4. Re:Vague? by krazyninja · · Score: 1, Redundant
      Actually, there are many patents out there which extend their claims this way. And having come across several patent lawyers myself, it looks like its standard procedure. All patents end with phrases like "..experts well versed in this field would know that this invention is not limited to (whatever the patent mentions) but also to related fields...". I am forced to believe it now..
      I have a list of incredulous patents here.

      --
      "Do something man. Right now."
    5. Re:Vague? by Eythian · · Score: 1, Funny

      I'd think any patent that uses phrases like "a variety of" is too vague.

      I'm considering patenting ``a method of doing a variety of things with the internet'', and suing all /. readers.

    6. Re:Vague? by k98sven · · Score: 3, Insightful

      All patents end with phrases like "experts well versed in this field
      would know that this invention is not limited to (whatever the patent mentions)
      but also to related fields"


      Am I the only one thinking about the tale of "The Emperors new clothes" right about now?

    7. Re:Vague? by informed · · Score: 1

      there are aboute 10 times more mod points given out lately, follow cmdr'r taco's log.

      (This is offtopic, I know)

    8. Re:Vague? by PMuse · · Score: 3, Insightful

      I'd think any patent that uses phrases like "a variety of" is too vague.

      Not that I'm defending these putzes, but using the word "variety" here is not entirely crazy. For instance, Amazon.com is well known for selling a variety of merchandise on the net. Do you think it makes any difference what gets sold when you're talking about how they sell it?

      If I patent an ink pen capable of writing in a variety of colors by extending one of several ink tubes out of an apature at the bottom of a pen, is it unpatentable because I used the word variety? No. It's unpatentable because people have been selling 4-color pens since at least the 1970s.

      I think this patent is ridiculous, but for other things, not for that.

      --
      "We reject as false the choice between our safety and our ideals." --The American President (20.1.2009)
    9. Re:Vague? by ajf442 · · Score: 1

      I wonder where you got the patent number (5670990) from?

      According to USPTO.gov, it is:

      Integral ball cage for pointing device

      Abstract

      An electronic mouse with an integral ball cage. The ball cage in one embodiment has integrally formed extensions having openings for enclosed shaft encoders and a pressure roller. The shaft encoders are preferably made of a single piece of plastic. The ball cage is preferably formed as part of the lower housing of the mouse.

      When the AC wanted to make up a patent number did he/she just look on the bottom of his/her mouse?

      Funny!

  2. Vending machines... by thenextpresident · · Score: 4, Insightful

    "The patents, No. 5,576,951 and No. 6,289,319, cover, respectively, an "automated sales and services system," and an "automatic business and financial transaction-processing system."

    Vending machines anyone?

    --
    Jason Lotito
    1. Re:Vending machines... by cei · · Score: 4, Interesting

      Sorry. The same guy patented computerized vending machines too, back in 1986...

      --
      This sig intentionally left justified.
  3. Okay - this is getting stupid by raydobbs · · Score: 4, Insightful

    Patent abuse should really be punishable. I mean, patents were made to stifle innovation, they were made to promote it. Now we've got every tom-dick-and-harry patenting blatently prior art things, or just commonplace market things, and attempting to sue people out of existance.

    Let's just make it that if you patent something that is reviewed, and sounds like a dug-headslap type thing - you get a toenail pulled out with a pair of pliers. On severe cases - just bring back public stoning (no, not drug induced bliss - bludgeoned to h*ll with big fu***** rocks) for the offending numbskull, and his/her lawyer.

    1. Re:Okay - this is getting stupid by Soko · · Score: 5, Funny

      Let's just make it that if you patent something that is reviewed, and sounds like a dug-headslap type thing - you get a toenail pulled out with a pair of pliers. On severe cases - just bring back public stoning (no, not drug induced bliss - bludgeoned to h*ll with big fu***** rocks) for the offending numbskull, and his/her lawyer.

      Sorry, but I already have a patent pending on this exact method. You'll hear from my solicitor in the morning (never liked him anyway). :P

      Soko

      --
      "Depression is merely anger without enthusiasm." - Anonymous
    2. Re:Okay - this is getting stupid by H310iSe · · Score: 2, Insightful

      reminds me of a Chris Rock joke (recently heard in Bowling for Columbine). ...innocent bystanders getting killed ... one simple way to solve the problem, make bullets cost five thousand dollars. That way no one would be shooting them all over the place, you'd be damn sure you hit what you were aiming at (acts like he's looking down at a dead guy) damn, they put $15,000 worth of bullets in his ass, he musta done SOMEthing bad...

      Just make everyone who unsuccessfully sues to defend a patent pay for all the court costs for both parties.

      --
      closed minded is as closed minded does
    3. Re:Okay - this is getting stupid by Raw+Ostrich · · Score: 5, Insightful

      There is a bright side to this. When it comes to immaterial rights, thigs need to get worse before they get better. The inertia of the status quo has to be overcome by unbearable stupidity and cost of the current legislation. I would urge everyone to seek patents whenever possible, as broad as possible and as harmfull to development as possible. Lets get it over with and move on...

    4. Re:Okay - this is getting stupid by nemesisj · · Score: 5, Interesting

      I've got a friend who has a friend that works in the USPO and he was telling me how ridiculous it is to work there. Basically, you're supposed to nail predatory patents like these obviously are, but this guy who works there gets creamed by his boss whenever he tries to deny a patent. His boss is involved in all sorts of payoffs and dirt - I literally couldn't believe the stories he was telling. He later got put on a committee that was trying to track fraud and they figured out that some really high percentage (don't remember exactly, but it was over half) of the patents are frivolous and completely bunk. One tactic lots of patent filers like to use is to send in a 25 page document, and the first 24 pages are garbage designed to lull the reviewer to sleep, then they slip in a couple of paragraphs that involve what they're really trying to patent at the end. So to sum things up, its his opinion that the whole system is completely out of control, which is too bad, and he also thinks its so broken it can't be fixed, which is where things REALLY begin to suck.

    5. Re:Okay - this is getting stupid by mOdQuArK! · · Score: 5, Interesting
      His boss is involved in all sorts of payoffs and dirt - I literally couldn't believe the stories he was telling.

      I wouldn't be surprised - our (very small) company has been fighting a huge company over the violation of one of our patents, and they're using the strategy of delaying the reviews of our patent so that we can't go to court (and they are hoping that our little company will eventually die).

      We've fought off their challenges to our patent FOUR times (now going on a fifth reexamination), taking over 4 years now. Each time, the primary examiner has revalidated our patent - and then his boss overrides his conclusion & throws our patent out (the same boss each time), usually without a reason.

      Needless to say, we've got some questions about the motivations of the patent examiner's supervisor - but there isn't anything we can prove, and due to the rules of the Patent Office, we can't get anyone else to look at the case.

    6. Re:Okay - this is getting stupid by siskbc · · Score: 2, Informative

      For the majority of you who don't read the articles, they DO have contact info for PanIP at
      www.youmaybenext.com/who.html. ;)

      Unfortunately, their site seems to be removed (www.panip.com), though it gives you a directory listing. I'm surprised this site is still standing.

      Also, is there any way that the ./ community can help on this one? Make our views known to rmercado37@yahoo.com and info@panip.com?

      I wonder if the victims' organization takes donations to their defense fund? I'd throw them $10, how about the rest of you?

      --

      -Looking for a job as a materials chemist or multivariat

    7. Re:Okay - this is getting stupid by Tablizer · · Score: 1

      Basically, you're supposed to nail predatory patents like these obviously are, but this guy who works there gets creamed by his boss whenever he tries to deny a patent. His boss is involved in all sorts of payoffs and dirt

      Payoffs?

      It would take just one good exposure of this to bring attention to the problem. A Marrian-Berry-like hidden video camera or something.

      Payoffs would explain the stupidity. However, shear gov slackery and lack of checks and balances alone could account for it too.

    8. Re:Okay - this is getting stupid by 5KVGhost · · Score: 2

      Each time, the primary examiner has revalidated our patent - and then his boss overrides his conclusion & throws our patent out (the same boss each time), usually without a reason.

      How about speaking to the boss's boss? Even if they can't directly intervene in the case they've gotta be able to take a look at what their own employees are doing.

    9. Re:Okay - this is getting stupid by mOdQuArK! · · Score: 3, Informative

      According to the rules (as I understand them), the only higher authority in the PTO is the Patent Office Appeal board - and the appeal board has a 6 month waiting list before they'll even tell us whether they'll take the case. (If anyone knowledgeable about difficulties with the Patent Office has any suggestions, I'll love to pass them on to my boss!)

      Not only that, but we are technically winning each re-exam so we do not have the standing to take our case to the Appeals board, but then the examiner's supervisor keeps letting the big company submit "a little more" prior art (BS stuff which is easy to refute) to force a new re-exam, which lets them delay the court case for 4-8 months (the judge doesn't want to do anything until he gets a firm "patent is valid/not valid" indication from the Patent Office).

      We are hoping that because this is the 5th re-exam (and four were in our favor), that the judge will decide that "enough is enough" and let the case go forward (in which case we're expecting to kick butt), but in the meantime we're just a small company with our IP in an uncertain status trying to stay afloat in a bad economy.

  4. don't re-invent the wheel...PATENT it by babylon93 · · Score: 5, Insightful

    Too bad these people seem so be trying to get their money from suing others rather than perfecting the magic of E-commerce, which they basically claim to have invented.

    1. Re:don't re-invent the wheel...PATENT it by jeffy124 · · Score: 2, Funny

      I'm still waiting for the patent on "cylindrical/circular device to facilitate movement in a single direction"

      --
      The One Rule Of Chess You'll Ever Need: Don't play someone who carries a kit in their bookbag.
    2. Re:don't re-invent the wheel...PATENT it by arb · · Score: 2
  5. deja vu by outlier · · Score: 5, Informative
    PanIP has been mentioned in slashdot before.



    It seems that the disease that is PanIP has been spreading...

    1. Re:deja vu by mstyne · · Score: 2

      I agree wholeheartedly. Pardon my French, but upon getting about halfway through the story, I thought "Oh man, not these fucks again..."

      Ass clowns like PanIP need to ... have something hideously painful and violent done to them. It's late, I can't be any more creative than that.

      --
      mstyne: real name, no gimmicks
    2. Re:deja vu by Unordained · · Score: 1

      yior french eez nut pardunned, silli ameriken! but ze ass claouns, zei must bee maid to pe!

  6. Is that so? by neksys · · Score: 5, Insightful
    In that case, I'd like to assert my own patent on 'a physical system for selecting and obtaining a variety of goods and services' and 'a electronically assisted, human-run data-processing system for processing business and financial transactions between entities at a physical location.'"

    Namely - any store or business with a cashier.

    1. Re:Is that so? by absurdhero · · Score: 1

      Hmm. i think i should take on this patent with the prior art of my lemon aid stand from 15 years ago.

    2. Re:Is that so? by Anonymous Coward · · Score: 2, Funny

      What sort of help did your lemons need?

  7. patent patents? by technoid_ · · Score: 5, Funny

    Some one needs to phrase the job of the US Patent office really vaguly and then get a patent on it. Then sue the patent office for patent infringement.

    hmmm, wonder if i could make this into a business plan and get some VC behind me...

    --
    Two wrongs don't make a right, but 3 lefts do - Lew of GO magazine
    1. Re:patent patents? by Henry+V+.009 · · Score: 2

      Filing as we speak: A government system for appropriating the obvious and awarding it, by order of legal expenditure magnitude, to corporate entities unable to compete without government-granted intellectual property monopoly.

    2. Re:patent patents? by EmagGeek · · Score: 3, Funny
      "Method and apparatus for the protection of methods, procedures, and apparatuses by grant of exclusive rights by a governing body having executive authority over such rights" (Grant of Patent)

      "Method and procedure for the dismantling of civilized society by exclusive diversion with legistative processes" (making people so busy defending themselves against lawsuits to do anything productive)

      "Method and apparatus for the production of intellectual property and information by means of the exercise of a passive or active electromechanical or electronic relay causing the dissipation of energy in various ceramic, plastic, semiconductor, or organic elements, causing the semi-permanent organization of atomic or subatomic particles on a dielectric, metallic, organic, semiconductor, ceramic, or plasticine substrate, also causing the luminescence of phosphorescent or electronic optoelectrical or optoelectronic elements." (use of computer)

      Sorry I couldn't get any more vague than that.

    3. Re:patent patents? by Jobe_br · · Score: 2

      Your description of the computer is first rate. Absolutely excellent. I'm literally typing this from where I fell on the floor, next to my chair. Thank you!!

    4. Re:patent patents? by Tablizer · · Score: 2

      Some one needs to phrase the job of the US Patent office really vaguly and then get a patent on it. Then sue the patent office for patent infringement.

      It would come back with the explanation, "being a dumbshit" is too vague.

      Then you reword it, "using a computer or network to be a dumbshit" and it will go through without a hitch.

    5. Re:patent patents? by phvvrt · · Score: 1

      Interesting... while looking up the patents on USPTO.GOV I noticed that they have a shopping cart. I wonder if they'll get sued or if they've already paid the extortion, er, umm, license fee?

  8. Ummmmmm by Anonymous Coward · · Score: 1, Insightful

    The patents PanIP bases its lawsuits on were granted-the first in 1996 and the second last year-to Lawrence Lockwood, now a principal of PanIP...(etc)

    WTF. One of these patents was granted LAST YEAR? Hmm, oh no, there were NO e-commerce sites LAST YEAR. There is no PRIOR ART. PAY UP EVERYONE.

  9. is it just me or.... by the_2nd_coming · · Score: 4, Insightful

    is 1996 seem a little to recent to have a good claim for a patent? now if it had been around 1990 then sure I could see how they think they have a good patent, but 1996!!! my god....businesses were doing web sales for a few years before these yokels said "hey that sales system is not patented..."

    --



    I am the Alpha and the Omega-3
    1. Re:is it just me or.... by zurab · · Score: 5, Interesting

      businesses were doing web sales for a few years before these yokels said "hey that sales system is not patented..."

      Even the article states:

      DeBrand, literally a mom-and-pop shop in Fort Wayne, Ind., has been selling its homemade chocolates over the Web "practically from the beginning, probably seven, maybe eight years...

      and several paragraphs later:

      The patents PanIP bases its lawsuits on were granted-the first in 1996...

      This makes no sense. The shop has been selling stuff online since 1994-95. USPTO, with its head buried in the dumpster, approves and hands the patent to PanIP in 1996 on the obvious prior art stuff that had been going on by thousands of companies/individuals for years before. PanIP turns around and sues small companies that can't afford to defend against patent infringement and would probably rather pay $5k.

      Note the following:

      1. To PanIP: the company that you are suing has prior art to your patent if your accusation is correct that they are infringing in the first place. They have been in business longer and actually *doing* what you patented couple of years later.

