Slashdot Mirror


Royal Society "Creationist" Resigns

Chris_Keene writes in to let us know that the Prof. Michael Reiss, who recently caused a storm with comments about teaching creationism in schools, has resigned from his post as director of education at the Royal Society in the UK. This news coincides with word out of the Anglican church that it is ready to apologize to Charles Darwin, 150 years after it poured scorn on his theory of evolution by natural selection. "The Church of England will concede in a statement that it was over-defensive and over-emotional in dismissing Darwin's ideas. It will call 'anti-evolutionary fervor' an 'indictment' on the Church."

658 comments

  1. First Intelligently Designed Trout! by Anonymous Coward · · Score: 2, Funny

    I AM A FISH!

    1. Re:First Intelligently Designed Trout! by raver31 · · Score: 0

      If you are really a fish, then you have proved evolution is a fact, as clearly you can type, fins do not work on keyboards, therefore, you have grown fingers as you had to adapt.

    2. Re:First Intelligently Designed Trout! by Anonymous Coward · · Score: 5, Funny

      wehat dio yoiui meaan fgins domnt woerk, yiou inswensatiove clode!

    3. Re:First Intelligently Designed Trout! by thePowerOfGrayskull · · Score: 5, Funny

      I AM A FISH!

      I am the walrus.

      That means you are dinner.

      (And before some smart-ass tells me that walruses prefer mollusks, yeah, I know. Now stop trying to ruin my joke.)

      (And before some smart-ass tells me that I did that all on my own, yeah, I know. Now stop trying to ruin my meta-joke.)

    4. Re:First Intelligently Designed Trout! by Alsn · · Score: 2, Funny

      I'd like to point out that you ruined your meta-meta-joke.

    5. Re:First Intelligently Designed Trout! by Anonymous Coward · · Score: 0

      Strongbad doesn't need fingers to type. He be much evovlved.

    6. Re:First Intelligently Designed Trout! by glittalogik · · Score: 3, Funny

      Does 'meta-joke' refer more accurately to a joke about jokes, as in your example, or a joke that generates other joke, like the Irish knock-knock joke (hint: you start), or one that sort of does both?

      "Three blokes go into a pub. One of them is a little bit stupid, and the whole scene unfolds with a tedious inevitability."
      -- Bill Bailey

    7. Re:First Intelligently Designed Trout! by Anonymous Coward · · Score: 1, Funny

      I am the walrus.

      An Royel Sosietty can evolve me new bukkit.

    8. Re:First Intelligently Designed Trout! by x2A · · Score: 0, Redundant

      "Now stop trying to ruin my joke"

      Woosh! Think your own joke went over your head *lol* fool!

      --
      The revolution will not be televised... but it will have a page on Wikipedia
    9. Re:First Intelligently Designed Trout! by Anonymous Coward · · Score: 0

      You what? You walked in in there, wrote "I AM A FISH" 400 times, did a funny little dance and fainted.

    10. Re:First Intelligently Designed Trout! by andrewbaldwin · · Score: 1

      Obligatory 3 stereotypes/pub joke...

      An Englishman, Scotsman and Irishman walked into a bar

      You'd have though one of them would have seen it!

    11. Re:First Intelligently Designed Trout! by Yewbert · · Score: 2, Funny

      My favorite of that ilk:

      A priest, a clown and a six-foot tall talking rabbit walk into a bar. The bartender goes, "What is this, some kind of a joke?"

    12. Re:First Intelligently Designed Trout! by Anonymous Coward · · Score: 0

      It is not easy to type with an erect dorsal fin.

    13. Re:First Intelligently Designed Trout! by Anonymous Coward · · Score: 0

      You doin it rong!

  2. That was an intelligently designed decision by Anonymous Coward · · Score: 5, Funny

    Actually, no, it was survival by the fittest.

    1. Re:That was an intelligently designed decision by pilgrim23 · · Score: 5, Funny

      Creationists Evolved, Evolutionists were created....

      --
      - Minutus cantorum, minutus balorum, minutus carborata descendum pantorum.
    2. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 5, Insightful

      Creationists Evolved, Evolutionists were created....

      Other way around.

      Creationists exist because a clever human engineered a story ("In the beginning...") that could propagate from believer to believer in spite of of evidence to the contrary.

      Evolutionists exist because "evolution through natural selection" is the theory that has survived a repeated process of that has rendered (thus far) all competing theories extinct.

      If a memetic equivalent of an asteroid strikes (say, a sequence of DNA from a 200-year-old Galapagos Tortoise, that, when translated from base-4 to base-2 and divided into 8-bit bytes, produces ASCII for "This being copyright God, Inc., 4004 BC, and limited license is hereby given to this being to go forth and multiply", and said sequence is discovered before the invention of self-propagating genetically-engineered Galapagos-Tortoise-specific retroviruses), we evolutionists will be happy to reconsider our views. The creationists, not so much.

    3. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Don't worry, he got a job at the next US cabinet. Sarah "Drill, Baby, Drill" Plain got her Secretary of Science...

    4. Re:That was an intelligently designed decision by Bryansix · · Score: -1, Troll

      Actually science still can't explain where DNA came from or for that matter science cannot explain matter. The big bang was a theological idea used to give scientists a starting point. That they don't believe in what caused that starting point is moot. I would love if Evolutionists would reconsider their views but for them it is the Holy Grail and a religion. I don't dispute evolution as in "Survival of the fittest" and change over time and adaptations. I reject it as an explanation for the source of all matter, dna, and life. It doesn't tackle those subjects yet you always see those lumped into evolutionary discussions.

    5. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      actually... that's a good point!

    6. Re:That was an intelligently designed decision by lee1026 · · Score: 1

      I wouldn't be sure whether it would be wise to reconsider - after all, there is a lot of genetic material in the world, and just out of sheer coincidence, there might be a string to that effect.

    7. Re:That was an intelligently designed decision by AshtangiMan · · Score: 5, Insightful

      Evolution is not put forth as an explanation for the origins of matter or life. It is put forth as an explanation for how life, once begun, spread, adapted, and led to more complex organisms. What views are you interested in seeing "Evolutionists" reconsider? I have trouble with some of the scientist friends of mine, as they tend to work off of a predefined "operational model" which is required for the scope of their study. But they often forget that outside of this scope they need to reconsider their operational model. Most of them will concede that point after a brief discussion. But my religious friends never do the same. Science calls for constant reconsideration of premises, assumptions, theories, explanations, etc. Science is the business of proving or trying to prove yourself wrong.

    8. Re:That was an intelligently designed decision by poetmatt · · Score: 2, Insightful

      Where DNA came from? It's called ribose/deoxyribose. Or if you wish to go further back, lets just say carbon oxygen and sugar.

      Easy answer, done.

      See, you think too complicated. All things are really not that complicated. Especially since we are carbon based life forms.

      It is for this reason, you are marked redundant. Because we don't have a tag for "factually incorrect" because it would be abused.

      Next time, accept that you essentially evolved from a monkey that evolved from a fish that evolved from an amoeba that evolved basically from a molecule and so forth and so forth.

      If you refuse this explanation, then you refuse your own view as well.

    9. Re:That was an intelligently designed decision by kestasjk · · Score: 5, Insightful

      It doesn't tackle those subjects yet you always see those lumped into evolutionary discussions.

      You're absolutely right; people act as if it's creationism vs evolution, but it's actually creationism vs the whole of science. If creationism is right we've got geological science wrong, the science of star and planet formation wrong, the speed of light wrong, radioactive decay rates, the universe's rate of expansion, the doppler shift's effect on light, the cause of the background x-ray radiation, etc, etc.

      If it was just creationism vs evolution creationists wouldn't be so hypocritical when they accept the parts of science which they think fit.

      --
      // MD_Update(&m,buf,j);
    10. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      "Next time, accept that you essentially evolved from a monkey that evolved from a fish that evolved from an amoeba that evolved basically from a molecule and so forth and so forth."

      Stop with the negative waves. I want my 17 virgins waiting for me in the after-life!

    11. Re:That was an intelligently designed decision by jswigart · · Score: 5, Insightful

      umm no.

      the theory of evolution makes no claims on the origin of life.

      the big bang is more of an attempt at that, sure, and it too supported by much evidence. like all things in science, evolution and big bang are the best we have right now given what we know, can observe and test against. that's infinitely more useful than what creationists have(nothing), and it certainly isn't a religion as you attempt to claim.

      science follows theories best supported by evidence. if evidence contradicts the theory it must be adapted.

      there is no reason to expect science will ever know how everything originated with high certainty. we may simply not have access to information needed to study and test with.

      feel free to provide your arguments for why evolutionists should change their views. so far you have parroted typical creationist nonsense, typically fed by total ignorance of the theories you are arguing against.

    12. Re:That was an intelligently designed decision by retchdog · · Score: 1, Interesting

      And apparently, to a biblical literalist, the refractive index of water was once different. Also when it "changed" to its modern value, that made it less likely for the Earth to flood. I guess water used to be a lot less dense, and now occupies less volume?

      Genesis 9:13-14:

      I do set my bow in the cloud, and it shall be for a token of a covenant between me and the earth.

      And it shall come to pass, when I bring a cloud over the earth, that the bow shall be seen in the cloud:

      And I will remember my covenant, which is between me and you and every living creature of all flesh; and the waters shall no more become a flood to destroy all flesh.

      --
      "They were pure niggers." – Noam Chomsky
    13. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 1, Funny

      ... that evolved basically from a molecule and so forth and so forth.

      It's molecules all the way down. Sheesh.

    14. Re:That was an intelligently designed decision by x2A · · Score: 5, Insightful

      "Actually science still can't explain where DNA came from"

      Abuse of word "actually", requires that following sentence is factually accurate. What you mean is that science still can't explain it to you. Don't assume that knowledge doesn't exist just because you don't possess it personally. "Generalising from self" is a form of inductive reasoning which should only be used when sufficient data for deductive reasoning cannot be easily obtained. You should remember though, that as this form of reasoning does not always yield a correct result, you should always be sure to word such uncertainty into your statements based on it so as to not inaccurately portray the level of research you have carried out which you base the statement upon.

      "The big bang was a theological idea used to give scientists a starting point"

      The big bang is a mathmatical idea resulting from divisions by zero in the time dimension... or something... it's not purely theological.

      "I reject it as an explanation for the source of all matter"

      The metric of whether a theory should be considered true or not should not be whether it explains the source of all matter, as explaining the source of all matter is not a prerequisite in explaining unrelated things and even many related things.

      --
      The revolution will not be televised... but it will have a page on Wikipedia
    15. Re:That was an intelligently designed decision by MrCreosote · · Score: 1, Troll

      Actually science still can't explain where DNA came from or for that matter science cannot explain matter. The big bang was a theological idea used to give scientists a starting point. That they don't believe in what caused that starting point is moot. I would love if Evolutionists would reconsider their views but for them it is the Holy Grail and a religion. I don't dispute evolution as in "Survival of the fittest" and change over time and adaptations. I reject it as an explanation for the source of all matter, dna, and life. It doesn't tackle those subjects yet you always see those lumped into evolutionary discussions.

      The only people who always lump all that other stuff into evolutionary discussions are creationists.

      --
      MrCreosote Meow!Thump!Meow!Thump!Meow!Thump! "You're right! There isn't enough room to swing a cat in here!"
    16. Re:That was an intelligently designed decision by tukkayoot · · Score: 5, Informative

      The big bang was a theological idea used to give scientists a starting point.

      I think it's interesting that you complain that the Big Bang, the origin of DNA, etc. get muddled up with evolution, and yet you are the one who has introduced these subjects to a discussion about about the theory of evolution. I think this is part of the reason these subjects get mingled together in the first place (besides the fact that they're all fascinating science that offers an explanation of our origins, albeit at different levels), somehow or another, these issues all get invoked beside each other, even if it's by someone who brings up the subject to make the point that we shouldn't do that!

      In any event, I think you're off the mark with this statement. The Big Bang developed out of Einstein's discoveries and astronomical observations -- the physics, mathematics and stars all seemed to indicate that the universe was/is expanding. If you follow that discovery out to its logical conclusion, you figure out the universe was once much smaller and more dense. Theology had nothing to do with it, even if "sudden creation" is an idea the world was already familiar with thanks to religion. If anything, it just paved the way of acceptance of the theory among the public. Also, "sudden creation" isn't the same as "rapid expansion," which is what the Big Bang theory is really about. Further, many people/scientists, for a long time, didn't presume either rapid expansion or sudden creation, but instead believed the universe was something eternal and relatively stable -- that's the "starting point" they were working from.

      As for "evolutionists" overapplying the concept of evolution, I see that much less than you apparently do, and when it does happen, I think you can attribute it to scientific illiteracy in general. If by "evolutionist" you mean "a person who subscribes to the theory of evolution," most evolutionists are ignorant about the nuts and bolts of evolution, as are most non-evolutionists. It shouldn't be surprising if they get abiogenesis and the theory of evolution mixed up. It is creationists who I see really get things confused by connecting the Big Bang with the theory of evolution though.

      Also, evolution, in the broadest sense, just means "change over time." That makes it a word applicable to pretty much anything in the world. You can speak of the evolution of the cosmos or DNA, and you're not wrong to do so. What might make you wrong is if you get into the specifics of that evolution.

      Even when we're dealing with specific mechanisms though, it may be fair to draw from the theory of evolution to seek explanations (or new perspectives) on other phenomenon. The law of natural selection is probably the mechanism that is most often invoked, since it can be applied to anything which replicates, can be modified, and is acted on by some sort of selection pressure (how many non-living entities like that exist is a matter that's up for debate). Probably the most common extension of natural selection outside the domain of biology is memetics, a way of looking at the evolution of ideas/culture. Memetics doesn't give you a grand, overarching "theory of culture," but it may be a piece of the puzzle, and gives us an interesting alternative perspective on things.

      As for the origins of DNA, this is an area where natural selection may be applicable. For the scientists engaging this issue, given the relevance of natural selection in the post-DNA world, I think it would be stupid for them not to ask, "Can we explain any of this with natural selection?" Some people may be overconfident that the answer is "yes." This likely stems mostly from ignorance among people who don't understand the distinction between abiogenesis and the theory of evolution, but a few more knowledgeable "evolutionists" do like the theory of evolution so much that they don't see any reason to make such a distinction.

      On the origin of matter, I know of very, very few

    17. Re:That was an intelligently designed decision by cortesoft · · Score: 3, Insightful

      That is my favorite argument against creationists... basically, that if what they are saying is true, this computer they are using to tell me that wouldn't work. I don't understand how you can follow a belief system that selectively accepts what we have learned from the scientific process; it works for EVERYTHING else, but not evolution?

    18. Re:That was an intelligently designed decision by smittyoneeach · · Score: 0, Flamebait

      Alas, it also becomes an orthodoxy.
      In the hands of some, it becomes a club.
      Those who do not toe the line will be beaten.

      --
      Get thee glass eyes, and, like a scurvy politician, seem to see things thou dost not.--King Lear
    19. Re:That was an intelligently designed decision by PopeRatzo · · Score: 5, Interesting

      Actually science still can't explain where DNA came from

      And religion can't explain why God created birth defects.

      --
      You are welcome on my lawn.
    20. Re:That was an intelligently designed decision by PopeRatzo · · Score: 1

      it's actually creationism vs the whole of science

      Bless your excellent insight.

      Unfortunately, I've used my daily mod points already or I'd show my appreciation in a more numerical manner.

      --
      You are welcome on my lawn.
    21. Re:That was an intelligently designed decision by PopeRatzo · · Score: 4, Informative

      Sarah "Drill, Baby, Drill" Plain got her Secretary of Science.

      And a Bachelors in Communications. Don't forget that Bachelors in Communications. She worked six long years for that degree.

      --
      You are welcome on my lawn.
    22. Re:That was an intelligently designed decision by MagdJTK · · Score: 2, Insightful

      Actually science still can't explain where DNA came from or for that matter science cannot explain matter.

      As Stephen Fry once said: "Science may not know everything, but that doesn't mean science knows nothing".

    23. Re:That was an intelligently designed decision by TapeCutter · · Score: 4, Insightful

      "I don't understand how you can follow a belief system that selectively accepts what we have learned from the scientific process; it works for EVERYTHING else, but not evolution?"

      There is still a sizable population of slashdotters who think the scientific process doesn't work when it comes to climate.

      IMHO there is too little effort spent teaching the role of skepticisim in science and too much effort spent teaching factoids. I think the good reverend was trying to make a similar point but that was ignored in favour of a good ol' fashion witch burning.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    24. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 1, Interesting

      Actually science still can't explain where DNA came from or for that matter science cannot explain matter.

      ...and religion still can't explain where god came from.

      I never understood how the big bang is laughed at by creationists as a ridiculous theory when the counter argument means that an all powerful all knowing being just happened to always exist, and created the entire universe. Yet for some reason this all powerful all knowing being feels he should spend all his time and energy with one insignificant little species on one insignificant little planet floating around in an insignificant little solar system.

      Yeah the evolutionists are the crazy ones...

    25. Re:That was an intelligently designed decision by Nutria · · Score: 1

      You're absolutely right; people act as if it's creationism vs evolution, but it's actually creationism vs the whole of science. If creationism is right we've got geological science wrong...

      It would be incredibly helpful to provide a link to some website or book that demonstrates why your assertion (which seems reasonable to me!) is correct.

      --
      "I don't know, therefore Aliens" Wafflebox1
    26. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      >If creationism is right we've got geological science wrong, the science of star and planet formation wrong, the speed of light wrong, radioactive decay rates, the universe's rate of expansion, the doppler shift's effect on light, the cause of the background x-ray radiation, etc.

      Yes, that's correct. Some geological science can be shown to be in error. Some astronomical science can be shown to be in error. The speed of light can be questioned. etc. etc. Try researching it a little. You might be surprised at the vast amount of science that has called into question what you probably accept as fact.

    27. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 2, Funny

      Why wait? Attend a church today!

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    28. Re:That was an intelligently designed decision by Bullet-Dodger · · Score: 5, Funny

      Actually science still can't explain where DNA came from or for that matter science cannot explain matter.

      Which is why I personally don't believe in matter.

      I would love if Evolutionists would reconsider their views but for them it is the Holy Grail and a religion

      Damn scientists and their unwavering, dogmatic belief in whichever theory is best supported by the evidence!

      I don't dispute evolution as in "Survival of the fittest" and change over time and adaptations. I reject it as an explanation for the source of all matter, dna, and life. It doesn't tackle those subjects yet you always see those lumped into evolutionary discussions.

      You stand brave against that strawman! I also reject evolution as an explanation for continental drift, tornados, and the northern lights. Take THAT, scientific dogma!

    29. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 5, Insightful

      I think the focus of science class, nay all of school, should be to teach children how to think, not what to think. Facts and such can be picked up from books - proper ways of thinking are much more important to society.

      The other problem esp with climate change and evolution is that it has been politicised, and so effectively it doesn't matter any more what the underlying truth is, for most people your belief about it is formed as an extension of your other beliefs which don't have anything to do with the issue.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    30. Re:That was an intelligently designed decision by rubycodez · · Score: 1, Interesting

      Wrong answer to wrong question. The important question is from where did the information in DNA come? Encoding medium composition is of secondary interest.

    31. Re:That was an intelligently designed decision by againjj · · Score: 3, Funny

      It's punishment for the sins of the parents or, if you believe in reincarnation, the sins of the person being reborn.

    32. Re:That was an intelligently designed decision by Anonymous Coward · · Score: -1

      Actually, religion (at least Christian theology) does have explanations for things like birth defects, but if I bring up the concept of original sin, that will be even harder for you to swallow at this point.

      Please understand that creationism and science aren't necessarily at odds with each other. I'm a staunch creationist, but believe that God did create our universe via the Big Bang. I reject the concept of macro evolution, as I've never been presented any type of evidence I could even remotely swallow.

      As for micro-evolution (a species adapts to fit changes in it's environment) I have no problem, there is ample evidence for it.

      Evolution has way to many holes merely from a mathematical standpoint to consider it to be even slightly plausible.

      (That's the long version of "please flame me!" LOL

      Larry Nielsen

    33. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 3, Interesting

      This stems from a confusion of what information is. Creationists define information as something intelligent beings make and therefore evolution is wrong as DNA contains information. This is a crappy circular argument. The information in DNA comes from the environment - evolution (described as a information process) can be described as the transfer of information from the environment to DNA. Natural selection ensures that those creatures whose DNA closely match the environment are allowed to continue into the next generation. Hence over time the DNA has more and more information about the environment.

      No matter how stupid this question is, creationists still think it somehow stumps evolutionary biologists!

      For more information: http://www.skeptics.com.au/articles/dawkins.htm

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    34. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 2, Funny

      In fact, everything we know about the world is wrong where it contradicts my opinions.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    35. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 1

      Actually, religion (at least Christian theology) does have explanations for things like birth defects, but if I bring up the concept of original sin, that will be even harder for you to swallow at this point.

      God hates you coz something your supposed ancestors did a long time ago (wanting to learn). The guy needs to learn how to let go...

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    36. Re:That was an intelligently designed decision by rubycodez · · Score: 1

      the interesting question to me is, where is that information in the explosion of the big bang, how did that encode all?

    37. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      And I will remember my covenant, which is between me and you and every living creature of all flesh; and the waters shall no more become a flood to destroy all flesh.

      Translation: "Okay, maybe I fucked up ONCE, but I PROMISE I won't do it again!"

    38. Re:That was an intelligently designed decision by bh_doc · · Score: 1

      I don't get it. Where exactly is the line separating "micro"-evolution and "macro"-evolution, when it's the same process that takes place in each?

    39. Re:That was an intelligently designed decision by retchdog · · Score: 2, Interesting

      This is not flamebait; maybe it's troll, if you want to misjudge my intent.

      I think that for a lot of people, biblical literalism seems to only govern "occult" (meaning hidden) things, or at least grand-sounding things which perhaps Man ought not claim even partial knowledge of. Big things: origins of matter; life at the beginning of the earth (an amazing 5000 years ago!); evolution; &c, and that this makes it easier to accept.

      Now, even though it shouldn't be, it is still to me an entirely different thing to take water, the stuff of life, tangible and indisputably understood as two H, one O, bond angle ~104 degrees, and imagine how it could possibly have been different. It appeals to a primal "need to know" in a way that the more myth-entrenched concepts of "origin" don't. It's harder to say things like "god put the fossil record there to deceive us"; it's water, you're touching it right now and you need it to live. Yet, 4500 years ago, if you had put a stick into the water and looked at it from the side, it would have not appeared broken.

      Since literalists stake their fervor on a complete acceptance of the Bible (not just vis-a-vis evolution but against all science and even all other truth), I want one of these religious apologists to construct an explanation of how god did this. How did God cause water to start refracting while leaving every other fact about the world unchanged?

      Really, it's the least they could do, right? I'll accept that "God did it," along with everything else in your storybook, if you can just tell me an acceptable story of what the physical world was like before rainbows existed, and just how such a fundamental change in matter could have happened while leaving the rest of the world more-or-less the same. Did he change the valence of oxygen? Try drinking some hydronium and tell me how you like it. Were there not electrons before the Flood? If that's the case, how did stuff stay together back then? I would love to read your explanation - it would be the greatest work of hard sci-fi ever to grace the earth and well worth my conversion just to read it! But I am not holding my breath...

      --
      "They were pure niggers." – Noam Chomsky
    40. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 1

      mp3?

      On a more serious note, what is information and why must it have been in the big bang?

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    41. Re:That was an intelligently designed decision by camperdave · · Score: 1

      Maybe it has nothing to do with the refractive index of water at all. Maybe it has to do with the presence or absence of water droplets in the atmosphere.

      --
      When our name is on the back of your car, we're behind you all the way!
    42. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Beautifully written. Kudos.

    43. Re:That was an intelligently designed decision by retchdog · · Score: 1

      Thinking outside the box! Good start.

      Now kindly explain the absence of water droplets in the atmosphere. The bible verse mentions clouds, so this seems like not a very promising argument.

      --
      "They were pure niggers." – Noam Chomsky
    44. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 1, Interesting

      Original Sin?

      Ooh, ooh, wait, no, I know this one: because, from His infallible point of view it was a Good thing to have done!

      Or better, if he didn't do crazy shit like birth defects sometimes He wouldn't really work in mysterious ways, which those who believe both in Him an in their own religous infallibility say He does, thus He must.

      Oh wait, I've got another one, this time based on science! Omnipotent God realized that a world without chaos would be a world without entropy, which would be a bit boring, even given His infinite patience, so He created chaos while he was creating everyting else... 6000 years ago.

      Or even, shut up, clearly you don't get the idea of this whole faith thing. (author's note: I get this one a lot.)

    45. Re:That was an intelligently designed decision by glitch23 · · Score: 1

      You're absolutely right; people act as if it's creationism vs evolution, but it's actually creationism vs the whole of science. If creationism is right we've got geological science wrong, the science of star and planet formation wrong, the speed of light wrong, radioactive decay rates, the universe's rate of expansion, the doppler shift's effect on light, the cause of the background x-ray radiation, etc, etc.

      Just because the theory behind how we got here doesn't mean other theories are wrong. We still need theories to describe our universe. But we act like that those theories must describe a secular universe, one in which a different theory must exist if we accept that God created it. I don't know why, if we accept God created the universe, that it must mean that how stars form with a God are different from that of stars without a God. The rules of the universe stay the same no matter what and in fact if God were accepted as being the cause then we know they were actually put in place; it means that we have a reason for why the rules are they way they are. Is the universe's rate of expansion or the gravitational constant all of a sudden wrong because we publically accept that God exists? No. It just means that we know that the values have to be the way they are or otherwise we couldn't exist. We have known that for a while anyway. The same reasoning is used if God didn't create us but the mindset for that reasoning is vastly different. Are we here *because* of the values being just right or was there foresight to make those values exactly set *for* us?

      Some things do have to change though I believe. I just don't know what all are on the "must change" list. I do believe that for data points which have been *interpreted* such as geological evidence those things must be revisited. In fact, I think that if the evolutionists and other scientists who want to prove Creationists wrong once for and for all, the evolutionists, et al. should take every argument Creationsists have (e.g., arguments involving geological evidence and biological evidence interpreted in favor of evolution, et al.) and everything in the Bible and address each one. Be the "bigger man" and address each "fact" that Creationsists use for their evidence and refute each one. If it is a waste of time then why do we ever have any of these arguments? Let the "nutjobs" wallow in their own stupidity. If the secular theories are so simple and concretely proven then just take the time to put Creationsists in their place. This doesn't mean to berate them, calling them insane, or nutjobs. That doesn't do anything besides make the evolutionists fit their supposed roots: that of a mere animal incapable of meaningful conversation. If evidence were reexamined by scientists as if the Creationsists would say "just humor us" and the scientists are of the mindset that they should take the opportunity to prove their side right then they may come to find out they have been totally wrong. Then again, maybe that is what they are afraid of and why what I propose will never happen.

      It's looking at evidence/data with a clear mind, a different approach, which can even include different biases, that spawns new theories and new views on evidence to allow us to further our scientific theories. Einstein decided to view space and time as intertwined. He decided to view energy and mass as the same thing and turned physics on its head to produce the greatest revolution in physics next to quantum mechanics. It takes revolutionary thought to make paradigm shifts. I think we are due for another paradigm shift. There is nothing wrong with rexamining evidence and being proven wrong as long as you admit you were wrong. Scientists do that all the time with minor theories.

      With evolution though I believe that too many people have built their careers on it and are afraid to prove it wrong. It can affect other scientific disciplines drastically but in the end it could also be the path to the theory of everything because, humor me, when some new pr

      --
      this nation, under God, shall have a new birth of freedom. -- Lincoln, Gettysburg Address
    46. Re:That was an intelligently designed decision by mfnickster · · Score: 1

      I don't get it. Where exactly is the line separating "micro"-evolution and "macro"-evolution, when it's the same process that takes place in each?

      Easy. "Macroevolution," as biologists use the term, is evolution at the species level or above.

      http://en.wikipedia.org/wiki/Macroevolution

      Of course, speciation is not simply defined either, so there's bound to be some argument over whether a given two species are truly separate, or merely varieties of the same species.

      Creationists talk about "macroevolution" as being transitions between "kinds," whatever those are. Their main gripe is that you don't see one type of existing animal transitioning into another type of existing animal, e.g. half-cat, half-dog. That's based on a misunderstanding of evolution, because transitions will always be between some existing species x and a future species y which is like x, but not x.

      --
      "Slow down, Cowboy! It has been 3 years, 7 months and 26 days since you last successfully posted a comment."
    47. Re:That was an intelligently designed decision by TimSSG · · Score: 2, Interesting

      Which came first the chicken or the egg? Evolutionists should answer egg. Creationists, who take the Bible literally, should say chicken. I have always been amazed at the number of people who did not realize what this riddle was about. Tim S

    48. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      And yet, the infinitely many complex structures of a snowflake are encoded in nothing but the shape of the water molecule and random fluctuations in the local environment.

      But wait, the shape of a water molecule is encoded in the electron structure of hydrogen and oxygen atoms.

      But wait, the electron structure of hydrogen and oxygen atoms are encoded in...

      It all comes back to the fundamental constants of the universe, from which you can construct unending complexity. Science doesn't even pretend that it can explain the origin of those fundamental constants.

      Oh and don't pull the Second Law of Thermodynamics canard. You can have local decreases in entropy (like, say, on the surface of a planet) as long as they're offset by local entropy increases elsewhere in the universe (like, say, in the nuclear fusion of a star).

    49. Re:That was an intelligently designed decision by bh_doc · · Score: 1

      While correct, that doesn't address my main point that the process in micro/macro is the same. Cf. the WP article: "The consensus of the scientific community is that the alleged micro-macro division is an artificial construct made by creationists and does not accurately reflect the actual processes of evolution."

    50. Re:That was an intelligently designed decision by smaddox · · Score: 4, Interesting

      Evolution is not put forth as an explanation for the origins of matter or life. It is put forth as an explanation for how life, once begun, spread, adapted, and led to more complex organisms.

      I hear people make this argument all the time, but it never comes from a biologist. Do you know why? Because biologists realize that "life" is hard to define.

      In reality, there was no paramount "moment of conception". Life evolved out of simple molecules, just as animals evolved out of simple organisms. The method of selection was different, in that there were not yet 'genes' per say, but there was still selection. When one grouping of molecules failed to produce a self-replicating grouping, it would eventually be broken into quasi random parts. Those parts would then have another chance to form a self-replicating grouping.

      Eventually, a grouping came about (most likely RNA) that could replicate and store information. This grouping may have been formed inside of a 'bubble' of polymer that protected the grouping from the outside world - and the first 'virus' was born.

      I could go on, but I think you get the idea. Natural selection can be seen all around you - not just with 'genes'. Every system has states that are favorable for the continuation of said system.

    51. Re:That was an intelligently designed decision by Miseph · · Score: 5, Insightful

      The glitch in your argument is that few people outside of Biblical literalists and creationists actually believe that the universe requires a different model if God is present. In fact, many Biblical non-literalists who believe that scripture is comprised of moral and spiritual, but not necessarily historical, Truth believe the exact opposite.

      You say that "Evolutionists" are afraid to lose their jobs if the science is debunked... could it also be that Creationists are afraid to lose theirs?