      2. I hope the judge sees (a) the obviousness and numerous prior art of the patents, (b) the ill intent of PanIP, LLC, (c) the frivolous and wrongful lawsuit brought by PanIP, and dismisses the lawsuit, awards legal expenses plus punitive damanges to the defendants, and orders to close down PanIP, LLC, put all its patents in public domain, and orders its founders/owners and laywers to spend 3 months in community service and 9 months living with GNU/RMS at their own expense!

      3. USPTO will approve any patent claim that contains the word "apparatus". It seems like this is one of the qualifying criteria for approval. I can probably get an approval for a patent for an "apparatus that hammers the nails in the wood", or an "apparatus that can roll in a circular motion on any surface". Hey! why not - check out the infamous method of swinging on a swing granted on April9, 2002?

      4. This has got to stop! Write to your local corporate representatives in DC and tell them this is devastating for local small and medium size business!

      5. USPTO database and website should be turned into a comedy and satire website and public entertainment source (Ok... done already), but remove most of their entries' legal implications. On a side note, when you are bored and have nothing to do try searching patents on your favorite activity. How about a tub for bathing granted on June 25, 2002 solely from the drawings?

    2. Re:is it just me or.... by PaxTech · · Score: 3, Funny
      ...and orders its founders/owners and laywers to spend... 9 months living with GNU/RMS at their own expense!

      Unfortunately, cruel and unusual punishments are prohibited by the Constitution, and this is certainly both.

      --
      All movements for social change begin as missions, evolve into businesses, and end up as rackets.
    3. Re:is it just me or.... by octalgirl · · Score: 2

      You've got to be kidding me! (quote from Swinging on a Swing patent):

      "The user may even choose to produce a Tarzan-type yell while swinging in the manner described, which more accurately replicates swinging on vines in a dense jungle forest. Actual jungle forestry is not required."

      This doesn't bode well for technology patents.

    4. Re:is it just me or.... by ergo98 · · Score: 1

      I really don't believe that it's possible to have a faultless patent office: There are millions of inventions yearly, and patent examiners aren't infalliable - There is no way that they can know everything about everything, all while maintaining a brain history of every patent ever filed to avoid overlap. On top of that, the patent office really seems to have a policy of "grant the patent and let the courts settle it if conflict arises", which may be fair. If the swing guy (whose satirical patent is brilliant) tries to start suing children, then the real validity will come to play. Let's face it: Most patents filed have been filed just so that the maker can claim 40 patents on a plunger or flashlight (of course some of them are too lazy, and just claim the even more worthless "patent pending").

      The real issue comes into play when courts are involved. It seems to me (personal opinion, not statement of fact) that this PanIP is a predatory patent abuser that engages in willful barratry, with specific intent to limit the venue of justice for their victims (i.e. the onus of responsibility to be forced to travel to their court district alone is financial incentive to just pay up to their, in my opinion, blackmail). If the patent office insists upon granting any patent, then lawsuits involving patents should be more balanced: If you want to sue someone for a patent, a summary judgement regarding the financial capability of both parties should be completed and if it's against a small, low income company (hence almost certainly patent blackmail), then the petitioner can go to their district and fight it out.

    5. Re:is it just me or.... by Marc2k · · Score: 1

      A method of swing on a swing is disclosed, in which a user positioned on a standard swing suspended by two chains from a substantially horizontal tree branch induces side to side motion by pulling alternately on one chain and then the other.

      Side to side? Let them have their fun, I like swinging forward and backward best, anyway.

      --
      --- What
    6. Re:is it just me or.... by budgenator · · Score: 2

      United States Patent 6,289,319 Lockwood September 11, 2001
      Inventors: Lockwood; Lawrence B. (5935 Folsom Dr., La Jolla, CA 92037) Appl. No.: 347270 Filed: November 30, 1994

      the gist of this seems to be that the USPTO took 6 years and 11 months to approve this patent! I think the art priori is from the conception date not the filing or granting date.
      typicaly an inventor will make a draft of his idea and mail it to himself using the postmark as proof of conception date. More technicaly savy will do it on a computer and publish the MD5SUM in the news paper for proof. just noticed the granting date in preview, 9/11/2001!

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
  10. Bullshit...... by Gene303 · · Score: 1

    Fucking money grubbing gluttons these people. But that is the nature of our fine democracy isn't it. Can't get out the image of our president given a speech on patents a few days ago out of my head. This case truly highlights the weakneses in out patent system. Unless, of coarse, the claims these PanIP people lay prove fruitless, as I suspect they will. And if they don't I'm moving to canada.

    --
    im a hippie
  11. Interesting related link... by TheGreenGoogler · · Score: 1, Redundant

    A Google Cache of a site by those being sued can be found here... It brings up several interesting questions...

    1. Re:Interesting related link... by Call+Me+Black+Cloud · · Score: 1

      Looking at the cache, I think they are now this site.

    2. Re:Interesting related link... by toomz · · Score: 1

      They claim that if you use graphical and textural information on a video screen for purposes of making a sale, then you are infringing on their patent.

      Wow... That's almost vague enough to cover any TV ad that provides a 1-800 number. Look out Ron Popeil!

      --
      If a chair is thrown in a forest, and there are no witnesses, did Ballmer still do it?
  12. web patents are lame by D4Vr4nt · · Score: 1, Interesting

    Web patents are exteremly lame.

    - Amazon 1 click shopping for example (I know this is old news, but gawd damn).

    While they're at it they should patent, hovering over "a href" tags, or utilizing bold statements for emphasizing a title.

    Trying to place patents on web sites / ecom, is about as effective as pothole fixing in NY.

    --
    R4NT.com - A great many people think they are thinking when they are merely rearranging their prejudices.
  13. Vague and foolish by Facekhan · · Score: 5, Interesting

    Can you imagine if this lawyering tactic and blatant abuse of an overburdened patent office had taken place 150 years ago. I could patent things like "a way to use electricity for an artificial light source" and then I could have sued Edison or perhaps I could have patented "a method of towing freight along metal rails" and the railroad and locomotives would have been sued into non-existence. Its insane.

    1. Re:Vague and foolish by SmallFurryCreature · · Score: 3, Interesting
      You second patent would be easily circumvented. Just put the locomotive behind the freight.

      That is really the problem here. Where patents used to be almost complete inventions, with a working touchable product behind them. (So for instance the patent for the black-and-decker workmate involves technical drawing showing you how to build one.) Modern patents seem little more then concepts. (Yeah like maybe if I made somekind of raised surface with bits you can build things on).

      Sadly this seems obvious to all normal people. Problem is of course that normal people have little to do with this. Judges are famous for some pretty idiotic descions, in lower courts. And jury's must be specially selected for their unpredicatablity. Simpler to cough up the license fee then risk biting the dust and still having to pay the license fee, youre own attorny fee, the courts time, and the oponents legal fee, while all the time you can't run youre small business effectively.

      But considering their methods, if one of the defandents manages to win, couldn't PanIP be sued for racketeering?

      --

      MMO Quests are like orgasms:

      You may solo them, I prefer them in a group.

  14. New patent ideas... by Kevin+Burtch · · Score: 1

    .
    I want to patent frivolous lawsuits!

    Heh... I'd get as rich as BillyG in a year from
    South Florida alone!

    --
    - Preferences: Solaris 10 (servers), Ubuntu (desktops), Solaris 11 (personal servers) -
  15. To file a Patent Protest... by thenextpresident · · Score: 5, Informative

    Please file a protest for patents 6,289,319 and 5,576,951

    "1901.01 Who Can Protest
    Any member of the public, including private persons, corporate entities, and government agencies, may file a protest under 37 CFR 1.291. A protest may be filed by an attorney or other representative on behalf of an unnamed principal since 37 CFR 1.291 does not require that the principal be identified."
    http://www.uspto.gov/web/offices/pac /mpep/document s/0841.htm#sect1901.01

    --
    Jason Lotito
    1. Re:To file a Patent Protest... by Florian+Weimer · · Score: 3, Informative

      Any member of the public, including private persons, corporate entities, and government agencies, may file a protest under 37 CFR 1.291.

      Nice idea, but 1.291 reads:

      1.291 Protests by the public against pending applications.

      It's too late for this kind of action.

    2. Re:To file a Patent Protest... by Kindaian · · Score: 1

      Not that simple... The stupid US laws don't accept prior art from ourside US for one thing... and for another... is any evidence that is found by a judge/jury as not valid is "for ever" forbiden to be reevaluated due to new aditional information.

      Sum to that the normal ignorance of judges/juries of any kind of tecnical things and you have what you get today... a system that doen't work and is moving to a stop...

      European laws and methodologies are unfortunatly going in the same direction... with the only diference is the way laws are applied on Europe, which tends to make the whole process much slower and smooth... but on the other hand, makes it last much longer also...

      Cheers...

  16. utilitarian by intermodal · · Score: 2

    I seem to recall not allowing patents that were "utilitarian in nature" listed somewhere in law...I don't remember exactly where though. Might not even have been US law, but if anyone knows where this was from, let me know...now I'm curious.

    --
    In SOVIET RUSSIA... erm...NSA AMERICA, the Internet logs onto YOU!
  17. How fun... by Crasoum · · Score: 3, Interesting
    The article also mentions patents about one click shoppign and name your price e-commerance... Who is to say slashdot couln't be sued for say.... using a image of a PDA?

    And yet another part of the article bothers me...

    Yet PanIP may not be simply going after low-hanging fruit. Some patent attorneys speculate that it may be looking to build a war chest to take on larger companies. It also may be looking for legal precedents for its patents-either decisions in court or a critical mass of settlements-that would bolster lawsuits against big E-commerce companies, such as Amazon.com Inc. or eBay Inc.

    It seems scarry how some coperation may potentially come after me, for me using a system I invest a mild amount of trust in, just because I -trust- the system. They coming after me, just so they can use me as a stepping stone to attack E-bay is even MORE frightening.

    And I was scared using my credit card online.... This may cause much worse damage.

  18. "Sorry, I've got some bad news..." by pavera · · Score: 1

    I develop web sites for small businesses, many of them ecommerce or that move some business services to the web,

    do I just go to all of my clients and say "Oh btw, this technology is patented, it will cost $5000 more to build the site"?

    the patent license alone is more than 5 times what I normally charge for a site design. This is ridiculous.

  19. The whole legal system needs to be changed by SexyKellyOsbourne · · Score: 5, Insightful

    In the United States, people currently can sue each other for any reason and any thing, and usually win, thanks to the corrupting influence of trial lawyers in Washington, DC.

    There is hope, however; tort reform is taking storm in many states, and it's preventing such frivolous lawsuits from taking place.

    If you don't want these small businesses to be persecuted, then drop the keyboard and write your state and federal Congressmen by snail-mail and demand that he or she fight in the Capitol for real, meaningful tort reform.

    Don't wait until tomorrow -- do it now!

    1. Re:The whole legal system needs to be changed by jeffy124 · · Score: 5, Insightful

      The problem centers around "nothing to lose" cases, where the plantiff has nothing to lose by losing the lawsuit.

      In many countries (US is not one of them), if you sue someone and lose (or get caught under perjury or something), you must pay for the defendant's legal fees, and get opened up to counter-suits from the defendant. In the US, unfortunately, the plantiff can just walk away from a lost suit as if nothing happened, despite how much work (and money) a defendant can put in to defend himself. This is especially true for lawyers that hire themselves out on contingency.

      --
      The One Rule Of Chess You'll Ever Need: Don't play someone who carries a kit in their bookbag.
    2. Re:The whole legal system needs to be changed by Billly+Gates · · Score: 5, Insightful

      Tourt reform is sponsored by the mega corps to reduce consumers right to sue. ITs all about profit for them. At least that is Bush's version of it. Polluters love tourt reform since its expensive to prove that the pollants they discharge cause damage and to prove it would cost tens of millions of dollars. Insurance companies also love it because they can charge the same price for insurance and rake in more profits.

    3. Re:The whole legal system needs to be changed by broken_bones · · Score: 5, Insightful

      The idea of "nothing to lose lawsuits" is a double edged sword. On one hand if these suits are allowed then you have to worry about the possibility of having to defend against one. On the other hand if a losing plaintiff is liable for the legal fees of the defendant it provides a severe advantage to large corporations. No little guy in his right mind would ever sue a megacorporation if he had to pay said megacorporations legal fees in the event of a loss. Losing without incurring that liability is already a very expensive proposition.

      Personally I think the key to tort reform is to remove the profit insentive to lawsuits by diverting punative damages to education. This would mean that if you sue Huge-Mega-Corp for something and win you would collect actual damages (ie restitution, money to compensate you for what you actually lost/suffered). Any punative damages (punishment, the bazillion dollar sums that are supposed to say "don't do that again") awarded would go to an education trust used to buy books, computers, college scolarships etc. for your state.*

      *This is the first time I have ever floated this idea to anyone. If you see holes in it please respond so I can avoid looking like an idiot in the future.

      --

      Never disturb your enemy while he is busy making a mistake.
    4. Re:The whole legal system needs to be changed by Henry+V+.009 · · Score: 2

      On the other hand, modern consumer lawsuits are so random in application and award that rather than causing good behavior in large corporations, they instead create a climate of uncertainty which serves to sieze up the gears of capitalism through what amounts to a government mandated legal tax across the board, accomplishing little public good except the certain enrichment of the legal class and a lottery type system of enrichment of certain citizens through chance rather than meritorious conduct; structural reform may be impossible, therefore proposed tort reforms seek mainly to reduce the magnitude of the legal tax.

      Look, Mom, no periods!

    5. Re:The whole legal system needs to be changed by Anonymous Coward · · Score: 1, Interesting

      There's also the issue of actually defending yourself. If you lose, you still need to pay the bill to the attorneys. In the PanIP defense case, that can take years, meanwhile your attorneys suck you dry until if you perhaps win your case.

      Tort reform is not the solution -- it only protects the corporations with big pockets, but doesn't do anything for the small business, as is the case here.

      A defense for DeBrand chocolates might take millions of dollars. I know this company -- I live in Fort Wayne, they don't own millions of dollars -- and I don't know of many lawyers who would donate years worth of service without anything to show for it. You might find one, but don't count on it.

      And so what if PanIP were forced to put up a bond? They still have the money to do it. And until the case was settled, DeBrand still has the case above.

      So even Tort Reform (in this case) wouldn't help DeBrand chocolates.

    6. Re: The whole legal system needs to be changed by Black+Parrot · · Score: 2


      > Tourt reform is sponsored by the mega corps to reduce consumers right to sue. ITs all about profit for them.

      Also, tort reform is the issue where I first heard about astroturfing. Way back 10-15 years ago a consortium of big companies hired a law firm in Florida to play middle man and piled zillions of dollars into small businesses' coffers in exchange for getting them to speak up in favor of a tort reform bill written by and for the biggest corporations. When the story broke the law firm didn't even try to deny it, though they did decline to name the players.

      --
      Sheesh, evil *and* a jerk. -- Jade
    7. Re: The whole legal system needs to be changed by Black+Parrot · · Score: 3, Interesting


      > On the other hand, modern consumer lawsuits are so random in application and award that rather than causing good behavior in large corporations, they instead create a climate of uncertainty which serves to sieze up the gears of capitalism through what amounts to a government mandated legal tax across the board, accomplishing little public good except the certain enrichment of the legal class and a lottery type system of enrichment of certain citizens through chance rather than meritorious conduct; structural reform may be impossible, therefore proposed tort reforms seek mainly to reduce the magnitude of the legal tax.

      Unfortunately, the only tort cases you ever hear about are the ones with apparently unfair verdicts and/or extreme penalties. Yeah, there are abuses, but I'm not convinced that they amount to more than a small fraction of all cases. Based on my experience with being called out for jury duty, there must be hundreds or even thousands of tort cases in court every day. And most of them are the result of one company suing another, not of some deadbeat playing the courtroom lottery.

      Also IMO there is a grave risk associated with capping tort payouts. If we put a cap of, say, $1,000,000 on wrongful deaths we'll end up with corporate accountants trading lives for profits in the most direct manner imaginable. (I suspect this already happens, but the uncertainty of the tort system presumably encourages companies to lean a bit toward caution in the calculation of the profits/lives ratio.)

      For instance, I was formerly associated with the petrochemical industry. OSHA had rules for red-tagging valves on pipes when someone's life would be forfeit if the valve were opened. There were still too many accidents, so OSHA wanted to insitute a lock-out on top of the tag-out, to make it physically impossible to open the valve when someone's life depended on it staying closed. The petrochemical industry fought the new rule tooth and nail. Ask yourself why the owners of a $500,000,000 plant wouldn't want a chain on a valve even to protect a human life.

      Tort reform is simply a way of saying "your life is worth less than our investment". IMO the reform we need is to institute criminal liability, not to reduce financial liability.

      --
      Sheesh, evil *and* a jerk. -- Jade
    8. Re:The whole legal system needs to be changed by Gerry+Gleason · · Score: 2
      This would mean that if you sue Huge-Mega-Corp for something and win you would collect actual damages (ie restitution, money to compensate you for what you actually lost/suffered)

      It really depends on how you determine 'actual' damages. They should include reasonable legal fees and an assessment for interest for the time taken to settle. Having gotten about $3500 from the insurance company of the idiot that totaled a restored car that I had already invested about $8000 and a lot of time ...

      Things are pretty stacked in favor of the big organization with lawyers on the payroll in just about every situation. There's got to be a way to get a quick, reasonably fair hearing to set the baseline settlement (or throw it out completely like the examples from this PanIP). Then if one of the parties wants to challenge that, the one challenging should have some liability for the other's legal fees (within limits) if they still lose.

    9. Re:The whole legal system needs to be changed by Best_Username_Ever · · Score: 2, Insightful

      I think that if an organisations' claim for patent infringement is overturned then they should automatically have to pay for the legal fees for both sides. If the problem was due to a ridiculous patent, which was dismissed, then the organisation could then sue the patents office for causing the problem in the first place. That way :

      a) The innocent party is not dragged into a legal battle on an uneven playing field to try and recoup for the legal expenses.

      b) Perhaps the patents office might start to pay more attention to the patents they approve.

    10. Re:The whole legal system needs to be changed by pavera · · Score: 2

      you have taken the Insurance companies bait, hook line and sinker.
      The insurance companies and huge corporations would have you believe that "punative damages" are where they really get hurt, however, this is not the case generally,
      in most law suits the actual damages are at least 85% of the total award, with barely %15 percent in punative damages (I know my father is an attorney, these are valid statistics of nearly 20 years of his private practice)
      recently in nevada they passed a tort reform, capping punative damages at 350,000. This means that in Nevada if your child dies because a doctor messes up, or if he dies in a car accident that is not your fault, you will only collect 350,000 (seems like a rather small sum for a lost child to me) because children have no wages, and therefore no "lost wages" and there is no way to guess as to how much they would have made in a lifetime.
      the insurance companies pushed this law through under the premise that they would then lower premiums, however as soon as it went through they said "sorry, now we'll have to study the effects of the law on our profits for the next 10 years before we can decide whether we can lower premiums". So basically everyone's screwed but the insurance companies. Tort Reform = make rich people richer, at the expense of everyone else.

    11. Re:The whole legal system needs to be changed by cybermage · · Score: 5, Insightful

      Personally I think the key to tort reform is to remove the profit insentive to lawsuits by diverting punative damages to education.

      A few of problems with that:

      First, as I see it, the truely disenfranchised (i.e., flat broke) victims of Huge-Mega-Corp's actions would not be able to attract lawyers willing to sue on purely contingency basis; and the lawyers who do so would be taking their cut out of the actual damages.

      Second, the flow of cash into an education fund like you describe would likely create a government agency to administer it. Give the government a source of money to play with and two things will happen: Much will be allocated as pork, and revenue will be sought to maintain the pork programs when the fund runs low.

      Third, restricting the punative damages to a single geographic area, if small enough, may give the tax payers who make up the jury a bias toward the plaintiff as it may reduce their school taxes.

      Instead, what might be better, would be a statuatory compensation rate for lawyers who are granted punative judgements (say 10%, up to $500/hour.) The jury could then allocate the balance of the punative judgement to government (local, state, or federal) and/or 501c3 charitable institutions suggested by the plaintiff(s). Obviously, the plaintiff's list would be submitted only after the jury reaches a verdict and determines the amount of the penalty.

    12. Re:The whole legal system needs to be changed by canadian_right · · Score: 5, Informative
      The loser should pay the winners legal fees to prevent abuse. It works great in Canada. We also have caps on punative damages. This means there NEVER billion dollar awards for pain and suffering. You can get back whatever is required to make up whtever loss your are suing for, plus reasonable damages (the cap is around $100,000). These two simple rules make silly lawsuits very rare up her in the Great White North.

      This in no way stops the little guy from suing - when he is in the right. It makes it easier because when he wins he has NO LEGAL BILLS to worry about. Of course, if you are sure you are going to win you think twice about starting, but that is a GOOD thing.

      Big coprs still try SLAPP suits, but many jurisdictions have anti-SLAPP legislation. All in all, this system works very well, not just in Canada, but in many countires whose law is based on English Common Law.

      --
      Anarchists never rule
    13. Re: The whole legal system needs to be changed by canadian_right · · Score: 3, Interesting
      In Canada there are laws that force companies to put chains on valves that would kill someone if opened. You would NOT be sued, you'd be going to jail if you did something like that as it would be a criminal matter. If companies are playing with lives where you live, you shouldn't be worrying about Tort reform, you should be pressing the government to pass some basic industrial safety regulations.

      Caps on punative damages help prevent 'lawsuit bingo'.

      All companies doing real risk analysis do have to put a price on human life. They never advertise the fact, but its the only way to do it properly.

      --
      Anarchists never rule
    14. Re:The whole legal system needs to be changed by Martigan80 · · Score: 1

      thanks to the corrupting influence of trial lawyers in Washington, DC.

      I think the judge that listen to these lawyers should also be recognized in "helping" them win.

      --
      This SIG pulled due to lack of funding. (This damn war is costing too much!)
    15. Re:The whole legal system needs to be changed by EmagGeek · · Score: 2, Insightful
      Tort reform won't fix the IP law problem. The problem here is that (all together now) "the patent office can't equate something done on the web to something that is already commonplace on the street."

      You walk into a store and buy something. That is NO DIFFERENT than going on the web and buying something. There's no patent to be had there. There's nothing novel about shopping online. There was catalog shopping with phone-ordering for YEARS before these idiots started giving patents to "online e-business."

      My patent is still pending on "Method and Apparatus for facilitating the converstion of energy by interchange of gases in an organic membraneous environment" (remaining alive by breathing)

    16. Re:The whole legal system needs to be changed by ClarkEvans · · Score: 2

      Personally I think the key to tort reform is to remove the profit insentive to lawsuits by diverting punative damages to education.

      This is a great idea. I've actually floated it with a few legislative assistants (while I was living in D.C.) they said it was a good idea... then I never heared back from them. I've also suggested this via snail mail to several representatives.

      The problem is that the plantiff's attorney's
      want a chunk of this extra pie. So, if you want
      this to have a chance in hell, to get passed the
      laywer's lobby you'd have to let the suing
      atty keep 10% or something like that; or cap the
      punative damages which goes to the plantiff at,
      say 1 million dollars; while amounts over a million go to education. Even this will get
      resistance beacuse some people think they "deserve" punative damanges.

    17. Re:The whole legal system needs to be changed by jejones · · Score: 2

      Polluters love tourt reform since its expensive to prove that the pollants they discharge cause damage and to prove it would cost tens of millions of dollars.

      <sarcasm>And we can't let trivia like proof get in the way of sticking it to the "mega corps," can we?</sarcasm>

    18. Re:The whole legal system needs to be changed by benzapp · · Score: 1

      First of al, the spelling is "tort", the word is derived from torsion, to twist.

      The primary reason mega-corporation have arisen in the US is because small businessmen cannot afford the legal fees associated with civil actions. The economy we have today is the direct result of the massive capital needed to function within the American legal system today.

      Insurance companies WANT expensive tort rulings. It was NOT legal in the US to purchase liability insurance until about 1915. The idea was simple, it should be the INDIVIDUAL (or company) that pays. Insurance, by its nature, spreds the risk and the cost.

      It wasn't until this was changed that insurance REALLY took off.

      I am judging by your spelling mistakes and syntax errors that you are still a little young and don't quite understand this shit. Think about it this way, you will have a really hard time starting a business today. Such a huge percentage of your operating expenses will go to paying for liability insurance, you won't be able to really make any money.

      The only ones with that money are huge companies, so you go work for them.

      If there is any one thing that will destroy the mega-corporations it is making their biggest asset obsolete: the cash reserve to pay for hefty liability insurance.

      --
      I don't read or respond to AC posts
    19. Re:The whole legal system needs to be changed by lordgert · · Score: 1
      I am judging by your spelling mistakes and syntax errors that you are still a little young and don't quite understand this shit.
      Examples abound that whether s/he understands it or not, it won't keep that person from posting here.
      And I just have to take a jab at you for picking on someone's spelling:
      Insurance, by its nature, spreds the risk and the cost.
      Even the best aren't immune to mistakes.
    20. Re:The whole legal system needs to be changed by gsfprez · · Score: 2

      >Tourt reform is sponsored by the mega corps to reduce consumers right to sue. ITs all about profit for them. At least that is Bush's version of it.

      are you a tit?

      Tourt reform has been 100% rejected by Democrats - who are literally either part of the system or are beholden to the system.

      The love of the judicical branch of government by the left-wing is their inability to have the most kooky of hippie beliefs passed by the people of the country - so they get into the judiciary, where it is impossible (practically) to be removed from their places of power.

      Or haven't you noticed that the last Democrat to be president was a lawyer... and the next Democrat in office will ALSO be a lawyer (and also named Clinton).

      your allegience to the left-wing has you blinded to truth.

      --
      guns kill people like spoons make Rosie O'Donnell fat.
    21. Re:The whole legal system needs to be changed by PMuse · · Score: 2

      Tort reform won't fix the IP law problem.

      Patent infringement is not a tort. Patent infringement is patent infringment. "Tort Reform" has nothing to do with it.

      Tort Reform is only about certain kinds of lawsuit -- things similar to personal injury suits. Tort reform will have no effect on other kinds of lawsuits, including all kinds of intellectual property suits, contracts, criminal law, etc. For instance, Tort reform won't change the way you sue some one who defaults on a contract. Same thing for patents.

      --
      "We reject as false the choice between our safety and our ideals." --The American President (20.1.2009)
    22. Re:The whole legal system needs to be changed by eaolson · · Score: 1
      We also have caps on punative damages. [...] You can get back whatever is required to make up whtever loss your are suing for, plus reasonable damages (the cap is around $100,000).
      I'd like to point out that the entire purpose of punitive damages is to be just that, punative. They are intendted to punish the wrongdoer, not just compensate the victim. Sure, to me $100,000 is a huge amount of money, but if, say, a major car company can save $10 million by inadequate testing some safefy feature, they may choose to do so because they know their liability would be capped at $100,000. To companies that have billions of dollars in assets (heck, didn't Microsoft have $40 billion just in cash recently?) 100,000 could fairly easily be chalked up to "the cost of doing business."

      Furthermore, not every case involves punative damages. From this article:

      They are available only if the defendant acted with malice or gross negligence. Punitive damages are not awarded often, and when they are, it is for acts that go beyond mere human error. They are supposed to be awarded when the defendant not only hurt the plaintiff, but did so in a way that expressed disdain or contempt for the plaintiff. Punitive damages, one might say, are the plaintiff's chance to get revenge -- through the court, and through the medium of money.
    23. Re:The whole legal system needs to be changed by DaytonCIM · · Score: 2

      I just noticed you labeled me as a "foe." I guess I'd better get busy earning that distinction.

      tort the word is derived from torsion, to twist.

      Ironically, the word "tort" is Norman French and means "wrong".
      Tort is a branch of common law concerned with redressing wrongs committed by one person against another.

      Insurance companies WANT expensive tort rulings.

      Just like automakers want car crashes and dentists like hockey. Right?

      To be fair, I think you are partially correct. Insurance companies do like tort rulings, but given a choice would overwhelmingly prefer small rulings to expensive ones. Small rulings allow an insurance company to raise or cancel policies for an affected company and retain a small profit. While, large judgments threaten even a large insurance company's bottom line.

      Further, an insurance company may raise policies across the board using a judgment as an excuse. Thus, making more profit.

      Moving on...

      I am judging by your spelling mistakes and syntax errors that you are still a little young and don't quite understand this shit.

      Do I need to go here? Ummmm... yes.

      Insurance, by its nature, spreds the risk and the cost.

      Kettle meet pot. Pot meet kettle. (If you don't "get it," maybe you are still a little young and don't quite understand.)

      The only ones with that money are huge companies, so you go work for them.

      Me think you type good and should keep giving good advice to masses of reading people.

      Out.

    24. Re: The whole legal system needs to be changed by GigsVT · · Score: 1

      (I suspect this already happens,

      It does. On another message board, a former IBM employee posted a formula he came up with for valuation of lives based on the future earnings and an interest discount percentage. Surprisingly, the management didn't like his proposal balancing money and lives, even though the logic was flawless, the formula correct.

      http://boards.fool.com/Message.asp?mid=17949338

      Go there if you have a fool.com membership. You can sign up for a free trial.