      --
      Try not to take me more seriously than I take myself.
    52. Re:That was an intelligently designed decision by azakem · · Score: 1

      I realize this is completely off the original topic, and I'm late hopping on this thread ... but would someone please take a stab at explaining to me where matter comes from? I probably completely misunderstand the big bang theory, but if my brain remembers any relevant random knowledge for once, I believe it had something to do with all the matter in the universe existing in some ultra-dense form that exploded outwards? Or maybe it was that the big bang caused the existence of space-time itself? In any event, what are the current theories on the origins of the big bang? I guess put simply, where did all the stuff come from? This always makes my brain hurt.

    53. Re:That was an intelligently designed decision by IWannaBeAnAC · · Score: 2, Interesting

      Information is not a conserved quantity. Have you ever heard of the Mandelbrot set? A very complicated object that encodes an infinite amount of information in the equation z = z^2 + c.

    54. Re:That was an intelligently designed decision by nomadic · · Score: 1

      Actually science still can't explain where DNA came

      Every reputable scientist agrees that DNA originally came from mighty Zeus.

    55. Re:That was an intelligently designed decision by camperdave · · Score: 1

      Well, that is the first verse in the bible to mention clouds. So, obviously the waters of the flood were taken up into the atmosphere to form the first clouds, and the first rainbow.

      --
      When our name is on the back of your car, we're behind you all the way!
    56. Re:That was an intelligently designed decision by IWannaBeAnAC · · Score: 1

      I don't think I really understood evolution in a deep sense until I read "The Blind Watchmaker".

      For me, the punch line is that evolution is the mechanism by which species stay approximately the same, and only change very slowly. The reason is that the natural mutation rate for DNA is fairly high, so that if there was no natural selection (ie, every organism that is born survives until it reproduces) then the planet would be filled with bizarre mutations and there would be no stable species. Instead, almost all of the time a mutation is quite harmful for the survival of an organism, and typically the creature will die before reproducing. On a very rare occasion though, a mutation will be useful, and be a genuine improvement. I regard this as self-evident, which leads to a big mental disconnect whenever I try and debate a creationist who simply don't get it.

      In this sense, evolution does the opposite of what creationists suppose it does; rather than causing organisms to change form over time, it is actually causing them to stay the same and only change over enormously long time scales!

      The reason why the rest of science comes into this, beyond just evolution, is that science forms a coherent whole, and very many different branches of science are involved in the details of evolution. For example, without evolution there would need to be some alternative mechanism to slow down or stop mutations of DNA. Mutations have two main causes: (1) mistakes caused when a cell copies the DNA in preparation for cell division. (2) environmental effects such as UV radiation, cosmic rays, nuclear radiation etc. Both of these are significant, so to slow down or eliminate DNA mutations both causes would have to be eliminated. But changing these involves changing the underlying rules of chemistry and physics, and this would flow on to change all other areas of chemistry and physics as well. So you cannot change the reaction rate of some chemical reaction without changing the properties of the molecules involved, and you cannot change the properties of a molecule without changing the atomic structure of the elements (and so on, down to the fundamental properties of quarks etc, but this is far enough for now). Once you change the atomic structure of elements, everything changes, not just the rate of DNA mutations. Anything you can possibly imagine about the natural world would have different properties, and exactly how different is virtually impossible to judge. Most likely, the universe as we see it simply couldn't exist.

    57. Re:That was an intelligently designed decision by bckrispi · · Score: 1

      Mod parent -1: Dumbfuck

      --
      Xenon, where's my money? -Borno
    58. Re:That was an intelligently designed decision by cromar · · Score: 1

      Every state has a continuum that is favorable for the explanation of said state.

    59. Re:That was an intelligently designed decision by rubycodez · · Score: 1

      actually, as far as known with no exceptions, information is absolutely conserved the same as energy, thermodynamics applies to information, and its application to heat is just a special case. Not even a black hole destroys information, see the famous argument over the years that Hawking lost.

    60. Re:That was an intelligently designed decision by rubycodez · · Score: 1

      thermodynamics in the broad consideration says information is neither created nor destroyed, the big bang had to hold all information after t-0.

    61. Re:That was an intelligently designed decision by bckrispi · · Score: 1

      The information in DNA comes from the environment - evolution (described as a information process) can be described as the transfer of information from the environment to DNA.

      Be careful with this argument. I see what you're saying, but it's *very* easy to be taken the wrong way and to feed in to even more creationist babble. The environment does *not* guide mutations within DNA. It only guides natural selection.

      --
      Xenon, where's my money? -Borno
    62. Re:That was an intelligently designed decision by johanatan · · Score: 0

      My experience has generally been exactly the opposite. Religious folk (at least the educated ones) tend to have a better understanding of the different modes of knowing and arriving at knowledge. Scientists, however, tend to covertly market a materialistic philosophy and pretend that it is the only philosophy and the only way of arriving at knowledge. In fact, this form of extreme fundamentalism, blind faith and censorship really borders on religion--secular humanism is a religion. It's time that people wake up and the courts treat it as such and apply the establishment clause to it as equally as its applied to ID/Creationism. What's good for the goose is good for the gander.

      [P.S. Rationalists it seems are also quite reluctant to accept the inherent limitations of their methods as imposed by Godel's theorems (either that or ignorant of the implications of his theorems)].

    63. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 1

      I can't really say I'm a physicist, but my degree in wikipedia says otherwise: http://en.wikipedia.org/wiki/Physical_information

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    64. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      For example, without evolution there would need to be some alternative mechanism to slow down or stop mutations of DNA. Mutations have two main causes: (1) mistakes caused when a cell copies the DNA in preparation for cell division. (2) environmental effects such as UV radiation, cosmic rays, nuclear radiation etc

      To get variation in DNA makeup of a population, it is not necessary to have mutation. Mere preference in selection of mates is sufficient.

      For example, if in a human population, tall people more often than not married tall people, so that their offspring were tall, and short people tended to marry short people so that their offspring were short, and almost all of these offspring (whether tall or short) survived to breed themselves, and they in turn also exhibited the exact same preferences in selecting mates ... then what would tend to happen is the the population as a whole would tend to "spread out" in respect of that characteristic (height).

      Who is to say that this is not actually happening right now?

      Speculation: eventually they might have to design products and houses with "tall" or "short" customers in mind. Given enough separation, there might eventually even arise a geographical and cultural separation into the distinct groups ... you could get "tall" towns and "short" towns. Given enough time, and no "survival of the fittest" selection mechanism operating, eventually (over a very large number of generations) the species could split into two.

      Evolution without mutation.

      BTW ... I can make a very similar argument for "smart" and "dumb" characteristic as I have made for "short" and "tall". The exact same reasoning would apply, even though this argument would be met with far more passioned opposition.

    65. Re:That was an intelligently designed decision by johanatan · · Score: 1

      Scientists are still human. They are still prone to fads and popular opinion. In fact, when you take a close look at them, most are in it for the notoriety--divas, if you will. They are on par with the barbie doll pageant contestants--the only difference is the 'idol'--it is intelligence in their case instead of beauty.

      Most scientists do not have the time or energy to rock the boat with regards to evolution--there's just too much already invested in it (and it fits too nicely with the secular worldview which is so convenient). The fact is scientists *want* Darwinism (i.e., materialism) to be true.

      And as for climate change-- it's simply a pivot point for the Democrats/liberals. It's a symbiotic relationship between unscrupulous politicians and scientists (who are in it for the funding).

    66. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Life evolved out of simple molecules, just as animals evolved out of simple organisms.

      Just as molecules evolved out of nothing... wait what?

      If you read the grandparent more carefully, it says "The explanation for the origins OF matter..."

      Regardless of how you think the Earth got here, you have to believe either matter (or some elementary particle, dimension, etc.) always existed or God always existed and created that matter. Either way, it's pretty impossible to explain, where *something* truly came from.

    67. Re:That was an intelligently designed decision by rtb61 · · Score: 1

      Creationism, because evolution was just too hard and dangerous to explain to a bunch of armed primitive shepherds, rather disturbing that it is still true in this day and age. Obviously human society still has a long ways to go on the evolutionary path.

      I suppose you can look at it in another way, at least more educated and clear thinking individuals can share their opinions and drag along the rest of society into a more knowledgeable future with out getting burned at the stake, forced to commit suicide or suffer various other lethal indignities, evolutionary speaking humanity at least stand a chance of surviving it's own stupidity, hmm, just maybe ;).

      --
      Chaos - everything, everywhere, everywhen
    68. Re:That was an intelligently designed decision by zebslash · · Score: 3, Informative

      I hear people make this argument all the time, but it never comes from a biologist.

      That's completely BS. Read Stephen Jay Gould, he wrote several chapters debating exactly this point. But do not let the facts get in the way.

    69. Re:That was an intelligently designed decision by pacificleo · · Score: 1

      Very true

      --
      somethings are best left unsaid , I am one of those things
    70. Re:That was an intelligently designed decision by jtn · · Score: 3, Insightful

      Actually.. it's complete nonsense. Mixing evolution with cosmology with abiogenesis is just a distraction, a smokescreen. If you accept change over time adaptations, then you accept evolution. The so called "micro" and "macro" evolution are one and the same, just over different time scales.

    71. Re:That was an intelligently designed decision by jtn · · Score: 2, Insightful

      Regardless of how you think the Earth got here, you have to believe either matter (or some elementary particle, dimension, etc.) always existed or God always existed and created that matter.

      Why do you believe there are only those two options? Locking out other possibilities actively being explored by physicists is basically screwing your eyes shut and shouting "LA LA LA CAN'T HEAR YOU".

    72. Re:That was an intelligently designed decision by jtn · · Score: 1

      ... which would apply how at the beginning of the universe, where the rest of physics tends to be considered as a point of break down? Wrong argument.

    73. Re:That was an intelligently designed decision by IWannaBeAnAC · · Score: 1

      No, information and energy are completely different in their properties. To be clear, the word 'information' has lots of meanings. In the technical sense, 'information' is usually described by the quantity called 'information entropy' (or 'Shannon entropy'). The information entropy of a system is the number of bits (binary digits) needed to describe its state. Even in an isolated system this can change (up or down) over time. The information entropy determines how efficient a compression algorithm will be.

      This is quite a different concept to the thermodynamic entropy, that is famous from the Second Law of Thermodynamics (in an isolated system the thermodynamic entropy always increases). In specific situations there are some relationships between these two forms of entropy, but in general they can have completely different properties.

      There is yet another definition of entropy that occurs in quantum mechanics, which is often referred to as the '(quantum) information entropy', or 'von Neumann entropy'. This is the quantum analogue of the Shannon entropy of classical systems. But it is important to remember that quantum information is fundamentally different in some major respects to classical information. It is true however that the quantum information entropy of a mixed state (such as a thermal system) can never decrease under the action of a quantum operation. In particular, this means that a system that evolves in time obeys a quantum version of the second law of thermodynamics and the quantum information entropy always increases (or at best, stays constant). But this certainly does not mean that the quantum information entropy always has this property. Like the second law, it requires very special circumstances.

      Hawking's bet refers to the quantum information entropy of a black hole. The thermodynamic entropy of a black hole had already been resolved many years earlier (with the discovery of Hawking radiation), the remaining problem was with what appeared to be quantum information loss.

      In summary, you are correct that, in a very precise sense, quantum information is not destroyed in an isolated system (but it is not conserved either; in particular it is allowed to increase!). But 'information' here is used in a different technical sense to the Shannon entropy of classical information theory. But even in the precise technical sense, there is no problem at all with a physical process that generates information. Such as a device that calculates the boundaries of the Mandelbrot set, or even a pseudo-random number generator.

    74. Re:That was an intelligently designed decision by smittyoneeach · · Score: 0

      Some churches are actually about intellectual freedom, though that statement too may contradict an orthodoxy.

      --
      Get thee glass eyes, and, like a scurvy politician, seem to see things thou dost not.--King Lear
    75. Re:That was an intelligently designed decision by IWannaBeAnAC · · Score: 1

      To get variation in DNA makeup of a population, it is not necessary to have mutation. Mere preference in selection of mates is sufficient.

      Inheretance of traits is an important evolutionary mechanism, however I didn't mention it in my post because it would have been a complication. In particular, mixing of genes within a population (with no mutations) only mixes existing genes among the population, it does not lead to the formation of completely new genes. For example, if a pair of organisms contain genes ABC and DEF, then there are 6 possible different offspring, AEF, ABF, AEC, DBC, DBF, DEC. Without mutations you are never going to get a completely new gene (H) that is surely a precondition for the eventual formation of a completely new species.

    76. Re:That was an intelligently designed decision by blueg3 · · Score: 1

      That's not correct. Shannon's information theory is closely tied to thermodynamics. In it, acquiring information is a reduction in entropy. (It's a local reduction in entropy, meaning that more entropy must be created elsewhere. It makes for an interesting argument why entropy must always increase. It's easy to show that entropy must always go one direction or the other. Our world-view, in which information is always being acquired, can only exist in an a universe where entropy always increases.)

    77. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      There is still a sizable population of slashdotters who think the scientific process doesn't work when it comes to climate.

      You are confusing a moral issue with a factual issue. The primary issue regarding global warming is, given the facts, what should we do? "What should we do?" is not a questio science typically answers. Partly because the conditions are open-ended. Do we wish to

      a) maximize our GDP at the expense of other nations?
      b) create global discontent?
      c) end poverty?
      d) help big business?

      Also, regarding climate and unlike evolution (generally), you do not have a binary proposition as YOU would LIKE to believe. There are dozens of scientific questions. If you assume more than a few are adequately address, you are mistaken.

    78. Re:That was an intelligently designed decision by Nazlfrag · · Score: 1

      Well, the sea used to be red according to Homer. Many scholars have speculated upon it but I doubt many scientists have looked at it as a serious problem. We don't always need the purest explanation. Would you criticise an Aborigional Australians interpretation of the Rainbow Serpent mythology as unscientific? Perhaps there are some arguments best left untouched by scientific reasoning. It is not the only sort.

    79. Re:That was an intelligently designed decision by moosesocks · · Score: 1

      There is still a sizable population of slashdotters who think the scientific process doesn't work when it comes to climate.

      There's a sizable population of climate scientists who tend to ignore vast swaths of the scientific method when arriving at their conclusions.

      I'm by no means in denial of global warming. However, had we been a little more careful earlier on, there wouldn't be nearly as much controversy.

      Similarly, focusing on education, rather than evangalization could improve things. Most people don't realize the tremendous volume of gas that exits your tailpipe over just a few miles. This should be enough to convince most people that, even if global warming isn't caused by human activity, reducing our energy consumption will greatly improve our lives in a number of ways. Taking the "I'm right, you're wrong" stance will never get you anywhere.

      --
      -- If you try to fail and succeed, which have you done? - Uli's moose
    80. Re:That was an intelligently designed decision by Macgrrl · · Score: 2, Funny

      Was it the first mention of rain? Rain requires clouds to form.

      I'm going to regret wading into to this I suspect.

      --
      Sara
      Designer, Gamer, Macgrrl in an XP World
    81. Re:That was an intelligently designed decision by TheLink · · Score: 1

      Well we just had an educated and clear thinking professor of science education being forced to resign for something he did not do.

      I guess that's progress eh?

      --
    82. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 2, Insightful

      In fact, some churches denounce god!

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    83. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      For example, if a pair of organisms contain genes ABC and DEF, then there are 6 possible different offspring, AEF, ABF, AEC, DBC, DBF, DEC. Without mutations you are never going to get a completely new gene (H) that is surely a precondition for the eventual formation of a completely new species.

      There are only four protein molecules involved in DNA.

      http://en.wikipedia.org/wiki/Dna

      "The DNA double helix is stabilized by hydrogen bonds between the bases attached to the two strands. The four bases found in DNA are adenine (abbreviated A), cytosine (C), guanine (G) and thymine (T)."

      It is quite a bit more complex than this, but essentially all DNA for all life on earth is basically just different sequences of A, C, G and T.

      Long, long sequences .... TTTTAGCCGTTAAAACGTTACGGAT or whatever, for pages and pages ... but just those four involved.

      You do not need a new "H" to create a new species. No mutation is required. Just pairing of individuals, inheritance of characteristics, and some means in a given section of the population to favour one set of gene sequences over another. The mechanism doesn't have to involve selection, and you can have a "split" into two groups of characteristics as easily as you can have an extinction of one group. That is all that eveloution is, in essence.

      No mutation is required. Mere inheritance and selection (via whatever means) is all that is required.

    84. Re:That was an intelligently designed decision by IWannaBeAnAC · · Score: 1

      Whoa, for a start, it was just some example (as one might do in a genetic algorithm on a computer), I wasn't referring to real DNA. And secondly, my point was that if you have a population that has a limited amount of diversity, there may be some genes that you cannot ever get to without a mutation. For example, suppose that every organism in your population has a DNA sequence that starts with the same set of proteins (say, for example 'GATTCA'). Then no amount of hereditary mixing will produce a different sequence for those particular proteins.

      Now it may be that the population is big enough that every possible sequence can be constructed. (Actually I have no idea on that). But even if this is the case, there is still way to add or remove entire chromosomes for example. And the number of chromosomes certainly varies among species.

    85. Re:That was an intelligently designed decision by pacificleo · · Score: 1

      "Actually science still can't explain where DNA came from" origin of DNA has its roots in some complex chemical reactions happened in earth before the birth of uni cellular creature like amoeba . since this was not a controlled experiment so we might not be able to replicate it for the sake of proov but you can always give a statistical proof . this was a highly improbable event where bunch of Protiens and Nucliec acids combined in double helix to form a DNA . as i said its very improbable but given the age of earth i guess its not that improbable too . Bigger Q if scientist somehow manage to create DNA in lab [and they are trying ] will it suffice to Bible Brigade . I am tired of this debate and i wish it to be resolved for good . but I am apprehensive that Bible Brigade will come up with some other mindless faith based argument . we have important things to discuss at /.

      --
      somethings are best left unsaid , I am one of those things
    86. Re:That was an intelligently designed decision by mi · · Score: 1

      I guess that's progress eh?

      of course it is: Isaac Newton — himself a deeply religious member of Royal Society — would never have resigned...

      --
      In Soviet Washington the swamp drains you.
    87. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      The method of selection was different, in that there were not yet 'genes' per say, but there was still selection.

      I bet you don't even know what "per say" means.

    88. Re:That was an intelligently designed decision by dbIII · · Score: 1
      While it's tempting to ridicule somebody on that basis if I look back to my student years every single one of the University political hacks took at least an extra year to finish. That includes medical students and not just the typical student polititions on a soft arts course just doing time before they get a party job or a job at Dad's company. These people are not necessarily dumb but there is something about being a policial trainee of some kind that really adds time to studies.

      At the time of course I tended to look down on them as perpetual undergrads.

      Now it's time for some flamebait. I find it odd that people are being taken in by the "outsider" approach from a VP candidate of the ruling party. Despite her acheivements I'm also cynical enough to think she was chosen to get the "white trash" vote and that some of her speeches have been carefully crafted to do so (pitbull lipstick etc).

    89. Re:That was an intelligently designed decision by jimdread · · Score: 5, Insightful

      Since literalists stake their fervor on a complete acceptance of the Bible

      Apparently, these literalists believe that the bible is 100% literally true. Where do they get this idea? Does the bible say that the bible is 100% literally true? I don't think it does, because it says several times in the bible that it is not completely literally true. For example:

      Jesus spoke all these things to the crowd in parables; he did not say anything to them without using a parable. (Matthew 13:34)

      A parable is not literally true, it's a comparison, an allegory. If somebody claims to be taking the bible completely literally, the obvious question to ask them is why they are doing that. If they are also claiming to base their beliefs totally on the bible, they should be able to point out the part of the bible which says that it should all be taken literally. Which they won't be able to, because the bible is chock-full of parables, stories, and symbolic language.

      That's where this problem is coming from. Some people have decided that everybody must accept that the bible is completely literally true. And it's not. It's a spiritual book, not a science textbook.

    90. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 1, Funny

      If a memetic equivalent of an asteroid strikes (say, a sequence of DNA from a 200-year-old Galapagos Tortoise, that, when translated from base-4 to base-2 and divided into 8-bit bytes, produces ASCII for "This being copyright God, Inc., 4004 BC, and limited license is hereby given to this being to go forth and multiply", and said sequence is discovered before the invention of self-propagating genetically-engineered Galapagos-Tortoise-specific retroviruses), we evolutionists will be happy to reconsider our views.

      Dude - I am so going to synthesize that retrovirus now! Heck, I might as well insert my own name and take all the credit...

    91. Re:That was an intelligently designed decision by Weedlekin · · Score: 1

      "religion (at least Christian theology) does have explanations for things like birth defects, but if I bring up the concept of original sin, that will be even harder for you to swallow at this point."

      If birth defects are punishment for original sin (i.e. the fall of man), then why do so many other organisms also have them?

      --
      I'm not going to change your sheets again, Mr. Hastings.
    92. Re:That was an intelligently designed decision by cyphercell · · Score: 1

      Is it not possible that God be made of matter? We are after all "made in his image". Science does not rely on the belief that all that can't be measured does not exist. It is simply a field of study that concentrates on that which can be measured. Science cannot disprove the existence of God anymore than the bible can disprove the existence of the Higgs Boson particle. You seem intent on pushing science as being related to the philosophy of materialism when the official stance from the scientific world is that they cannot measure those things, which by definition cannot be measured.

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    93. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      >in that there were not yet 'genes' per say, but there was still selection

      Actually, it's written "per se" , not "per-say". Thank you.

    94. Re:That was an intelligently designed decision by khanyisa · · Score: 1

      I wouldn't divide it as cleanly as that. You can believe that the Scripture comprises of moral spiritual and historical Truth without believing that the creation accounts contradict evolution...

      Lets take the account of the origin of life in Genesis 1, for instance: "And God said, Let the earth sprout vegetation, plants yielding seed, and fruit trees bearing fruit in which is their seed, each according to its kind, on the earth. And it was so.The earth brought forth vegetation, plants yielding seed according to their own kinds, and trees bearing fruit in which is their seed, each according to its kind. And God saw that it was good."

      So basically if you read it literally, God commanded, the earth produced vegetation - this doesn't really seem to contradict evolution to me.

      The key principle is that there is a supernatural God directing natural events. There's obviously plenty more to debate here, but I think a lot of the problem stems from culturally derived views of the Bible rather than examining what it actually says in the way it was originally meant to be interpreted

    95. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      This grouping may have been formed inside of a 'bubble' of polymer that protected the grouping from the outside world - and the first 'virus' was born.

      Viruses can't replicate themselves - they need a host cell. Bootstrap problem...

    96. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      It's one of the mysteries that you simply have to accept from the same compassionate, loving God that created war, starvation, rape, murder, and George Bush.

    97. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Evolution is not put forth as an explanation for the origins of matter or life. It is put forth as an explanation for how life, once begun, spread, adapted, and led to more complex organisms.

      I hear people make this argument all the time, but it never comes from a biologist. Do you know why? Because biologists realize that "life" is hard to define.

      Richard Dawkins in The God Delusion:

      "Darwinian evolution proceeds merrily once life has originated. But how does life get started? The origin of life was a chemical event, or series of events, whereby the vital conditions for natural selection first came about."

    98. Re:That was an intelligently designed decision by Krabbs · · Score: 1

      -----We are after all "made in his image".----- I love how people think they can quote the bible as truth in a scientific discussion. Are you trying to annoy us, or do you seriously think scientists view the bible as a credible source of information? If god is made of matter he will most likely have a gravitational pull and should therefore be measurable. Actually, if God has any influence on the world, he should be measurable. And what is the point of such a god? You would not be able to feel his presence(that feeling would be measurable). He would not be able to answer prayers. There would be absolutely no difference in a world with a god and one without. So why claim there is?

    99. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Maybe to see how people will handle that. In heaven your body will have no defects. If you believe in evolution (I do not) then why hasn't men evolved from birth defects? Just because you do not understand everything in the world does not mean there is no God.

    100. Re:That was an intelligently designed decision by JasterBobaMereel · · Score: 3, Interesting

      This is the problem - If God can do everything then he can do anything!, no matter how illogical or apparently impossible - which means that we cannot discover anything because God can just change the rules anytime he likes ...

      God could have created the universe in 4004 BC and made it look like it was created several billion years ago ... or he could have done it last tuesday ... we could never tell unless he wanted us to

      I like to think that if God exists that he wants us to work out what is going on and so has left just enough clues to find out ...

      --
      Puteulanus fenestra mortis
    101. Re:That was an intelligently designed decision by Oktober+Sunset · · Score: 2, Funny

      If you don't vote for either the democrats or republicans you are throwing your vote away!

    102. Re:That was an intelligently designed decision by cyphercell · · Score: 1

      god i wish you were smarter

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    103. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Actually science still can't explain where DNA came from or for that matter science cannot explain matter.

      So what? Believe it or not, in science it is perfectly O.K to say "I do not know" or "We do not have enough evidence". Unlike religion, you do not use the crutch that "God done it".

    104. Re:That was an intelligently designed decision by rtb61 · · Score: 1
      Consider the flip side, if the religious fundamentalists had been in charge and a scientists came up with a view they didn't like, not only would the scientist get no opportunity to quitely resign, they would at minimum be imprisoned and most likely executed, so yes it most definitely is progress.

      Now of course if you had read the article you would find that "he will step down immediately as director of education - a part-time post he held on secondment" and still "He is to return, full time, to his position as professor of science education at the Institute of Education.". So no loss of pay just a loss of title.

      So he wasn't thinking very clearly when he made that statement considering the nature of the position. Now the reaction might have been a little extreme but, they were just trying to avoid years and years of religious nonsense disrupting science education in that country, so clearly and visibly nipping it in the bud and, the person who made the verbal blunder suffered no real harm part from the loss of title and a bit of bruising to their reputation.

      --
      Chaos - everything, everywhere, everywhen
    105. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Some geological science can be shown to be in error. Some astronomical science can be shown to be in error. The speed of light can be questioned. etc. etc.

      Yes. We call this questioning of accepted orthodoxies "science".

    106. Re:That was an intelligently designed decision by Thiez · · Score: 2, Informative

      > Eventually, a grouping came about (most likely RNA) that could replicate and store information. This grouping may have been formed inside of a 'bubble' of polymer that protected the grouping from the outside world - and the first 'virus' was born.

      You really shouldn't call that thing a 'virus'. A virus, by definition, cannot reproduce on its own.

    107. Re:That was an intelligently designed decision by Nursie · · Score: 1

      If those arguments are about the nature of being, why we're here, general religious and theological stuff, sure.

      If those arguments are being used to deceive children about the nature of reality, and win legislation on religious grounds, then no. That's where the line is. I don't care if you live in fairyland, just don't warp your kids' minds with it or force it on me.

    108. Re:That was an intelligently designed decision by Nursie · · Score: 1

      "In fact, when you take a close look at them, most are in it for the notoriety"

      Complete fucking bullshit.

      "Most scientists do not have the time or energy to rock the boat with regards to evolution--there's just too much already invested in it (and it fits too nicely with the secular worldview which is so convenient)."

      Right, so they're in it for the notoriety, divas as you say, but nobody's going to rock the boat and contradict evolution. You've managed to be inconsistent with yourself by sentence three. If there was a single scarp of evidence that contradicted, or even contraindicated evolution, you don't thinkg some "diva" would jump on it for the notoriety?

      You're an idiot.

      "And as for climate change-- it's simply a pivot point for the Democrats/liberals. It's a symbiotic relationship between unscrupulous politicians and scientists (who are in it for the funding)."

      yes, that's all it is, because of the heaps of evidence showing it to be nonsense. Oh, wait, no, everything's pointing towards it being not only a real phenomenon but caused by human activities. The only people with a problem with it are those with a financial interest in denial.

    109. Re:That was an intelligently designed decision by Nursie · · Score: 1

      "Just because the theory behind how we got here doesn't mean other theories are wrong."

      if biblical creation were to be correct (how laughable!), we would have to pretty much abandon everything from biology, astrophysics, geology, chemistry (molecular physics)... Not to mention that there's no use in predictive science if the god factor might kick in at any moment and change things however he/she /it feels.

      No, there is no science in a created world.

      "I think that if the evolutionists and other scientists who want to prove Creationists wrong once for and for all, the evolutionists, et al. should take every argument Creationsists have (e.g., arguments involving geological evidence and biological evidence interpreted in favor of evolution, et al.) and everything in the Bible and address each one. Be the "bigger man" and address each "fact" that Creationsists use for their evidence and refute each one."

      It's been done, many times over. See talkorigins.org

      the thing is, you refute the creationists point and then the very next day you see them spouting teh same bullcrap again. Facts and explanations having made no difference at all.

      Creationists are fundamentally dogmatic and wilfully ignorant.

    110. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      http://en.wikipedia.org/wiki/Computer_chess

      A computer chess program works by first trying all possible moves it can make, evaluating the position by a simple set of criteria (such as how many opponent pieces attacked/attacking, etc) and then working out the opponents possible responses and doing this recursively into the possible future.

      Such a chess program is relatively easy to program given the rules of chess. The resulting actual games of chess that the program eventually comes up with are very often significantly better games than the programmer himself is capable of playing.

      Chess programs running on powerful computers are currently ranked amongst the very best chess players on the planet.

      OK, so where exactly does the "information" represented by these best-of-class games actually come from? It clearly doesn't come from the programmer, because the computer program plays better chess than the programmer can.

      For curiosity, either alpha-beta pruning or negascout searches are the algorithm used:

      http://en.wikipedia.org/wiki/Alpha-beta_pruning
      http://en.wikipedia.org/wiki/Negascout

      One can see some parallels in how these algorithms work to create a great chess game and the way that evolution works ...

      You can argue that an "intelligent designer" designed the algorithms and even the computer program that implements the algorithms, but you cannot argue that the actual moves and the whole of the actual games played come from the "intelligent designers".

      OK, so where do the series of expert-class moves and games really come from, then?

    111. Re:That was an intelligently designed decision by Krabbs · · Score: 1

      Okay?... Erhmmm... Thank you for the information?

    112. Re:That was an intelligently designed decision by CrazedWalrus · · Score: 1

      My biggest problem with this primordial soup idea is not that some some variation of a simple cell could form accidentally, it's that it would form accidentally and have all of the facilities necessary to reproduce itself. How did an essentially random mass of crap acquire the ability to replicate itself? Wouldn't that be a very early requirement, before the tumultuous environment split that thing apart again?

      It's funny, I read these long "well it could have", and "then maybe with enough time" and "if the conditions were just right...", and to be honest, I see grasping at straws. While some of it explains how the first one might form accidentally, it doesn't explain how the random chemicals begin acting in concert to reproduce and carry out the metabolic functions of even the simplest cell.

      Why does a cell metabolize anything? Why doesn't it just sit there and wait for its current supply of chemical reactions to finish, and then just go inert and dry up? You can say this behavior is happenstance, but it's a pretty fortunate one. Unlike evolution, it doesn't have the deus ex machina of millions of years to rely upon. This sort of thing has to happen exactly right or it doesn't work.

      So once you've got a cell with the ability to metabolize outside chemicals and expel the resulting metabolic products, this thing has to be able to make more of itself or wind up a curiosity in the dark, blank history of the universe.