      Fair Use Exerpts:
      It is impossible to do a safety evaluation until you figure out the real cost of doing nothing. And, since "the worst case senario" of doing nothing is death, I had to calculate the "Present Value" of a human life.

      The answer is: Every life has a different value based upon the earning capacity of the individual which varies with education level, normal life expectancy, salary at the time of death, personal health, individual motivation, promotability, the job market, interest rates, inflation rates, monetary policy, taxes, and expected retirement age.

      Anyway, this was the gist of the discussions I had with IBM safety about the subject. However, they would never agree with any "numbers" because they argued that a human life is priceless. I learned then that you just cannot have a technical discussion with a liberal. They do not care about the costs...they just want everything they can think of for free.

      However, I decided that annual salary times two and a half divided by the 10 year bond yield was completely fair for anyone who was killed by an industry in an accident! Today, the number would be $3 to $7 million for just about everyone in America.


      Credits to BMW on the Fool for this. This is only the highlights of a pretty long message.

      --
      I've had enough abrasive sigs. Kittens are cute and fuzzy.
    25. Re: The whole legal system needs to be changed by greenrd · · Score: 2
      If companies are playing with lives where you live, you shouldn't be worrying about Tort reform, you should be pressing the government to pass some basic industrial safety regulations.

      - and not only that, enforce them. It's no good having workplace health and safety regulations if a corporate-bribed administration just cuts back on enforcement, as happened e.g. under Reagan.

    26. Re:The whole legal system needs to be changed by Alphtoo · · Score: 1

      "*This is the first time I have ever floated this idea to anyone...." Man! That's a great idea! Why are you posting it here? Quick... patent that son of a bitch!

  20. Several things. by ketamine-bp · · Score: 2, Interesting
    IAPNAL (p for possibly), but:

    1. one doesn't need to be making sense to get a patent. you can find a patent relates to a algorithm that 'can compress arbitary data by at least 1 bit' (note that this results in compression of anything to 0bit (or even less.) upon recursion.

    2. revocation of patent is possible but usually impractical since this requires a lot of time and money (ask your peear who's doing as a law costs draftsman and they'll tell you that.)

    3. Somebody would tell you the availability of the overseas outsourcing possibility. this is still vulnerable as your business model does not change. you can help, however, if your company is based on somewhere which is not on the states though.

    4. Now, IAPNAL (this P stands for presumably) The heart of the case lies on the word 'automated' with its relationship to prior art.

    5. What we can do is write to progress (oh no, congress) to get somebody proposes a new patent system.

  21. Presumption of validity. by cpaluc · · Score: 1

    There's a presumption of validity with patents (because they've gone through the examination process). In other words, a patent is presumed valid until it's challenged in the courts and found invalid. However, the examination system is so inadequate that there are probably a large number of granted patents that don't deserve the presumption of validity. That's small comfort to those threatened with bad patents and who may find it cheaper and easier to simply capitulate.

  22. The patent office is looking pretty stupid by Gerry+Gleason · · Score: 3, Insightful
    The whole idea of software patents is pretty dubious to begin with, but don't they have anyone who knows a thing about systems and software? It seems to me that anything claimed in these patents was nothing more than obvious applications of HTTP technology. Maybe CERN could have patented it all in the beginning, but they made it available to all of us, and some idiot is claiming he owns some piece of that.

    Seems to me that the solution is somewhat obvious, and implied in the article. It is likely that they will try to sue some of the big players with deep pockets if they can collect enough in settlements. Don't you think Amazon would be well served to help these little guys squash this thing in the first round before it gets any momentum.

    1. Re:The patent office is looking pretty stupid by Zeinfeld · · Score: 4, Interesting
      It seems to me that anything claimed in these patents was nothing more than obvious applications of HTTP technology. Maybe CERN could have patented it all in the beginning, but they made it available to all of us, and some idiot is claiming he owns some piece of that.

      For prior art see the Internet Shopping Network (now part of HSN) which was operating in '94, Also the UK Prestel system which operated in the early 80s.

      I don't doubt that we could have got a patent for HTTP, but it is only a more efficient transport than ftp. There used to be quite a few sites that used ftp to serve HTML.

      This type of extortion should be punished. In the UK you would be hit with a crippling legal bill for the defendant's costs if you lost so there is little point in filing vexatious patents. Also prior review means that the probability of getting a vexatious patent is much lower.

      The problem with the USPTO is that it speaks with a forked tongue. When it is justifying its racket it claims that a patent has to be 'novel', when justifying the actions of its franchisees it claims that their legal definition of 'novel' is 'anything at all, even something completely obvious'.

      Actually cases like these are the ones that might lead to reform. A corrupt senator bought by USPTO franchisees can ignore the complaints from the likes of Microsoft or slashdotters, but it is harder to ignore small business owners. And no, the judgemet against Microsoft on the disk compression patent was not any more justified than the present scam. What was being claimed there was not LZW but the idea of a compressed disk.

      Don't you think Amazon would be well served to help these little guys squash this thing in the first round before it gets any momentum.

      They have their own problems in this area, there are something like 2000 odd patent extortion scams going on and Amazon have their fair share.

      --
      Looking for an Information Security student project suggestion?
      Try http://dotcrimeManifesto.com/
    2. Re:The patent office is looking pretty stupid by budgenator · · Score: 2

      >This type of extortion should be punished.

      I think its entirely legal to counter-sue for damages such as legal expensives, cost of lost opertunity for the time the principals spend preping for the ligiation rather than tending to business. I'm not sure why this is not done more often.

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
    3. Re:The patent office is looking pretty stupid by mkldev · · Score: 1
      The most expedient manner is proabbly a SLAPP-back. But in order to do that, you first have to appear in court and file a motion with the judge requesting summary judgement on grounts that the suit is without merit. If you can convince a judge to do so, -then- you counter-sue and odds are you get your expenses back. The problem is that you have to first fight the initial case in court, which is painful for a small business. That's why these things are usually settled out-of-court.

      Caveat emptor, IANAL.

      --
      120 character sigs suck. Make it 250.
  23. And so it goes.. by Tuffnut · · Score: 1

    Website: "Ok sir your order for CowbowNeal: Space Explorer has come to a total of $39.99!"

    Customer: "Wow, what a deal! Slashdot was selling for $1999.99!"

    Website: "Oh, I'm sorry, we also require you pay $1960 in order for us to cover the processing patent just like Slashdot."

    Customer: "Erm...what?"

  24. It could be worse... by llamaluvr · · Score: 2, Funny
    --
    Insightful: 76, Off-Topic: 379, Flamebait: 24, Funny: 152, Interesting: 201, Underrated: 55, Troll: 9, Total: 896
  25. This makes no sense by Stlkr13 · · Score: 2, Insightful

    If you read the patents that are the basis of the lawsuit the case has no merit. The patents are for video loan terminals, not internet business. I don't know how the two are the same?

    1. Re:This makes no sense by Xformer · · Score: 2, Informative

      Agreed. According to the wording of the patent, it's specifying dialup terminals connecting directly to a private data processing center, not through any kind of common communications network (outside of telephones). There have been systems like that before (mid-80s probably), but for the most part they don't exist anymore since the Internet has taken off.

      It seems like PanIP is just trying to rehash interpretations of their vague patents to apply them to technologies that they neither envisioned or invented (if indeed they thought of this in the late 80s) in order to line their pockets a little more.

      --
      All I want is a kind word, a warm bed and unlimited power.
  26. USPTO has been in a cave. by Louis_Wu · · Score: 2
    I think that the USPTO patent examiners are only let out of their caves to stamp the patents which come before them, that might explain why they seem so #$%#@!$^%#% clueless so often. Or maybe the USPTO is a giant government agency which doesn't have to answer to the public, so they can do whatever they want.

    ...

    pant pant pant

    [/end_rant]

  27. Monster.com Patent by stu42j · · Score: 1

    I noticed recently that Monster.com has a patent on online job boards (5,832,497). I think they might have a valid claim here but I was wondering whether there had been any controversy about it. Do all the other job sites pay them money? Anyone know?

  28. Granted != Applied by Gerry+Gleason · · Score: 4, Interesting
    The patent office takes a while to actually grant a patent (not that I know how long this is, but probably several years).

    It boggles the mind to think about what kind of qualification process would keep letting through all sorts of patents that any semi-competent engineer would recognize as obvious and/or prior art. Maybe it is just easier to rubber stamp the applications so they can get to the bar early.

    1. Re:Granted != Applied by Moekandu · · Score: 3, Insightful

      In a recent article (don't remember where, been getting kinda blogged down), it was stated that the USPTO has been "rubber stamping" between 30 and 40% of the patents submitted each year. The USPTO, of course, is very worried because it used to be between 60 and 70% yearly, and their budget is based on the number of patents awarded, not the number reviewed.

      That's the big one to email your Rep and Sen about. Get them to change the budget based on the work necessary (i.e. reviewing patent applications), not on the number of awarded.

      And for the other, those people who believe what is legal is therefore ethical, well. . . nerfbats. An army of properly wielded nerfbats would go a long way to 'splainin' things 'round here.

      Moekandu

      "It is a sad time when a family can be torn apart by something as simple as a pack of wild dogs."

      --
      Mediocrity knows nothing higher than itself; but talent instantly recognizes genius. -- Sir Arthur Conan Doyle
  29. time to step up to the plate... by maktub_7 · · Score: 1

    "revocation of patent is possible but usually impractical since this requires a lot of time and money"

    So, what is Amazon and E-bay doing in order to invalidate these ridiculous patents??

    1. Re:time to step up to the plate... by frovingslosh · · Score: 2
      So, what is Amazon and E-bay doing in order to invalidate these ridiculous patents??

      I don't think one-click Amazon has any interest in invalidating ridiculous patents, and I don't think this ridiculous patent holder has any intention of harassing the big guys. At least not until someone not capable of putting up a sound legal defense looses in court first, setting a precident.

      --
      I'm an American. I love this country and the freedoms that we used to have.
  30. The patent office has looked stupid for years by tewwetruggur · · Score: 1
    Maybe if they had some funding, they could hire competent people AND have a decent sized staff to look into everything. As it stands, they don't and can't - so they won't. They'd rather sign off on a patent and let it get fought over in court. Sadly, going to court costs money, so "little guys" can't afford to duke it out with "giant company" that happens to own some stupid patent that never should have been approved in the first place.

    The USPTO needs major reform and funding. Next time your congressman/senator gives themselves a pay-raise, think again when election time rolls around... are they really thinking of the people, or themselves?

    --
    Hi! This is the Sig, blatantly attached to the end of this comment.
    1. Re:The patent office has looked stupid for years by Gerry+Gleason · · Score: 3, Interesting
      Yeah, I loved this quote from the article:

      The Patent Office is unequivocal. "All patents are presumed valid once they're issued," says Brigid Quinn, deputy director of public affairs.

      This would be funny if it wasn't true, but there decisions are legally binding until challenged, as you say.

      I was talking to a friend about a more libertarian or maybe even anarchistic legal system where the government wouldn't be the only entity with the legal standing to represent the public at large. I know, there could be real problems (like SLAPP style prosecutions for any law they can find on the books). He's really much more libertarian than me, since I think there really is a constructive role for government to play, if only they were effective and actually represented the people.

      He was telling me that there is a legal mechanism where you can try to force the state to take legal action. I forget the technical legal term, but it basically translates as "do your job", and he was telling me about an example (which I also forgot). Maybe the patent office can be sued under this framework, but you still have the basic catch 22 that they didn't do their job in the first place, so it will be difficult to enforce an effective remedy.

    2. Re:The patent office has looked stupid for years by D+iz+a+n+k+Meister · · Score: 5, Funny

      I was talking to a friend about a more libertarian or maybe even anarchistic legal system . . .I think there really is a constructive role for government to play, if only they were effective and actually represented the people. . .I forget the technical legal term. . . and he was telling me about an example (which I also forgot).

      Yeah, I like smoking weed with my friends too.

      --

      He painted a unicorn in outer space. I'm askin' ya, what's it breathin'?
    3. Re:The patent office has looked stupid for years by mcrbids · · Score: 4, Informative

      I forget the technical legal term

      Writ of Mandate. aka Writ of Mandamus A court order to a government agency, including another court, to follow the law by correcting its prior actions or ceasing illegal acts.

      (BTW, IANAL, but more details can be found here in a legal dictionary)

      --
      I have no problem with your religion until you decide it's reason to deprive others of the truth.
    4. Re:The patent office has looked stupid for years by plague3106 · · Score: 1

      Then you hurt 'the little inventor' b/c he can't afford to patent. While there may not be many left, i'm sure there are some out there.

    5. Re:The patent office has looked stupid for years by bbqBrain · · Score: 1

      This method was used in an episode of Law & Order. The prosecutors wanted to charge the guilty party but didn't think they had enough evidence to go to trial. The family and lawyer of the victim used a Writ of Mandate to force them to proceed.

      --

      One of the reasons that I became a lawyer was to avoid ever having to hire one. -SPYvSPY
    6. Re:The patent office has looked stupid for years by Tablizer · · Score: 1

      Yeah, I like smoking weed with my friends too.

      Then you owe me royalties for patent 12987439423, "Using biological substances to provide user with a feeling of pleasure or euphoria".

      Cough it up or no more weed for you.

    7. Re:The patent office has looked stupid for years by D+iz+a+n+k+Meister · · Score: 1

      My lawyer told me to inform you that I did not inhale.

      --

      He painted a unicorn in outer space. I'm askin' ya, what's it breathin'?
    8. Re:The patent office has looked stupid for years by Tablizer · · Score: 1

      (* My lawyer told me to inform you that I did not inhale. *)

      In that case you violate a variation patent filed by the Clinton administration.

  31. That's it. Call your Uncle Tony... by certron · · Score: 5, Funny

    OK, Amazon.com, Buy.com, bn.com, and anyone else who wants in should set up a fund to hire someone to club the kneecaps of everyone involved in this stupid, stupid lawsuit. My usual style would be to hit them in the face with a frying pan, since it is almost impossible to misinterperet that action as anything other than sheer and utter revulsion and hate, but sometimes the frying pan just doesn't do the job.

    I mean, seriously. This is one of those 'just when you had accepted the fact that things couldn't get any more stupid or pointless, you were harshly proven wrong' things. I'm going to patent candy and beachballs and start collecting royalty payments from kids, those pathological users of unlicensed intellectual property... (No, don't even try and apply logic to that one. Trust me, don't.)

    I'm ready to put in $20 for the hitman. Who is with me? Hey, it worked for the blender source code.

    (OK, I'm not an evil person. I really just wish they would drop the lawsuits and grow a spine and some clue. That would be far preferable to having to spend money on a hitman. I mean, uh, I hope nothing bad happens to them. But I'll probably smirk if something does. No, wait... If the police ask, I had nothing to do with it. Yeah, that's the ticket...)

    --

    fair.org counterpunch.com truthout.com indymedia.org salon.com
    eff.org guerrilla.net debian.org gentoo.org
    1. Re: That's it. Call your Uncle Tony... by Black+Parrot · · Score: 1


      > OK, Amazon.com, Buy.com, bn.com, and anyone else who wants in should set up a fund to hire someone to club the kneecaps of everyone involved in this stupid, stupid lawsuit. ...

      > I'm ready to put in $20 for the hitman. Who is with me?

      I tried, but the lawyers already had www.breakakneecap.com shut down due to the patent violation.

      --
      Sheesh, evil *and* a jerk. -- Jade
    2. Re:That's it. Call your Uncle Tony... by what+do+i+have+to+do · · Score: 1

      why cant that sniper take out morons like the ones at panIP. the world would be grateful to him for it

    3. Re: That's it. Call your Uncle Tony... by ceejayoz · · Score: 2

      1-Click ordering on hitmen? Does it come with free shipping, too?

  32. What a bad idea. by Una · · Score: 1

    From the article, it appears that they are filing suit on random small companies
    just to get themselves on higher ground to go after bigger fish.
    For once I'd love to see one of these lawyers forced to file suit against one of their parents.
    Imagine one of these lawyers had a mother running a small website selling knitted sweaters.
    "Im sorry mom, but mister bigshot made me do it!
    I never would have sued you, but he made me! I swear!"

    Any company that goes after little mom and pop shops for patent violations should have its upper management gagged and tortured.
    I just cant believe this kind of legal abuse..
    Whats going to happen next?
    Are people going to just pick people at random and sue them for looking at them funny?
    Ohh wait, they allready do that.
    Our legal system has completely gone to shit.
    Would it be any better if the patent office had never granted these patents in question? I think not.

    Perhaps I should file a patent for a method of protecting ideas and sue the patent office.
    Or possibly file a patent covering the actual filing of lawsuits and sue all the lawyers!

    I think an overhaul of our legal system and patent review process is way overdue.
    If I can file a lawsuit against any random person at will, with no legal basis what so ever,
    there is definately something wrong.
    Likewise, if I can file a patent for something thats been in use since the beginning of time,
    (Like, say, copy a chapter out of a highschool science textbook dealing with nuclear fusion in stars) and have it granted,
    There is definately something really wrong.
    Now, If we combind the two, and I file suit against everyone for "ilegally" reciving light from "my" solar fusion device,
    Something isn't wrong... Its completely fucked.

    This is where we currently stand.
    What a shame.

    -Una

  33. Patents suck by shnarez · · Score: 3, Interesting
    Why do we need to stifle innovation of the entire society by granting a patent to an interested party, when said party usually does not implement their `idea' but really waits for someone else to do the hard work just so that they can sue them later?

    Why even have patents? Call 'em trade secrets. If someone can figure out what you did and do it better, faster, cheaper, and easier, tough luck, it's their achievement.

  34. Long-Term Results by Nynaeve · · Score: 2, Interesting

    Think about it for a moment. What are the long-term results of what we see here? Patents are supposed to foster innovation by offering protection. This innovation, in turn, is intended to support capitalism and all of the nifty inventions we see every day. What we are now seeing is that _abuses_ of the patent system are feeding off of the energy provided to capitalism in the first place! What do you think will happen? Could it reach a point that businesses will be less willing to produce products for fear of litigation (one business already has, according to the article)? If so, what is the threshold of this point, and what forces could we emphasize in opposition to it?

    I don't want to see innovation stifled "in the name of IP" leaving us with a modern version of the Dark Ages. With the increasing emphasis of individual or corporate profit (Enron, WorldCom, et. al) to such levels that it tips the balance of capitalism, perhaps it is possible that the contribution of individuals and small business to the GNP could decrease significantly.

    Remember what fueled the Dark Ages (AD 500 - 700) - fear of prosecution/persecution. How is that different from what we see here?

    1. Re:Long-Term Results by toomz · · Score: 1

      Innovation in the USA slows down, causing a scenario similar to the Dark Ages? I think not.(I think historians like to call them the Early Middle Ages now anyway)

      The world is a very big place.

      --
      If a chair is thrown in a forest, and there are no witnesses, did Ballmer still do it?
    2. Re:Long-Term Results by the+grace+of+R'hllor · · Score: 1
      Remember what fueled the Dark Ages (AD 500 - 700) - fear of prosecution/persecution. How is that different from what we see here?
      Mainly the fact that 'prosecution' in those days was done by sticking hot bits of metal in you until you admitted that you were evil incarnate.

      We'll not mention 'persecution' here, except to point out that fire is bad.

      Sheesh, overreact much? :-)

  35. patent patenting by bulletloco · · Score: 1

    is there any way to patent the process of patenting? I think that would solve a lot of this.

    1. Re:patent patenting by bulletloco · · Score: 1

      if only it was a joke.. I was seriously asking about what is patentable and what is not. I always thought that it you can prove that it was in use before you filed the patent, then it is no longer patentable. Maybe im wrong on this, but with the situations that were coming up lately, i am just confused.

  36. GATS by tobo · · Score: 1

    Has anybody ever mentioned GATS or TRIPS here? :)

  37. from the we-got-patent-pending-on-that dept. by silvaran · · Score: 2

    How about from the no-shit-sherlock-thanks-watson dept.

    Seriously folks, these issues have been discussed before, and the most prominent of problems has been identified that the patent system was funded by -- and for -- large corporations. What small business is going to have the kind of funding needed to defend a patent against a large corporation?

    Additionally, a small business that knows it has rights on a patent issued by a large corporation is going to have a difficult time proving it -- financially, at least.

  38. That's just wrong by Sexy+Commando · · Score: 1

    Patents should only protect those who actually spend money and time on research and development. What's the cost of "inventing" e-commerce. Plus. the idea behind e-commerce is not non-obvious to begin with. You should be making money out of your idea, not your patent. There's difference.

  39. PanIP website by scotch · · Score: 2

    The PanIP seems to be runningn apache, so they can't be all evil. ;) Seriously, the website seems to be showing the index page for the empty web directory - go check it out - there is one link "stats" - which doesn't allow access without a password. First person to crack their site and put up some proof (e.g. "we are blood sucking vampires") gets all my karma, respect, and a vitual beer.

    --
    XML causes global warming.
    1. Re:PanIP website by Chemical · · Score: 2
      Or you could just go to Netcraft and discover that they are using Apache (and something called Rapidsite) on IRIX, and that their page was apparently created with Frontpage 5.0. In addition they use mod_ssl and OpenSSL.

      Now then, where is my karma/respect/beer?

    2. Re:PanIP website by scotch · · Score: 2

      Re-read the offer. Karma/respect/beer redeemable for a crack only. Snooping around alone will not suffice.

      --
      XML causes global warming.
  40. Legislation Needed by GuruJ · · Score: 3, Insightful
    It sounds like only Government legislation can fix these patent problems. Once people (and their lawyers) 'smell the money', the only way to prevent abuse is to close the loopholes.

    At a minimum, the government should legislate that the patent holder must prove there is a 'case to answer' before any defendents have to touch their wallets. Maybe small businesses should even be exempt from patent claims altogether.

    This whole thing reminds me of a recent set of high-profile cases where Australian local councils paid $100,000s for people tripping on a crack in the sidewalk!

    Once people figured out that it was generally cheaper for councils to pay them $10k to shut them up than to fight the claim, everyone jumped on the bandwagon, hoping for a 'lottery win' payout.

    The patent system will remain broken until the 'lottery win' mentality no longer applies.

    --
    -- Askari: Give JavaScript the bird.
    1. Re:Legislation Needed by Unordained · · Score: 2, Insightful

      i appreciate the motives behind 'maybe small businesses should even be exempt from patent claims altogether' but this would create a one-sided situation: small business invents something, big corps can't have it. fine. big corp invents something ... and ... they can't profit enough off of it to pay for the R&D, because all the very small businesses are just running very small versions of big corp's business -- staying small enough to continuously avoid lawsuits, but big enough to make a profit. and that ... will kill the idea altogether. there are some things small businesses simply can't invent, for lack of funding for research. maybe they can invent late-1800's technology in the garage, but they can't, out of their shop on main street, test their manned-mission-to-jupiter system ... i'll note though that perhaps my fears only matter in the middle-ground: the small shops -also- won't be able to duplicate the really expensive technologies -- both in R&D and in production costs ... but if the production is cheap enough, then perhaps they can. without paying for R&D.

  41. Bad Patents = Easy Money by MrNybbles · · Score: 3, Insightful

    Most (if not all) of these bad patents we have been reading about lately in the news have to do with human leaches trying to get money without working for it (the lawyers do all the work).

    It's easy. For patents just come up with some broad, utterly asinine idea that people have been doing long enough that people will not stop.

    This works for the same reason that sending a bill for $15 to a large business works; the company will pay the small fee because it is cheaper to do so than to investigate every questionable bill.

    With these bad patents, if the price is low enough then most companies will pay the licensing fee instead of the greater cost to fight it in court.

    The only solution that could work is getting the people working in the patent office a clue. How about some redundancy so it would take at least 3 people to review patent. That way if we can get at least one of those three to be a person who has common sence, problem solved!

    Or is this just wishful thinking?

    --
    Losing faith in humanity one person at a time.
    1. Re:Bad Patents = Easy Money by MrNybbles · · Score: 1
      Holy shit, that works?!? I always sent mine for $15 MILLION but never got a response! Damnit!

      Yah. Try sending a bill to Microsoft for $15 bucks. As far as I know this is not illegal. They could always not pay it of course.

      Actually this might be a good way to get an unofficial refund for all the MS Crapware that gets bundled with our computers. Out of the five or so OEM software packages that came bundled and pre-installed with my PC, I use non of them.

      --
      Losing faith in humanity one person at a time.
  42. How does he make a living? "I enforce my patents" by sssmashy · · Score: 5, Interesting
    PanIP's principal owner, Lawrence Lockwood, previously had filed suit against American Airlines in 1994, charging that the company's online reservation system infringed on other patents he holds. Lockwood lost that lawsuit, which went all the way to the U.S. Supreme Court

    This Lockwood guy sounds like a real pro. He's been at it for at least 10 years. He sniffs out broad new technological trends in business - the kind of thing you might read about in a Forbes article - and then cynically abuses the weakness of US Patent Law by patenting a vague expression of that trend. He never intends to produce anything with his "ideas"... he just slinks into his hole and waits for the real innovators to come along so he can extort money from them.

    He's going to lose any court case--that's almost a given--but in the meantime he's hoping that enough of his small, carefully picked victims cave in and throw him $30k, or at least a few grand to make him disappear.

    The key to wiping the smirk off his face is to make sure no more of his victims cave. Sure, lawyers aren't cheap, but the 30 companies have to realize that there is no way they can lose this disgusting and frivolous lawsuit, especially if they work together.

  43. Hey file a patent on THIS busines method. by JollyFinn · · Score: 1

    Filing patents on obvious changes that are obviously required in future for many businesses. And sueing those businesses for cash.
    [And many variations of the thing, with future changes, I know exacly what I would put on few patents like that, but I don't wan't to give any precedence to that patent.]
    AND LET THEM TASTE THEIR OWN MEDICIN ;)

    --
    Emacs is good operating system, but it has one flaw: Its text editor could be better.
  44. What's scary, is if you read the actual patent... by raehl · · Score: 3, Interesting

    What they REALLY patented was pretty much *ANY* database. It even looks like a series of labelled pictures in a word document would violate the patent as written.

    All it'll take is one person to take this to court to get the patents invalidated. They're atrocious.

  45. I'm going to patent the lung... by Newer+Guy · · Score: 2

    Well actually it's: "an organic system for extracting and concentrating oxygen from gases present in the atmosphere".... Or am I full of hot air?

  46. Why not just take out a patent on ..... by weetabix · · Score: 1

    A system for the disabling of logical, rational thought; a system that creates random decisions and has no method of control or accountability?

    In other words... patent stupidity and sue the pants off these fuckers :)

    --

    -- "It's tough to run with both feet stuck in your mouth" - Zoe's evil side

    1. Re:Why not just take out a patent on ..... by Soko · · Score: 5, Funny

      A system for the disabling of logical, rational thought; a system that creates random decisions and has no method of control or accountability?

      Sorry. I really don't think you can patent the U.S. Patent Office itself.

      Soko

      --
      "Depression is merely anger without enthusiasm." - Anonymous
    2. Re:Why not just take out a patent on ..... by garyok · · Score: 1

      Ah, that's because you haven't thrown in the internet to confuse them. How about patenting "an online system for allowing public access and review of innovative designs and business processes during, and after, the process of registering intellectual property rights." See if you can get away with that, and then sue the shit out of the USPTO website for violating the patent they were careless enough to grant.

      Maybe when your public accounts committee (or whoever you USians have to check the government's departmental spending) starts asking questions like "what happened to all the money we gave you just last week to pay everyone's salaries?" you'll start getting a bit of accountablility in the system.

      Gary

      --
      One of the penalties for refusing to participate in politics is that you end up being governed by your inferiors - Plato
  47. Umm...no. by GoogolPlexPlex · · Score: 1

    I think that you would find that there is prior art on your claims.

    1. Re:Umm...no. by mobets · · Score: 1

      that's the point, If you actualy got the pattent, it would show _every_ one just how messed up the system has become.

      --

      It was me, I did it, I moved your cheese
    2. Re:Umm...no. by quintessent · · Score: 2

      But I have a patent on the creative use a system to demonstrate its foolishness, sometimes involving media such as plastic or monitors or maybe optical drives or some kind of storage, well anyway, there's somebody somewhere doing something.

      The author will kindly pay up.

  48. NO by The+Tyro · · Score: 1

    Tort reform is also being sought by physicians to reduce the "malpractice lottery."

    Nobody denies that medical mistakes happen... medicine is practiced by human beings, after all. The problem is that some people refuse to accept that sh*t happens in the course of medical care. Bad luck exists. A certain percentage of all procedures will develop post-op infections. Orthopedic pin sites for external fixators have about an 8-10% infection rate, REGARDLESS of what you do. Some people show up in the ER too badly injured to save.

    The fact that a person dies or has a bad outcome is not presumptive evidence of malpractice... but too many people get sucked into the law firms that advertise on TV "Have YOU been injured? We'll get a settlement for YOU!" All that has to happen for a doctor to lose a case is for the jury to feel sorry for the plaintiff... Arrogant doctors make this MUCH easier for oppposing counsel. A little humility goes a long way.

    The classical arguments against the "loser pays" reform efforts make a valid point... it may take away the poor man's access to the courtroom. Other efforts include arbitration boards. Whatever the answer, the current system needs help. Some OB/GYNs pay more for malpractice insurance that I make in a year... some neurosurgeons can't even GET insurance at all.