      How do even these two complex events happen to coincide and form the simplest cells?

      Until I see it done by random processes in an experiment designed to mimic early earth, I think random biogenesis takes as much faith as saying "God did it." It may appeal to scientifically-minded people more, but you must realize that it sounds no more likely to people you're trying to convince. It's still just a lot of hmm and uhhhh and wild-ass guessing.

      I'm not saying that evolution doesn't exist, but how did it get started? I've asked this question before, and have never received a convincing reply that wasn't based on the assumption of unlikely events.

      "Oh, well RNA formed..." Great! Then what? What is it about RNA versus water or dirt that makes the surrounding environment automatically want to transcode and replicate it? What sets it apart from the rest of the junk heap?

      Oh! Then lipids formed around it... Thereby cutting it off from anything in its environment that would randomly transcode it?

      Where did all of the other organelles of the simplest cell come from? How did it happen that these organelles can be replicated and pushed into a copy of the cell using nothing but an unguided process and random material from outside the cell?

      The point is that you don't get to be all hand-wavy if you want the truth, and that's what I see. Lots of hand waving, which is exactly what you complain about with Creationists.

      I'm obviously not a biologist, but I do work in IT. Necessarily, that means I'm especially sensitive to hand-waving, and that I've honed my ability to see when people are talking out of their asses. You don't want me to think God did it? Great, show me something:

      • Plausible
      • Doesn't rely on "millions of years" in places where "millions of years" would have meant the destruction of the key happenstance.
      • Doesn't sound like you're making it up on the spot when I ask a question you didn't think of before.
      • Is completely devoid of the requirement of intelligence. Your experiment isn't allowed to stack the deck.
      • Doesn't gloss over complex functions as if they would obviously and naturally occur

      ...and then tell me how spontaneous biogenesis proves that God doesn't exist, because as far as I can tell, it's a non sequitur.

      So, until I see better, here's my model of the universe:

      1. God creates "physics"
      2. God creates universe to follow the laws of physics.
      3. God works within those rules to guide everything else that happens.

      In that scenario, science would study the "how", but could never study the guiding forces behind it. I have no doubt that biogenesis happened, and that at some point conditions were right for it. What I'm saying is that I don't think it was an accident.

    113. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      http://en.wikipedia.org/wiki/Human-computer_chess_matches

      "After convincing victories in two matches in 2005 and 2006, it appears that chess programs can now defeat even the strongest chess players."

      OK ... so where is the information that these chess games represent coming from?

      Clearly the games are not coming from actual people ... the chess programs can beat people players.

      They can even beat world champion chess players ... clearly the chess programs are far, far better players than the programmers who made the chess programs.

      So creationists ... here is the challenge.

      Where is the "intelligent designer" who is creating these best-class world-beating chess games?

      Where is the information (as in the series of chess moves) coming from?

    114. Re:That was an intelligently designed decision by db32 · · Score: 1

      Please stop...you don't understand what you just said...but you said it...and it is horrible. "produces ASCII for "This being copyright God..."

      This is only going to add fuel to those asshat evangelical fires. The English language happend LONG after that whole God being involved with human daily life business, he did not speak English. Jesus was not white. Matthew, Mark, Luke, John, Mary, etc are NOT their real names, they were anglicized. Hell Jesus isn't even the guys real name, and the anglicized form is correctly pronounsed "Heysoos". Christ was not his last name, it is a title and his real name was Yeshua!

      Two of my favorite things to do with the hardcore Bible thumpers is to walk by as they try to pass out their Bibles or get in peoples faces and say "Jesus was such a jew" and watch them get pissed for some bizarre reason. My other fun one is when asked "Have you accepted the Lord Jesus Christ as your personal savior!?"... "Well, no, I don't know who this Jesus guy is, but I try to follow Yeshuas teachings" and then watch them work themselves up in a fit of evangelical rage about heathens. (By the way, you don't have to buy the whole "Son of God" story to think his teachings were good stuff, if you read the parts where he is talking he basically just repeats "quit being pricks to eachother and that will make God happy", he was very against rules lawyering of religion and that is ultimately what got him killed, and the thing that strikes me funny is that I don't remember him ever refering to himself as the Son of God except in the context that we are all children of God, it was others that seemed to start that one.)

      --
      The only change I can believe in is what I find in my couch cushions.
    115. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      I've always found the inssue of the rainbow troublesome from a signific point of view. Therefore, after not much deliberation or study, I can see how the passage could be interpretted not as an origins of the rainbow, but merely using the existing rainbow as a symbol of His coventant.

      I would suggest that rainbows were always there, but this particular one was used as a seal of the coventant, and all following rainbows now have significance because of this verse, in much the same way as a wedding band exists before the wedding, but takes no special meaning until it is used "as a sign of my love..." in the wedding ceremony.

    116. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Clay soils can self-replicate:

      http://en.wikipedia.org/wiki/Graham_Cairns-Smith

      It isn't all that complicated. It is most decidedly completely devoid of the requirement of intelligence.

      There doesn't have to be a purpose to it. Perhaps that is the source of your confusion.

    117. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Read "Darwin's Black Box", "What is Creation Science", "A Brief History of Time".

    118. Re:That was an intelligently designed decision by camperdave · · Score: 1

      I'm going to regret wading into to this I suspect.

      Probably, just like I'm likely to regret keeping it going. :-)

      The first rain was at the start of the flood. God "miracled" the rain into existence by opening the floodgates of the heavens.

      --
      When our name is on the back of your car, we're behind you all the way!
    119. Re:That was an intelligently designed decision by indifferent+children · · Score: 1
      The so called "micro" and "macro" evolution are one and the same, just over different time scales.

      No. A billion small changes do not add up to a large change. /sarcasm

      Macro-evolution (to the point of speciation): a large number of mutations can change DNA to the point that a creature with these mutations cannot produce offspring with a related creature that does not have those mutations. How can anyone refute that this is possible, unless they deny the very existence of heritable mutations? How can they deny that this is must have happened if the Earth is 'old'? Not addressing abiogenesis, just that if there has been life (from whatever source) for a billion or more years, then it would take supernatural intervention to keep macro-evolution from happening.

      --
      Censorship is telling a man he can't have a steak just because a baby can't chew it. --Mark Twain
    120. Re:That was an intelligently designed decision by Nutria · · Score: 1

      Without mutations you are never going to get a completely new gene (H) that is surely a precondition for the eventual formation of a completely new species.

      That might not be true.

      Birds are genetically very close to dinosaurs. Experiments with chicken embryos have shown that many of the differences are simply that certain genes have just been "turned off" in birds.

      --
      "I don't know, therefore Aliens" Wafflebox1
    121. Re:That was an intelligently designed decision by Yewbert · · Score: 1

      Bingo - see also, the entire basis for "the bible code." Now, if you determine what the codec is in advance, and predict where the copyright notice would be found based on some other liturgical reason, and then find it exactly where you predicted, THEN I'd be a bit more impressed.

    122. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      You don't get transitions between "kinds". Cats don't give birth to dogs.

      However, at some point a long, long, long time ago there was an animal, neither a cat nor a dog, but definitely a mammalian quadruped, which had a divergence in its population, such that down through the myriad succeeding generations one group became cats and the other group became dogs & wolves etc.

      It is like a big "tree" in time. There is no cross-over between the branches ... but at some point as you go down each branch further and further back towards the roots eventually all the branches join to form the trunk.

    123. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      There is still a sizable population of slashdotters who think the scientific process doesn't work when it comes to climate.

      Care to elaborate on that? Most arguments that counter the Global Climate Scare I have seen are sound scientific arguments, and most center around the point that we do not have enough data to extrapolate the current trend for more than a few years. You seem to be suggesting that GCS is unambiguous and well-founded, and that people who refuse to accept that are not scientists?

      I know this is getting off-topic, but attacking a theory for lack of supporting data is a scientific method. You could of course argue that in this case, not erring on the extreme side of caution could end the world as we know it, but that is as much a non-scientific argument as anything. But discarding such arguments by declaring them non-scientific reeks of zealotry.

    124. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      actually, as far as known with no exceptions, information is absolutely conserved

      No exceptions? Hmm... that gives an interesting twist to Schrödingers comment: A post can only contain information if it is never read by anyone. So much for the Slashdot moderation system, then.

    125. Re:That was an intelligently designed decision by rubycodez · · Score: 1

      talking about after the big bang, not at or before

    126. Re:That was an intelligently designed decision by indifferent+children · · Score: 1

      It was Last Thursday, you misbegotten Last Tuesdayite heretic!

      --
      Censorship is telling a man he can't have a steak just because a baby can't chew it. --Mark Twain
    127. Re:That was an intelligently designed decision by eonlabs · · Score: 1

      Be careful what you wish for.
      Between endianness, encryption, and the ambiguity of translation from binary to base four where any of the digits could match up, there is a chance you could find that exact phrase in the DNA of an arbitrary animal. If you've ever heard of the bible code or nostradamus, you should realize that provided a large enough body of work and enough leniency in your analytical methods, it is possible to find anything you're looking for.

      --
      I wouldn't consider the mad hatter mad. Just reality impaired. He sure can make a mean cup of tea.
    128. Re:That was an intelligently designed decision by VeNoM0619 · · Score: 2, Insightful

      I like to think that if God exists that he wants us to work out what is going on and so has left just enough clues to find out ...

      So... Hes just toying with us...

      But you are assuming "if God exists" 'now'. What if he no longer exists? What if God (our creator) was not as powerful as you think? Technically we can consider ourselves god when we create things.

      Sadly enough I have to quote Dogma: beliefs are taken too far. People die for beliefs, a theory is just that, a thought.

      Time and time again, people are afraid to admit any changes in their view of their own god, and tend to reject any evidence that he is different than the way they think he is, but my (theory) is that this is because you were taught religion when you were a naive child. People tend to stick to their childhood beliefs a lot more than you think (fears, things you like, right and wrong, etc.). If you don't teach a child religion until they are adults, there's a far less chance they "convert" once they develop reasoning skills.

      --
      Disclaimer: I am not god.
      We may not be created equal
      But we can be treated equal.
    129. Re:That was an intelligently designed decision by hjrnunes · · Score: 1

      I agree. That's what I understood from TFA of yesterday or whenever... This is terrible for the credibility of scientific institutions. Now, the creationists, for example, will argue that scientists are so hard-headed and anti-religious that they force people to resign while they share the same scientific thoughts only because they are people of the cloth. Unfortunately this is true. Hearing the word creationism with classroom made them go hysterical and act incoherently. Like the great Douglas Adams said: Don't Panic!

    130. Re:That was an intelligently designed decision by spun · · Score: 1

      If you accept that anything, even God, can exist without an original cause, then you must admit the possibility that the universe itself does not need an original cause. If you think that nothing can exist without an original cause, then God can't, either. If you put God in a special category of 'original and un-caused (or self-caused) cause,' then your theory answers no questions at all. You can not say why God is in that special category, and the Universe is not. You are essentially engaged in mental masturbation.

      --
      - None can love freedom heartily, but good men; the rest love not freedom, but license. -- John Milton
    131. Re:That was an intelligently designed decision by spun · · Score: 1

      Some churches are actually about intellectual freedom, though that statement too may contradict an orthodoxy.

      And some prostitutes have a heart of gold. Some thieves only steal from the rich. Some politicians are honest. What's your point?

      --
      - None can love freedom heartily, but good men; the rest love not freedom, but license. -- John Milton
    132. Re:That was an intelligently designed decision by TapeCutter · · Score: 1

      IANAB but this 10min video on abiogenisis is brilliant.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    133. Re:That was an intelligently designed decision by OldSoldier · · Score: 1

      I'm saddened by this news. The fellow's comments seem to have been taken entirely out of context and as a result he's out of a job (albeit only a part time position, the Society is more than happy to have him at his "day" job).

      He seems to merely have been advocating debating ID if it came up in a biology class. Apparently there's a widespread movement to ignore ID in biology and not take that opportunity to teach kids how ID is not science. Apparently also it's OK to discuss ID in religion class. Well... I don't know about you, but I doubt there will be much discussion of how ID fails as a scientific theory in that class.

      I see this as an example of the spread of intolerance. I would have been much happier to see the Royal Society supporting this guy. Essentially thumbing their noses at the public outcry and simultaneously telling those who complain to "take a breath and think about what he's advocating" instead of just giving in to a knee jerk reaction.

    134. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Just because your religious friends are thickheaded does not mean you can take that and apply it to a whole class of people and say that for every one of these you get this attribute. People are their own. They make their own determinations. Christianity does not ask that its followers do not ask questions.

      When I was young I swallowed evolution as fact. Then I went the other way and rejected it completely. Now I have come back to the middle. I know that the natural selection model works and we can see it in bacteria all the time. I also know that in our lifetime we have never seen one species become another and so I'm more skeptical of that claim. I'm willing to listen to people convince me otherwise. I also have a problem with the idea that life STARTED at a primordial ooze as opposed to having some order already from some kind of interjection either scientific or from God. It's these things I am skeptical about but I am not so thickheaded as to never change my mind about them. Just because your friends are doesn't mean you can apply that universally.

    135. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      That is sufficiently nebulous to mean quite anything at all.

    136. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      mmhmm, that answers all my questions. You should write a science book for 9th grade Biology. Except you didn't offer any information at all and you didn't add any value at all either. I knew all you just spewed already but my point is "How did DNA come to exist in a cell in which the mechanisms to replicate it and protect it already existed?". If you has to answer that question then how would you go about it? "Well amino acids blah blah blah". No. It doesn't work. I'm not asking you what DNA is made of. I'm asking you how it became ordered and in a system the way it is IN EVERY LIVING CREATURE ALIVE TODAY.

    137. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Also I want to know where DNA got put together in such a fashion that its information was both useful for the cell and able to be replicated and protected at the same time.

    138. Re:That was an intelligently designed decision by Nadaka · · Score: 1

      Well...

      Just prior to the Oxygen Catastrophe, soluble iron was leached en mass from the worlds oceans to form massive iron oxide deposits of a red color. That was hundreds of millions of years ago when early plant life started producing oxygen. These deposits might have made a shallow sea appear red if they were exposed close to the surface of the water.

    139. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Wrong. You can't lump in creationism with Christianity or a specific group of believers within Christianity. First off Christians are broken down into "New Earth" and "Old Earth" Christians. The theological rifts are many and in fact probably number more then the sands of the world's beaches just to give it a number. The point is you are creating a STRAWMAN ARGUMENT, pinning up the defenseless strawman and then after dousing him with gasoline you light him on fire and declare victory when in fact your adversary is hiding in the corn fields beside you waiting to strike.

      Furthermore Creationism has more against abiogenisis then Evolution. That was my point in my original post. Natural Selection works. It is the assumption that it was the determining factor all the way back to the origin of life that is what Creationists have a problem with.

    140. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      First of you are using the English translation to point out a semantics problem which is ridiculous. Go back to the original language. Then stop taking it out of context. Those two things should solve your problem.

    141. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Once again don't argue the word in English. Go back to the original language of the scripture and then look at it in the context of the language at that time.

    142. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Creationists believe in a 6,000 year old Earth. I think that this makes claims on not only the origin of life, but how it developed on this planet (i.e. it didn't, according to creationism)

    143. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Thanks for composing a lot of sentences that said nothing at all. I can do that too. See I just created three of them.

      I never said Evolution claimed anything about the origin of life. My point was that the origin of life is what Creationists are arguing about and Evolutionists on whole reject creationism but not because they believe in Evolution nor because they have a good explanation for the origin of life but because they can't use SCIENCE to TEST CREATIONISM. However to say no facts point to Creationism is in fact a lie. I know I will be flamed by this but prophecy actually provides plenty of backing for Christianity and in addition statistically it makes more sense for things the way they are to have had some help at the origin of life as opposed to just randomly combining like most 9th Grade Biology teachers hold happened.

    144. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Oh spun, you silly sud. Nobody said God manifests physically. That is how the difference is made. It is the existence of matter and then the formation of DNA in a cell with replication capabilities and usefulness for the cell that I am wondering about. It is these things that Creationism answers.

    145. Re:That was an intelligently designed decision by Reservoir+Penguin · · Score: 1

      In this case to fill the gap in your education you could start with "The Origina of Spieces...." in particular it's last sentence: "There is grandeur in this view of life, with its several powers, having been originally breathed by the Creator into a few forms or into one; and that, whilst this planet has gone circling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being evolved."

      --
      US-UK-Israel: The real Axis of Evil
    146. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Please stop. It's you who doesn't understand.

      A god like Poseidon would find it a challenge to write English into a turtle's DNA in the past. An omniscient being would have absolutely no trouble writing a message into the DNA of a creature in exactly the language that would be spoken by the people who would one day discover it.

      He/She would in fact already know that Adam and Eve would fail the test of the Garden of Eden before they were even created, rendering the whole logic of the Genesis story.... but I digress. :)

    147. Re:That was an intelligently designed decision by cyphercell · · Score: 1

      It was a philosophical discussion and I am on your side. - you friggin' moron

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    148. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Actually since this was a discussion about Creationism in Science class and Evolution was not mentioned I'm sure the opposite is still true.

    149. Re:That was an intelligently designed decision by spun · · Score: 1

      Creationism does not 'answer' these questions, it merely draws a line in the sand and says, 'stop here. Do not question what is beyond the line.'

      The question of matter has been answered. Matter came from energy. That is as good an answer as saying it came from God. As for DNA and replication, the answer is also as simple. the entire world was the first primordial cell, chock full of all the basic building blocks, autocatalytic sets, and simple replicators. Given enough time, life was inevitable given this rich organic soup.

      --
      - None can love freedom heartily, but good men; the rest love not freedom, but license. -- John Milton
    150. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Carl Sagan got the two intertwined in many of his videos. I think this guy was suffeciently up on evolutionary theory and yet he hopped from the big bang to evolution with no transition and presented everything as fact not "Scientists believe".

    151. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Actually that one is easy. God didn't create birth defects. Adam and Eve fell from the Garden of Eden and so they live in an imperfect world where there is good and evil and where other beings or people have choices which can lead to good or bad consequences.

    152. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Right because that's how the mod system works right? If someone posts something factual but that goes against your belief system then you mod them down right?

    153. Re:That was an intelligently designed decision by AshtangiMan · · Score: 1

      I don't believe that I said that it applied universally. But don't try to change the subject. I was responding to this:

      I reject it as an explanation for the source of all matter, dna, and life.

      Which suggests a stark misunderstanding of what evolutionary theory is. You again demonstrate the same:

      I also know that in our lifetime we have never seen one species become another and so I'm more skeptical of that claim.

      It's like you see the world as an either/ or proposition. If you'd like to discuss this then fine, but if you are going to continue with the trolling (Just because your friends are doesn't mean you can apply that universally.) then don't bother.

    154. Re:That was an intelligently designed decision by Drogo007 · · Score: 1

      Hah, you think six years for a BA is good - I've worked 15 longs years and I'm barely finishing my Associates in CS - take that!!!

      Now where's my invite to be a Vice Presidential Candidate?

    155. Re:That was an intelligently designed decision by AshtangiMan · · Score: 1

      So, if I stop learning things, then my house will be less messy?

    156. Re:That was an intelligently designed decision by Kandenshi · · Score: 1

      The question is, what mechanism do you believe in that could stop micro from becoming macro, given that the exact same mechanism is responsible for both? The analogy I've usually seen used to represent this is this: "How do you stop all these inches from adding up to a foot/mile?"

      Change of/variation in genes is what allows for microevolution, and it is that exact same thing that permits macroevolution. Do you believe that God steps in and prevents further mutation?

      "Hey hey hey, I don't mind you two groups of cats that were geographically separated developing some differences in your coloration, jaw shape and diet... but changing THAT? It'd be enough to make you into new species, so stop it!"

    157. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      You sir are the troll and you miss the point of my main post which is that Evolution has nothing to do with this news story because Creationism deals with the origin of life and matter.

    158. Re:That was an intelligently designed decision by Ixot · · Score: 1

      Evolution is not put forth as an explanation for the origins of matter or life.

      As a matter of fact, once one has properly grasped the theory of evolution, it is not very difficult to imagine how life might have sprung into existence. Evolution is all about the most complex things evolving from the simplest organisms. Now it stands to reason that these organisms must have evolved from even simpler things, so trivial that we would not even call them "alive". Even these chemicals, before there was anything alive around, followed the same natural laws than us mammals, and still do.

      The point being, we observe evolution on every level everywhere in the universe, not merely in biology.

    159. Re:That was an intelligently designed decision by mog007 · · Score: 1

      the cause of the background x-ray radiation

      I think you went in the wrong direction of the visible spectrum, background MICROWAVE radiation is one of the best pieces of evidence in favor of the Big Bang Theory.

    160. Re:That was an intelligently designed decision by jswigart · · Score: 1

      I said plenty in my post, you just have your god goggles on. Creationists argue against evolution for a huge number of reasons. The origin of life is just one of them. Like I said, no FACTS support creationism, plenty of testable evidence support both evolution and big bang. That doesn't make them fact, that makes them the best explanation for what we know and can observe. Please entertain us with this prophecy that supposedly provides support. Phophecy is not fact.

      There isn't a single thing in the bible which has any significant evidence of actually having happened. In fact, the most significant of the fairy tales, such as we all coming from 2 people, the flood/ark, etc have compelling evidence in science that they in fact didn't happen, or rather, if they did they left no evidence that such 'real' events would have left. Short of pulling a bag over your head and calling all science wrong, your superstition carries no more weight than following any other fantasy literature. Also, statistically makes more sense? Are you serious? That's the dumbest thing I've ever read. You are saying that explanations that can be observed, tested, and confirmed are inferior statistically to your bibles collection of nonsense that without exception requires the complete abandonment of logic, evidence, and reason? Wow, that defies belief there. You truly are a true believer.

      Please, educate yourself on evolution. You keep echoing the same creationist drivel that shows complete ignorance of the subject. That referring to "just randomly combining like most 9th Grade Biology teachers hold happened". Here is some help on that particular subject.
      http://www.talkorigins.org/indexcc/CB/CB940.html
      No doubt that site addresses a number of your other bullshit creationist arguments as well.

    161. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      You _really_ need some education on what evolution is.

    162. Re:That was an intelligently designed decision by Krabbs · · Score: 1

      So you are just really bad at sarcasm? Anyway, just let it be, dude. Watch your language btw.

    163. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      Strange, as a point of principle this story seems to be exactly the opposite of what you say i.e. the CofE has reconsidered a response it made many years ago vs the Royal Society now getting rid of someone for daring even to discuss the discussion of a different point of view from their orthodoxy.....

    164. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Prophecy that comes true is fact.

    165. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      No I don't. I was pointing out that this whole discussion shouldn't even involve evolution as evolution and Creationism CAN coexist. It is the origin of life that Creationism is at odds with what is now taught in Science class.

    166. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      A common strategy I find from my discussions with creationists is that they try to point out as of yet unexplained parts and then say, "SEE,SEE, YOU CAN'T EXPLAIN IT, THEREFORE IT'S NOT TRUE." which obviously is a bogus argument. It just hasn't been explained yet. Just because we don't understand how cancer starts in some cases works doesn't mean cancer doesn't exist. My question that I often ask creationists is this: if you believe that God did indeed create the world 5000 or so years ago, then do you believe that God is lying to us when we look at all the rocks/stars/fossils that say otherwise? Anyways, regarding your point about how DNA became about, from what I remember it is thought that it was a mutation from RNA. And because RNA and DNA are quite closely related, it is thought that the machinery operating on RNA could have done so as well on DNA in a limited capacity, until more and more accumulated mutations would have resulted in the enzymes and molecules that are highly tailored for DNA that are present in cells these days.

    167. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      WOOT NICE REBUTTAL THERE DUDE!!!

      You, like, totally destroyed his entire argument with your flawless logic! PHEEEEEEEEEEEERR!!!!

    168. Re:That was an intelligently designed decision by johanatan · · Score: 1

      This isn't just about God. Last I checked, psychology was still a field of 'science' (and there's considerable evidence that a mind is greater the the sum of its atoms--i.e., that something akin to a 'soul' exists). Even the great 'bright' Daniel Dennett seems to concede that (and I say seems because I was left somewhat confused as to whether he had proved or disproved the existence of the soul after I read one of his books).

      The best definition of science that have is simply "the search for truth or knowledge". Once you start trying to draw lines beyond that on what is and what is not science, you quickly reach either contradiction or inappropriate exclusion of fields which would otherwise be intuitively and uncontroversially deemed 'science'.

      The problem we face is that the word has been hijacked by naturalists (materialists) which is a philosophy, not a science. This is rather ironic because if you were to go with a strict materialistic definition of science, then fields such as psychology would be *excluded*.

    169. Re:That was an intelligently designed decision by johanatan · · Score: 1

      Right, so they're in it for the notoriety, divas as you say, but nobody's going to rock the boat and contradict evolution. You've managed to be inconsistent with yourself by sentence three. If there was a single scarp of evidence that contradicted, or even contraindicated evolution, you don't thinkg some "diva" would jump on it for the notoriety?

      It's very hard to prove negatives (and historical events)--you know that. And, evolution is a very clever idea. No one has the amount of time required to test and prove it though (i.e., billions of years). Working professors have deadlines and they are not going to take such a long shot. [Not to mention that these professors work for those already sold out to the idea and who would not support research to the contrary (and the idea of materialism happens to sit quite well with their own personal biases--why would they work to disprove something they want to believe in?).]

      I think our best shot at disproving evolution will come from mathematicians and information scientists (and there is work being done in this area). It is inevitable really. Until then, we simply don't have the time or resources to exhaust all the possibilities required to prove evolution.

      Counterexamples do wonders for disproving positive statements but it will take rather an elegant mathematical proof (which as I said, we are working on) to convince scientists. We will soon have very tangible ways of measuring and/or computing 'specified complexity' and cranking the appropriate numbers to show that even billions of years is not enough time. [And, of course, Creationists have been offering counterexamples for a while a la Darwin's statement 'if it can be shown that one of these creatures could not have possibly evolved over time via a series of slight modifications, then my entire theory would fall apart'.] The key here is that natural selection cannot 'select' a mutation unless there is a working machine to start from.

      yes, that's all it is, because of the heaps of evidence showing it to be nonsense. Oh, wait, no, everything's pointing towards it being not only a real phenomenon but caused by human activities. The only people with a problem with it are those with a financial interest in denial.

      There's actually quite a bit of evidence to the contrary. 1 - The earth goes through cycles on its own. 2 - The sun is heating up. How do you think all of our carbon emissions caused the sun to starting heating up?

    170. Re:That was an intelligently designed decision by Anonymous Coward · · Score: 0

      And surely it was Last Thursday at least 100 years ago.

    171. Re:That was an intelligently designed decision by Macgrrl · · Score: 1

      So, if there was no rain - how did crops grow? Or any plants for that matter where there was no irrigation?

      --
      Sara
      Designer, Gamer, Macgrrl in an XP World
    172. Re:That was an intelligently designed decision by smittyoneeach · · Score: 1

      Just enjoying the hypocrisy of the close-minded.

      --
      Get thee glass eyes, and, like a scurvy politician, seem to see things thou dost not.--King Lear
    173. Re:That was an intelligently designed decision by spun · · Score: 1

      You'll find more hypocrisy and close-mindedness in organized religion than anyplace else. It tends to be the rule, not the exception.

      --
      - None can love freedom heartily, but good men; the rest love not freedom, but license. -- John Milton
    174. Re:That was an intelligently designed decision by camperdave · · Score: 1

      Gen 2:6

      --
      When our name is on the back of your car, we're behind you all the way!
    175. Re:That was an intelligently designed decision by bckrispi · · Score: 1

      To post something "factual" means you actually have to post "facts".

      --
      Xenon, where's my money? -Borno
    176. Re:That was an intelligently designed decision by Cassius+Corodes · · Score: 1

      You rightly criticise the science of abiogenesis as not having solid proof, but what proof do you have for your rival theory?

      Do you hold it to the same standard of proof?

      Why is god the default hypothesis?

      As for the RNA question: RNA is like DNA in that it is physically (and chemically) shaped to form chemical bonds to the matching RNA molecule. It is not the only thing that does this, there are a number of other molecules that have this property. RNA has an additional property that it can also act as a protein, which makes it an attractive player in any abiogenesis story, as you have both the storage and function elements already together. This is certainly not the only theory, and for all we know it could emerge that there are multiple possible pathways to life. Wikipedia as always has the best information: http://en.wikipedia.org/wiki/Origin_of_life

      The science of self-organisation also shows great promise in understanding how complexity emerges out of simple starting conditions: http://en.wikipedia.org/wiki/Self-organisation

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    177. Re:That was an intelligently designed decision by retchdog · · Score: 1

      People tell me to "go to the original language", as if I care to. Why don't you (or they) do the work for once and tell me what is wrong with the English translation? If it's such a glaring problem, it must be easy to explain at least the gist of what I'm missing. (Although note: that most of these deluded literalists are, oddly enough, literalists following the King James version, so it is not totally inappropriate for me to be following a translation.)

      The same applies for taking it out of context. In my context I have no problem with Genesis; it's a good story and the only book, along with Exodus, of the pentateuch worth a damn. Note well: the literalists are the ones taking it out of context, and forcing their bad context onto others.

      --
      "They were pure niggers." – Noam Chomsky
    178. Re:That was an intelligently designed decision by tukkayoot · · Score: 1

      Carl Sagan got the two intertwined in many of his videos. I think this guy was suffeciently up on evolutionary theory and yet he hopped from the big bang to evolution with no transition and presented everything as fact not "Scientists believe".

      This seems unlikely to me, but then I haven't seen every Sagan video. I know he's done a narrative of our origins that describes the events of the Big Bang and the evolution of life (sometimes without even explicitly naming either theory), but in the videos I've seen, you'd have to misinterpret it pretty badly to come away thinking the Big Bang and the theory of evolution are the same thing. From the videos I've seen, it is clear that he understands the distinction between the two.

      As for not prefacing explanations of evolution or the Big Bang with "scientists believe," I don't see anything wrong with that. That sort of qualifier is largely unnecessary unless you're talking about some sort of fringe hypothesis or an area where there are significant differences of opinion about which model to favor. Sprinkling "scientists believe" about just dilutes and drags down the dialog. For all intents and purposes, the chief features of a legitimate theory can and should be presented as fact. In concept, those theories are all provisional in nature, and are subject to falsification, but in reality we're confident enough in them that we can't imagine ever overturning them completely.

    179. Re:That was an intelligently designed decision by retchdog · · Score: 1

      All right, I looked at a few commentaries and concordances. The phrase "I do set" is Strongs' [05414] and from what I can see, in the other uses in Genesis, it is read as "I give you" or "I put" something physical; e.g. Eve was given to Adam; God gave the herb bearing seed; &c.

      Or, He really put the bow there; and then in another clause it gets the meaning of a memento.

      The commentaries all claim that the rainbow was there before, but I think it's because they foresaw this difficulty...

      Amusingly, this is a similar problem of interpretation, as there is with the second amendment of the US constitution. :)

      --
      "They were pure niggers." – Noam Chomsky
    180. Re:That was an intelligently designed decision by Yunzil · · Score: 1

      Carl Sagan got the two intertwined in many of his videos.

      Name one.

    181. Re:That was an intelligently designed decision by The+Famous+Brett+Wat · · Score: 1

      If you accept change over time adaptations, then you accept evolution.

      So, having accepted that variation occurs, I must accept that variation alone explains all the diversity of life on Earth? Some variation has been observed, ergo all life must have been produced through common descent and variation? This isn't a complete argument, and it's people who might want to say "I acknowledge variation within limits, but spare me the unsubstantiated nonsense about fish and mammals being related" who want to make distinctions like "microevolution" and "macroevolution".

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    182. Re:That was an intelligently designed decision by johanatan · · Score: 1

      And, you're wrong about what evolution is put forth as. If it weren't put forth as an explanation of the 'origin' of life, then it wouldn't have lead to so much anti-religious fervor (and it wouldn't be championed and cherished by secular humanists and atheists the way it is). If evolutionists would just admit that the theory cannot actually address philosophical/theological questions, then we'd all be much better off. But, as it is, they put their full weight on this theory as a refutation of religious belief (and the unthinking masses let them get away with it). With so much weight on one idea, they sure should hope that it is right. Otherwise, it will be the greatest embarrassment of all time.

      Even a small child can ask enough questions to reach the end of science's explanation of such matters, yet the population is entirely content with its supposed implications for 'God' and religion. How much more damage can an expert do to this theory? (Hint: Watch some debates. They are few and hard to find, but when the scientific establishment does consent, they are typically slaughtered).

      Evolution is rarely mentioned without the undertones of an attack on religion--to think otherwise is simply willful ignorance.

    183. Re:That was an intelligently designed decision by The+Famous+Brett+Wat · · Score: 1

      the theory of evolution makes no claims on the origin of life.

      Sure, if you arbitrarily slice and dice along those lines. Darwin's comment on the origin of life was that it could conceivably occur in a "warm little pond" with the right prevailing conditions. It's hardly a stretch to include this aspect of the overall problem under the heading "evolution", especially if it's part of a naturalistic programme which attempts to avoid intelligent intervention at all steps of the process. Would you call someone an evolutionist if they claimed that God created the first living cell (and only that cell)?

      the big bang is more of an attempt at that, sure

      WTF? Modded +5 insightful for this junk? The big bang has nothing to do with the origins of life at all. It's primarily an attempt to explain the large-scale shape of the universe, particularly the red-shift and background radiation observations.

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    184. Re:That was an intelligently designed decision by trashyspaceman · · Score: 1

      Life evolved out of simple molecules, ...

      That's the fundamental scientific problem with evolution. Take the simplest lifeform that is able to reproduce by itself, given nutrients and water. It is impossible for this organism to have formed spotaneously. Is life a single molecule? No. Is it a collection of ten molecules? No. Is it a virus? A virus might consist of a protein coat that can enter larger, more complex cells and, once inside, can insert some RNA that can influence the transcription process of a far more complex molecular system. Therefore, the host organism must be more complex than the virus. No matter how "life" is defined, at some point the definition requires a level of complexity that cannot form spontaneously. Even the most basic lifeform isn't just molecular soup, but has self-assembling structures at many orders of scale that are mutually functionally dependant. Don't confuse self-assembling with spontaneous ab initio assembling. Its like confusing the girl of your dreams with a random choice of a lifeform from planet Earth. Don't make the mistake of picking a bacterium for a life-long partner!

      So where did the first life form come from? Wrong question. Evolution depends on an assertion that is clearly impossible and therefore unscientific. Is science about rational deduction or providing a naturalistic explanation for everything? I have no problem with either rational deduction or providing naturalistic explanations for natural processes, but it is an irrational assumption to presume that everything has an naturalistic explanation.

      For example, a couple who are close family friends prayed for another family friend who was born with one leg shorter than the other. Jesus Christ (who is a supernatural being) graciously healed the shorter leg within seconds. The husband was telling me he could feel the leg grow under the garment. We're talking 2-3 inches of new bone, muscle, skin, nervous system, etc. instantly. This is a true testimony and by no means an isolated incident. This shows that Jesus is real and loves to heal people. It also shows that not everything in this universe can be explained naturalistically.

      I'm not going to prove Christianity is true -- I'll let you work that out for yourself. Nor will I try to justify the behaviour of Christians who do not really know Jesus. But I do want to show you that both evolution and a purely naturalistic approach to examining the universe fall flat on their faces.

      Blessings, Matt

    185. Re:That was an intelligently designed decision by cyphercell · · Score: 1

      why claim there isn't?

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    186. Re:That was an intelligently designed decision by Krabbs · · Score: 1

      I don't, I just say it is absurd to discuss it. There's a huge pink elephant on my desk. However, it is invisible and does not interact with the world in any way. Whenever there is something science cannot explain, the default explanation is that the pink elephant did it. Science is fundamentally flawed because it is unable to discuss the existence of my pink elephant.

    187. Re:That was an intelligently designed decision by smittyoneeach · · Score: 2

      No, perhaps the same, but no more. Humans on both sides, after all.

      --
      Get thee glass eyes, and, like a scurvy politician, seem to see things thou dost not.--King Lear
    188. Re:That was an intelligently designed decision by Nursie · · Score: 1

      "It's very hard to prove negatives (and historical events)--you know that."

      But it's very easy to falsify a set of theories that make many many positive claims. Strangely nobody has managed this.

      "No one has the amount of time required to test and prove it though"

      FAIL. Speciation has been observed in the wild and recreated in the lab. A huge wealth of fossil and DNA evidence helps. Evolution is proven. The fine tuning of the mechanisms behind it are still being discovered. You probably get evolution mixed up with the big bang, abiogenesis and pretty much the whole of scientific knowledge and method though. A typical creationist thing, blur the terms of the debate and mix everything together.

      "Counterexamples do wonders for disproving positive statements but ..."

      There are no counterexamples. Not a single one.

      "it will take rather an elegant mathematical proof (which as I said, we are working on) to convince scientists. "

      the creationist take on information theory has been discussed elsewhere in this thread and does not hold up to examination. It's just more misdirection and bullshit.

      "[And, of course, Creationists have been offering counterexamples for a while a la Darwin's statement 'if it can be shown that one of these creatures could not have possibly evolved over time via a series of slight modifications, then my entire theory would fall apart'.]"

      Now you're making me laugh. This is pitiful.

      "The key here is that natural selection cannot 'select' a mutation unless there is a working machine to start from."

      You're a very clever idiot, talking yourself into ever more incredible corners you think you can abuse to your own ends, trying to bend science and mathematics to support your insane notions. Good luck to you, but it's a doomed exercise because you're still trying to fit reality to your preconceived fairytales.

      "There's actually quite a bit of evidence to the contrary."

      Like with creationism, there isn't any.

      "1 - The earth goes through cycles on its own."

      Whoa, whoa, I thought the world was only 6000 years old, when was there time for cycles?

      2 - The sun is heating up.

      No it isn't. It's very quiet at the moment, spotwise, and the output has ben static for as long as we've been able to measure.

      " How do you think all of our carbon emissions caused the sun to starting heating up?"

      YOU FAIL. AGAIN.

    189. Re:That was an intelligently designed decision by indifferent+children · · Score: 1

      No, that wouldn't be "Last" Thursday; that would be like 5200 Thursdays ago. An omnipotent god can implant an entire lifetime of memories in your brain, an attosecond after he creates you. You have absolutely no proof, and can never have any proof, that the world is more than 6 days (or 6 milliseconds) old. This is the nifty intersection of omnipotence and proof.

      --
      Censorship is telling a man he can't have a steak just because a baby can't chew it. --Mark Twain
    190. Re:That was an intelligently designed decision by JasterBobaMereel · · Score: 1

      The problem with an omnipotent deity is that by definition they can do anything so they can fool you as much as they want (if they want to) and simply not being around anymore is not an escape since they just arrange things to be as they want forever ....

      *If* a God exists (which I am not convinced of) then I hope it is omnipotent because if it is not then it's just an alien with pretensions ....

      --
      Puteulanus fenestra mortis
    191. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Actually you are confusing "New Earth" theology with creationism. There are Creationists who believe in an "Old Earth" theology too. Second of all what made the RNA? What purpose did RNA serve without DNA? Why is RNA never replicated by itself without DNA? You have no answers. Just distractions.

    192. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      Sorry but which part of my post was NOT factual. Every sentence contained facts.

    193. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      There is a comprehensive book on the subject. It is called Answering the Objections of Atheists, Agnostics, and Skeptics Buy it.

    194. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      When you can't imagine something you set your world up to come crashing down around you.

    195. Re:That was an intelligently designed decision by cyphercell · · Score: 1

      then why do you discuss it? Are you absurd? Computers are not intended to drive on the road, are they fundamentally flawed because they don't?

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    196. Re:That was an intelligently designed decision by AshtangiMan · · Score: 1

      The only people that I've heard claim that evolution tries to explain the origins of life are the anti-evolutionists. I am both religious and a scientist and I've never seen a conflict between evolutionary theory and my religious beliefs. Those who do are usually claiming that creation of life happened as described in Genesis and when they talk about the origin of life, this is what they mean. You are correct that evolutionary theory contradicts this version of creationism, and I did not intend to imply otherwise, but just because evolution contradicts that account for the origin of life does not mean that it tries to explain how life originated. Evolution explains how life, once begun, adapted, spread, and specialized. On the whole this science vs. religion thing is a crock, and those who believe that one has to supersede the other, or that belief in one equals disbelief in the other are being willfully ignorant. With the exception of some fundamentalist Christian religions, religion in general is quite accepting of scientific principles. Science itself is simply a tool, and one that has proven to be very useful.

    197. Re:That was an intelligently designed decision by CrazedWalrus · · Score: 1

      I don't need proof, because I'm not really proposing it. I'm taking this position as a point of argument, and want you to provide a good argument as to why I should change my mind.

      The point is that most people going on about abiogenesis sound no better. That they then call others stupid, ignorant, and claim that it has anything at all to do with the existence of God makes it all the worse.

      I'm saying these people are self-deluded hypocrites, no better than those whom they're bashing. My rival theory was only rhetorical.

    198. Re:That was an intelligently designed decision by Krabbs · · Score: 1

      Stop running in circles and hoping I will get confused. I didn't discuss the existence of an unmeasurable god, I said that discussing the existence of things that cannot be measured is absurd. Also, the elephant was meant as a joke, I don't think science is flawed. This is becoming a serious waste of time, so I'll leave it at that.

    199. Re:That was an intelligently designed decision by jswigart · · Score: 1

      There is no slicing and dicing. Just because Darwin threw out a potential hypothesis doesn't mean it's an integral part of evolutionary theory.

      http://en.wikipedia.org/wiki/Evolution#Origin_of_life

      My apologies, I meant origin of the universe when referencing big bang, in reference to the previous posters claim of not knowing where matter, etc came from.

      There's no reason why someone can't be a believer of evolution while still being religious. They deal with different problems.

      Would you call someone an evolutionist if they claimed that God created the first living cell (and only that cell)?

      No, that would be a creationist. To me, the simple matter that someone is willing to abandon all reason and usually the search for truth(scientific progress) just because science can't yet answer that earliest part of the origin of life question is enough to group them with any other creationist. The "god did it" answers to all unknowns is useless and down right dangerous to the progress of human knowledge.

      Faith is more often in direct opposition of scientific progress, because to make such progress in some cases provides compelling evidence to doubt what a believer previously held as truth. This is why creationists are trying to get their nonsense taught in schools as science, or failing that, trying to get evolution to be taught in such a way that reduces its scientific validity to those learning it.

      In my opinion, the survival of religion as a whole is entirely dependent on the fact that science may not ever be able to answer huge questions such as the origin of life. In that sense, I believe religion is becoming threatened by science, which is leading to all this bullshit evolution vs creationism, even though at this second each subject isn't necessarily mutually exclusive.

    200. Re:That was an intelligently designed decision by tukkayoot · · Score: 1

      Sorry, I thought you'd understand my meaning when I used the phrase "can't imagine" by the context; it was hyperbole. If scientists consider even the best theories as being at least nominally subject to revision/falsification, then of course they can "imagine" scenarios in which those theories are proven utterly wrong. It's just that such a scenarios are so implausible/unlikely that they're not worth taking seriously, or even mentioning.

    201. Re:That was an intelligently designed decision by Miseph · · Score: 1

      "I wouldn't divide it as cleanly as that."

      I wouldn't either, but since there is an enormous movement to read the Bible in the most literal sense possible (well, except the parts where it says to be kind and generous, that the wealthy are essentially doomed to hell, that killing is wrong and that we are all equally sinful; those are a little fuzzier...) which has formulated a very well known consensus view of what the Bible says, i feel it's valid to argue against that view and ignore most others for this purpose.

      The main point, on which we seem to agree, is that one can (pretty easily) interpret the Bible in such a way that evolution does not contradict it at all, though a not insignificant people refuse to do so for whatever reason.

      --
      Try not to take me more seriously than I take myself.
    202. Re:That was an intelligently designed decision by againjj · · Score: 1

      I was modded funny, but I was serious. People really did believe that. That was one of the thoughts behind some caste systems, for example.

    203. Re:That was an intelligently designed decision by The+Famous+Brett+Wat · · Score: 1

      There is no slicing and dicing. Just because Darwin threw out a potential hypothesis doesn't mean it's an integral part of evolutionary theory.

      Of course there is slicing and dicing: knowledge doesn't classify itself. You draw the line at such and such a point, and I accept that, but don't insist that's the only possible place to draw the line.

      Would you call someone an evolutionist if they claimed that God created the first living cell (and only that cell)?

      No, that would be a creationist. To me, the simple matter that someone is willing to abandon all reason and usually the search for truth(scientific progress) just because science can't yet answer that earliest part of the origin of life question is enough to group them with any other creationist.

      So here is someone who believes in the entirety of evolution theory as you have classified it, and you call him a creationist. From this, I surmise that by "creationist", you mean "irrational idiot", and you classify anyone who thinks that God exists and ever did anything as an "irrational idiot".

      At this point I see no possible profit in reasoning with you.

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    204. Re:That was an intelligently designed decision by cyphercell · · Score: 1

      your ability to spin bullshit will not compensate for a lack of thought, I was hoping you would become un-confused, the cyclical nature of our discussion relates directly to your ability to spin bullshit. That is why it is called SPIN. You are mistaking logic for rhetoric and arguing rhetorically on behalf of logic. It is confusing and I really thought you ought to know.

      is it absurd to ask questions of the universe, even though we cannot effectively measure it? What are quarks made out of? How long is time? Exactly?

      --
      Under the influence of Post-Cyberpunk Gonzo Journalism
    205. Re:That was an intelligently designed decision by johanatan · · Score: 1

      "It's very hard to prove negatives (and historical events)--you know that."

      But it's very easy to falsify a set of theories that make many many positive claims. Strangely nobody has managed this.

      It's obvious to me now that we're talking about two different forms of evolution. Yes, variation and mutation obviously occur (no one can disprove that--just look at viruses for example). But, we're talking about a theory that claims that some primordial material suddenly formed a working 'cell' which then started replicating and evolving from there. But, it's a chicken and egg problem, you see? A working cell doesn't appear from nowhere (let alone a replicating and functional cell). And, until you have a working cell, natural selection cannot do its thing. What makes one non-functional pile of garb any better than the next?

      Have you ever heard of von Neuman's universal constructor? He set out to design in a purely artificial environment (i.e., that of mathematics) the minimal self-replicating automaton possible. Now, he may or may not have actually done so. But, two things are for sure--he came darn close and it's rather complex (on the order of 2 or 3 hundred moving parts). One missing bit and it does not work--how can that evolve? [And, this was in a purely intellectual environment (without the normal constraints of physics.]

      "No one has the amount of time required to test and prove it though"

      FAIL. Speciation has been observed in the wild and recreated in the lab. A huge wealth of fossil and DNA evidence helps. Evolution is proven. The fine tuning of the mechanisms behind it are still being discovered. You probably get evolution mixed up with the big bang, abiogenesis and pretty much the whole of scientific knowledge and method though. A typical creationist thing, blur the terms of the debate and mix everything together.

      Once again, we are talking about two different forms of evolution. The form I argue against is more properly referred to as Darwinism (and it is the combination of evolution and the philosophy of materialism as put forth by such extremist atheists as Dawkins, Dennett, & Hitchens). I agree most people are more reasonable that that (and even you seem to be). You don't really believe it all appeared out of nowhere do you? (If so, just where did the atoms that make up the primordial soup come from)? That form of extreme atheism is simply irrational--no matter how much they want to call it 'rationalism'. Anyone who thinks that evolution (major or minor) disproves theism is simply intellectually dishonest.

    206. Re:That was an intelligently designed decision by johanatan · · Score: 1

      Well, you really should watch Christopher Hitchens and Dinesh D'Souza debate the issue:

      http://www.youtube.com/watch?v=l-NduvegITQ
      http://www.youtube.com/watch?v=6vMeAwpTW1I

      And, Richard Dawkins (author of _God Delusion_) is another extremist who thinks that the beloved theory is the death of religion. There also seems to be no shortage of their followers here on Slashdot--I'm surprised you haven't read any of their posts. There is certainly such a thing as 'evangelical atheism' and at the heart of it is the theory of evolution (or more specifically--Dawinism, which is the potent combination of evolution and the philosophy of materialism). The two are inseparable--evolution in today's context almost exclusively refers also to greater Darwinism/naturalism/materialism/secular humanism/atheism.

      Don't be fooled by their sleight of hand and bait/switch tactics. Proponents of the theory feel it quite natural (and proper, mind you) to slide at will between the various forms and strengths of the theory and its supporting philosophy (especially when you start to pin them down on specifics, asking tough questions and/or exposing their true motives, ignorance, or disingenuousness).

    207. Re:That was an intelligently designed decision by AshtangiMan · · Score: 1

      I try to stay away from forming my arguments based on the extremists (both sides). Both will take (for instance) something like evolution and use it to push their agenda. This does not mean that the things they assert regarding evolution should be given credence. And I disagree with you here:
      evolution in today's context almost exclusively refers also to greater Darwinism/naturalism/materialism/secular humanism/atheism.
      If you fall for that load of tripe then you must also think that you can't be catholic and support choice (but war of course is ok), that spirituality is extant from man and you need religion to explain it to you, and that the government is here to protect you, so please shut up and be protected. I am sure that you are correct that the attitude exists, but this does not make it representative of the science of evolution, but of the religion of evolution (which is a load of tripe).
      The proponents of evolution that you speak of sound suspiciously like pundits rather than scientists. You would do yourself a great favor if you simply tuned them out.

    208. Re:That was an intelligently designed decision by kurzweilfreak · · Score: 1

      Please explain how to tell the difference between these "different modes of knowing and arriving at knowledge" and just completely making shit up out of your ass and calling that knowledge too. What's good for the goose would be good for the gander, except we know the gander exists (humans) yet there is still no evidence that the goose exists outside of the minds of those who claim to worship it.

      --

      kurzweil_freak

      5th Kyu Genbukan Ninpo/KJJR student

      Be the darkness that allows the light to shine.

    209. Re:That was an intelligently designed decision by kurzweilfreak · · Score: 1
      Actually this is backwards. There's nothing but chemistry going on, it's only "information" because you anthropomorphically ascribe meaning to it. There's no more information in DNA than there is in any other molecule, but no one is asking who put the information in the formula for water or how it interacts with any other chemicals.

      The only difference is that DNA has the interesting property of being able to replicate itself (although it isn't the only molecule able to do that).

      If you look at DNA without also taking into account the history of how DNA got to be where it is now, certainly it looks pretty implausible. Context helps.

      --

      kurzweil_freak

      5th Kyu Genbukan Ninpo/KJJR student

      Be the darkness that allows the light to shine.

    210. Re:That was an intelligently designed decision by johanatan · · Score: 1

      No, goose = ID, gander = secular humanism. If ID is religion and should be excluded from science classrooms, then secular humanism should be too (though I don't concede that ID is religion as it makes tangible verifiable predictions and offers fitting theories and corollaries).

      One mode of knowing is to directly measure. The other is to produce a formalized system of logic starting from certain axioms and leading to certain conclusions (all of science utilizes this technique extensively). Philosophy is based on this formal logic and although this is also an essential part of science, design is excluded a priori as a possible conclusion on the query of the origin of life. That's short circuiting the process and it's not beneficial.

      The really unintuitive (at least to me) thing about systems of formal logic though is that they cannot be both complete and consistent (per Godel's theorems (see Fn. 1 below)). i.e., There is knowledge and truth that is simply not possible for rational minds (or machines) to discover (--or-- reality outruns knowledge). The mere existence of these higher truths raises obvious questions about eternity and the universe (and the metaverse or the supernatural realm). Just how does this higher truth exist if there isn't a higher power?

      So, that leads me to the third mode of knowing--spiritual senses. We all also have spiritual senses although we don't all recognize it.

      Fn. 1 - These theorems literally shook up the entire world of mathematics--everyone was surprised by Godel's work so their unintuitive (and somewhat countercultural) nature should still surprise most (if not all) students today.

    211. Re:That was an intelligently designed decision by johanatan · · Score: 1

      So, are you saying that because we are ordered creatures (i.e., composed of highly specified and complex parts), we are pre-disposed to recognizing order in the universe? What should the order of a mind have to do with what the mind 'thinks' about? Couldn't it possibly be the operation of a 'soul' beyond the material bits of the mind?

    212. Re:That was an intelligently designed decision by kurzweilfreak · · Score: 1
      Name a few tangible, verifiable predictions that Intelligent Design makes besides just arguing that evolution isn't sufficient to explain X.

      Your second "method of knowing" is great on its own, but what you forget is that it also has to be grounded in physical reality, otherwise you're just much adieu about nothing. One could come up with an incredibly complex, self-consistent logic set that doesn't mean anything because it's not based on anything in reality. As for your third method of knowing, "spiritual senses, well, you just assert as much with nothing to back it up. Also, define "spiritual". And define "higher" as in higher truths. And how can you know there is knowledge and truth that we simply can't, no way, no how, discover if we.... can't discover it?

      Calling Secular Humanism a religion is at best a bastardization of the meaning of the word religion. Despite popular claims, the Supreme Court never ruled that secular humanism is a religion. It was only stated as such in a dicta footnote, which is not a binding rule. By its very nature, the secular in secular humanism makes it pretty obvious that it isn't a religion...

      --

      kurzweil_freak

      5th Kyu Genbukan Ninpo/KJJR student

      Be the darkness that allows the light to shine.

    213. Re:That was an intelligently designed decision by smaddox · · Score: 1

      No matter how "life" is defined, at some point the definition requires a level of complexity that cannot form spontaneously. Even the most basic lifeform isn't just molecular soup, but has self-assembling structures at many orders of scale that are mutually functionally dependant.

      I think life is well defined as beginning with bacteria, but not including viruses. However, it is well known that viruses evolve in much the same way that bacteria, reptiles and mammals evolve. That is, natural selection favors certain outcomes.

      If viruses evolve, and that evolution is controlled by natural selection, perhaps other - possibly even simpler systems are controlled by natural selection. That is the assertion I was attempting to put forth.

      Evolution, as described by Darwin, pertains only to living creatures. However, there is a form of natural selection at all levels of existence. Entropy requires this to be true. Even at the level of a single atom, certain orbital states of the electron are favored over others. THAT is the universality of natural selection, and THAT is why complexity forms out of simplicity.

      It's not a simple concept, and that is why many people find it difficult to understand. I'm grateful to those who withdraw peacefully.

      On a side note, in order to prove Christianity is true, you would first need to expound upon what you define Christianity as. If your definition is simply that there are actions that are moral, and there are actions that are immoral, then I would agree with you. However, if your definition results in a claim that there are enigmas that can never be understood by humans, I would disagree with you.

    214. Re:That was an intelligently designed decision by trashyspaceman · · Score: 1

      It is true that in chemistry, a lower potential energy state is favoured. However, most of the lowest energy states for a molecules are quite boring, e.g. water, which is incredibly stable, CO2, CH4, CO, etc. So technically speaking, the "natural selection" of small molecules would lead to only basic substances.

      The issue here is that the level of molecular complexity required to do anything useful with one of the these molecules is much too high to have formed spontaneously. For example, the protein that can break down alcohol (alcohol dehydrogenase) is significantly more complex than the alcohol molecule it breaks down. The same can be said for proteins that form bonds in other chemicals.

      Could functional proteins form randomly? How many different proteins are expressed in humans/plants/.../etc.? Roughly 30,000 in humans excluding splicing. They are each, again roughly, 100 amino acids in length. Let's be really generous and say there are 1,000,000 functionally different alternative designs to each protein that perform the same function (generally across species a given protein looks similar). There are 20 different kinds of amino acids in human proteins. People often do experiments by changing one of the amino acid residues in a protein to see if the protein becomes non-functional - let's say about half may be swapped. So how many functional human proteins could there ever be? 30,000 * 1,000,000 * 20^50. If we randomly try to reproduce a human protein there are a total of 20^100 combinations. So of our pool of random proteins, (30,000 * 1,000,000 * 20^50)/(20^100)=1/(10^55) of them are actually functional.

      From here we can work in either time or space. Most proteins fold in milliseconds to seconds and nearly all proteins require a decent amount of water to work. The hardest part is that proteins don't know if they are functional or not, they just randomly wobble through jelly (water at the nanoscale) so any activity would require all the functional proteins to be in the same physical location.

      Unfortunately, the chemical world, particular biochemistry, is really complex, even though we have managed to produce simple models that generally work well. Don't get me wrong - I certainly enjoy science and I think it is an amazing way to appreciate God's creation.

      Now on the subject of Christianity, you wanted me to explain what it is. A Christian is someone who recognises that God is real, has the character of perfect love, wants to save and desires to walk with us. Jesus (meaning "God saves") was a gift to humans to supernaturally provide eternal access to a perfect God from a fallen nature. Good works are a form of godliness but are not powerful enough to bridge the gap.

      I hope that answers your questions.

      Blessings, Matt

    215. Re:That was an intelligently designed decision by mfnickster · · Score: 1

      It's just a term. It has a definition which makes it useful, but it's not a thing that has an existence all its own.

      Isn't your question a bit like asking "where exactly is the line separating 'skyscraper' from 'office building'"?

      --
      "Slow down, Cowboy! It has been 3 years, 7 months and 26 days since you last successfully posted a comment."
    216. Re:That was an intelligently designed decision by bh_doc · · Score: 1

      That's exactly my point. There are creationists who accept the evidence for evolution at small scales (size/time) and say they "believe in microevolution...", but are unable or unwilling to follow the logic (not to mention the empirical evidence) that extends the same process to large scales ("...but not macroevolution"). Yet the distinction between the two is as artificial as, as you so eloquently put, the distinction between an office building and a skyscraper.

      I'm pretty sure we're in agreement. When I first asked the question I was kind-of hoping for an explanation from someone who actually makes that distinction between the macro- and microevolution process"es", in case I've missed anything.

    217. Re:That was an intelligently designed decision by retchdog · · Score: 1

      Wow, this is rich.

      Seriously, you've apparently read a book entitled Answering the Objections of Atheists, Agnostics and Skeptics and are now incapable of doing what the book suggested (I hope that you at least read the book). I was shocked at your laziness at first, but now it is inline with what I expect from a modern-day (American?) Christian: you ignore most of your bible too, except for the coupla lines that contradict science, or condemn fags to death and hell. Mithras and Mammon have long since dethroned the King of kings in this country, and are now commemorating another golgotha.

      Back on the topic, scientists are able to give me at least a brief explanation of why I'm wrong, when I'm wrong. Sure, the details might be in a $200 textbook, but they can sketch it out.

      And you creationists (at this point I have to assume you are one, and a lily-livered apologist to boot) have the gall to call scientists elitist. Pathetic.

      --
      "They were pure niggers." – Noam Chomsky
    218. Re:That was an intelligently designed decision by Bryansix · · Score: 1

      The basic argument is that it never rained before the flood. The theory being that some force of nature prevented precipitation before that time or God prevented it.

      This is Slashdot. Do you realize that if I had to answer every skeptic on here I would never sleep, eat or leave my desk for months and still not finish? I can't force you to see God's existence. You have to seek him yourself. I can only point you in the right direction.

    219. Re:That was an intelligently designed decision by johanatan · · Score: 1

      Name a few tangible, verifiable predictions that Intelligent Design makes besides just arguing that evolution isn't sufficient to explain X.

      There is work being done to calculate specified complexities (and entropies) for systems and subsystems. Once this is done, then one could work out the math to determine the threshold between 'designed' and 'not-provably-designed' and test it on known quantities (i.e., designed and non-designed objects). One can also look at the entire field of forensics as a data point--we are pretty good at determining if deaths are accidental or 'designed' (and if designed, even 'who done it').

      Your second "method of knowing" is great on its own, but what you forget is that it also has to be grounded in physical reality, otherwise you're just much adieu about nothing. One could come up with an incredibly complex, self-consistent logic set that doesn't mean anything because it's not based on anything in reality.

      Incontrovertible axioms were assumed.

      As for your third method of knowing, "spiritual senses, well, you just assert as much with nothing to back it up.

      Yes, I agree that the existence of these senses is neither proved nor provable. That piece of knowledge I can only give from personal experience. YMMV.

      Also, define "spiritual". And define "higher" as in higher truths. And how can you know there is knowledge and truth that we simply can't, no way, no how, discover if we.... can't discover it?

      I was using spiritual, higher, and meta-physical interchangeably (though there are subtle distinctions). You need to fully understand Godel's theorem and the philosophical implications of it before you'll understand how I 'know' this truth exists. But, suffice it to say that the piece of knowledge which says that 'we can't know some things' happens to be one of the pieces of knowledge that we can 'know'. ;-)

      See:
      http://users.ox.ac.uk/~jrlucas/Godel/implic.html

      and specifically this quote is rather interesting:
      "If truth can outrun provability, reality can outrun knowledge."

      [although, I would modify it a bit to: As truth outruns provability, so reality outruns knowledge].

      If you want to understand the math before diving into the philosophy, I'd recommend Nagel's & Newman's _Godel's Proof_.

      Calling Secular Humanism a religion is at best a bastardization of the meaning of the word religion. Despite popular claims, the Supreme Court never ruled that secular humanism is a religion. It was only stated as such in a dicta footnote, which is not a binding rule. By its very nature, the secular in secular humanism makes it pretty obvious that it isn't a religion..

      Well, it certainly fits the 4th definition given here (if not any of the first 3): http://www.answers.com/religion

      and has very well-defined 'tenets' (i.e., doctrine).

    220. Re:That was an intelligently designed decision by johanatan · · Score: 1

      P.S. Since you seem to be a big fan of Kurzweil, you may also appreciate this:

      http://en.wikipedia.org/wiki/Minds,_Machines_and_GÃdel http://users.ox.ac.uk/~jrlucas/mmg.html

      [although I seem to differ with Lucas here a little in that I believe that Godel's theorem may in fact limit the human mind the same way that it does machines--just on a different level. I've not made my mind up on this one yet, but even if I had, the conclusion is neither likely nor unlikely to be true and thus could not be trusted. :-)]

  3. What a waste. by plover · · Score: 5, Insightful

    More than anything, this is an indictment on the scientists who pressured the good doctor out of his posting. He was bullied out for a misquote.