    I think a limit on "pain and suffering" damages is a good place to start. Not to devalue anyone's suffering, but I don't think 10 Billion dollars is a reasonable figure.

    --
    Even if a man chops off your hand with a sword, you still have two nice, sharp bones to stick in his eyes.
    1. Re:NO by The+Tyro · · Score: 1

      You are correct that contingency cases are taken to court all the time. You see it in law firm advertisements... "No fee if no recovery!"

      I don't think contingency cases should go away entirely, however. If you have a poor plaintiff, he may not have the money to put a lawyer on retainer. If he can't hire an attorney, then nobody can investigate whether the plaintiff really has a case. Doing away with contingency really does take away the poor man's keys to the court room, and I'll be the first guy to say that there are lawsuits that have merit. What might make better sense is an appointed board of doctors, attorneys, and lay people who can evaluate some of these cases before they go to trial, and perhaps suggest some arbitration or settlement terms. This would certainely cut down on frivolous suits. For example, I have a colleague who's being sued because he gave a mind-altering drug to a patient, warned her not to drive, and told her to call a ride. She decided to drive, promptly had an accident on her way home, and guess what? That's right... she's suing the doctor, despite the explicit instructions, her own negligence, etc... How's that grab ya?

      However, what really cranks up the cost of this type of litigation are the large pain-and-suffering damages. I can see lost wages, medical bills, etc... but billions for pain and suffering? Of course, this begs the question... how do you put a value on somebody's pain? The moment you try, some lawyer will accuse you of being cruel/heartless/killer of adorable puppies.

      Limiting damages would be a good first step, IMHO.

      --
      Even if a man chops off your hand with a sword, you still have two nice, sharp bones to stick in his eyes.
    2. Re:NO by canadian_right · · Score: 2

      Contigency cases are a good way for people with few means to pursue strong lawsuits. They are illegal in Ontario, Canada (except for class actions), but legal for most civil cases in the rest of the coutry. The 'loser pays' rule along with caps on punative damages makes 'lawsuit bingo' very rare in Canada. No lawyer is going to take on a weak cas eon contigency if she thinks she might get lose and stuck with the winners bills.

      --
      Anarchists never rule
  49. Well, kind of. by ubernostrum · · Score: 4, Informative
    A good friend of mine's dad works at the USPTO as a patent examiner...he's a very intelligent, well-read and well-rounded engineer. Unfortunately, due to budget constraints, when all the guys like him retire (and there arent many left even now), that's the end; they can get three or four cheap idiots fresh out of college with no experience for the salary a qualified examiner can command, and that's common practice for replacing an examiner.

    So please don't put all the blame on the patent examiners; while there are plenty of idiot examiners, a lot of this also has to do with bureaucracy's normal functioning: higher-ups trying to cut corners and save a buck.

    1. Re:Well, kind of. by Louis_Wu · · Score: 2

      Yeah, I know that they're not all bad; they can't all be bad, even if I wanted them to be. But BOY is it frustrating sometimes. BTW, I was offered a job as a patent examiner my senior year (about 2 years ago), and I almost took it as a missionary position: "I'll show the rest of the examiners that you can't patent something just because you append "with a computer" to a description". I don't consider myself an idiot, but my sister sometimes does. :)

    2. Re:Well, kind of. by PCBman! · · Score: 1

      Holy Cow!!!!

      So this is why I can't get a job at the USPTO! They only hire new IDIOTS!!!!

      I'd be relieved to know they didn't hire me because I'm overqualified, but apparently whoever's doing the hiring just doesn't get the kind of harm they're doing to the process.

      Although I can picture a company paying off someone higher up to push a patent through if I turned down everything that crossed my desk the first time.

      --
      So, when's lunch?
  50. Re:Vague? - nah, just lame by wanton · · Score: 4, Informative

    Actually, I checked out the patents, they do use the word plurality, however :) ...

    They're retarded. Both require that the 'textual' and 'graphical' content of the site be from a 'CD-ROM' or 'optical device'. I know of very few sites that do this. Additionally, the first patent defines that the device which essentially serves contents require a device for displaying graphical content. I guess the patent doesn't take into affect that some people host their shiznit on boxes without a monitor.

    So, fear not the whores.
    (I hope the lawsuits backfire on that blasted company)

  51. It did by KnightStalker · · Score: 2

    The same tactics (not necessarily the same abuse) have occurred over the lifetime of the patent system. There was a previous /. story (I'm too lazy to look for it) about how patent litigation stifled the development of the airplane until in WWI the US government refused to honor the affected patents. Then innovation just took off, if you'll pardon the pun.

    Also, I believe Edison had several patents covering the light bulb. (And thousands of patents covering other things.) It may be obvious to you but it was certainly not obvious in 1879.

    --
    * And remember, it's spelled N-e-t-s-c-a-p-e, but it's pronounced "Mozilla."
    1. Re:It did by KnightStalker · · Score: 2

      Did Swan ever sue Edison? I thought Swan only patented in England and was content to stay there. Not that that's a great excuse for Edison, but I'd be interested to find out if his patent was challenged, and what the outcome was.

      That's the sort of thing that might not get into modern history books, if you know what I mean. Questioning cultural myths and all that. :-)

      --
      * And remember, it's spelled N-e-t-s-c-a-p-e, but it's pronounced "Mozilla."
    2. Re:It did by budgenator · · Score: 2

      Actualy I thought Edison patented a practical light bulb, so his patent was for improving an existing patent.br?

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
  52. Job Requirements for patent office by squared99 · · Score: 3, Insightful

    what are the current job reqs for the patent office? Do they have different division? Meaning is there a patent division for internet technology, a patent division for genetic pateneting, etc?

    Decisions about patents are obviously being made by people who have no idea how these things work in their respective fields. Are they just checking the patent claims for grammer, and that all the checkbox's are filled in? We need people working there that actually have a vague idea of what is being patented. I dont understand how anyone semi tech-literate could allow these pass, hell I dont know how anyone literate could let these pass?

    Imagine if people start claiming necessary carpentry skills like 'the process of putting a a variety of small steel spikes in a piece of wood' - that'll cover hammering, screwing, etc. Or 'method of subdividing wood into smaller pieces.' - sawing.

    How is this any different?

    1. Re:Job Requirements for patent office by ProfBooty · · Score: 4, Informative

      there are general divisions for chemical, electrical, mechianical, biotech and business methods. from there, there are breakdowns into specific technologies, such as sporting equipment, telephones, tyres etc, nearly every catergory of invention.

      At least BS is requried, for some techonolgies, more is required for education/job experience.

      the people who work at the PTO probably know far more than you do about a specific technology. The problem is you have to read how the claims are written. The claims define the actual invention. If the law firm does a good search prior to filing a patent, they can word the claims so that the examiner can't find it. Likewise after a non-final rejection, the attorney can ammend the claims to not read on the art the examiner cited.

      "Imagine if people start claiming necessary carpentry skills like 'the process of putting a a variety of small steel spikes in a piece of wood' - that'll cover hammering, screwing, etc. Or 'method of subdividing wood into smaller pieces.' - sawing."

      The article poster only quoted the preamble, not the actual invention, so the slashdot article is misleading. Likewise the passage from the above poster is inaccurate. That is called the preamble and is not the actual invention. The actual invention portion of the claim would likely read something like this:

      1) A method if inserting small steel spikes in a piece of wood, wherein said wood is composed of pine. ETC with more and more detail AFTER the preamble portion

      I'm pretty tired of slashdot people, who are entirely uneducated in the patent process, critizing a process which they don't even fully understand.

      --
      Bring back the old version of slashdot.
    2. Re:Job Requirements for patent office by Vuarnet · · Score: 2

      At least BS is requried, for some techonolgies, more is required for education/job experience.

      Yeah, it's plain to see that the patent process is full of BS (drumroll).

      --
      Tongue-tied and twisted, just an earth-bound misfit, I
      Learning to fly, Pink Floyd.
    3. Re:Job Requirements for patent office by squared99 · · Score: 1

      yes, you are right. I dont know much about it, that's what I was intending for the post, a question about it, I actually wanted to know. I admit it was snarky, but I was exasperated. No offense intended personally, but patents like these are affecting my livelihood.

      It is good to know that there are specializations in patenting, but it seems to be failing somewhere.
      You have to admit a lot of frivilous patents have been passing, and they are affecting my field (programming) drastically. My example might have been a bit contrived, and the wording in the article, as you say, may be the preamble. But the result is the same, basic procedures and tools that people use everyday to get a job done are being patented. Common logic, or something so vague it can be used to shake small business down, as in the article. The fact that greedy shiesters like this Lockwood guy make a living from it, says something is wrong in the process.

    4. Re:Job Requirements for patent office by ProfBooty · · Score: 2

      no , i wasn't trying to be confrontational, i actualy work in patents, its just that there are a ton of ill informed people here.

      i won't comment on software patents other than the fact that inventors have used the courts to force software patents on the US. Its not like the PTO said, hey we need more money, lets do software patents.

      As you said there are patents on basic tools, but there are a ton of patents just for hammers alone. There are a lot of varations on the same idea, there is not reason why you can't patent a different implementation of the same idea, especially if you write the claim properly.

      I'd love to write an explanation for slashdot on how the patenting process works(and show that the PTO isn't a rubber stamp operation).

      I don't doubt that there are abuses of the patent system (for example submarine patents), its just that people are reading many patents far to broadly, since the patent in part is determined by the disclosure as well as the rejections which the examiner issued (they come up in court as evidence).

      --
      Bring back the old version of slashdot.
    5. Re:Job Requirements for patent office by squared99 · · Score: 1

      So do you think it may be a combination of things then? Not necessarily the patent process per se, but the way in which people attempt to enforce them in the courts, and the fact that there is no good recourse for frivilous lawsuits over patents, leading to these blackmail type lawsuits?

      I can see why the patent office would be allowing things to pass through that are basic tools, because as you say this allows for a variety of implementation on the same concept, but once it leaves the review/approval domain, it seems to spin out of control in the courts.

      Thanks for clearing things up a bit, I admit I have never had a chance to discuss it with someone who works in the process, so I appreciate your replies.

      Cheers,

    6. Re:Job Requirements for patent office by ProfBooty · · Score: 2

      That is the problem in itself. It is VERY exspensive to preform patent litigation in the courts, especaily for small companys/private inventors.

      I really don't know a solution to this since it really is the little guy fighting the big guy.

      --
      Bring back the old version of slashdot.
    7. Re:Job Requirements for patent office by CJ+COS · · Score: 1
      what really amuses me is the fact that if you take a look at the Patent Office's website showing the first patent being claimed, they themselves have an "online order system" where you can order paper copies of the patents themselves, theoretically in violation of the very patent they are displaying!

      The statement was that we Slashdotters don't necessarily understand as much as the patent office. Apparently, they're not reading for comprehension when they approve patents...

      --
      "Who is General Failure, and why is he reading my hard drive?"
  53. Patent system by The+Impossible · · Score: 2, Insightful

    I always wondered why the american patent system is so wierd. The european system is so very simple.

    You invent, then you patent, then publish. When you first publish or try to patent something that already is commonly used, forget it. It's not your idea, you could have found it anywere, so no patent is granted. Easy, simple and stupid actions like this can be prevented.

    BTW the legal system is pretty wierd to... is that why coffee cups state that coffee is hot... Overhere we complain when it's cold, coffee should be hot and a normal thinking person only drinks coffee when it's not to hot. WHen you burn yourself, you're to stupid to drink coffee. (but in america you're smart and start sueing the supplier)

    IMHO these rules, in patenting and the law, really prevent the Joe Common to use it's brain... Wait a minit... america is producing the biggest army and will start to invade every country that still doesn't listen... that's it. Keep the people stupid so you can use them...

    Be afraid... for hot coffee. ;-)

    --
    ... Wenn ist das Nunstruck git und Slotermeyer? Ja!... Beiherhund das Oder die Flipperwaldt gersput!
    1. Re:Patent system by Jade+E.+2 · · Score: 2
      This is (somewhat) offtopic, but here goes.

      You misunderstood the nature of the original McDonald's hot coffee lawsuit, as did most people. See the very informative site here for details, but basically it boils (no pun intended) down to the fact that McDonalds keeps it's coffee at 185 degrees F. Standard restaurant coffee temperature is around 165 degrees, but the coffee stays fresher (hence having to be re-made less often) at 185. At 165 degrees, a spill will probably cause first degree burns, but nothing serious. At 185 degrees, it causes third degree burns in under two seconds. You know, the kind that leave you with scar tissue for the rest of your life? McDonald's probably wouldn't have been found negligent if it was just the temperature, but prior to the famous lawsuit they had settled over 700 scalding claims relating to this practice. They admitted they knew it was a hazard. And the 81 year old woman only sued them because they refused to pay the medical bill for the skin grafts and 7 days in the hospital she suffered.

      There are problems in the system. Major problems. But you need to find a new example to throw around. (That, or specify which case you're referring to. Feel free to refer to this coffee case instead of the famous one that got the labels put on. :)

  54. Those bastards by forged · · Score: 1

    After reading the article, were I the only one wishing I had guns and drove over to visit them for a couple of hours ? (Think Leon here).

  55. Relational database and SQL by janimal · · Score: 2, Interesting

    is what comes to mind when I read "a computerized system for selecting and ordering a variety of information, goods and services"...
    These small businesses should be able to defend themselves sans lawyer.

    J

  56. Is Vend/Minivend prior art? by Jan0815 · · Score: 1

    IANAL - but IMHO there is prior art available that could turn these patents to where it belongs - /dev/null

    Take a look here:

    http://carnagepro.com/pub/Docs/MiniVend/

    Quote:

    "About Vend, MiniVend's ancestor

    Vend was written by Andrew Wilcox in the early part of 1995, and the first released (beta) version was 0.2. Vend 0.2 is the parent of MiniVend, and the first version of MiniVend (called Vend 0.2m7) was totally based on that. It added searching and DBM catalog storage. Subsequent versions took parts from Vend 0.3, especially the VLINK and Server.pm modules, which were adapted to run with MiniVend.

    The first release of MiniVend (0.2m7) was on December 28, 1995, making it over four years old. A veritable eon in web time!"

    I would love to hear something from Andrew Wilcox (is he still at Akopia/Interchange?) about this.

    From my european point of view I can only say that US patents again show to be just as ridiculous as US copyright protection. Gosh.

    1. Re:Is Vend/Minivend prior art? by the+eric+conspiracy · · Score: 3, Informative

      IANAL - but IMHO there is prior art available that could turn these patents to where it belongs - /dev/null

      IANAL either, but I do hold 12 patents and know a little about what prior art is.

      Prior art simply is art that is in practice or was publically disclosed at the time the inventor claims he made the invention.

      The fact that MiniVend was released in 1995 probably does not qualify it as prior art. The PanIP patent was ISSUED in 1996. The invention (and prior art) must occur BEFORE the original filing date which is in this case in 1984.