    Unfortunately, rather than engage in a reasonable debate over the unreasonable subject, he rationally decided to avoid the controversy completely by leaving.

    No matter what, the Royal Society is the loser here. Once they realized they were debating a misquote, the reasonable approach would have been to end the matter. Instead, they let the issue fester until a good man stepped down with a now-tarnished reputation.

    --
    John
    1. Re:What a waste. by moderatorrater · · Score: 3, Insightful

      I don't believe that anti-religious fervor is reaching the point where it's unreasonable. I refuse to believe it, and I suspect you of heresy for even saying it.

    2. Re:What a waste. by mdwh2 · · Score: 5, Informative

      Agreed, and just for reference (since Slashdot, along with the rest of the media, seem unwilling to link to them):

      Here is what he originally said: http://www.guardian.co.uk/science/blog/2008/sep/11/michael.reiss.creationism

      Here is the clarification just one day later: http://royalsociety.org/news.asp?id=8004

      I think he expressed his views rather poorly in what was said originally, making it easy to misread unless you look very closely. And it was reasonable to express criticism over that. But the media should not ignore the clarification after it has been made.

      Sure, there's a valid argument that it's better not to mention creationism at all (even to debunk it and explain why it isn't science, as Reiss was suggesting), but let's be clear: he was not advocating teaching creationism.

      To suggest otherwise is just the sort of thing IDers want - do we really want them to be able to say "Leading scientists support teaching creationism in science lessons"? Of course not, which is why this myth should not be propagated.

    3. Re:What a waste. by ShakaUVM · · Score: 2, Insightful

      >>More than anything, this is an indictment on the scientists who pressured the good doctor out of his posting. He was bullied out for a misquote.

      Right. By the slashdot and article summaries, it sounded like he wanted to replace evolution with creationism in the classroom, which wasn't what he said at all.

      It's so nice that we've come to a point in our society that merely being Christian is enough to get you kicked out of the Royal Society.

      Sorry, not kicked out. Chased out by rabid morons who can't read TFA wielding pitchforks and torches.

    4. Re:What a waste. by philspear · · Score: 1

      He was bullied out for a misquote.

      Man that's too bad. On an unrelated note, isn't the internet great? Good thing Gore invented it!

    5. Re:What a waste. by yali · · Score: 5, Insightful
      Agreed. If you read what Reiss actually said, it is clear that he was NOT advocating for giving creationism any scientific legitimacy in the classroom. Rather, he was giving some very sound and humane advice for how teachers can respectfully reach students who arrive in the classroom as creationists. Among his suggestions:
      • Students should be encouraged to voice their doubts so that teachers can deal with them in the open
      • Educators should see their role as making sure that students know the scientific methods, theories and evidence, even if the students' beliefs conflict with the science
      • Don't expect your students to abandon their long-held beliefs soon, or even at all. Hold them responsible for what they know, not what they believe

      Everything in his essay seems reasonable to me. The fuss arose in part, I think, because attacks on the scientific community have forced scientists into such a bunker mentality that they acted irrationally (i.e., not like scientists)

    6. Re:What a waste. by geekoid · · Score: 1

      He avoided it becasue he was wrong, and not ahving any solid logical argument he would rather run then think about his position.

      He tarnished his reputation.

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    7. Re:What a waste. by oldhack · · Score: 1

      Quick googling of news pieces with Michael Reiss turns up nothing to suggest he was misquoted. Do you have link to any report on what he actually said?

      --
      Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
    8. Re:What a waste. by mdwh2 · · Score: 1

      See my comment here for link to what he actually said, and that he was misrepresented by the media. (Of course googling news pieces wouldn't tell you that the news had misrepresented him ;)

    9. Re:What a waste. by Sponge+Bath · · Score: 2, Informative

      ...merely being Christian is enough to get you kicked out of the Royal Society.

      Well, no. That is not true at all.

      It sucks that his quotes were misinterpreted and he chose to step down to avoid the resulting controversy. But this was a reaction to the misperception that he was pushing creationism into science education, not just the fact that he was Christian. While I am embarrassed that such an ill informed fuss was made, I can understand it as there are plenty of people repeatedly trying to do just that: push creationism into science education. After defending against this again and again, I can see why supporters of science are a little trigger happy.

    10. Re:What a waste. by oldhack · · Score: 2, Interesting

      Nevermind, posts in this thread already provided it:

      http://www.guardian.co.uk/science/blog/2008/sep/11/michael.reiss.creationism

      Seems reasonable to me, but I found it objectionable on couple of points:

      1. Don't make creationism a special case. There are plenty other widely-held non-scientific beliefs, and they should be treated the same way in science classes.
      2. It would take great care to avoid getting swamped by the debate on the differences in the premises of science and various non-scientific beliefs, and not sure it's wise to dump this on secondary school teaching curriculum.

      One can argue it's more important for kids to know the basic premise of science than equations of Newton's mechanics. It might have been a good debate for the scientists and educators to have, but I suspect the politics would have hijacked the discourse - like it appears to have done in this case. Maybe the Brits are afraid of becoming a Kansas.

      Enough talking to myself now. :-)

      --
      Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
    11. Re:What a waste. by oldhack · · Score: 1

      Thanks - I saw that. I do think the Royal Society and those who called for Reiss' dismissal overreacted, but I can understand their rationale. It's a sad commentary on our society, and apparently we (the US) are not alone.

      --
      Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
    12. Re:What a waste. by jellomizer · · Score: 0, Offtopic

      For many cases Atheists groups show many of the negative trappings that formal religions give.
      First they start dividing into groups.
      Group One: There Is no God, that that, no further thought to the issue. Anyone who believes contradictory is wrong and stupid.
      Group Two: Don't believe in God. However willing to respect people who do.
      Group Three: Don't believe in God, but is open to the fact that they could be wrong.
      Group Four: Kinda Believes in God, but not really. Sees God as more of a superstition
      Group Five: Actually Believes in God, but doesn't want too.

      Second:
      The most extremist groups actually try to spread their beliefs by intimidating those who are not in their group. Excluding people who believe differently.

      Because for the most parts Atheists are not organized and a minority they haven't had the chance to organize into a violent group. However it they were organized and rather high they could get violent. Except fighting for God, they will just use a different call. Fight for Reason or Fight for Science, Fight for Darwin... It really doesn't matter people of any group are all messed up.

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    13. Re:What a waste. by AshtangiMan · · Score: 1

      You seem to be a not so good troll . . . perhaps you ignore the context or think that the summary is in some way informative. I know from a post of yours a little lower that you are not a complete idiot, but with nothing but your parent post you would appear to be nothing less.

      Or did you forget to add the new punctuation referred to in your sig?

    14. Re:What a waste. by CodeBuster · · Score: 1

      The really distressing thing is that these sorts of attacks and ambushes are becoming increasingly common in the public arena. An opponent or a perceived enemy is setup to take a fall by association, rightly or wrongly (it appears wrongly in this case), with a third rail issue and once the unfortunate target has been crushed it is impossible to un-ring the bell. It is like the common lament of the acquitted man, "How do I get back my good name"?

    15. Re:What a waste. by Cassius+Corodes · · Score: 1

      Atheists are resistant to being formed into groups - they don't all agree on any set principles so its hard to have a unifying cause that will motivate them all.

      I would like to see these "Atheist groups" that are dividing people into groups, and intimidating people...

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    16. Re:What a waste. by Antique+Geekmeister · · Score: 4, Insightful

      Well, first, you have to bundle them into stacks of strawmen.

    17. Re:What a waste. by ArsonSmith · · Score: 1

      He was wrong for wanting to insure that Science teachers were able to teach Science, even to students that may be creationists? Which part was he wrong at? Should Science teachers be teaching creationism? or are you just a standard did not RTFA, knee jerk reactionist who thought he wanted to teach creationism in science class?

      --
      Paying taxes to buy civilization is like paying a hooker to buy love.
    18. Re:What a waste. by Anonymous Coward · · Score: 0

      How would his reputation be tarnished if he were misquoted?

    19. Re:What a waste. by timmarhy · · Score: 0, Flamebait
      yeah what a bunch of whacko assholes, damn them and their quest for reason. lets all sit around in a big expensive church praying to jesus, symbolically eating his flesh while chanting.

      show me a single atheist group that's even remotely aggressive? fuck i didn't know there WERE atheist groups i'm gonna join me up with one.

      --
      If you mod me down, I will become more powerful than you can imagine....
    20. Re:What a waste. by JerkBoB · · Score: 3, Insightful

      Because for the most parts Atheists are not organized and a minority they haven't had the chance to organize into a violent group. However it they were organized and rather high they could get violent. Except fighting for God, they will just use a different call. Fight for Reason or Fight for Science, Fight for Darwin... It really doesn't matter people of any group are all messed up.

      Personally, I am somewhere in the middle of Group one and Group two. I would be more firmly in the camp of Group two (i.e. live and let live), except that here in the US, anyhow, the other side is insistent in forcing their worldview on me. And so I feel that I must return the favor.

      What irritates the piss out of me about fundamentalists is that they pick and choose the bits of science that fit their small-minded view of reality. If their appendix is infected and about to burst, they'll happily accept the intervention of modern medicine which is based on ... biology, which is based on ... science! Germ theory, sterilization, antibiotics, cauterization, etc. etc. None of that came from the Bible. They'll even use their computers (all that theory and math? based in logic...) to post on /. in defense of their belief system.

      Science is a thinking system, rather than a belief system... Those of us who understand the scientific method use it as a malleable model for understanding our world. It's not set in stone, although much of what we use for models is based on previous work by many people. It's all based in logic and empirical observation.

      Paradigm shifts do happen, but they're relatively rare. Because we know that current theories have been agreed upon by many smart people, we resist radical ideas that challenge the status quo. That's not to say that changes can't happen, though. New theories which last long enough to become paradigm shifters have survived the gauntlet of experts attempting to kill the idea. It's all about proof and rigorous logic.

      Do I claim to know that there is no God? Of course not. I can't prove it, any more than I can prove that there isn't an invisible pink unicorn standing next to all of us. I don't need a god, though, any more than I need an invisible pink unicorn. It's functionally irrelevant. Do I claim to know how/why we're here? No, and anyone who claims to know is a liar or is misguided.

      (Directed at any fervent believers who have read this far...)

      Do I need to make something up in order to live my life every day? No. And neither do you.

      Remember that for every one of your close-held beliefs about the supernatural, there are billions of folks out there who believe something entirely different. Think about that. Is everyone but you wrong? If your answer to that is "yes", then you need to grow up. We'll be waiting for you at the adults' table when you're ready.

      --
      A host is a host from coast to coast...
      Unless it's down, or slow, or fails to POST!
    21. Re:What a waste. by Anonymous Coward · · Score: 0

      Because I don't have mod points today, I'd like to say that I thought your remark was very witty. It's unsettling that you've been modded "insightful", though. Irony is a great litmus test of how seriously people are taking themselves, isn't it?

    22. Re:What a waste. by guyminuslife · · Score: 2, Interesting

      Thanks for linking that. This puts the whole debacle in perspective.

      I don't really agree with him anyway---not because I think he's wrong, but because I think he's naive. Perhaps his statements are in the context of a more laid-back British attitude toward religion. I don't know how it is over there. What I do know is how things work over here in the States, and I am quite certain that any loophole that can be exploited in order to teach creationism in schools over here, will be. If you can talk about it, you can critique it, if you can critique it, you can advocate it, if you advocate it, that's effectively the lesson plan. It's a poor choice to make.

      But it's nothing to be forced to resign over.

      --
      I don't believe in time. It's a grand conspiracy designed to sell watches.
    23. Re:What a waste. by Anonymous Coward · · Score: 0

      The biggest problem here is that the Society has lost a lot of clout in the eyes of the scientific community. TFA explains how many members don't believe he should have stepped down. As a pastor who has reconciled his beliefs, I would love to see an interesting and thoughtful debate on the merits of each worldview. Instead of exploring this, however, the society caved to secularist pressure and acted, dare I say, unscientific.

    24. Re:What a waste. by pxc · · Score: 1

      The most organized atheist group I've ever been a part of, or even directly encountered, is the Free Thinkers' Club at my highschool. Except even from its foundation it served as a place to discuss atheism, a subject that had gone so undiscovered at my high school that our meetings were filled with theists and deists of all kinds, from Catholic to pantheistic neo-pagan. The group eventually evolved into a philosophical and political discussion forum consisting of less than 50% atheists now. It also functions secondarily as a platform to allow any student activist to set up booths (for example counter-recruitment booths when Army recruiters come to school) at school functions.

      I guess my experience with atheistic groups is different than yours.

      I've also noticed that I know no militant atheists who did not grow up in a religious environment or according to a religious upbringing. Conversely, I've never met an atheist who had simply never been interested, introduced, or convinced by religion that was angered by or unaccepting towards it. It's the extremes of religion that cause certain reactionary atheists to call religion things like "the opiate of the masses", not the other way around.

      There are also some types of violence that are far less effective when motivated by anything other than religion. An extreme sacrifice, be it peaceful martyrdom or a suicide bombing, goes down much easier with the promise of eternal life or a favorable reincarnation. The problem with comparing Atheists (capital A,to emphasize their characterization as a group) to Religious Extremists X is that Atheists don't really exist. The way atheists form groups, if at all is generally differently motivated than the forming of a religious group. While religious groups organize in order to better understand a common source of wisdom or tenet such as a holy book or principles for improving one's (after)life, atheists are more likely to organize around issues upon which they are already agreed and for which they need more representation or something like that.

      With all this considered, saying that "Because for the most parts Atheists are not organized and a minority they haven't had the chance to organize into a violent group. However if they were organized and rather high they could get violent." is basically admitting "A group of people who tend not to form mobs could become dangerous if they were to form an angry mob." A true statement, but not a very useful one.

      --Patrick C.

      DISCLAIMER: I'm a young atheist (under 18) still living with a family that regularly attends church. I've been continuing to attend church for four years longer than I've believed in God, and I've been on all parts of the bitterness/acceptance spectrum that atheists are sometimes characterized by (like the groups you defined in your post).

    25. Re:What a waste. by Anonymous Coward · · Score: 0

      The Panda's Thumb has more on this. It seems Reiss was misquoted and the victim of alarmist reporting.

    26. Re:What a waste. by Anonymous Coward · · Score: 0

      Thank you for the link. It does look like this career was destroyed by the need for a gripping headline and the knee jerk response to it without understanding the actual article.

    27. Re:What a waste. by msuarezalvarez · · Score: 1

      Nice post.

    28. Re:What a waste. by stephanruby · · Score: 1

      Agreed, and just for reference (since Slashdot, along with the rest of the media, seem unwilling to link to them):

      Here is what he originally said: http://www.guardian.co.uk/science/blog/2008/sep/11/michael.reiss.creationism

      Here is the clarification just one day later: http://royalsociety.org/news.asp?id=8004

      No. His clarification is the blog post that you linked to, which was authored and posted by him. Part of his original statement was the sound file posted at the top of that blog post, in which he was speaking to a reporter. The second link you're referring to is not only a further clarification on his original clarification, but it's just a second-hand quote published by the Public Relations arm of his employer.

      In other words, that second-hand clarification doesn't really count (in my personal view at least). Public Relations departments do not speak for their employees. They speak for their company/organization, in this case they speak for The Royal Society. Public Relations departments do not clarify. They confuse, they censor, they edit, they rewrite, and sometimes, yes, they'll even lie.

      There is a reason controversial topics are rarely ever put to rest by the PR spokesperson. If a dicy personal statement needs to be clarified, it needs to be clarified by the original primary source. And in this case, it was! The Professor clarified in writing what he said in that recorded interview with the (slightly hostile) reporter. In other words, that blog post was already that Professor's own personal attempt at doing damage control (much to the horror of The Royal Society's PR spokesperson -- I'm sure).

    29. Re:What a waste. by TheLink · · Score: 1

      "but I found it objectionable on couple of points: Don't make creationism a special case"

      From the reaction of everybody (fanatics from both religious and atheist camps) it seems that creationism is a hot topic.

      And so it is a good topic for him to address and talk about specifically.

      I don't think he really was saying it should be dumped on the curriculum. I think it's more like ensuring that students with creationist beliefs can still learn the scientific way of thinking, without being shouted down/out.

      But it seems that even noncreationists Professors with religious beliefs aren't allowed in the classroom either.

      It's ironic he has proven there really is a problem out there. Imagine the people who got him kicked out were in charge of teaching students.

      --
    30. Re:What a waste. by Anonymous Coward · · Score: 0

      i too was disappointed to hear that he had resigned. i would expect this sort of ostracizing to happen in the religious circles, not the scientific community. i admittedly don't know all the details, but tolerance of differing suggestions and ideas is what drives free-thinking and science.

    31. Re:What a waste. by oldhack · · Score: 1

      It is sad. To defeat "the enemy", we became the enemy.

      --
      Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
    32. Re:What a waste. by stephanruby · · Score: 1

      I don't really agree with him anyway---not because I think he's wrong, but because I think he's naive.

      I personally do not think he's naive.

      His explanation for evolution is that the overwhelming majority biologists and scientists "believe" in it. Is that really how he was taught Science?

      And then, he goes on to say that creationism shouldn't be approached as a misconception, but as a world view. Why? He seems to confuse evolution as world view that the overwhelming majority of scientists believe in -- in one paragraph, and then in another, he wants to approach creationism as a world view as well.

      And of course, to him, it's the "theory of evolution", not the concept of evolution, nor is just straight -- evolution. So on one hand, he doesn't think relevant to mention testable ideas or the scientific method when arguing *for* evolution, but on the other hand, he likes to place the code word "theory" in front of "evolution" when we all know -- damn well that he wouldn't even think of doing the same thing for other theories -- like the "theory of gravity" for instance.

    33. Re:What a waste. by TheLink · · Score: 1

      "I think he expressed his views rather poorly in what was said originally, making it easy to misread unless you look very closely"

      I think the title and blurb added by Guardian didn't help at all.

      Anyway even if the teacher doesn't mention creationism, what happens if the student brings it up?

      Do you shout him out of the classroom like the fanatical atheists have shouted Reiss out of his position in the Royal Society?

      I'd have thought that would be unlikely, but now I'm not so sure - perhaps Reiss's concerns are well founded.

      --
    34. Re:What a waste. by ShakaUVM · · Score: 1

      >>Well, no. That is not true at all.

      Actually, one of the quotes from the original article was: "It's not appropriate for a Christian to be in the Science Education position", or something close to that.

      I wonder that if Dawkins had said that science teachers should answer questions about creationism in a science classroom if he'd have been pilloried and forced to resign as well.

    35. Re:What a waste. by Weedlekin · · Score: 1

      "show me a single atheist group that's even remotely aggressive"

      I'll cite two: Soviet Russia and Mao's China.

      --
      I'm not going to change your sheets again, Mr. Hastings.
    36. Re:What a waste. by khanyisa · · Score: 1

      Yes, but I'd wager that the "misperception that he was pushing creationism into science education" was largely because he is a religious minister, so people assumed he must have said something rather than reading it carefully.

    37. Re:What a waste. by Anonymous Coward · · Score: 0

      More than anything, this is an indictment on the scientists who pressured the good doctor out of his posting. He was bullied out for a misquote.

      According to what Nick Matzke just posted at pandasthumb.org, it was the BBC's misleading headlines that started all the outrage.

    38. Re:What a waste. by skrolle2 · · Score: 2, Interesting

      They're a minority in the US, yes.

      You should come to northern Europe, atheists are clearly in the majority here, and the result is that religion is not a big deal. There's a really low tolerance for religious extremism, or mixing religion and politics, but I would say that it's probably a lot easier to be religious over here, than an atheist in the US.

    39. Re:What a waste. by Anonymous Coward · · Score: 0

      Certain topics seem to be censored by science. Any scientist who discovers anything that goes against Darwinian evolution or Global Warming being leading to the end of humanity is exiled. It no longer matters how much methodology and data is there. It does not matter how much experience is there. It does not even matter what field of science was involved. The scientist is immediately denoted as fringe and ceases to have status of expert in the field.

    40. Re:What a waste. by Xybot · · Score: 1

      When the Director of Education is also an ordained minister, the opinions he expresses about creationism in science class should be crystal clear.

      --
      God was my co-pilot, but then we crashed and I was forced to eat him.
    41. Re:What a waste. by mdwh2 · · Score: 1

      His explanation for evolution is that the overwhelming majority biologists and scientists "believe" in it. Is that really how he was taught Science?

      Where does he say that?

      He states: "the overwhelming majority of biologists consider evolution to be the central concept in biological sciences, providing a conceptual framework that unifies every aspect of the life sciences into a single coherent discipline". I do not see him simply seeing this as a "belief", and he doesn't even mention belief in evolution at all.

      And then, he goes on to say that creationism shouldn't be approached as a misconception, but as a world view. Why?

      Whilst at first this sounds worrying, he explains it later in his blog:

      "Creationism can profitably be seen not as a simple misconception that careful science teaching can correct. Rather, a student who believes in creationism has a non-scientific way of seeing the world, and one very rarely changes one's world view as a result of a 50-minute lesson, however well taught."

      I.e., he's not saying "It's not a misconception, we should accept it as a valid viewpoint", he's saying that the problem is that it's not a simple misconception, but a worldview that has been ingrained into them.

      And he's right - unfortunately creationists beliefs often aren't due to a simple misunderstanding that you can correct like a spelling error, it's something they've been brought up to believe, and all of their worldview has been based around it. That's a difficult issue to fix.

      Perhaps it would have been clearer if he'd said "Creationism isn't a simple misconception, it's brainwashing", but I guess he was trying to maintain some politeness.

      And of course, to him, it's the "theory of evolution", not the concept of evolution, nor is just straight -- evolution. So on one hand, he doesn't think relevant to mention testable ideas or the scientific method when arguing *for* evolution, but on the other hand, he likes to place the code word "theory" in front of "evolution" when we all know

      What? Evolution is a theory. And creationism isn't a theory. You appear to be mistaking "theory" for a guess or idea, which is just the same trick that creationists pull when they say "Evolution is just a theory". A theory in science means it's supported by evidence (overwhelming amounts, in the case of evolution), and has been tested.

      Scientists often do talk about the "theory of gravity" (or the theory of general relativity which is the modern theory of gravitation; or other examples include quantum theory), and they are not kicked out of their job for it! On top of that, multiple times in the article, he does refer to simply "evolution" on its own.

      I have linked to direct quotes to support what I have said about him - you appear to be basing your view of him on hearsay and misrepresentations, and worse, you are using the same misunderstanding of scientific terminology that creationists use. I think this shows that we really do need to teach pupils better about what science is about, and what a scientific theory is.

    42. Re:What a waste. by mdwh2 · · Score: 1

      No. His clarification is the blog post that you linked to, which was authored and posted by him. Part of his original statement was the sound file posted at the top of that blog post, in which he was speaking to a reporter.

      Well okay, but either way, it's been clarified by his own words.

      The second link you're referring to is not only a further clarification on his original clarification, but it's just a second-hand quote published by the Public Relations arm of his employer.

      In other words, that second-hand clarification doesn't really count

      And the second hand sources about what he supposedly has claimed certainly shouldn't count.

    43. Re:What a waste. by jellomizer · · Score: 1

      Fundamentalists are actually a minority. They are just a very vocal minority. Most Major religions know the separation of Religion and Science and have been supporting real science for over a hundred years. One of the smartest man I ever talked to was a Catholic Bishop, he Had PHDs In Bio-chemestry and Theology, as well is quite aware of what is going on in science and is able to understand science far better then a lot of full time scientists. He was able to accept the Bible as a litery truth (Truth is in the meaning of the story not necessarily the facts) and science as oberservations and inferences made from observing the universe (in large and small scale) which we only logically can assume is true, as we don't have evidence to say otherwise.
      There is only a small group of Fundementalists who think Science and Relion conflict. But it seems that a lot of Athiests feel that they do... However they could just be a vocal minority as well.

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    44. Re:What a waste. by mdwh2 · · Score: 1

      You've got to remember this is the UK, not the US - hardly anyone, even among religious people, believes in creationism. The Church of England doesn't support creationism, and supports evolution (e.g., http://www.theregister.co.uk/2006/03/21/archbishop_backs_evolution/ , or there was also a recent case where bishops and scientists wrote together to the Government to oppose a school that was teaching evolution).

      So there wasn't any reason beforehand to think that he needed to take extra care to distance himself from creationism.

      (I also have this amusing image where fellow priests call for his resignation as a priest, based on them thinking he supports creationism...)

    45. Re:What a waste. by Anonymous Coward · · Score: 0

      I can't prove it, any more than I can prove that there isn't an invisible pink unicorn standing next to all of us.

      That's because he's invisible. (And therefore, not pink)

    46. Re:What a waste. by JerkBoB · · Score: 1

      Fundamentalists are actually a minority. They are just a very vocal minority.

      Gallup Poll: Almost half of Americans believe God created humans 10,000 years ago

      If that's not fundamentalism, I don't know what is. That is just a quick example. If I cared to, I could find more supporting evidence. Are you seriously claiming that politics in the US are not strongly influenced by fundamentalist Christian beliefs?

      You might have missed it, but there was a monumental court case heard as recently as 2005. The crux of the case was whether or not a creationist-based explanation for life as we know it could be taught in public school science classes as an alternative to the theory of evolution. In 2005!

      Fundamentalists are a minority? Maybe, but they're frighteningly influential. If they'd keep their nonsense out of my tax-funded schools, I wouldn't be so "militant." Yes, I'm threatened by them. I fear for my child's future as a free-thinking individual in this "one nation under God."

      --
      A host is a host from coast to coast...
      Unless it's down, or slow, or fails to POST!
    47. Re:What a waste. by jellomizer · · Score: 1

      You are talking about one view.
      And many of these people do not even know the official stance of the religion, or and understanding of science (this is a flaw in Americas science education).
      Remember about 50% of the population has below average intelegence.
      Then polls can be manipulated based on wording, and conclusions be made of the response to the question.
      Q: Do you believe in the creation story in the bible?
      A: Yes or A: No
      There is questions of the randomness of the samples which is always an issue of the people who makes polls, and people who respond to the pools. If you have a view but don't feel strongly you may not bother with the pools but if you do feel strongly then you will answer. Heck if you have seen Special Interest groups flood a poll. I remember Sierra Online had a poll about porting games to Linux. It got on Slashdot, and it flooded the website with votes for Linux. Although the user base is less then 1% (at the time of the poll)
      So oh there is a Gallop Poll about Creationism, All the church officials and other fundies go and make sure they are on the poll. As I stated they may be a minority but they are a vocal group. And will often ban together to make them look bigger then they really are.

      The problem with our system isn't the democracy or money corruption, it is due to the fact that it is influnced by those who yell the loudest.

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    48. Re:What a waste. by moderatorrater · · Score: 1

      Remember that for every one of your close-held beliefs about atheism, there are billions of folks out there who believe in a God. Think about that. Is everyone but you wrong? If your answer to that is "yes", then you need to grow up. We'll be waiting for you at the adults' table when you're ready.

      Altered for the American audience's benefit. The vast majority of people in the US were religious by the last estimate; by taking religion out of it, aren't you just imposing your worldview on them?

      The answer to that, of course, is "yes", but it's different because you're trying to make it so that there's no worldview at all rather than one that's based in religion. If you look at the trends, it seems that a majority or nearly a majority of the people would agree that religion needs to be taken out of politics, which means you've got a lot of religious people in that camp (myself included). But the fact of the matter is that you and people like you are trying to change the country to fit your view of what it should be, and it's different than it was in the past, and it's not as good for religious people and their families as what you're trying to do. Faulting them for wanting to keep the country the way that it was, the way that worked for them and their parents, seems rather small minded. If everyone would just come to the table and agree that the other side has a very valid viewpoint, concessions could be made and a lot of the hostilities would cease.

      Instead, we're left with a militant group who wants everything accepted as long as it doesn't directly harm another person, oh, and by the way, unborn children aren't people, and we're left with a militant group of religious people, who want to raise their children in something close to the environment they were raised in, which isn't even close to the way that we are now, oh, and by the way, they're in favor of killing unborn babies, and babies are easily the most precious thing on the planet. Neither side is completely wrong, neither side is completely right, and neither side is willing to compromise. The two groups are identical in their actions if you replace a few core beliefs.

    49. Re:What a waste. by Anonymous Coward · · Score: 0

      More than anything, this is an indictment on the scientists who pressured the good doctor out of his posting. He was bullied out for a misquote.

      Unfortunately, rather than engage in a reasonable debate over the unreasonable subject, he rationally decided to avoid the controversy completely by leaving.

      No matter what, the Royal Society is the loser here. Once they realized they were debating a misquote, the reasonable approach would have been to end the matter. Instead, they let the issue fester until a good man stepped down with a now-tarnished reputation.

      It's called a witch hunt.

    50. Re:What a waste. by JerkBoB · · Score: 1

      But the fact of the matter is that you and people like you are trying to change the country to fit your view of what it should be, and it's different than it was in the past, and it's not as good for religious people and their families as what you're trying to do.

      You seem to be claiming that I am (and others like me are) somehow trying to take religion away from others. I cannot speak for anyone but myself, but I will say that my motivation is not to kill religion.

      I do not, repeat DO NOT care what people believe, privately. My next-door neighbors, who are very nice people with whom we often socialize, believe in smudging and dowsing and charm trinkets to ward away "bad karma." I think that stuff's silly, but as long as they don't propose that it should be taught in public schools, I don't care.

      Would it be OK for them to set up a business that operated by spreading their ideas, encouraging people to pay a voluntary "weekly membership fee", and getting a tax-exempt status from the government? No, of course it wouldn't. But how is that any different than churches? The only difference is that some arbitrary belief systems have been around longer than others.

      Getting back to your suggestion that I'm somehow being hypocritical by ignoring the fact that "billions of people share a belief in God"... I don't have a problem with it. You are begging the question of which God, but that's OK, it's irrelevant to the discussion at hand.

      Can I prove that I'm right? Of course not. I don't need to, though, because I'm not evangelizing. I don't care whether or not anyone else chooses to disbelieve based on what I've said. All I care about is whether or not those who do believe can impose their belief system on me and my children.

      If religion stayed at home and in the church, concessions could be made and a lot of the hostilities would cease.

      --
      A host is a host from coast to coast...
      Unless it's down, or slow, or fails to POST!
    51. Re:What a waste. by mog007 · · Score: 1

      I don't think the United States is as theocratic as you make it seem. We have a low tolerance for *some* religious extremists, and as far as mixing religion and politics, let me quote from our Constitution's First Amendment:

      "Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof..."

      Sure, it's not a perfect separation, with "In God We Trust" on our currency, and prayer being performed in Congress, but we don't have mandatory prayer in school anymore, and whenever some school district tries to push creationism on our children, our courts kick that shit out.

    52. Re:What a waste. by ReedYoung · · Score: 1

      You don't honestly believe their crimes against the proletariat were motivated by atheism. Correlation does not equal causation. Dictators prohibit religion to prevent public assembly of people who might then revolt against the totalitarian state. The persecution of religious practice by various dictators, just like the mandate of religious practice by other dictators, is tactical, not ideological. Atheism as government policy is about power. Atheism as the personal policy of citizens in a free society is about intellectual integrity.

      --
      "I can't imagine how things could get any worse!" (some guy) "That could just be failure of imaginatioÂn on your p
    53. Re:What a waste. by Weedlekin · · Score: 1

      timmarhy asked to be shown a single atheist group that's even remotely aggressive, and I provided two of them. The rest of your post is therefore a straw man which doesn't address my points, i.e:

      1) both Soviet Russia and Mao's China were countries where atheism was the state religion, and

      2) they were aggressive.

      --
      I'm not going to change your sheets again, Mr. Hastings.
    54. Re:What a waste. by Anonymous Coward · · Score: 0

      He is a vicar who has gained credibility with non-scientists for advancing creationist views. He does this with pseudo-scientific babble that, to a layperson, sounds like reasonable science, when in fact it is nonsense. If he were to say "the sky is blue, so I had porridge this morning", most laypersons would identify this as a non-sequiter instead of a logical explanation for porridge. Unfortunately they are less able to do so when it comes to arguments for and against creationism. He has no business in the Royal Society.

      Further you may believe that this is a misquote, but if you read his stated opinions, you will find that it is not.

      Simply because most of the western world believes a lie, does not make it true. The world is not flat, and it was never flat, despite what the Vatican insisted, or that everyone believe the Vatican.

    55. Re:What a waste. by plover · · Score: 1

      Do you have references or an example? That's an interesting point that might mean the R.S. had an ulterior motive for drumming him out.

      --
      John
    56. Re:What a waste. by ShakaUVM · · Score: 1

      >>I think that stuff's silly, but as long as they don't propose that it should be taught in public schools, I don't care.

      There's a difference between teaching something, and being willing to discuss something in a public school. A science teacher who teaches evolution should be prepared for questions about ID, creationism, etc. That's all the Royal Society guy was saying, but they burnt him alive at the stake for it. (Bad metaphor?)

      >>Would it be OK for them to set up a business that operated by spreading their ideas, encouraging people to pay a voluntary "weekly membership fee", and getting a tax-exempt status from the government? No, of course it wouldn't. But how is that any different than churches?

      If they qualify as a church, then they qualify as a church. We got a lot of weird religions in America, and the government shouldn't be trying to distinguish which one is right. Why are they tax-exempt? Because they (more or less) fall under the category of non-profits, or more often, charities. Churches help better society by feeding the homeless, tending to sick kids whose parents can't pay for health care, and all that other irrational stuff that comes with a belief in God. The government recognizes that organizations make the country a better place, and allows them a tax-exempt status as long as they play by the rules which govern charities (such as they can't be used for political speech). Churches which don't follow these rules pay taxes.

      Since you obviously think that churches should lose their tax-exempt status, answer me this question:
      1) Do you want all charities to lose tax-exempt status, or are you just discriminating against religious ones?
      2) If you do want to eliminate all tax-exempt status, do you think that bankrupting charities will make the country a better place?

      Remember, it's a lot more than just churches which get tax-exempt status. 501c3's include labor unions, amateur sports organizations, and a bunch of other things besides.

  4. A terrible shame by David+Gerard · · Score: 2, Funny

    The contemporary militant Tooth Fairy jihadist movement continues to be disrespected by these scientific infidels.

    --
    http://rocknerd.co.uk
  5. please, please ... by unity100 · · Score: 0, Troll

    anyone who puts religious convictions or beliefs higher than their science, are not worthy of any scientific post.

    royal society did the right thing.

    1. Re:please, please ... by Anonymous Coward · · Score: 1, Insightful

      You're a idiot -- and I'm speaking scientifically, cause anyone who makes your claim in the defense of science must have a very low IQ.

    2. Re:please, please ... by oGMo · · Score: 3, Insightful

      anyone who puts religious convictions or beliefs higher than their science, are not worthy of any scientific post.

      Pressuring someone to resign because they mention the word "creationism" in a not entirely disparaging context, despite being misquoted, sounds like "religious convictions or belief higher than their science" to me. Unless their science involves propaganda and gut feeling rather than logic an facts. So who isn't worthy of a post here?

      --

      Don't think of it as a flame---it's more like an argument that does 3d6 fire damage

    3. Re:please, please ... by kitsunewarlock · · Score: 4, Interesting

      1.) This man didn't put religious belief higher than science. He just said it should be taught in school rather than ignored, but still taught in a way that promotes the theory of evolution as a science, and creationism as a religious belief not founded on logic and empirical evidence. He didn't want to waste hours on end talking about creationism--he just wanted to explain WHY its not science. Nor did he want to profess it was right.

      2.) Religious persons are fully capable of using the empirical method to logically deduce (and/or prove/discover) and record evidence (i.e. "science"). They shouldn't let their convictions stand in the way of their findings and remain a large part of an empirical system such as the royal society--but they shouldn't be completely disregarded by the society for a misguided attempt at teaching a social science alongside a theory of science. And in the end that's all he wanted to do. Teach a historically valid world view that is being phased out due to vast scientific evidence. Believing and learning about old beliefs and pseudo-sciences are two different things entirely. And refusing to listen to your opponent's argument isn't science: its ignorance.

      3.) From another article about him, I already read he also wanted to try to help kids who get picked on in science classes for their religious belief. Science should take precedent in a place of logic and learning over religion (especially in a state that holds a firm belief in religious tolerance). But the school should not be a place that allows religious intolerance to spread, even if it spreads as a result of empiricists ragging on dualists (I'm assuming dualism here as its "god created everything", making a clear separation from reality and the spiritual world).

      --
      Ginga no Rekshiya Mata Each page.
    4. Re:please, please ... by rand200069 · · Score: 1

      Did you happen to RTFA by chance? You seem a little mixed up on what happened. Reiss was misquoted. He did not put any religious convictions above scientific teaching.

    5. Re:please, please ... by mdwh2 · · Score: 2, Informative

      Citation please, where he did this?

      royal society did the right thing.

      Both The Royal Society and Reiss are entirely in agreement that creationism should not be taught as a science: http://royalsociety.org/news.asp?id=8004

    6. Re:please, please ... by Pantero+Blanco · · Score: 4, Informative

      anyone who puts religious convictions or beliefs higher than their science, are not worthy of any scientific post.

      royal society did the right thing.

      Go read the article.

      He said his experience had led him to believe it was more effective to include discussion about creationism alongside scientific theories such as the Big Bang and evolution - rather than simply giving the impression that such children were wrong.

      "This individual was arguing that we should engage with and address public misconceptions about science - something that the Royal Society should applaud."

      Roland Jackson, chief executive of the British Association for the Advancement of Science, said Mr Reiss's departure was a "real loss".

      "I was at the actual discussion and what I heard him say , however it has been reported, was essentially the position advocated by the Royal Society," he said.

      The original story was based on a misquote. The article that this summary links to says so. Why does the summary imply that the original story valid while linking to one that debunks it!?

    7. Re:please, please ... by Anonymous Coward · · Score: 1, Insightful

      You realize that the situation you describe has nothing to do with this story right?

      The man said that if Creationism is raised in class by a student it should be dealt with there as a teaching opportunity on the scientific method.

      He was right but badly quoted.

      Kevin

      PS - On a note unrelated to the story but related to your attitude. Nothing in this world is more annoying than an American atheist ... and their dogmatic approach appears to have leapt the pond as well.

    8. Re:please, please ... by irenaeous · · Score: 4, Insightful

      anyone who puts religious convictions or beliefs higher than their science, are not worthy of any scientific post. royal society did the right thing.

      Please RTFA. By your standard, the royal society did not do the right thing, because the professor did not advocate, putting his, "religious convictions or beliefs higher" than science. He clearly stated in his original article that creationism or intelligent design where not scientific viewpoints and should not be taught as such. He was misquoted.

    9. Re:please, please ... by Anonymous Coward · · Score: 5, Insightful

      1.) This man didn't put religious belief higher than science. He just said it should be taught in school rather than ignored, but still taught in a way that promotes the theory of evolution as a science, and creationism as a religious belief not founded on logic and empirical evidence. He didn't want to waste hours on end talking about creationism--he just wanted to explain WHY its not science. Nor did he want to profess it was right.

      This is why philosophy should be taught (again) at the high school level. Creationism, intelligent design, etc., are important topics for any introduction to philosophy class. And when they are taught in a philosophy class, they actually promote critical thinking. On the other hand, when they are taught as an alternative in a science class, they only promote closed thinking.

    10. Re:please, please ... by NeutronCowboy · · Score: 2

      Except that the guy was saying exactly the right thing - that creationism is not science, and that science teachers need to be able to explain why creationism is not science.

      Someone is guaranteed to bring up the question about creationism in science class. The proper answer is a discussion about what science is, why creationism is not science and why it is better discussed in the context of social sciences and philosophies. This is the position Reiss advocated. I have no idea how people managed to contort that into something else.... unless the world is a lot more like Slashdot than I care to think.

      --
      Those who can, do. Those who can't, sue.
    11. Re:please, please ... by Cheesey · · Score: 4, Insightful

      But he didn't do that!

      He just said that science teachers should be free to discuss creationism, i.e. why it isn't science.

      The creationists couldn't have asked for a better outcome. They have always claimed that scientists "believe" in evolution as if it is was a religious faith, and that they won't tolerate criticism of their ideas or other beliefs. Scientists always said that was nonsense... and yet, now we have an example of a man who has been persecuted for speaking out of turn.

      The greatest threat to science isn't the creationists, but the armies of Dawkinsbots who defend "science" with fundamentalist fervour. If you're going to fight creationism, you have to stick to the facts, otherwise you're as irrational as they are.

      --
      >north
      You're an immobile computer, remember?
    12. Re:please, please ... by Bryansix · · Score: 2, Interesting

      Please Please yourself. This had nothing to do with religion. And you are just shooting yourself in the foot. The philosophers used to be in control back in the time or Aristotle and the scientists were ridiculed. Now that scientists are in control they ridicule philosophy. I'm quite tired of the whole thing. Both sides are big babies.

    13. Re:please, please ... by jlarocco · · Score: 4, Informative

      Sigh. Learn to fucking read.

      The guy's original article essentially boils down to: "If students ask about creationism, science teachers should explain why it's bullshit."

      What part of that do you disagree with?

    14. Re:please, please ... by uberjack · · Score: 0

      You'd say that, but what of people like Donald Knuth, who are devotedly religious? Whether they're worthy or not does not make their contribution any less significant.

    15. Re:please, please ... by uberjack · · Score: 0

      PS - On a note unrelated to the story but related to your attitude. Nothing in this world is more annoying than an American atheist ... and their dogmatic approach appears to have leapt the pond as well.

      That's the stupidest comment I've read so far. Last time I checked, Richard Dawkins was not American, and I don't know another atheist as outspoken as he is.

    16. Re:please, please ... by uberjack · · Score: 1, Funny

      Please Please yourself.

      No - please please me - whoa yeah!

    17. Re:please, please ... by agbinfo · · Score: 2, Insightful

      I want to agree with you. Your points make some sense. The problem I have is when I try to extrapolate from your arguments.

      You see, I was brought up in the Catholic faith so these belief don't seem that weird to me. Well, maybe they seem weird but I've grown used to them. But what about other religions? Should we teach about Eloims, Buddha, Flat Earth, Greek Gods? Maybe, but not in a science class.

      By the way, not wanting to listen to the same unsupported evidence doesn't make someone ignorant. It's more of a selective usage of one's personal time.

    18. Re:please, please ... by retchdog · · Score: 1

      Exactly. Science classes should not be dogmatic, but keep our minds forever voyaging, but within the bounds of reason and empirical data.

      It will eventually work out this way - creationism will take a limited foothold in the short term, and science education will respond decisively and embarrass it soundly. We're not doing creationism versus evolution; we're doing a watered-down creationism (which is still palpably absurd) against "science" classes with questions like this:

      The scientific method requires ______ (choose the most appropriate answer below).

      a. truth
      b. inquiry
      c. air
      d. pizza

      Except that I give too much credit; "truth" versus "inquiry" might give rise to critical thinking and an interesting discussion. Actually, choice (a.) would be something like "thermometers". Seriously, I "learned" what the scientific method is about fifty times in elementary school, not once even rubbing a balloon on a piece of wool or whatever. We crushed peppermint life savers once.

      And the political correctness around evolution (even at good colleges, the professors tend to pussy-foot around it; think about that!) is sickening. We need to pull this diseased slice of anachronism into the light, so we can crush it. That's messy work, but otherwise is just dishonest.

      "What is evil, but that which conspires to do good?"

      --
      "They were pure niggers." – Noam Chomsky
    19. Re:please, please ... by Anonymous Coward · · Score: 1, Interesting

      Nothing in this world is more annoying than an American atheist .

      The only reason you even know there are atheists in America is because the Christians are even more annoying than they are. In the US, there is literally no escape from religious influence in public life, and it's getting worse by the day.

      So you can expect atheists and other advocates of rationalism to become even more "annoying," to use your word.

    20. Re:please, please ... by The+Famous+Brett+Wat · · Score: 2, Insightful

      I agree with A.C. that philosophy is important for the development of critical thinking. I don't follow the bit about the teaching of alternatives in science as promoting closed-mindedness, though. How does that work? If you teach only the One Accepted Theory, this promotes open-mindedness? Seems backwards to me.

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    21. Re:please, please ... by atraintocry · · Score: 1

      I have very strong opinions in these matters, and I still have no reason to see this as anything other than a witch hunt. I don't know about his past performance, but if this was all over this one quote, it's a damn shame, because what he said was nowhere near "we should teach creationism in schools". It was more like "we should come up with good ways to show students why Creationism is not science, should they bring it up in class."

      This makes the Royal Society look bad, it makes British science in general look bad, and it makes any scientist trying to defend the theory of evolution looks bad.

    22. Re:please, please ... by PopeRatzo · · Score: 4, Funny

      Pressuring someone to resign because they mention the word "creationism"...

      Mentioning "creationism" when your in the Royal Academy of Science is not unlike mentioning "blowjob" at a meeting of the Evangelical Women's Association. It's a little more than a "slip of the tongue", and you might get asked to leave.

      --
      You are welcome on my lawn.
    23. Re:please, please ... by PopeRatzo · · Score: 2, Insightful

      Exactly right. It would be one thing if "creationism" meant discussing all of the worlds major creation myths. But that's absolutely not what they're talking about. It's the Christian view of Genesis. Period. As long as "creationism" means "Christian dogma" then it does not belong in any science curriculum.

      It's not like science teachers have all this extra time in their curriculum to be teaching things that don't have anything to do with science. You want to teach creationism? Do it in Sunday School. Not in any publicly funded education system. I don't know if the kids in the UK are beating the world when it comes to learning science, but I'm betting there are more important things science teachers might be covering.

      --
      You are welcome on my lawn.
    24. Re:please, please ... by PopeRatzo · · Score: 1

      his experience had led him to believe it was more effective to include discussion about creationism alongside scientific theories such as the Big Bang and evolution

      So, kids in the UK are doing so well in physics and biology, and they've got so much excess class time that they should bring up a topic that has absolutely no basis in science? I'm sure the members of the Royal Society are horrified by the lack of comity shown to Mr. Reiss, but he sounds like a bit of a tool to me.

      --
      You are welcome on my lawn.
    25. Re:please, please ... by PopeRatzo · · Score: 1, Insightful

      The man said that if Creationism is raised in class by a student it should be dealt with there as a teaching opportunity

      And if a student brings up what happens when you mix Mentos and Coca Cola in Modern European History it should be "dealt with as a teaching opportunity"?

      There are better ways to teach the scientific method than discussing Christian theology, and they won't result in wasting a day's class time arguing over religion.

      Maybe this Reiss guy had good intentions, but you cannot let the nose of religious fanaticism into the tent of science. Maybe one teacher would make a good example of how not to think scientifically, but another just might try to use it to proselytize.

      --
      You are welcome on my lawn.
    26. Re:please, please ... by n2art2 · · Score: 1

      your silly. . . everyone well knows that blowjobs are just fine, as long as in the confines of marriage. Never heard of the undefiled marriage bed? Seriously.

      --
      Self proclaimed wannabe geek. You know how it is. Most of us who read this stuff probably fit in that category.
    27. Re:please, please ... by PopeRatzo · · Score: 3, Funny

      Nothing in this world is more annoying than an American atheist

      Clearly, you've never met a Missouri fundamentalist.

      --
      You are welcome on my lawn.
    28. Re:please, please ... by PopeRatzo · · Score: 1

      It will eventually work out this way - creationism will take a limited foothold in the short term, and science education will respond decisively and embarrass it soundly.

      You mean the way civil liberties eventually took hold in fundamentalist islamic society? No, bro. The good guys do not always win. How many generations do we have to sacrifice to religious fanatics?

      --
      You are welcome on my lawn.
    29. Re:please, please ... by LowlyWorm · · Score: 1

      I have no objection to philosophy being taught in high school. Both religion and science derive from philosophy. Religion is a branch of metaphysics and science is a branch of empiricism. If it is taught that way that is fine with me. I just don't want the two confused.

      --
      Time flies like an arrow. Fruit flies like a banana.
    30. Re:please, please ... by PopeRatzo · · Score: 4, Insightful

      Now that scientists are in control they ridicule philosophy.

      David Hume is philosophy. Kierkegaard is philosophy. Plato is philosophy.

      Religion is not philosophy, it's superstition.

      --
      You are welcome on my lawn.
    31. Re:please, please ... by retchdog · · Score: 1

      The good guys don't always win, but the status quo sucks and we're sacrificing (part of) a generation right now. The Dawkins-crusaders aren't doing much, and the "Brights" movement smacks of a populist MENSA: all of the arrogance, with no entrance requirement. Any ideas?

      Xian fundamentalism isn't going away without something happening (whether or to what extent it was engineered by a Republican alliance is irrelevant now); and finally, the equation of fundamentalist USian Xianity (2x offensive abbreviation combo!) with Islamic fundamentalism is tired & ridiculous.

      I suspect that the real story behind this ID thing is that the Republican interest (the real players are as agnostic as the rest of us) in this is really in disgracing the Department of Education. If we get the government teaching religion, it legitimizes opposition to yet another government program.

      --
      "They were pure niggers." – Noam Chomsky
    32. Re:please, please ... by PopeRatzo · · Score: 4, Insightful

      Further, Confucius is philosophy, Lao Tzu is philosophy. The teachings of Jesus Christ are philosophy, but modern day fundamentalist Christianity has as much to do with the teachings of Jesus as the modern day Republican Party has to do with the ideas of Thomas Jefferson or James Madison.

      --
      You are welcome on my lawn.
    33. Re:please, please ... by Anonymous Coward · · Score: 0

      Posting anonymously for obvious reasons, and please, I'm not just trolling...

      But seriously, why put faith in "facts"? Why must Scientific Method be the judge by which all truth is based upon?

      Serious replies only please.

    34. Re:please, please ... by Cassius+Corodes · · Score: 1

      Depends - often there is little point teaching alternatives if there are no good ones. Science is not a good place for this as all the low level stuff that children would be learning are solid - a subject like politics is more suitable for that, where there are different core philosophies.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    35. Re:please, please ... by Cassius+Corodes · · Score: 4, Insightful

      I've never read Confucius or Lao Tzu, but the teachings of Jesus are not philosophy, as the philosophers would have know it, as it contains no reasoning. Its loosely metaphysics.. or perhaps a system of values.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    36. Re:please, please ... by hierofalcon · · Score: 1

      I'm a Christian. Let me be one of the first Christians in this thread to say that Creationism (or its hideous offshoot Intelligent Design) should not be taught in science class. The teachers do have too much to do to get bogged down in debates. There are a couple of conditions though.

      1. Clearly identify evolution as a theory of scientists that explains the facts as they see it.
      2. In the literature classes where the "world's major creation myths" as you put it are described, be sure to include Christianity. You see, one of the reasons Christians get so fed up with the school system is any world religion can be discussed with the exception of Christianity. You can talk about American Indians and their beliefs in grade school. You can talk about Muslims, Hindus, Buddhists and their beliefs in the middle grades studying geography or cultural studies. You can study Greek, Roman, and Egyptian creation myths and the whole pantheon of their gods and goddesses in various literature classes. More than that, you have to memorize the facts about them and regurgitate them for a grade. But you can't discuss Christianity or some atheist will be up in arms suing the school district.

      Separation of church and state sounds good in theory, but what it really boils down to is exclusion of Christianity, just because it happens to be the majority religion at the moment. All other peoples and their belief systems are OK to study under the context of broadening the mind and multi-culturalism. Just don't let the mind of any kid who isn't fortunate enough to go to Sunday School get his or her mind broadened to include Christianity. That would be a violation of church and state, for heaven's sake.

      And before you lump me in with the crowd who says the earth was created a few thousand years ago, I would go on record that you won't find that anywhere in the Bible. I've argued the subject recently and won't repeat myself here.

    37. Re:please, please ... by msuarezalvarez · · Score: 1

      How else are you proposing the judge the veracity of statements? Wait for signals from imaginary friends?

    38. Re:please, please ... by Anonymous Coward · · Score: 0

      It's not quite that simple, though. As pretty much everyone knows, creationism and evolution are not at odds--they are two completely non-overlapping concepts. Science teachers are trained in science and hired on their ability to communicate it. They could be (and probably are) terrible teaching comparative religions. Not their job. Shouldn't be, either.

      So the proposal was that science teachers discuss a topic for which they are totally untrained and in all likelihood unable to communicate effectively. And how would this be good for education?

      Furthermore, by devoting time for non-science questions in a science classroom, you reduce the amount of time actually spent on science. Get your kids to ask enough questions and you've got yourself a denial-of-service on science.

      I don't disagree that kids shouldn't learn about creationism--they just shouldn't learn about it in science class. I attended public schools in the US in the 1980's and read Genesis in class. There's no reason why I shouldn't have. It was in English class, and we read it as background material for later literature, which was a totally appropriate context for it. My English teacher even taught Sunday school so he was able to provide traditional interpretations of some of the contradictions. Great class, but not even remotely science.

    39. Re:please, please ... by Anonymous Coward · · Score: 0

      how does teaching "creationism, intelligent design, etc." in a science room "only promote closed thinking" yet teaching survival of the fittest, evolution, etc. not promote the same thing? Please keep in mind that while many people credit Darwin with the theory of evolution, he was, at the same time, as a firm believer in creationism.

      "There is grandeur in this view of life, with its several powers, having been originally breathed by the Creator into a few forms or into one; and that, whilst this planet has gone cycling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being evolved"

    40. Re:please, please ... by TheLink · · Score: 1

      Usually saying "Your religious beliefs are bullshit" is counterproductive to teaching.

      It boils down to if students mention creationism, science teachers should still figure out how to teach them the scientific way (e.g. evolution etc). People can hold two (or more) ideas in their head. Forcing them to decide between their religious beliefs and science in 50 minutes is not a good approach.

      Also attacking students for their beliefs, is not very productive and a waste. People who think that students won't be attacked for their beliefs can take the example of Professor Reiss himself.

      Professor Reiss himself has proven there is a problem with fervent anti-creationists.

      They deal out fatwas without even examining the evidence.

      What a waste - Reiss obviously understands how to teach people. In contrast the Dawkins bunch might win more arguments but win less people.

      --
    41. Re:please, please ... by Rary · · Score: 3, Insightful

      The man said that if Creationism is raised in class by a student it should be dealt with there as a teaching opportunity

      And if a student brings up what happens when you mix Mentos and Coca Cola in Modern European History it should be "dealt with as a teaching opportunity"?

      Only if the mixing of Mentos and Coca Cola is part of an already enormous and still growing movement which is constantly butting heads with historians.

      The fact of the matter is that the Creationism/ID juggernaut is here, and like it or not, it's influencing political, scientific, and religious discourse. Science teachers who ignore it are not doing their students any favours. Right now they have students in their classes who are being taught by their parents and their religious leaders to ignore what their teachers say, because those teachers are godless heathens who "believe" in this Darwinist cult which attacks the foundations of The One True Religion.

      These teachers can pretend it's not happening, and their students will learn nothing, or they can address it, and use it as a vehicle to teach the scientific method.

      Your Mentos example is silly, as is any talk of the FSM, or other creation myths, simply because Creationism/ID is, unfortunately, a special case. That's reality. Ignoring it won't fix it. Talking about it might.

      --

      "You cannot simultaneously prevent and prepare for war." -- Albert Einstein

    42. Re:please, please ... by A+non-mouse+Coward · · Score: 1

      This is why philosophy should be taught (again) at the high school level.

      Do you know how to get the Philosophy PhD off of your doorstep?
      Pay him for the pizza!
      <rimshot>

      --
      libertarian: (n) socially liberal, financially conservative; neither left, nor right.
    43. Re:please, please ... by Anonymous Coward · · Score: 0

      The good guys do not always win.

      Who says the fight is over?

    44. Re:please, please ... by fastest+fascist · · Score: 2, Insightful

      Except there was no suggestion to teach them as alternatives, just to discuss creationism if it should come up, in order to clarify the difference between an item of religious belief and a scientific theory.

    45. Re:please, please ... by TheLink · · Score: 2, Insightful

      Well I think Reiss has proven that there is a high chance of people going crazy just because someone says "creationism" in the context of "classroom".

      So his concerns are demonstrably valid.

      His opinion is it should be dealt with rather than dismissed outright. I do not think he should have to lose his position just because of that.

      Pity the fervent atheists declared fatwas on him, and kept saying he called for the teaching of creationism in the classroom, despite evidence to the contrary. Talk about faith vs evidence based ;).

      --
    46. Re:please, please ... by The+Famous+Brett+Wat · · Score: 3, Insightful

      Well, that makes it sound like, "open-mindedness has its place, but the scientific elite will decide under what circumstances it's allowed -- and that will generally be in areas other than science, since science has a Method for determining whether alternatives are good or not, and bad science is not allowed." There's nothing wrong with that as such, but (a) it's not exactly a thorough endorsement of open-mindedness (it's like the Chinese promotion of "freedom" and "democracy", which are fine so long as they don't upset the status quo), and (b) it sounds a lot like a priesthood deciding which ideas are heretical, and I thought people didn't like that kind of thing thanks to the Galileo incident.

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    47. Re:please, please ... by Cassius+Corodes · · Score: 1

      Ok - there is no scientific elite (I guess Nobel prize winners might be the "elite" but what they say is not taken as gospel), nor hierarchy - its a distributed system, that operates on consensus. There is no central system or "high scientists" that define what science is currently "accepted". What children get taught are not the cutting edge of science either - they are taught things that we have known for a long time, and have survived challenges. The places where you would start to encounter real scientific uncertainty would be at 2nd or 3rd year level at university. So until then there is no real need to talk about "alternative theories".

      What teacher should do is to encourage students to challenge them for proof - my fondest memories of science class in high school was when the teacher would be asked to prove something, and he would make an experiment to prove it to us. This has both education value, and encourages evidence based thinking.

      I am not sure how what I have said in post above made you think that it resembles the Chinese government!

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    48. Re:please, please ... by jimicus · · Score: 3, Insightful

      So, kids in the UK are doing so well in physics and biology, and they've got so much excess class time that they should bring up a topic that has absolutely no basis in science? I'm sure the members of the Royal Society are horrified by the lack of comity shown to Mr. Reiss, but he sounds like a bit of a tool to me.

      Are you a troll or do you honestly have no idea of what the original gist of Mr. Reiss' remarks were before they were misquoted?

      I'll spell it out for you nice and slowly, paraphrasing to make it easier to understand:

      "If a pupil says to their science teacher "Evolution is wrong because it's not in the bible", the science teacher should not say "You're wrong. End of discussion. Next subject...". Instead, the science teacher should explain that the whole point of science is to try and explain things on the basis of available evidence rather than just taking someones' word for it (which is essentially what "faith" means) as the final answer to any questions one might have - and if new evidence which breaks your explanation comes to light, you accept that your explanation was wrong and try and alter it (or even completely rewrite it) to fit the newly discovered evidence."

    49. Re:please, please ... by khanyisa · · Score: 1

      You didn't read what he actually said them. He didn't say they should be taught as acceptable alternatives, he said they should be discussed critically.

    50. Re:please, please ... by khanyisa · · Score: 1

      He was saying they should bring up the topic because about 10% of the kids in the class believe in creationism. So you should rather engage in critical discussion than just ignore them.

      He is an evolutionist. Him being pressured to resign is ridiculous, and largely due to people assuming he meant something different to what he said because he is an Anglican minister. That's called discrimination.

    51. Re:please, please ... by jdfox · · Score: 1
      The teachings of Jesus Christ are not merely philosophy:

      "I am the bread of life."

      "I am the light of the world."

      "It is not I alone who judge, but I and the Father who sent me."

      "Jesus said to him, "I am the way, the truth, and the life. No one comes to the Father except through me."

      Etcetera. Jesus wasn't handing out philosophical advice on how to live, like Confucius or Lao Tzu. The fact that many fundamentalists have got his teaching all wrong doesn't change the fact that Jesus clearly proclaimed himself Messiah and Savior.

    52. Re:please, please ... by khanyisa · · Score: 1

      And which of you by being anxious can add a single hour to his span of life? If then you are not able to do as small a thing as that, why are you anxious about the rest?

      (Luke 12:25)

      It may not be pure reasoning on the lines of Greek philosophy, but it does contain reasoning.

    53. Re:please, please ... by unity100 · · Score: 1

      its the same as saying nazizm should be allowed as an ideology. because, its just an ideology.

      stuff starts that way. if creationism is even 'discussed' at schools, it gives a bonus to the segments of the society who are trying to brainwash kids with it. +5 to persuasion, for it was also in school, so it should be credible.

    54. Re:please, please ... by unity100 · · Score: 1

      jesus of nazareth says that there is a single 'god' entity, it sent him as its ambassador, and it asks you to obey some rules. thats no philosophy.

    55. Re:please, please ... by unity100 · · Score: 1

      being free to discuss something opens up possibilities for many points of view, in which there would be a noticeable number of teachers who would express favorable views of creationism. which would be little different than letting them teach it.

    56. Re:please, please ... by unity100 · · Score: 1

      what about a good number of teachers who would express positive views of creationism when the topic is brought up ?

    57. Re:please, please ... by extrasolar · · Score: 1

      Wrong. Confucius is religion. Lao Tzu is religion. Preaching ethics and/or living a life of mystical resignation doesn't, on it's own, make for philosophy. Philosophy is, at the very least, argumentative: it doesn't hold any truths as just obvious.

      Now, it's possible to say that Confucius, Lau Tzu, and Jesus Christ all represent philosophers, but this use of 'philosophy' is in a much looser sense. But, in this loose sense of the term 'philosophy' it is no longer incompatible with religion.

    58. Re:please, please ... by extrasolar · · Score: 1

      Usually saying "Your religious beliefs are bullshit" is counterproductive to teaching.

      This is true; however the main problem is that 'faith' is counterproductive to learning.

      First, I assume you understand what hyperbole means and how it is being used in the post you're responding to as a rhetorical device. He doesn't literally want to call people's religious beliefs bullshit.

      But, if the weight of the evidence shoes that a certain religious belief is false, or most probably false, then it isn't doing students any favor to hide that evidence.