      Unless you can come up with prior art in this time frame you aren't going to get anywhere.

      Now what is particularly interesting in this case is the long string of CIP's. It would be rather interesting to learn what the expiration date of this patent is - it may be relatively soon since one of CIP's issued as a patent.

  57. PanIP targeting companies not in California? by richard-parker · · Score: 5, Insightful

    The PanIP Defendants web site mentioned in the article has a list of the 50 companies that have so far been sued by PanIP. Interestingly, despite the large number of e-commerce companies in California, none of the defendants are located in California.

    Since the patent holder, PanIP, is located in San Diego the cases are taking place in the U.S. District Court for the Southern District of California. Since all of the companies being targeted are small out-of-state companies they are unlikely to already have an established relationship with an attorney licensed to practice in California. I wonder if PanIP is specifically targeting companies that are not in California, perhaps on the theory that out-of-state companies will be more likely to settle when faced with having to litigate a case far from home?

  58. 25 pages? Amateurs! by pommiekiwifruit · · Score: 4, Interesting

    Biotech companies have been submitting patents of 140,000 pages in length. These may take some time to examine thoroughly.

    1. Re:25 pages? Amateurs! by jdiggans · · Score: 4, Informative

      For biotech patents on genes or proteins the USPTO requires you include a 'sequence listing' describing the sequence of the gene(s) or protein(s) you're patenting. This must be submitted in a very structured format that increases the vertical length of the submitted content by a great deal, especially for long sequences (so I imagine this 140k page application was a small app with a giant sequence listing trying to keep the claims as biologically broad as possible).

      The PTO has finally gotten wise to the act of including everything but the kitchen sink in a patent listing (as was the industry's habit a few years ago) and now charges on a per-page basis for patent submissions. This ensures that if a company files a 140k page patent, they really mean it and are willing to pay for it.

      One of the FEW good ideas out of the USPTO in a long time; let's hope there are others.
      -j

    2. Re:25 pages? Amateurs! by Alien+Being · · Score: 2

      CAGTAGTAcGATACAGAGGATACAGCGATACAGCGA
      GTACGATACAGA CGATACAGCGATACAGCGATACA
      ACGATACAGACGATACAGCGAGACAGCGATACAGA
      ACGAALL YOUR BASE ARE BELONG TO USAC
      ATACACACGATACAGCGATACAGCGATACATAAACA
      GTACGA TACAGACGATACAGCGATACAGCGATACA
      ACGAtACAGACGATACAGCGATACAGCGATACAGA
      ACGATAcAGACGATACTGCGATACAGcGATACAGA
      ATACACACgATACAGCGATACAGCGATACATAAACA
      GTACGATACA GACGATACAGCGATACAGCGATACA
      ACGATACAGACGATACAGCGATACAGCGATACAGAc
      ACGATACAGACGATACtGCGATACAGCGATACAGA

  59. Defendants love such language by werdna · · Score: 3, Insightful
    I'd think any patent that uses phrases like "a variety of" is too vague.

    Vagueness such as this rarely helps the plaintiff. Consider Claim 1:

    1. A computerized system for selecting and ordering a variety of information, goods and services, which comprises


    Ordinarily, the preamble is not read into the claim, although it certainly can be in appropriate cases. But here --assuming, a bad assumption, that it actually serves as a claim limitation--, the addition of the words "a variety of" works to the detriment of the plaintiff. (Consider the fragment with those words deleted). In the absence of the language, the fragment is far broader, referring to all information, goods and services. With the language, which must be read to mean SOMETHING, a narrower set of possibilities is considered.

    Does it mean: more than one thing, where each thing is either information a good or service; more than one thing, and different things, where each thing in one of the categories; or more than one thing, with things in two or more of the categories? Answers are found in the spec, the prosecution history and elsewhere, and it is stuff like this that gives defendants a chance.
    1. Re:Defendants love such language by GiorgioG · · Score: 1

      1. A computerized system for selecting and ordering a variety of information, goods and services, which comprises

      Wouldn't a Point-of-Sale or Procurement be system considered prior art?

  60. that's like by Alarion · · Score: 1

    patenting the grocery store

    hmm...
    I think I will patent the act of rolling around in a bed (or floor, kitchen table, rooftop, etc) with a member of the opposite sex which results in the creation of another human life nine months after...

    I'm going to be soooo rich!

  61. prior art by dnight · · Score: 4, Interesting

    I was implementing EDI 15-17 years ago.

  62. What if you use .NET or WebSphere? by iconnor · · Score: 1

    These are products designed for e-commerce in which Microsoft and IBM and have millions of patents. If you are licensing this software, you must be covered for patents. You need to check which patents you are already licensing as they may be enough.
    Also, as soon as this firm tries to sue anyone big, their patents will be history.

  63. method for swinging on a swing... by Cl1mh4224rd · · Score: 1
    In accordance with one embodiment of the present invention, a method is provided for swinging on a swing.
    So, basically, they turned simple instructions into a patent. Wtf?

    Must've been "Bring Your Bong To Work" day...
    --
    People will pass up steak once a week, for crap every day.
  64. The bathtub is a DESIGN patent by ProfBooty · · Score: 2

    that bathtub patent you referenced is a DESIGN patent. There are design patents for almost everything (you can find video game console designs etc). Design patents ONLY HAVE DRAWINGs.

    Utility patents have drawings and a specification.

    there is a big difference

    --
    Bring back the old version of slashdot.
  65. Charge 'em by jimcooncat · · Score: 1

    I think the courts ought to charge the loser of these patent suits triple the cost of the judge, bailiff, overhead, etc. and have the residual profit go back to the taxpayers. The people involved in these disputes are tying up our courts' resources that could be used for real problems.

    Of course, if the patent process actually worked for us I probably would have a different opinion.

  66. Clearly... by Overzeetop · · Score: 2

    ...we need to go back to the time when you were required to submit a scale model of your patentable "invention" which would fit in a 12" cube and have all the relavent identifiable parts.

    --
    Is it just my observation, or are there way too many stupid people in the world?
  67. um hello did you read the patent it dates to 1988 by ProfBooty · · Score: 2

    the patent has an effective filing date of 1988!

    Look at the parent applications, it has priority back to 1988, which is prior to the people selling chocololate over the internet and prior to a lot of other art.

    The patent process is far more involved than people here seem to think it is. If people would actually read the claims and look at the priority information, they would realize that things aren't as ovbious as they think it is. Doing so is hindsight. If a patent has priority back to 1988, you have to use the art available to you in 1988, not 1996!

    --
    Bring back the old version of slashdot.
  68. Last year? by stewby18 · · Score: 1
    The patents PanIP bases its lawsuits on were granted-the first in 1996 and the second last year ... The claims in these patents being asserted in the lawsuits refer to "a computerized system for selecting and ordering a variety of information, goods and services" and "an automatic data-processing system for processing business and financial transactions between entities from remote sites".

    Last year?!?! Granted, they are both stupid, but how could someone have managed to get a patent on a basic part of e-commerce last year? Did the patent officer reviewing this one live in a cave?

  69. Tort reform / Losing Legal Fees by tdemark · · Score: 1

    There's been a lot of talk about tort reform and how the little guy can't sue the big guy since, in a loss, they would probably have to pay the big guy's legal fee.

    How about this to level the playing field:

    The amount of damages to repay legal fees can be no more than the smaller of the plaintiff's legal fees or the defendant's legal fees.

    Thus, if two similarly sized companies sue each other, the fees should be about the same. If a small company (or person) sues a big company, the big company can't allocate a team of lawyers to the small company's one lawyer and expect to get it back in a counter-suit.

    Just an idea.

  70. Prior Art by NetRanger · · Score: 2

    Compu$erve has had online job listings since nearly the beginning in 1979.

    --
    -- We live in a world where lemonade is artificial and soap has real lemon.
  71. Automobile suffered the same fate by Goonie · · Score: 2
    There was a guy who came up with a vague patent describing the general idea of an automobile (which was obvious for some time before its actual development) back in the 1870's, kept on revising the patent for a decade as development of actual cars progressed, then enabled the patent just as the first actual cars were produced. He then used the patent to set up a cosy cartel of makers who kept costs artificially high.

    Along came Henry Ford, who along with perfecting mass production of the automobile, busted the cartel and the ridiculous patents.

    --

    Any sufficiently advanced technology is indistinguishable from a rigged demo
    --Andy Finkel (J. Klass?)
    1. Re:Automobile suffered the same fate by mekkab · · Score: 2

      Well, from what I recall, Henry Ford paid right along with it until he had enough money to afford to break it in court.

      --
      In the future, I would want to not be isolated from my friends in the Space Station.
  72. Re:What is a patent? by chrish · · Score: 1

    I can't tell you that without a licensing fee... sorry.

    --
    - chrish
  73. Once it's issued... there IS a protest period. by Anonymous Coward · · Score: 1, Informative

    Anyone can challange an issued patent's validity without first being sued for infringement.

    There are in fact expected changes to be implemented in this area of patent law that strengthens the ability to challenge patent validity (Its called an inter parties reexamination).

    The main drawback to this approach is that if the patent is ruled valid as the result of an inter parties reexamination then the party that has requested the reexamination cannot challenge the patent's validity again in any subsequent infringement litigation.

    President Bush is expected to soon sign legislation that contains fundamental changes to existing patent reexamination procedures. The legislation would allow reconsideration during a reexamination proceeding of prior art references cited in or considered by the United States Patent and Trademark Office (PTO) during the original prosecution of the patent undergoing reexamination. The pending legislation would also allow third parties in inter partes reexamination proceedings to appeal adverse decisions to the Court of Appeals for the Federal Circuit.

    THE PENDING LEGISLATION

    Recently, the Senate approved amendments to the patent laws, similar to amendments previously passed by the House of Representatives. The House and Senate versions of the patent law amendments were reconciled in conference, and attached to H.R. 2215, 21st Century Department of Justice Appropriations Authorizations Act. H.R. 2215 has been cleared by Congress to be forwarded to President Bush, and his signature on the bill is expected soon.1

    RECONSIDERATION OF PREVIOUSLY CITED ART

    The Patent Law allows any person, including a patent owner, to cite prior art patents and printed publications to the PTO that are believed to bear on the patentability of one or more claims of a patent, and to request that the PTO institute a reexamination of the patent.2 If it is decided that the cited prior art raises "a substantial new question of patentability," the Director of the PTO will order reexamination of the patent in question.3 During reexamination, some or all of the original claims of a patent can be declared invalid, patent claims can be narrowed to overcome the prior art, or the patentability of some or all of the original claims can be confirmed.

    Currently, two decisions by the Court of Appeals for the Federal Circuit, the court having exclusive jurisdiction over patent cases, limit the prior art that the PTO can consider in a reexamination proceeding.4 Prior art that was cited or considered during the original prosecution of a patent cannot alone form the basis for a substantial new question of patentability triggering the reexamination of that patent. Further, previously cited or considered prior art can only be considered by the PTO during a reexamination proceeding if combined with prior art not previously before the PTO. Thus, under the present law, a reexamination proceeding cannot be based on an argument that the PTO overlooked prior art cited during the original examination of a patent, or that the PTO was mistaken in its consideration of prior art during the original prosecution proceeding.

    With the signing into law of H.R. 2215, patent validity challenges based on previously cited or considered prior art will be able to be made in the PTO in a reexamination proceeding.5 In such instances, this alternative to contesting patent validity by litigation in the federal courts may provide a less costly and more expeditious means of mounting a patent validity challenge.

    RIGHT OF THIRD PARTY TO APPEAL AN ADVERSE REEXAMINATION DECISION

    Presently under the law, the appeal rights of a third party who has instituted an inter partes reexamination proceeding against another's patent are limited. The third party can appeal an adverse decision by the PTO to the PTO Board of Patent Appeals and Interferences (BPAI). However, third parties are expressly prohibited from seeking court review of a decision rendered by the BPAI.6 Conversely, patent owners are allowed to seek judicial review of adverse decisions by the BPAI in reexamination proceedings by appeal to the Court of Appeals for the Federal Circuit.7

    H.R. 2215 provides that third parties in inter partes reexamination proceedings will have the same appeal rights as patent owners.8 Thus, once H.R. 2215 is signed by President Bush, a third party challenger will have resort to the Court of Appeals for the Federal Circuit to contest adverse decisions by the BPAI as well as to be party to any appeal to the Federal Circuit brought by a patent owner.

    The inability of third parties in inter partes reexamination proceedings to seek judicial review of adverse decisions has been considered a major drawback by those challenging a patent's validity. The provisions of H.R. 2215 should make the inter partes reexamination procedure more attractive to anyone contemplating the challenge of a patent based upon prior art patents and printed publications.


  74. Re:um hello did you read the patent it dates to 19 by Wirr · · Score: 1
    Look at the parent applications, it has priority back to 1988, which is prior to the people selling chocololate over the internet and prior to a lot of other art.

    So what? In Germany there was BTX much prior even to that, 1984ish I think, where a lot of stuff was sold (rather pixelish pr0n for example). The French had a similar system, which predates the German one too.

  75. Re:Vague? - nah, just lame by gmack · · Score: 4, Insightful

    Optical device== Camera ?

    So I'm guessing they think the patent covers anyone who took pictures of their product and put them up on their website.

  76. A Point of Patents Anymore? by KalenDarrie · · Score: 1

    Considering the current nature of patents and the fact that it seems every other company out there is trying to twist and bend them to their own will, I think it might be time for the organizers of these patents to put their heads together and develop an advisory board of some type that weeds out any patents that have language that's too vague. Or if there is already one, it needs to be replaced. Now.

    This is getting to the point where I(and perhaps others) are starting to wonder what good there is in patents where they can be so easily used to give legitimate businesses a hard time. Though I realize it isn't a better idea to just ditch all patents and turn invention and innovation into a nasty free for all. Or maybe it is? Think it might be better to just turn them all loose on one another without restraints?

    --
    Kalen D'arrie
  77. The truth of the matter is: by dapic · · Score: 1

    A government office can make a decision solely on their own, while the decision may affect potentially a lot of businesses. Worst part is, if the government office makes a mistake, there is no way to mend it other than letting some legitmate businesses taking the hit.

    It seems that in almost all aspects of government activities, the decisions can be disputed and reversed, except for patents. This should be changed, or it will greatly impair people's right to "pursue happiness" (thru conducting legitmate businesses), which were explicitly granted in the US Constitution.

  78. Re:um hello did you read the patent it dates to 19 by ProfBooty · · Score: 2

    my point is simple. You can't use hindsight reasoning for why things are ovbious.

    I'm not argueing that there isn't prior art that doesn't get around the patent, it is likely that the claim language makes it difficult to get around.

    I mean really, how many different mouse trap designs are there. They way the US patent classification system is organized, you have hundreds of patents listed for each class/subclass combination for example class 348 is television and there are hundreds of patents in there, there just isn't one TV patent which covers every tv element every made.