    59. Re:please, please ... by Cassius+Corodes · · Score: 1

      True enough. I stand corrected.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    60. Re:please, please ... by Anonymous Coward · · Score: 0

      Creationism, intelligent design, etc., are important topics for any introduction to philosophy class.

      Except creationism's not really philosophy either.

    61. Re:please, please ... by adpsimpson · · Score: 1

      Insightful?

      Good grief, have you even read what Prof Reiss said? The exact words were:

      Teachers should be in a position to explain why evolution is a sound scientific theory and why creationism is not, in any way, scientific.

      In other words, science teachers should respectfully explain what science is, and is not, all about.

      Hardly looks sackable in context, does it?

      --
      Is crushing a suspect's child's testicles illegal?
      John Yoo: "No, [if] the President thinks he needs to do that."
    62. Re:please, please ... by Anonymous Coward · · Score: 0

      It's not about dogma, it's about efficient use of classroom time. It's about science teachers that shouldn't be wasting their time refuting every single fabricated piece of ID-pseudofact. Accepting pseudofacts and treating them on the same level as facts would give a very wrong signal and open a dangerous door.
      In theory anything should be discussable in science class, but when there's already such a huge pile of evidence stacked against ID it's an exercise in futility. ergo waste of time.

    63. Re:please, please ... by TempeTerra · · Score: 1

      I don't follow the bit about the teaching of alternatives in science as promoting closed-mindedness, though.

      Teaching about alternative scientific theories in science isn't a problem (although my teachers at school said they stuck to the accepted theory because they didn't want to muddy the waters for the students who were struggling with the material, but I digress), teaching an alternative to science, in science class is a problem.

      Scientific enquiry is about figuring out which idea is right based on evidence; an alternative to science by definition ignores or dilutes evidence based reasoning (because the alternative didn't, it would be simply another branch of science). The rejection of evidence based reasoning would be the closed-mindedness in question.

      --
      .evom ton seod gis eht
    64. Re:please, please ... by Anonymous Coward · · Score: 0

      Hey dude, there a few dozen ancient Greek philosophers outside who want to talk to you. They seem pretty pissed.

    65. Re:please, please ... by agbinfo · · Score: 1

      I'm a Christian. Let me be one of the first Christians in this thread to say that Creationism (or its hideous offshoot Intelligent Design) should not be taught in science class. The teachers do have too much to do to get bogged down in debates.

      That's a good start.

      There are a couple of conditions though.

      • Clearly identify evolution as a theory of scientists that explains the facts as they see it.

      Why? Should that be done every time a broadly accepted theory is discussed or only where there are religious opinions that claim different?

      When I was in school, I don't remember the teachers making a pause after each theory to say that this was the best theory so far. Should it be different for the theory of evolution or do you want this to be explained for electricity and cooking classes as well?

      • In the literature classes where the "world's major creation myths" as you put it are described, be sure to include Christianity. You see, one of the reasons Christians get so fed up with the school system is any world religion can be discussed with the exception of Christianity. You can talk about American Indians and their beliefs in grade school. You can talk about Muslims, Hindus, Buddhists and their beliefs in the middle grades studying geography or cultural studies. You can study Greek, Roman, and Egyptian creation myths and the whole pantheon of their gods and goddesses in various literature classes. More than that, you have to memorize the facts about them and regurgitate them for a grade. But you can't discuss Christianity or some atheist will be up in arms suing the school district.

      I'm not American so I don't know what is taught in the US literature classes. I agree with you on that one. Christianity should not be ignored or take a back seat.

      ... Just don't let the mind of any kid who isn't fortunate enough to go to Sunday School get his or her mind broadened to include Christianity. That would be a violation of church and state, for heaven's sake.

      Yes it is. If you do it to expose children to your religious beliefs then school is not the place.

      And before you lump me in with the crowd who says the earth was created a few thousand years ago, I would go on record that you won't find that anywhere in the Bible. I've argued the subject recently and won't repeat myself here.

      The problem with the Bible is that you'll use it to support your claims when it's convenient. Sometimes it's what the preacher said, sometimes the Pope or some other authority. In my opinion, saying that the Bible says "such and such is true" to support your faith cannot be considered serious unless you are willing to defend the whole of it.

    66. Re:please, please ... by hierofalcon · · Score: 1

      Evolution as theory..: I happen to like science a lot - got straight A's - it was neat. But the thing about evolution is that you can't conduct an experiment to prove it. You can show species adaptation to an environment. You can show from fossil records that horses have changed sizes from the past to today. You can show lots of things. But you can't show total evolution from one critter to another significantly more advanced critter. You also can't show, via the fossil record, that evolution from one species to a completely different thing occurred. It may or may not have happened, but it wasn't directly observed by anyone present today. People are just proposing their theories based on what they think the fossil record says because they won't accept any other way to explain what they see. I think the disclaimer should be made any time there isn't a directly observable result that can be reproduced today. Not every country is going to have a super-collider and I'm willing to accept research going on elsewhere in the world as sufficient to not require the claim for every theory expressed. But evolution requires way too much faith to accept without qualifications.

      I don't feel that school is the place for religious beliefs to be taught. They should be taught in a religious setting or at home by the family. However, the reality in U.S. public education is that you hear of the religious beliefs of the American Indian, you are exposed to each of the major faiths (mostly as cultural events as peoples but always with some religious information as well) and you are exposed to all of the Greek mythology with their gods, et cetera along with their creation stories. This is called literature.

      Yet Christianity can't be discussed. If they are going to allow some, they should allow all, equally. The trouble is there is never enough time to allow all, because there are so many around the world. So I'd be fine with none. That may not be uniform across the entire country, but it was what I experienced.

      I don't have a problem with my kids being exposed to other religions. It is good to be aware of what is out there in the world. It helps to understand where other people are coming from. But when, at the same time, they are told that they can't even invite someone to a church Christmas program during recess because we can't have anyone talking about God I get frustrated. That's the dichotomy Christians face all around the country today. Can't offend anyone by mentioning anything about God at school, but better know the right answers about Zeus to pass your English literature exam. It is all right to expose kids to other people's religious beliefs. Just not the majority belief. It's ridiculous!

      The Bible stands by itself. I do defend the whole of it. I am not a Greek or Hebrew scholar, so I have to take it based on a translation I can read, and there are times that some parts are hurt by the translation process. Some parts aren't particularly popular today, but overall I try to understand it myself with the help of any study aids I find useful. I also don't claim that the preservation process was 100% successful. The Hebrew writing system had lots of jots and tittles that sometimes were lost but which changed numbers slightly so there are places that the best translation from the surviving bits of manuscript give slightly different results in different places. What the preacher, Pope, or anyone else says is fine if it appears to line up with what the Bible says. Otherwise, I ignore it. There are parts of prophecy that I don't fully understand and that was true for those who heard prophecies that have already come about. It is easy to look back and say - well that was clearly what was meant there because it all links together now that the prophecy is fulfilled. Looking forward isn't always so easy. There is also a lot of figurative language in prophecy where the prophet tried to explain what he was seeing as best he could using the words he knew. If we were to see the same things today, we might explain them diff

    67. Re:please, please ... by Bryansix · · Score: 1

      That's not my point. My point is philosophy is where the teleological argument comes from and a myriad of others. But now one man says we should answer Creationists with facts from science and the Scientists hate philosophy SO much that even mention of something that is one degree away from a philosophical principle makes them go coo coo for coco puffs and force the guy to quit.

    68. Re:please, please ... by franz · · Score: 1

      ... the whole point of science is to try and explain things on the basis of available evidence rather than just taking someones' word for it (which is essentially what "faith" means)

      Your words, not those of Prof. Reiss, I take it. And a common theme among the disciples of Dawkins. But that is not essentially what faith means, and I don't see how someone who says so can even have begun to engage with religious thought in any significant way.

    69. Re:please, please ... by jimicus · · Score: 1

      Your words, not those of Prof. Reiss, I take it. And a common theme among the disciples of Dawkins. But that is not essentially what faith means, and I don't see how someone who says so can even have begun to engage with religious thought in any significant way.

      I did say I was paraphrasing ;)

      Faith: Mental acceptance of and confidence in a claim as truth without proof supporting the claim.

      How exactly is that radically different from "taking someone's word for it"?

      You may interpret "faith in God" to imply that one believes in the bible and strives to follow the ideas expressed in it, but I'm talking about the word "faith", not "what having faith in a particular religious belief further implies".

    70. Re:please, please ... by jeephistorian · · Score: 1

      Amen!

      Wait...

      --
      Huh?
    71. Re:please, please ... by The+Famous+Brett+Wat · · Score: 1

      Ok - there is no scientific elite (I guess Nobel prize winners might be the "elite" but what they say is not taken as gospel), nor hierarchy - its a distributed system, that operates on consensus. There is no central system or "high scientists" that define what science is currently "accepted".

      There's no scientific pope, no. There are, however, scientists in highly influential positions. There are those who influence which papers get published in their prestigious journals or conferences. There are those who make policy decisions regarding research in leading institutions. And the whole field is fraught with politics: if you hold a position of responsibility in science and make a public remark that might be construed as sympathetic to creationists (even if it isn't, actually), people will be howling for your resignation within hours. That's what I'm talking about when I speak of the scientific elite. I don't even mean "clever scientists" -- I mean people of influence in scientific circles, regardless of how that influence is achieved.

      Oh, and "consensus, my arse." Consensus is de facto after the fact. If you manage to get a particular theory taught to the exclusion of others, or if you get to decide which research programme will be funded, you can be pretty sure that consensus will follow. We have consensus among scientists that evolution is a fact because everyone who thinks otherwise has been branded a non-scientist, even to the extent that saying something about creationism that isn't sufficiently harsh can be a career-limiting move.

      I am not sure how what I have said in post above made you think that it resembles the Chinese government!

      In short, the Chinese government is happy to allow ideas like capitalism, freedom of speech, and democracy only to the extent that they are compatible with the existing governmental regime, and that pretty much guts the concepts. You're happy to allow open discussion of matters in science class to the extent that it fits within the framework of currently acceptable scientific practice. Neither you nor the Chinese government will allow the kind of talk that leads to revolution. For China, the present style of government is government, and everything else is anti-government. (Actually, I'm probably being unfair when I single out China here. Think about it.) For you, the present style of science is science, and everything else is non-science or anti-science. China allows freedom of speech so long as it's pro-government, and you're happy with discussion in the science class so long as it's pro-science. One must not challenge the status quo in either case.

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    72. Re:please, please ... by The+Famous+Brett+Wat · · Score: 1

      Scientific enquiry is about figuring out which idea is right based on evidence; an alternative to science by definition ignores or dilutes evidence based reasoning (because the alternative didn't, it would be simply another branch of science). The rejection of evidence based reasoning would be the closed-mindedness in question.

      The argument over whether the Earth moves or not was conducted on both sides by evidence-based reasoning. Galileo was opposed not only by the church, but also by the scientists of his day. Science had well-established and accepted reasons for concluding that the Earth did not move, based in physical evidence. If there's a Galileo around today, we almost certainly think of him as a crank -- we probably call him a "flat-earther" for his ridiculous views, although he's probably invented something useful.

      My point is that even a creationist can use evidence-based reasoning, but you would simply reject his interpretation of the evidence in the same way that Copernicanism was rejected for so long. There was evidence, and there was reasoning, but it was considered inferior by the mainstream. Then there was a political watershed (what Kuhn calls a "paradigm shift"), and the motion of the Earth became the popular view. The shoe is now officially on the other foot, and anyone who presents the old arguments against the movement of the Earth is considered to hold an unscientific view, regardless of the empirical and rational content.

      Summary: science is not simply evidence-based reasoning, because there's plenty of evidence-based reasoning not tolerated by modern science. (There's also quite a bit of science not based on evidence (e.g. "thought experiments"), but that's a different story.)

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    73. Re:please, please ... by Cassius+Corodes · · Score: 1

      Well I have to disagree, scientists and researchers who have tenure are free to do or say as they will. They don't have to subscribe to the consensus, and science in replete with stories of scientists who have been ignored or chose to research something that contradicts the mainstream, and emerging victorious after completing a persuasive study. They were right to be ignored at the start (extraordinary claims require extraordinary evidence - comparable to inertia) and right to be recognised after that have compiled enough evidence.

      As for peer reviewed papers, on 90% of journals the people who do peer review are those who were accepted the previous edition. There isn't a constant group of people that could act as some sort of cabal. The people who make policy decisions are usually not (unfortunately) scientists - they are politicians, businessmen or bureaucrats and their behaviour is governed by different rules.

      I suspect that this whole questioning of the science world is a result of your disagreement with the consensus surrounding evolution. It angers me that you have such an ego that you would rather believe the whole world wrong than that you are misinformed.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    74. Re:please, please ... by The+Famous+Brett+Wat · · Score: 1

      Well I have to disagree, scientists and researchers who have tenure are free to do or say as they will. They don't have to subscribe to the consensus, and science in replete with stories of scientists who have been ignored or chose to research something that contradicts the mainstream, and emerging victorious after completing a persuasive study.

      You have such an optimistic view of the process. In order to qualify for tenure (where it exists), one must have a significant degree of academic success as measured by publications, citations, and successful grant applications, so those who obtain tenure do so by having largely told the scientific world what it wants to hear. Some have the patience to achieve tenure before they pursue their crackpot ideas, and some even succeed in having their ideas accepted, but the process can hardly be said to encourage radical thinking. Naturally radical thinkers are, to use the evolutionary term, at a significant selective disadvantage.

      Some of the great names in science have only been recognised as such posthumously: Mendel springs first to mind; Copernicus follows. God only knows how many great thinkers we have lost because their work was obscure at the time and then forgotten completely.

      As for peer reviewed papers, on 90% of journals the people who do peer review are those who were accepted the previous edition.

      Thus promoting "groupthink". It's not a cabal, no, but it is quite resilient to ideas outside the mainstream even so. If you want to get a paper published, look at the kinds of papers that have been accepted in the past and produce something like that.

      I suspect that this whole questioning of the science world is a result of your disagreement with the consensus surrounding evolution.

      And I suspect that your rosy view of science indicates that you really like the status quo, but that's irrelevant. Rational discourse demands that I focus on the actual content of your argument, not your motives for holding the position in the first place (cf. Bulverism).

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    75. Re:please, please ... by Cassius+Corodes · · Score: 1

      I don't think there is much more to say. While you say I have an optimistic view of the process, I say you have a pessimistic view of the process.

      How would you make it better?

      Any system that you design will have to have some sort of positive weight being placed on ideas that are supported by other accepted ideas, and conversely negative weight on ideas that are contrary to accepted view. This is true of almost any system you can think of as it is the most efficient way of making progress. Yes there is a loss on occasion of some good ideas that are too radical for its time, but that is offset by the fact that incrementally it is reached in due time.

      So in no way is the system broken, over time it has been finely tuned to get the best outcome.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    76. Re:please, please ... by The+Famous+Brett+Wat · · Score: 1

      How would you make it better?

      I promote Feyerabend's "scientific anarchy".

      Yes there is a loss on occasion of some good ideas that are too radical for its time, but that is offset by the fact that incrementally it is reached in due time.

      That is an enormous, sweeping claim. Go write a book to defend that point of view. Be sure to address the issues already identified by Feyerabend in Against Method, since it offers a ready-made counter-argument.

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    77. Re:please, please ... by TempeTerra · · Score: 1

      So you're saying that as a practical matter, even evidence-based reasoning is rejected if it's unpopular? That's true, and I'm acquainted with Kuhn, although it's been a few years. The change from geocentric to heliocentric cosmology is very interesting but it was a change from old science to new science, with plenty of politicking and shennanigans thrown in.

      I suppose you're talking about the scientific establishment, where I'm talking about the scientific ideal the establishment tries to live up to (I admit I was being sloppy by over-simplifying science as being merely evidence-based reasoning).

      What were we talking about again? Teaching alternative theories in science class. Some statements:

      1. Science class in school is, sadly, where students learn about the results of science rather than how to do science
      2. It would be good to teach about how scientific theories are developed
      3. It would be good to teach about competition between scientific theories
      4. It would be good to teach about heuristics used to decide which theories to develop (see cold fusion)
      5. It would be good to teach about the difference between scientific theories and pseudoscience
      6. It would be bad to teach that pseudoscience is valid competition to science
      7. It would be bad to teach that pseudoscience is a useful alternative to science

      I think that would work out fine as a module in a school science curriculum rather than a university philosphy course where I learned it.

      ---------------------

      Now that polite discussion is out of the way; ...but you would simply reject [a creationist's] interpretation of the evidence in the same way that Copernicanism was rejected for so long.

      Thanks for pigeonholing me, I won't feel bad about returning the favour.

      let's talk about these creationists and their hypothetical evidence based reasoning. Straight up: do you believe that creationism is a valid alternative to evolution, or are you just playing around? I claim that creationism (specifically the modern YEC movement) is unscientific, is not evidence based, is thinly veiled Christian literalist dogma and has no place being taught in schools except as an example of the opposite of a good idea. Disagree with that?

      A creationist could argue from evidence in a scientific manner, and should be listened to if they do. I'm sure old earth creationists can work productively and even brilliantly in most scientific fields - but how would they make an evidence-based argument about creationism? The qualities of good scientific theories, parsimony and predictive power, are cast aside; the usual evidence is 'The Bible' (appeal to privileged authority) and above all it is unfalsifiable. If you've studied Kuhn rather than a reading potted summary that shouldn't be incomprehensible jargon, but I suspect there's been an essay passed around in creationist circles which mentions Kuhn and paradigm shifts without actually going into messy details, like how religious beliefs utterly fail as scientific theories.

      I'm very sorry if I've mistaken you for a creationist when you're not - my anti-creationism rant is on a hair trigger these days. Kuhn is very interesting, and I'm quite fascinated by the practicalities of doing good science in the face of politics, grants, popularity contests and marketing. I'm quite offended that his work is misrepresented by some creationists as an attack on the objectivity of science rather than an investigation into how scientists choose between plausibly competing scientific theories.

      As a matter of interest, what evidence-based reasoning is not tolerated by modern science and what do you mean by 'not tolerated' (was this just an allusion to creationism)? I know there are subjects such as cold fusion where there might be potential but the theory is currently out of favour because of lack of results/scientific misconduct. This seems reasonable to me on the grounds that 1. other more promising leads are being followed 2. if any actual results arise I expect the mainstream science to eagerly adopt the theory.

      --
      .evom ton seod gis eht
    78. Re:please, please ... by Anonymous Coward · · Score: 0

      If you read all of Reiss's writings you will find that while he may have been misquoted, his life to date has been trying to pervert science with pseudo-science to support his religious beliefs.

      It is entirely possible that he is just stupid, but he exhibits all the behaviors and talents of a political animal who knowingly makes a name for himself by courting the fairy-tale believers. Similarly all those making money selling creationist books. They are all laughing at you while taking your money. Its a good business, but its not the Royal Society.

      I suggest you do your research. Reading *one* article does not give you the entire picture.

    79. Re:please, please ... by Cassius+Corodes · · Score: 1
      I think how far we have come with science, and the exponential increase in scientific output makes my argument for me. As for Feyerabend all I needed to read was:

      advocates treating science as an ideology alongside others such as religion, magic and mythology, and considers the dominance of science in society authoritarian and unjustified

      When he is sick, he can go to a shaman, or a priest (after all they are just equal ideologies). I will go to a doctor.

      If you truly think that treating religion, mysticism and magic on the same level as science is a good idea then go to an Islamic country, or parts of Africa and see how life is there compared to here. We have got where we are because we have identified reason being better than faith and "mysticism".

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    80. Re:please, please ... by The+Famous+Brett+Wat · · Score: 1

      I suppose you're talking about the scientific establishment, where I'm talking about the scientific ideal the establishment tries to live up to.

      I'm a follower of Feyerabend's philosophy of science. I view the "scientific establishment" as a political force that primarily uses the "scientific ideal" as a means to exclude undesirables (creationists being a case in point) rather than a thing that they actively try to live up to. As Feyerabend points out in his book, Against Method, anyone who takes any formal scientific ideal seriously will wind up opposing scientific revolutions. Good science is not supplanted by better science: it is supplanted by different science. The old school firmly opposes the new because it sees the new as inferior, lacking the maturity and explanatory power of the old. Feyerabend's rule for science is "anything goes".

      What were we talking about again? Teaching alternative theories in science class.

      Sort of. The part of your message to which I responded was more about the distinction between science and non-science. You were saying that science is evidence-based reasoning (an oversimplification, and I'll let it slide since you recognise it as such -- some don't), but that things which weren't scientific shouldn't be taught in science. I think this is still where we have a point of disagreement, since I'm not going to lightly accept any such distinction. I say that science is the study of nature, not a method of studying nature.

      • It would be good to teach about the difference between scientific theories and pseudoscience
      • It would be bad to teach that pseudoscience is valid competition to science
      • It would be bad to teach that pseudoscience is a useful alternative to science

      I tend to disagree with these. "Pseudoscience" is a term used by the current scientific mainstream as a simple term of disparagement for methods other than their own. It promotes closed-mindedness with regards to method. What would be better is to show how different discoveries in science have required different methods and different kinds of reasoning. Also, show that scientific progress does not rest purely on the merits of the ideas themselves, but also on the rhetorical ability of the idea's promoter. Galileo was a case in point.

      This is probably too advanced a study for school, but it would be appropriate for anyone taking a science degree. However, nothing of the sort is taught anywhere that I know of. This comes as no surprise: the way that science is taught in school promotes "one true method" scientific thinking (in addition to giving a basic grounding in some current theories), and so people take it for granted that "science" involves a certain conduct, rather than being a field of study amenable to many methods. We definitely need to change the way we teach science at the school level in order to counteract this, and I think that change must necessarily offend the scientific mainstream, since it won't be sufficiently disparaging of "pseudoscience". Beyond that, I don't have detailed suggestions at this time.

      Straight up: do you believe that creationism is a valid alternative to evolution, or are you just playing around?

      It should be pretty clear by now that I do consider it a valid alternative. This should be clear on the basis that I am extremely liberal in what I will accept as "scientific". That's not to say that I have equal admiration for all scientific practice: far from it. I'm just opposed to the kind of ostracism that's being practised in scientific circles -- the whole "you have no place in my field, for you are not methodically acceptable" thing.

      I claim that creationism (specifically the modern YEC movement) is unscientific, is not evidence based, is thinly veiled Christian literalist dogma and has n

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
    81. Re:please, please ... by agbinfo · · Score: 1

      First, I make a distinction between science and culture. When teaching culture, and I consider literature to be a part of it, then it makes sense to teach some aspects of Christianity and other religious belief. In science classes, there's no reason to do so. If there are laws that say you can't mention Christianity in an English literature class, I don't believe there are, then that's wrong.

      I'd like to add that I'm not American so I can only judge the school system there from what I read and hear from others.

      Second, about the Bible. You can't be serious. Just look here and explain some of these inconsistencies.

    82. Re:please, please ... by hierofalcon · · Score: 1

      There's a lot there and I don't intend to wade through it all. If there are one or two items that particularly bother you, point them out and I may take a crack at an answer.

      You see, I've seen God's hand at work in the lives of people I know well. My wife had been to the doctor for a health problem that she had. It was visible. The doctor had verified the problem and directed her to a specialist. Before she went to the specialist, she went up and was prayed for and God healed her instantly. I know that she wasn't faking the illness just so I could write about it here. It was real, and her healing was real. The results were directly visible. Another person at the church was wheelchair bound for years and was prayed for and healed and walked away. I don't claim to know God's timing in why some prayers take longer than others to be answered, but once you've seen God's miraculous power work - and know that it was real - then all the silly jabs at inconsistencies in the Bible become really quite irrelevant. As I said in my last comment - the Bible does have a few inconsistencies due to mistranslation or fragmentation of the original texts. That is acknowledged. But in its main purpose, it is completely consistent. If you've never been in a setting where you see God move in a miraculous ways, then I can understand why you prefer to look with skepticism at the whole thing. Once you've seen God at work, it resets you heart.

      Did you ever wonder why there are never any lawsuits about the other religions being taught in school? Why don't atheists go after school systems that teach about the Greek gods or about Hinduism or Islam? Satan isn't worried about those religions because the power of God isn't present in them. He doesn't fear when others are led astray to religions he controls. But Christianity is actively opposed because he hates it when people draw close to the living God.

      I repeat - if you've never seen the hand of God work, it is easy to look at the few minor inconsistencies and reject everything. But when you do that, you are rejecting the basic message that the Bible is there to proclaim. God exists. Christ came to provide a sacrifice for sin. Everyone is a sinner and needs to accept that sacrifice for eternal life. The gift of salvation is free, but must be accepted. God is holy and sin separates you from God. Accepting the blood of Jesus as your sacrifice for sin is the only thing that is acceptable to God to have an eternal relationship with Him.

      Miracles and healings aren't done to make our lives better - although that is a nice side benefit. They are done to show that God is still working in His people today. I know that there are a lot of places where the church isn't very effective today. That is true both in the U.S. and around the world. But there are also places in each country where God is working miracles and moving in mighty ways. I can't compel anyone to go check them out, and I can assure you that there are a small number of staged events that are not real. But the genuine thing is happening as well. Seek God and He'll make himself real enough to you that your doubts will be erased forever.

      Best wishes

  6. Intellectuals are so right... by Anonymous Coward · · Score: -1, Troll

    The universe farted and presto, out we all came, purposeless beings.. you smart guys have it all figured out.

    1. Re:Intellectuals are so right... by RightSaidFred99 · · Score: 1

      I know. Everyone with any everyman common sense knows that a human looking super-being shit us out and cares about each of us individually. Those stupid int-eee-lec-tuuu-als think they know it all, don't they?

      I guess you can never lose by appealing to the moron's distrust of people smarter than him.

    2. Re:Intellectuals are so right... by onkelonkel · · Score: 1

      What evidence do you have that this is not the case?

      --
      None of them can see the clouds; The polished wings don't care.
    3. Re:Intellectuals are so right... by Curtman · · Score: 1

      Yeah, makes much more sense to think an omnipotent being (who's origin we shall not discuss) created us in order to serve him and telepathically announce our eternal servitude to him so we can live forever.

    4. Re:Intellectuals are so right... by Anonymous Coward · · Score: 0

      The universe farted and presto, out we all came, purposeless beings.. you smart guys have it all figured out.

      Assuming you aren't -1 flamebait in two seconds...

      you assert that 'god' gives us purpose then? ok, but that purpose would only be of any matter to a purposeless being, since god can't have a greater purpose since nothing gave him one.

      Oh what? God doesn't need anything to give him/her/it a purpose? Then neither do I. Piss off.

    5. Re:Intellectuals are so right... by CorporateSuit · · Score: 0, Troll

      Yeah, makes much more sense to think an omnipotent being (who's origin we shall not discuss) created us in order to serve him and telepathically announce our eternal servitude to him so we can live forever.

      You just described an evolutionist's understanding of DNA.

      --
      I am the richest astronaut ever to win the superbowl.
    6. Re:Intellectuals are so right... by Anonymous Coward · · Score: 0

      Scientists "preach" that true science is the observability, repeatablility and testability of the phenomena it seeks to explain. Yet scientists are still unable to create even a simple protocell directly from organic compounds. Show me evolution from the ground up to prove that life is not divine.

    7. Re:Intellectuals are so right... by Anonymous Coward · · Score: 0

      Please don't feed the troll. Anyone who actually believes in intelligent design would create a post much more coherent than this one. The goal of the person who wrote this was to get you all upset, the same way that people got mad at the Royal Society for using the phrases "Creationism" and "should be taught" in the same sentence.

      Or, if he's not purposely trolling, then you shouldn't pick on him the same way that you shouldn't pick on a 5-year-old who tries to make a post with the same sort of sarcastic wit that the big boys do on /.

    8. Re:Intellectuals are so right... by MeanderingMind · · Score: 2, Informative
      --
      Thunderclone: ONE MAN ENTERS! TWO MEN LEAVE! ONE MAN ENTERS! TWO MEN LEAVE!
    9. Re:Intellectuals are so right... by Curtman · · Score: 3, Funny

      You just described an evolutionist's understanding of DNA.

      I guess I must have missed the part on telepathy and omniscience.

    10. Re:Intellectuals are so right... by CorporateSuit · · Score: 1

      I guess I must have missed the part on telepathy and omniscience.

      Then you either have not studied evolution from an evolutionist, or never asked questions when you had the chance...

      --
      I am the richest astronaut ever to win the superbowl.
    11. Re:Intellectuals are so right... by Curtman · · Score: 1

      Then you either have not studied evolution from an evolutionist, or never asked questions when you had the chance...

      You really need to post a link. I have to see this.

    12. Re:Intellectuals are so right... by AshtangiMan · · Score: 1

      Evolutionary theory does not discount the possibility that the origins of life are divine. But since this is (as of yet) something that cannot be tested and proved or disproved it lies outside of the realm of science. Something can exist outside the realm of science and be true and valid. Sorry to feed the trolls . . .

    13. Re:Intellectuals are so right... by Anonymous Coward · · Score: 0

      I really do understand your comment. I find it very interesting that so called intellectuals, have no imagination beyond what can be immediately proven. If we are nothing but an accident, in a universe that came from who knows where. Why do we care about such things as global warming, etc. The universe doesn't care if we live our die, we are like virus, in pursuit of continued existence, but nothing more. sucky

    14. Re:Intellectuals are so right... by CorporateSuit · · Score: 1

      You really need to post a link. I have to see this.

      You don't "really need a link" to attend a university course in evolutionary biology.

      1. Look up university of your choice
      2. Enroll in course

      When I tell you that you obviously haven't studied it, I wasn't referring to reading something online. I was telling you to actually formally study it with someone you can address your questions to.

      If you want to skip this process (After all, who wants to look dumb by asking the emperor why he looks naked?), pick up "The Blind Watchmaker", as I'm sure any Richard-Dawkins-fellating philosopher will tell you is the greatest literary work of our time. Read on how DNA calculates, predicts, economically manages inherent "bio-credits", plans, adapts, and self-motivates to construct massive biological machines and places illusions into the inanimate elements that compose those chemical reactions -- telling them the best ways to breed and prepare itself for further replication, because each construct will last only a few dozen years. If you don't think DNA is the all-knowing, mind-reading, future-predicting shit after reading this book, you don't agree with the most popular explanation of evolutionary theory available. You are not a "scientist"

      --
      I am the richest astronaut ever to win the superbowl.
    15. Re:Intellectuals are so right... by radarjd · · Score: 1
      From the Wikipedia article you quoted: a person regards the lack of evidence for one view as constituting proof that another view is true.

      I didn't read the GP as proclaiming that it is true that life is divine in origin. He or she merely pointed out that it is impossible to show that it is not. Surely the simple observation that evolution has not be demonstrated (in the non-theoretical sense) does not automatically create a presumption that it could only have been divinely created. That in and of itself advances the theory of evolution to some sort of inviolate stage where it cannot be questioned. It can always be questioned, and it only advances or becomes more refined when challenged.