    --
    Bring back the old version of slashdot.
  79. When someone.. by Mabidex · · Score: 1

    When someone get's to the tipping point...

    they'll end up waiting somewhere dark with a sniper rifle.

    Ok, maybe that was a little to harsh, but if everyone knows there is a problem, why does it take some crazy incident to trigger change?

    Wonder what crazy incident will it take for the patent office to change?

    I think it maybe the time when certain states stop dealing with the restricitions all together. Can states enter into state law such a device?

    You guys are smarter than me, do individual states have this power?

    Mabidex

  80. on a lighter note by SupahVee · · Score: 2

    We seem to have reduced their website into a smoldering pile of silicon and aluminum. Keep up the good work, boys.

    --
    "See, we plan ahead! That way, we never have to do anything now."
  81. Examine the Claims by Anonymous Coward · · Score: 1, Insightful
    I'll bite to your troll:

    "I've got a friend who has a friend that works in the USPO and he was telling me how ridiculous it is to work there."

    Well, I have a friend of a friend of a friend whose girlfriend's mother's uncle said differently. I certainly wouldn't use your source for the basis of opinion; Would you use my source? I, however, was an examiner at the USPTO for several years, so I think that I have a good idea of what it's like to work there and how the system works.

    "His boss is involved in all sorts of payoffs and dirt - I literally couldn't believe the stories he was telling."

    Then don't be a fool and believe them. All of the people that I know at the USPTO are hard working professionals. And, no, I'm not a shill. Noone I know of is the recipient of payola. In fact, the law forbids examiners from taking gifts, and employees sign an acknowledgment as to such. They are constrained, however, by law and many in the slashdot community don't know what the law is (and I'm not talking statutes, but case law).

    "One tactic lots of patent filers like to use is to send in a 25 page document, and the first 24 pages are garbage designed to lull the reviewer to sleep, then they slip in a couple of paragraphs that involve what they're really trying to patent at the end."

    Patent examination involves reading the claims first, not the specification. A patent application doesn't read like a novel, and is not meant to. The examiner looks at the specification to see if the claims are supported under 35 U.S.C. 112, and does the prior art search on the claims. The examiner also creates a prosecution history with the applicant, so that the scope of terms is defined in that application history. Notice, however, that in the examination process if the claims are not supported by the specification, then they will be rejected. Thus the impetus to put as much as you can into the specification so that the scope of the invention is supported as fully as possible. It is not for the purpose of lulling anyone to sleep.

    The same goes for claiming. The applicant is entitled to claim what they believe is the scope of their invention. If they have overstepped the bounds, then it is the examiner's job to reel it in. This is the reason that claims are written broad ->narrower ->narrower still ->etc. ->narrowest. Patent claiming is analogous working with Venn diagrams. The trick is not drafting a set of claims that are outside of your invention and into the prior art. If something slips past the examiner (they're only human), then the courts can set it straight.

    "He later got put on a committee that was trying to track fraud and they figured out that some really high percentage (don't remember exactly, but it was over half) of the patents are frivolous and completely bunk."

    That is complete bovine sh*t. A patent system based on "over half" of the patents being "frivilous and completely bunk" would never support the weight of the costs involved. Your friend's friend may not see the value of a given patent application, but my friend's, friend's, friend's, girlfriend's mother's uncle surely did, and that is why he filed his application.

    1. Re:Examine the Claims by Tablizer · · Score: 1

      In fact, the law forbids examiners from taking gifts, and employees sign an acknowledgment as to such. They are constrained, however, by law and many in the slashdot community don't know what the law is

      Oh, they sign a paper and it is law, therefore they don't do it and we are all safe from bribery there.

      "It does not happen because they sign a paper that says it does not happen."

      Yeahright. What planet are you from?

    2. Re:Examine the Claims by Tablizer · · Score: 1

      My point is that stating it does not happen because people swore that they would not do it is NOT a very good reason to say it does not happen.

      One person has anecdotal evidece that it does happen and you have anecdotal evidence that it does not happen. Why is your anec better than his/her anec?

      IOW, you offered 2 peices of evidence:

      1. Swearing on paper that they wont

      2. Anecdotal evidence of character

      Well, the other person's anecdotal evidence cancelles out #2, leaving #1, which is a weak argument IMO.

      That is my reasoning in a nutshell.

    3. Re:Examine the Claims by Tablizer · · Score: 1

      (* One difference is that I have first-hand experience, not anecdotal. *)

      I don't see your claim as being any stronger than the other guy's from my perspective. Remember, I am not you. I can only listen to two people making similar types of cliams that point to different conclusions.

      Now, if you actually worked in the patent office yourself, then I might give your statements more weight than his.

  82. No, those bastards!!! by Oliver+Wendell+Jones · · Score: 1, Flamebait

    DeBrands makes some of the finest chocolates I've ever tasted. They have a store in Indianapolis that sells their chocolates and fresh desserts. You haven't lived until you've tried one of their hot carmel beverages (like hot chocolate, only with carmel instead).

    If they go out of business due to these money-hungry bastards, I swear by all that I hold holy, I will hunt down everyone that has anything to do with PanIP and make them sorry.

    --
    A computer once beat me at chess, but it was no match for me at kick boxing -- Emo Phillips
  83. Proof you can patent anything by greggersh · · Score: 1

    This is an important patent. We really need this one:

    Method of swinging on a swing

    Abstract
    A method of swing on a swing is disclosed, in which a user positioned on a standard swing suspended by two chains from a substantially horizontal tree branch induces side to side motion by pulling alternately on one chain and then the other.

    Full Patent here

  84. More prior art... by agallagh42 · · Score: 1

    I distinctly remember ordering a few CDs from cdconnection.com in the summer of '94. It was an online CD store that had a telnet interface. I remember it quite clearly. I dialed in to my brother's university shell account, using my 286 with DOS and Qmodem, to make the purchase. CDs arrived safe and sound about a week later.

    --
    Carpe Cerevisi - Seize the Beer
    1. Re:More prior art... by agallagh42 · · Score: 1

      I know, don't reply to your own posts, blah blah. Just wanted to point out that, according the the current CDConnection.com website, they've been online since 1990! That's gotta count for something...

      --
      Carpe Cerevisi - Seize the Beer
  85. I hearby patent by aliens · · Score: 1

    This patent currently waiting for clearance will cover and protect my latest creation.

    A variety of ways to induce conciousness, including but not limited to, biological, mechanical, and chemical(from here referred to as [the processes]). Along with the means necessary to support the processes.

    All 6 billion+ of you humans are now in violation of my patent. Pay me. Oh and my list shows one HAL 9000 as well. Pay me too.

    Disgusting.

    --
    -- taking over the world, we are.
    1. Re:I hearby patent by Daniel+Dvorkin · · Score: 2
      aliens wrote:
      Oh and my list shows one HAL 9000 as well. Pay me too.
      "I'm sorry, aliens, I can't do that."
      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
  86. Re:claim language by ProfBooty · · Score: 1

    correct. Unfortunatly, a lot of posters seem to believe that the scope of the claims are infinetly wide which is not really the case.

    Perhaps a post directing people to portions of the MPEP would be useful in educating slashdot posters?

    --
    Bring back the old version of slashdot.
  87. When will we get Amazon,Buy,Microsoft (!) onboard? by jswitte · · Score: 1

    Seriously people, when will we get MS onboard to fight this? We may not like MS, but if Bill G could be convinced that this should be fought (and not just to give MS the patent), I'm sure that PanIP would be monetarily pummelled into dust very very quickly.. Add to MS's money pot that of Amazon, Buy, Yahoo, Ebay, etc ad infinitum.

  88. Patenting GOALS is just stupid stupid stupid by Tablizer · · Score: 1

    As somebody pointed out last time, they are granting patents to goals these days, not just implementations. "Exchange money using a computer" is NOT a technology, but a fricken goal. They are wildcarding "Do X using a computer" where X is any process currently done by paper, phone, or in person.

    I am surprised that there has not been a constitutional challenge. Goals or anything like them are NOT mentioned in the constitution.

  89. Sue the patent office? by jiriw · · Score: 1

    How long should we wait 'till your U.S. Patent Office will be sued for them releasing to many false patents by those companies hurt by to many bullshit patent infrigement sues?

    What could those companies sue the patent office for? Forgery, grave neglience, discrimination ?

  90. Pass the buck by Tablizer · · Score: 2

    One solution may be to use an online store service, like Yahoo Stores, instead of roll-your-own. That way they would have to harass Yahoo instead of the mompop store. Of course you can kiss customization good bye.

    Let's see if they have the balls to sue Yahoo.

  91. Doublegood idea! by The_Guv'na · · Score: 1

    "using a computer or network to be a dumbshit"

    Great, when Taco gets a real lawyer [instead of just rolling over and taking it hard and violent from the scientologists without even trying to practice the principles his site preaches] rather than one that just tells him what fights to pick, then he can sue all the trolls and crapflooders for the $$$, thus being able to abollish subscriptions and adverts, plus we'll all have a better board to post on :)

    Ali

  92. Software, business model patents don't make sense by Grax · · Score: 1

    Software and business model patents are totally illogical. They are just written works and no more patentable than a Stephen King novel. ("a method of inducing nightmares in children and other humans")

    Whoever decided they were patentable was either paid off, didn't understand what software was, or both.

  93. Bottom feeders in Lake Erie by terraformer · · Score: 1

    This morning I read the Science Times and read a piece on Botulism and it detailed how a bottom feeder named a goby fish, an invasive species from Eastern Europe, was killing the eco-system of the lake. I guess here is an example of a bottom feeder killing the eco-system of the web...

    --
    Who are you? The new #2 Who is #1? You are #617565. I am not a number, I am a free man! Muhahaha.
  94. Re:um hello did you read the patent it dates to 19 by zurab · · Score: 3, Informative

    the patent has an effective filing date of 1988!

    Eh? What patents are you looking at? Either you are a troll or you didn't check them yourself:

    Patent 5,576,951:
    Inventors: Lockwood; Lawrence B. (5935 Folsom Dr., La Jolla, CA 92037)
    Appl. No.: 210301
    Filed: March 16, 1994
    Patent date November 19, 1996.

    Patent 6,289,319:
    Inventors: Lockwood; Lawrence B. (5935 Folsom Dr., La Jolla, CA 92037)
    Appl. No.: 347270
    Filed: November 30, 1994,
    Patent date September 11, 2001.

    Where did you get the 1988? I am wondering if you are referring to the parent case text with abandoned applications that were referenced there? If so, the dates go back to 1984 and 1986. However, I am not aware of the rule that prior art has to pre-date any of the abandoned patent applications!

  95. let me clarify by ProfBooty · · Score: 1

    the actual invention is everything AFTER the preamble, that is essentially everything after the first comma.

    --
    Bring back the old version of slashdot.
  96. Re:Prior Art by stu42j · · Score: 1

    Actually the patent is more specific than just 'online job listings'. The innovation that the patent claims deals with connecting the applicant resume database to the employer joblistings database.

    I'm not familiar with CompuServe's system so I don't know if this actually changes anything.

  97. "Patents suck"? I think not... by Embedded+Geek · · Score: 2
    when said party usually does not implement their `idea' but really waits for someone else to do the hard work just so that they can sue them later?

    O.k. First, a disclaimer. I work as a software engineer in civil aviation and have worked on military areospace products previously. I have also had peripheral exposure to patents back in my academic days. Therefore, I may not be coming from the same background as you might. I also have not personally been granted a patent even though many of my coworkers have. With that said, though...

    I have never seen a patent that was not implemented in an actual, shipped product. Usually, the patents are developed by engineers facing a specific problem who come up with a unique solution. If the solution is recognized as being novel and extendable to a general case, the patent process is kicked into high gear. By the time the engineer gets his pretty bass patent plate for his cube wall, the original solution is already embedded in a product rolling off the assembly line.

    While I understand that there have been abuses of the patent process in the past (and, yes, especially in the software arena), the system works quite well, thank you. As to "stiffling innovation," I think you have to look at the big picture.

    Patents allow for at least some protection against reverse engineering, which the trade secrets do not. Any time you ship a physical product, be it a be it an executable binary, a mechanical gizmo, or a new pharmacutical (sic), reverse engineering jeapordizes not just the final solution you came up with but (more importantly) all the R&D you placed into the product in the first place. For example, it is not unusual for thousands of new drugs to be researched for each one that makes it to the patent office, to say nothing of those that make it to clinical trials. If patents did not exist to protect against reverse engineering, then no one would put any money into R&D beyond specific, immediate applications - and we'd all be much worse for it.

    Trade secrets can protect specific implementations. But it is patents that protect broader ideas as well as the up front R&D required to derive them in the first place. Expiration dates on patents force innovation to continue and prevent companies from sitting on their patents for too long. If you have complaints against the current state of the US or European patent offices, go ahead and gripe. But to condemn the entire concept of the patent is short sighted and foolish.

    --

    "Prepare for the worst - hope for the best."

  98. Re:CIP's by the+eric+conspiracy · · Score: 2

    The CIP's mean that the patent takes original expiration date?

    In some cases yes. I've had patents issue, and then updated (perhaps split to get better coverage on the patented matter) and the new patents have the expiration date of the original issued patent.

  99. Re:um hello did you read the patent it dates to 19 by zurab · · Score: 2

    actually there is such a "rule" it is called 35 U.S.C. Section 120 you might want to look at http://www.uspto.gov/web/offices/pac/mpep/document s/0014.htm and in particular heading 201.08

    Again, most of the prior applications referenced in those two patents are *abandoned*; therefore, you need to look at the same page you referenced under heading "203.05 Abandoned". The only two relevant applications that were not abandoned that were also referenced were:

    1. In patent 5,576,951, now has its own patent, which is patent number 5,309,355;
    2. In patent 6,289,319, now has its own patent 4,567,359.

    However, claims under these patents are not under dispute by the patent owner. Again, check them yourself before posting crap.

  100. Last Post! by alpg · · Score: 1

    Software suppliers are trying to make their software packages more
    "user-friendly". ... Their best approach, so far, has been to take all
    the old brochures, and stamp the words, "user-friendly" on the cover.
    -- Bill Gates, Microsoft, Inc.
    [Pot. Kettle. Black.]

    - this post brought to you by the Automated Last Post Generator...

  101. Re:patent patents? -- by Slime-dogg · · Score: 1
    "Method and procedure for the dismantling of civilized society by exclusive diversion with legistative processes" (making people so busy defending themselves against lawsuits to do anything productive)"

    You could also sue the government of the U.S., England, ... Any government that has any sort of laws.

    Heh... now, would your patent be invalidated once you've forced Government to stop production of governance?

    --
    You need to restart your computer. Hold down the Power button for several seconds or press the Restart button.