      I personally despise these religiously charged articles on slashdot. The rancor thrown by the atheist crowd abandons the passionless purpose of science, which is ultimately observation and description. The religious crowd is just as bad at damning the other side and not responding with any complex or nuanced theology. I know some very smart atheists and some very smart religious people -- scientists and engineers on both sides; Democrats and Republicans on both sides. Slashdot is not the place to convert people, because ultimately 99.9% (insert your own decimal level of confidence here) of people are not won over to either by the strength of any logical or reasoned argument, but by fickle emotion. Sure, everyone on slashdot will claim to be part of the .1% who chooses only on the basis of observable evidence, but given how emotionally charged these (and other - btw, Apple Sucks) discussions get.

    16. Re:Intellectuals are so right... by louzer · · Score: 1
      Hey, a God that created a:

      DNA that calculates, predicts, economically manages inherent "bio-credits", plans, adapts, and self-motivates to construct massive biological machines and places illusions into the inanimate elements that compose those chemical reactions -- telling them the best ways to breed and prepare itself for further replication...

      and listens to prayers, makes himself be born of a virgin, lets 1 child die from a very efficient parasite every 30 seconds, but is all loving and all knowing and almighty, has got to be much more complex and therefore unlikely to have come into existence without a cause. It is more unlikely than a hurricane assembling a fighter jet.

      --
      Heroes die once, cowards live longer.
    17. Re:Intellectuals are so right... by Anonymous Coward · · Score: 0

      You know, it's possible to take a metaphor too far. Dawkins does it. You do it.

      Does that make you Dawkins?

      No, of course it doesn't, but that's what you've just implied.
      Scientists and engineers are annoying because they won't just tell you why you're wrong, they'll also tell you how.

    18. Re:Intellectuals are so right... by Curtman · · Score: 1

      When I tell you that you obviously haven't studied it

      You haven't got a clue what I've studied and what I haven't. You claimed that evolutionary theory told of telepathic beings which demand our loyalty and praise which in turn give us eternal life.

    19. Re:Intellectuals are so right... by Anonymous Coward · · Score: 0

      Scientists "preach" that true science is the observability, repeatablility and testability of the phenomena it seeks to explain. Yet scientists are still unable to create even a simple protocell directly from organic compounds. Show me evolution from the ground up to prove that life is not divine.

      What you ask is maybe not so far off at all ...

      http://blog.wired.com/wiredscience/2008/09/biologists-on-t.html

      "Biologists on the Verge of Creating New Form of Life
      A team of biologists and chemists is closing in on bringing non-living matter to life."

      Paradoxically, the article uses the word "created" in a headline about that exact evidence which you ask for to show the opposite.

    20. Re:Intellectuals are so right... by MeanderingMind · · Score: 1

      I appreciate your viewpoint and actually share it. Generally speaking I despise the debate because it is emotionally charged on both sides. However, I don't let that stop me from arguing logically and pointing out when others are not.

      I believe I was quite correct in calling that post out as an argument from ignorance. The implication of the sentence "Show me evolution from the ground up to prove that life is not divine" is quite clear. It obviously points to a lack of evidence (the scientist's inability to show evolution from the ground up) as proof for another view (that life is divine).

      --
      Thunderclone: ONE MAN ENTERS! TWO MEN LEAVE! ONE MAN ENTERS! TWO MEN LEAVE!
  7. Evolution by Anonymous Coward · · Score: -1, Troll

    Evolution is still a theory until proven a fact.

    1. Re:Evolution by st0rmshad0w · · Score: 1

      Just like gravity.

    2. Re:Evolution by nattt · · Score: 4, Funny

      Gravity is just a theory, not a proven fact, but I still fall over...

      --
      -- oldthinkers unbellyfeel ingsoc
    3. Re:Evolution by Beek+Dog · · Score: 1

      Damn it, I accidentally marked you as interesting. Now I have to post to get rid of it. So, I'll take this opportunity to call you a moron. Moron.

    4. Re:Evolution by geekoid · · Score: 1

      You don't know what a theory is, when you figure that out then you will understand why that statement makes no sense what so ever.

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    5. Re:Evolution by Kinky+Bass+Junk · · Score: 2, Funny

      Alcohol is just a theory, not a proven fact, but I still fall over...

      --
      Anonymous Coward
    6. Re:Evolution by Anonymous Coward · · Score: 0

      It's not gravity, It's Intelligent Falling

  8. romancer by Romancer · · Score: 5, Informative

    The statement quotes Reiss saying, "Creationism has no scientific basis."

    He goes on to say, "However, when young people ask questions about creationism in science classes, teachers need to be able to explain to them why evolution and the Big Bang are scientific theories but they should also take the time to explain how science works and why creationism has no scientific basis.

    "I have referred to science teachers discussing creationism as a worldview'," he goes on to say, "this is not the same as lending it any scientific credibility."

    --


    ) Human Kind Vs Human Creation
    ) It'd be interesting to see how many humans would survive to serve us.
    1. Re:romancer by moderatorrater · · Score: 2, Interesting

      It seems to me that his comments were that children who believed in creationism should be taught the difference in a way that wouldn't raise their defenses. This is a good thing, and there's no argument about that. When you're an educator, you need to find methods to teach everyone, not just those who are receptive to what you have to say. In effect, he wanted to teach the difference between religious teaching and science, and that's a good thing for everyone since religion and science aren't mutually exclusive.

      Of course, this may be the wrong forum to suggest that religion and science can coexist.

    2. Re:romancer by Pantero+Blanco · · Score: 4, Insightful

      It seems to me that his comments were that children who believed in creationism should be taught the difference in a way that wouldn't raise their defenses.

      That's exactly what he was saying.

      If you approach someone with a holier-than-thou attitude or mock them, they get pissed off and the discussion becomes a personal conflict. If you insult (not "state something that conflicts with", but actually insult) something that they regard as part of their culture, it becomes a political conflict.

      Once that happens, none of the logic you throw at someone is going to make a bit of difference.

      If you want to fight someone, insult them. If you want to convince someone, educate them.

    3. Re:romancer by couchslug · · Score: 2, Insightful

      " If you insult (not "state something that conflicts with", but actually insult) something that they regard as part of their culture, it becomes a political conflict."

      To the dedicated religionist, there is no difference between disagreement and blasphemy.

      --
      "This post is an artistic work of fiction and falsehood. Only a fool would take anything posted here as fact."
    4. Re:romancer by Anonymous Coward · · Score: 0

      When you're an educator, you need to find methods to teach everyone, not just those who are receptive to what you have to say.

      Suppose a student believes that the world was created in seven Earth days. How do you explain the Big Bang without contradicting this cherished belief? Reiss seems to think you should say, "The world could have been created in seven days, but that's not what science is about. Now I'll tell you what science says, but feel free to ignore it if you'd rather believe something else." Is that a good way to prepare students for the real world?

    5. Re:romancer by rkww · · Score: 1

      Although Creationism has no scientific basis, some pupils believe its descriptions to be literally true. So how (and under which subject umbrella) should said pupils be enlightened?

      R.E. teaches people to respect others' religious beliefs, so it's obviously not the right venue; and in hard science an individual's personal beliefs should be irrelevant to their work, so that's not the right venue either.

      It seems to me that the natural home for the discussion of the reality of belief is Philosophy. But is that a science?

    6. Re:romancer by servognome · · Score: 1

      He goes on to say, "However, when young people ask questions about creationism in science classes, teachers need to be able to explain to them why evolution and the Big Bang are scientific theories but they should also take the time to explain how science works and why creationism has no scientific basis.

      They don't even need to do that. Rather than look at scientific theories for "truth," which the structure of science can never achieve, look at theories for their utility. With that perspective the debate shifts, where even if one assumes intelligent design is correct, it doesn't have practical real world extensions the way evolution does - opens discussions and can be applied to things like genetics.
      Science isn't about "truth" - the Ideal Gas Law makes assumptions that are known to be untrue, but the utility of the theory cannot be denied.

      Teach and treat science as a problem solving tool rather than a definitive answer to everything.

      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
  9. bunch of hypocrites by Anonymous Coward · · Score: -1, Troll

    You can never be pleased. First the guy says some crazy shit about creationism and then you all get angry that such a person could be elected to such a high scientific position. The guy then leaves, and now you're angry that he didn't stay to chat his crazy ideas with the other real scientists. You're all a bunch of hypocrites and you'll never be pleased by any outcome.

  10. Burying Ms Hatchet. by Anonymous Coward · · Score: 1, Funny

    "This news coincides with word out of the Anglican church that it is ready to apologize to Charles Darwin, 150 years after it poured scorn on his theory of evolution by natural selection. "The Church of England will concede in a statement that it was over-defensive and over-emotional in dismissing Darwin's ideas. It will call 'anti-evolutionary fervor' an 'indictment' on the Church.""

    Now will the evolutionist and the creationists kiss and make up?

    1. Re:Burying Ms Hatchet. by mjwx · · Score: 1

      "This news coincides with word out of the Anglican church that it is ready to apologize to Charles Darwin, 150 years after it poured scorn on his theory of evolution by natural selection. "The Church of England will concede in a statement that it was over-defensive and over-emotional in dismissing Darwin's ideas. It will call 'anti-evolutionary fervor' an 'indictment' on the Church.""

      The Church of England is one of the most forward thinking churches, They were the first to allow women and gay priests and have openly held discussions on the very existence of God. As an atheist I can honestly say that I am not surprised by the Anglican Church on this one, they tend to be quite logical and reasonable given they are a church.

      --
      Calling someone a "hater" only means you can not rationally rebut their argument.
  11. oozists rethinking their widely held disbeliefs by Anonymous Coward · · Score: -1, Troll

    not many options left, seeing as EVERYTHING made by man fails.

    greed, fear & ego are unprecedented evile's primary weapons. those, along with deception & coercion, helps most of us remain (unwittingly?) dependent on its' life0cidal hired goons' agenda. most of yOUR dwindling resources are being squandered on the 'wars', & continuation of the billionerrors stock markup FraUD/pyramid schemes. nobody ever mentions the real long term costs of those debacles in both life & the notion of prosperity, not to mention the abuse of the consciences of those of us who still have one. see you on the other side of it. the lights are coming up all over now. conspiracy theorists are being vindicated. some might choose a tin umbrella to go with their hats. the fairytail is winding down now. let your conscience be yOUR guide. you can be more helpful than you might have imagined. there are still some choices. if they do not suit you, consider the likely results of continuing to follow the corepirate nazi hypenosys story LIEn, whereas anything of relevance is replaced almost instantly with pr ?firm? scriptdead mindphuking propaganda or 'celebrity' trivia 'foam'. meanwhile; don't forget to get a little more oxygen on yOUR brain, & look up in the sky from time to time, starting early in the day. there's lots going on up there.

    http://news.google.com/?ncl=1216734813&hl=en&topic=n
    http://www.nytimes.com/2007/12/31/opinion/31mon1.html?em&ex=1199336400&en=c4b5414371631707&ei=5087%0A
    http://www.nytimes.com/2008/05/29/world/29amnesty.html?hp
    http://www.cnn.com/2008/US/06/02/nasa.global.warming.ap/index.html
    http://www.cnn.com/2008/US/weather/06/05/severe.weather.ap/index.html
    http://www.cnn.com/2008/US/weather/06/02/honore.preparedness/index.html
    http://www.nytimes.com/2008/06/01/opinion/01dowd.html?em&ex=1212638400&en=744b7cebc86723e5&ei=5087%0A
    http://www.cnn.com/2008/POLITICS/06/05/senate.iraq/index.html
    http://www.nytimes.com/2008/06/17/washington/17contractor.html?hp
    http://www.nytimes.com/2008/07/03/world/middleeast/03kurdistan.html?_r=1&hp&oref=slogin
    http://biz.yahoo.com/ap/080708/cheney_climate.html
    http://news.yahoo.com/s/politico/20080805/pl_politico/12308;_ylt=A0wNcxTPdJhILAYAVQms0NUE
    http://news.yahoo.com/s/nm/20080903/ts_nm/environment_arctic_dc;_ylt=A0wNcwhhcb5It3EBoy2s0NUE

    is it time to get real yet? A LOT of energy is being squandered in attempts to keep US in the dark. in the end (give or take a few 1000 years), the creators will prevail (world without end, etc...), as it has always been. the process of gaining yOUR release from the current hostage situation may not be what you might think it is. butt of course, most of US don't know, or care what a precarious/fatal situation we're in. for example; the insidious attempts by the felonious corepirate nazi execrable to block the suns' light, interfering with a requirement (sunlight) for us to stay healthy/alive. it's likely not good for yOUR health/memories 'else they'd be bragging about it? we're intending for the whoreabully deceptive (they'll do ANYTHING for a bit more monIE/power) felons to give up/fail even further, in attempting to control the 'weather', as well as a # of other things/events.

    http://www.google.com/search?hl=en&q=weather+manipulation&btnG=Search
    http://video.google.com/videosearch?hl=en&q=video+cloud+spraying

    unintended results?;

    'The current rate of extinction is around 10 to 100 times the usual background level, and has been elevated above the background level since the Pleistocene. The current extinction rate is more rapid than in any other extinction event in earth history, and 50% of species could be extinct by the end of this century. While the role of humans is unclear in the longer-term extinction pattern, it is clear that factors such as deforestation, habitat destruction, hunting, the introduction of non-native species, pollution and climate change have reduced biodiversity profoundly.' (wiki)

    consul

    1. Re:oozists rethinking their widely held disbeliefs by OldFish · · Score: 1

      Well, sure, everything made by man fails. I'm just waiting for religion to fail completely.

    2. Re:oozists rethinking their widely held disbeliefs by Anonymous Coward · · Score: 0

      You might have to wait a while for that.

  12. Creationism never, Sharia Law forever! by ProteusQ · · Score: 1, Troll
    1. Re:Creationism never, Sharia Law forever! by Anonymous Coward · · Score: 0

      Humph! What pitiful people.. Could anyone save us some future trouble and kill those fervorous religious idiots right now?

    2. Re:Creationism never, Sharia Law forever! by TubeSteak · · Score: 1

      A) How is that any different from decades of "Death to America!"?

      B) Claiming Britain "adopts Sharia law on the sly" is dishonest.

      Jewish Beth Din courts operate in Britain under the same provision in the Arbitration Act and have been dispensing justice for over a 100 years.

      Some politicians and Christian clergy have expressed concern that this could mark the beginning of a 'parallel legal system' for British Muslims.

      I think those lines FTFA sums up the ridiculousness of the premise.
      Mutually agreed upon binding arbitration != Britain officially adopts Sharia law
      Replace Sharia Law & Muslim with Talmudic Law & Jew and see how scary TFA is.

      C) Creationism is part of Islam, which would mean refuting it (aka innovating) contravenes Sharia Law

      D) How is any of this ontopic? I only reply to rebut dishonest spin.

      --
      [Fuck Beta]
      o0t!
    3. Re:Creationism never, Sharia Law forever! by Anonymous Coward · · Score: 0

      There's not a better expression of Western guilt than this dichotomy.

    4. Re:Creationism never, Sharia Law forever! by Curtman · · Score: 1

      Mutually agreed upon binding arbitration != Britain officially adopts Sharia law

      I've heard these alternative court systems have worked well.

    5. Re:Creationism never, Sharia Law forever! by Anonymous Coward · · Score: 0

      There is a legal principle that a law that is nondiscriminatory by formal logic may still be discriminatory in its effects. In these cases it shall be considered a discriminatory law.

      In a similar vein, whether "Britain adopts Sharia on the sly" is correct _in effect_ or not, depends on at least two things:

      - Do the vast majority of muslims practicably and in effect have the freedom to choose not to be subject to a Sharia court, without indirectly being forced to? If the answer to this is "no", then Sharia has been adopted on the sly as mandatory for muslims.

      - Does the majority of muslims who, even if they desire to have something tried before a Sharia court, respect and adhere to the decision if it is tried before a regular court? If the answer to this is "no", then Sharia has been imposed in effect on British nonmuslims, in the sense that they can only gain legal redress by appearing in front of a Sharia court.

      - Strengthening or weakning the assertion subject to one of the above being true: How many courts _are_ Sharia courts, and how many muslims are there? If every fourth person is a muslim, and these only adhere to Sharia courts, that is a very different reality than if Islam is a religion in totality shared by four people who have chosen a fifth as their only arbitrator.

      In this way, whether Britain has had Sharia imposed is not a matter of formal logic, but a matter of degrees and effects.

    6. Re:Creationism never, Sharia Law forever! by Anonymous Coward · · Score: 0

      Replace Sharia Law & Muslim with Talmudic Law & Jew and see how scary TFA is.

      That's actually also very disturbing.

  13. Please... by OldFish · · Score: 1

    let Sarah Palin be a member of the Royal Society!

    1. Re:Please... by Anonymous Coward · · Score: 0

      sure, why don't we force everyone into molds so that it doesn't hurt your tender little head to think that people should be looked on upon as individuals... instead we can just lump them all together and deal with them real nice and neat ala the holocaust.

      jerkoff.

    2. Re:Please... by OldFish · · Score: 2, Informative

      What's your problem? She's a fucking nutcase, she has no business aspiring to a leadership position that requires clear thinking and a reality-based worldview. She should quit, no, be fired, from her aspirations. I'm not suggesting she be destroyed. Religion, on balance, is nothing.

  14. No good deed goes unpunished by pvjr · · Score: 5, Insightful

    Whether he was right or wrong, as I understamd it, A scientist should be able to state his ideas without fear of reprisals such as that.

    Its the scientific version of the Church vs Galileo.

    1. Re:No good deed goes unpunished by Anonymous Coward · · Score: 0

      A scientist can state there own ideas however only if also proposing or gathering advise in ways of testing and proofing.

      An idea from a scientist often is looked at as an authoritative word so unless they make it 100% clear that it is only there personal opinion with no scientific basis they are hindering the science community.

    2. Re:No good deed goes unpunished by vertinox · · Score: 1

      Whether he was right or wrong, as I understamd it, A scientist should be able to state his ideas without fear of reprisals such as that.

      If the head of a scientific institution declared the earth was flat, would not not call for the questioning of his post?

      It would be like the head of OPEC declaring that oil comes from cows.

      --
      "I am the king of the Romans, and am superior to rules of grammar!"
      -Sigismund, Holy Roman Emperor (1368-1437)
    3. Re:No good deed goes unpunished by Tablizer · · Score: 1

      Its the scientific version of the Church vs Galileo.

      The brits are at least faster than the Catholic church. It took the Church something like 500 years for their apology.

      (begin political sarcasm)

      Do you think W and Co. will admit there's no WMD's by 2500?

      (end political sarcasm)
           

    4. Re:No good deed goes unpunished by eebra82 · · Score: 1

      It would be like the head of OPEC declaring that oil comes from cows.

      Well, theoretically, it does. Only it would take a long time before organic material becomes oil.

      Hate to break it to you, but your analogy sucked.

    5. Re:No good deed goes unpunished by bendodge · · Score: 1

      He didn't endorse Creationism. He simply said that teachers in the classroom should be able to answer questions concerning it, instead of the current policy of ignoring them.
      Get your facts straight, then criticize.

      --
      The government can't save you.
    6. Re:No good deed goes unpunished by mdwh2 · · Score: 1

      Sure, but that's irrelevant. What if he declared that we should teach children about the earth not being flat, and that such views are not based in science?

    7. Re:No good deed goes unpunished by UberDude · · Score: 1

      Scientists are frequently admonished for publishing ideas which have no scientific basis, or for which there is little or no evidence or where elementary mistakes were made in assumptions or experiments.

      We can argue whether God exists or not, but most reasonable people would agree that there is no scientific basis for religion. There is no measurable evidence, there is no coherent hypothesis, and not even a broad consensus of opinion among religious communities.

      Therefore it has no place in a science classroom.

    8. Re:No good deed goes unpunished by Anonymous Coward · · Score: 0

      Get your facts straight, then criticize.

      Next time take your own advice and read the post you reply to more carefully.

  15. Inaccurate Information in Post by Anonymous Coward · · Score: 0

    "the Prof. Michael Reiss, who recently caused a storm with comments about teaching creationism in schools"

    He did not make a comment about teaching creationism in schools or say that it should be taught in schools. As the other article the post cites clearly points out, he merely said that teachers should discuss creationism with students if the student brings up the topic first. From the article cited:

    "He was criticised by other scientists - though misquoted as saying creationism should be "taught" in science classes."

    They quote a number of other professors who elaborate on it more.

    I think this is a bit of an overeaction. While I hold that the theory of evolution is scientific fact and creationism is pure faith and religion, I don't think that Prof Reiss was in any way disparaging evolution. I believe he was trying to prevent educators from making children feel as though they are stupid because their parents or church have taught them to believe in creationism.

  16. Nonsense by jopet · · Score: 0

    A scientist who commits a serious blunder has to face reprisals such as this. If a mathematician claims that he found a method to trisect an angle he should be fired. What this man did, is at least a serious a blunder.
    Creationism contradicts the scientific principle .. if he feels like it, he still can become a priest or some other person who makes a living by believing in unprovable fairytales.

    1. Re:Nonsense by Antique+Geekmeister · · Score: 1

      First: this man is a priest, and a biologist, and a respected biologist at that.

      Second: the 'blunder' was basically failing to say things in a way that couldn't be misquoted. His original suggestions, which were also written about on Slashdot, were reasonable ones saying 'let students, and teachers, discuss it in class and compare its reasoning to that of science'. That's a good approach, just what Mythbusters does and excellent material for exploring scientific reasoning versus superstition or dogmatic beliefs.

      Unfortunately for him, he's not a Jesuit. If he were, he'd have had far more practice in the kind of spirited debate that would have helped him avoid being misquoted and misunderstood.

      Also unfortunately, the shouting has obscured one of the dangers of his actual suggestion. But bringing creationism into the classroom, even to discredit it, it is lent a certain respectability for people who are not in the class. And other teaching professionals, more convinced of their religious versions of biology and physics, can hide their fraudulent scientific claims by calling it 'analysis'. That kind of stunt used to be pulled all the time in US classrooms, teaching political propaganda, and I can only assume that it also occurs in UK classrooms as well. So we want to be very careful about what, exactly, we spend valuable classroom time analyzing.

    2. Re:Nonsense by bendodge · · Score: 1

      You (and the Slashdot editors) committed a serious blunder: you failed to read what he actually said.

      http://www.guardian.co.uk/science/blog/2008/sep/11/michael.reiss.creationism
      http://royalsociety.org/news.asp?id=8004

      Even if the Guardian summary ("Teachers need to accommodate the differing world views of students from Jewish, Christian or Muslim backgrounds â" which means openly discussing creationism and intelligent design as alternatives to evolutionary theory") were true, I don't think it warrants the kind of Muslim-esque head-on-a-platter firestorm we saw yesterday.

      --
      The government can't save you.
    3. Re:Nonsense by jopet · · Score: 1

      In my opinion, being religious. let alone a priest, and being a scientist is not compatible unless one manages to keep up some odd kind of schizophrenia.
      I agree that discussing the flaws of creationism could be a good idea in a society where obviously a significant number of people think that creationism is an "alternative" to science.

    4. Re:Nonsense by Anonymous Coward · · Score: 2, Funny

      Gosh. It's been a long time. I'm pretty sure I could divide an angle into an number of divisions using my compass and a straight edge. The trick is that you have to be an engineer instead of a mathematician. It reminds me of a joke...

      An engineer and a mathematician are standing some distance away from Natalie Portman who is holding a pot of steaming hot grits. They are told that they can only approach Natalie by covering one half the distance with each iteration. They can use as many iterations as they want to approach Natalie. The mathemetician leaves in disgust. The engineer says, "I can get close enough for practical purposes."

    5. Re:Nonsense by JonathanBoyd · · Score: 1

      In my opinion, being religious. let alone a priest, and being a scientist is not compatible unless one manages to keep up some odd kind of schizophrenia.

      Pity you weren't around to tell Michael Faraday and James Clerk Maxwell that their evangelicalism were incompatible with them being among the greatest scientists in history.

    6. Re:Nonsense by physicsphairy · · Score: 1

      "A scientist who commits a serious blunder has to face reprisals such as this. If a mathematician claims that he found a method to trisect an angle he should be fired."

      Well, you should certainly be forbidden to hold any mathematics related position, apparently, because what you said is absolutely untrue. It is possible to trisect an angle--any angle--or do you think division by three is impossible? Perhaps what you meant to say was that it is impossible to trisect an arbitrary angle by geometric construction. But that's not what you said, and it's not even misquoted like Reiss's statement--it's just flatout wrong.

      And while we're persecuting you for being dumb, maybe we should focus our efforts on history and denounce any mathematician who claims to have found a geometry of many dimensions. I suppose Gauss was right to hold off in his discovery, fearing confrontation with Kant's argument that any more than 3 dimensions was impossible. Or we may go against Isaac Newton/Leibniz in the theory of infinitesimals (which was not only thoroughly criticized by rigorous mathematicians, but has only recently been given a solid mathematical basis). Or maybe we will go after those who propose the existence of negative or imaginary numbers--an obvious impossibility! Who could conceive of a negative apple!?

      No, sir, science has no room for an inquisition of its own, and your desire to purge the heretics is best kept to yourself. A good scientist is any scientist who can perform well in the context of modern scientific theory, which he knows by heart. Not believes in--that is religion--knows. It doesn't matter at all what he believes, whether it is in the FSM or negative numbers. If a man knows every rule of calculus, every proof, every theorem, and can solve any problem that is tractible, then that is faultless. His other bizarre ideas should not only be tolerated, but encouraged. It is what is called "hypothesis" which is absolutely integral to the scientific process, even, and especially, when it contradicts known rules.

    7. Re:Nonsense by canajin56 · · Score: 1

      I agree. Catastrophic blunder to say you should explain to a child why creationism isn't science, instead of kicking the child from the class. Good thing the Royal Society agrees with you, and took exactly your position: He says we shouldn't lynch creationists, but instead explain why they are wrong! LYNCH HIM

      --
      ASCII stupid question, get a stupid ANSI
    8. Re:Nonsense by Anonymous Coward · · Score: 1, Insightful

      Pity you weren't around to tell Michael Faraday and James Clerk Maxwell that their evangelicalism were incompatible with them being among the greatest scientists in history.

      And Isaac Newton believed in alchemy. Does that mean that alchemy should be referenced in chemistry class as a valid contemporary "worldview?"

      The "God of the Gaps" was evicted from quite a few of those gaps between Newton's time and Maxwell's, and between Maxwell's time and ours.

    9. Re:Nonsense by Seraphim_72 · · Score: 1

      No, sir, science has no room for an inquisition of its own, and your desire to purge the heretics is best kept to yourself.

      Thank you for that, I may shamelessly steal it for my sig :) Wonderful post.

      --
      Slashdot, where armchair scientists get shouted down and armchair theologians get modded up.
    10. Re:Nonsense by Antique+Geekmeister · · Score: 1

      Or examined the biology and physics research done at major religious universities worldwide. Some priests believe that actually observing and understanding their god's more practical handiwork is a form of worship, and I can certainly work with such people to do so. People believe all sorts of mythical beings, like truth, justice, demoracy, murphy's law, and various forms of god. As long as they keep a handle on it, we can work with them in real and effective ways.

    11. Re:Nonsense by JonathanBoyd · · Score: 1

      And Isaac Newton believed in alchemy. Does that mean that alchemy should be referenced in chemistry class as a valid contemporary "worldview?"

      Are you replying to the right post, because that doesn't seem to have anything to do with what I said? I was pointing out that it's entirely possible to be both a Christian and a great scientist. Do you dispute that? If not, then you don't need to reply. If you do dispute it, you'll need to explain what your last post has to do with the issue, because I see no connection.

      The "God of the Gaps" was evicted from quite a few of those gaps between Newton's time and Maxwell's, and between Maxwell's time and ours.

      Who's arguing for a "God of the Gaps"? Certainly no Christian scientist that I know. The God of the Bible most definitely is not the God of the Gaps and such an idea hasn't been taken seriously in theological circles for a long time. And again, what does it have to do with what I posted? Or are you just throwing up strawman arguments because you have no genuine case to make?

  17. Re:What a waste. -- Mod up by irenaeous · · Score: 5, Insightful

    You make this great point when you say:.

    To suggest otherwise is just the sort of thing IDers want. . .

    The effective firing of this man also plays into the hands of the "IDers". They can now decry the persecution of this individual (you know they will) and get good millage out of the argument because they would not have be totally wrong in this case. The Royal Society should not have caved in this way.

  18. WTF? by achenaar · · Score: 4, Insightful

    Why the hell did he quit? He was misquoted, taken out of context and made an example of... What in the shitting hell did he say to make this happen? I've read the articles and he has his head screwed on straight so for crying out loud, why hasn't this man been supported?
    ARGH!
    Do we have to deal with athiest fundies now?
    Yeesh!

    1. Re:WTF? by OldFish · · Score: 1

      I'm not sure about the actual facts in this particular case, but I think the scientific position is generally more open to changing itself to fit reality than the religious viewpoint. I see a problem with placing the two viewpoints on the same footing and then deciding that science must accommodate religion as anything other than a curiosity of cultural biology. Mankind has endured enough crap from the religious. Well, and from science too, to be honest, but at least the scientific method offers a future of expanded knowledge and, as we know from one of the finest films ever made, "Knowledge is Good"..

    2. Re:WTF? by achenaar · · Score: 1

      Well, in any event, I've sent an email to the only account on the contact page that seemed anywhere near worth talking to, expressing my disgust at their acceptance of the resignation.
      I don't feel like my work is anywhere near done but I did mention that the email address completemediacircusandinjusthanging@royalsociety.org probably wasn't registered.
      This is some seriously bad shit.

    3. Re:WTF? by MeanderingMind · · Score: 1

      The problem is that journalistic rigor and integrity are largely dead.

      In the age of the internet and instantaneous communication you have a variety of news sources competing to get the word out first. The speed with which an article hits the internet/24 hour news network is so important that the level of fact checking and common sense appraisal has dropped considerably. It doesn't matter whether the article is wrong, you need those page views/advertising dollars before the other web site/network can get them. You can always issue an apology/corrective statement later, or fire an anchor.

      Some might argue that this is coupled with a loss of critical evaluation of said news sources by the general populace, but that's something of a moot point. It doesn't particularly matter whether or not people stop and consider the veracity of their news source because the next five they check will say exactly the same thing.

      As a result people don't know what to believe. They either float about in confusion or latch on to the only tangible "truth" available. Specifically, whatever it is the media is telling them is true.

      It doesn't matter that later the real truth comes out because it isn't as interesting and fewer people pay attention to it. As a result, this person could expect to suffer at the hands of his miscommunication for years. Even after stepping down it will take him a long time to be able to rebuild his reputation.

      It's a shame, but that's the kind of reactive, uncontemplative world we live in.

      --
      Thunderclone: ONE MAN ENTERS! TWO MEN LEAVE! ONE MAN ENTERS! TWO MEN LEAVE!
    4. Re:WTF? by achenaar · · Score: 1

      Which still doesn't answer the question "why did the man quit?".
      It's glaringly obvious he was misquoted, and the (shudder) truth will out, so why on earth would he forsake his organisation by ducking out? It makes no sense.
      Media circus is as media circus does. That doesn't mean that when you're *right* as this guy was, you should pander to the feckers who say you're wrong.
      GRAAAAARGH
      ME ANGRY!

    5. Re:WTF? by oldhack · · Score: 1

      You're so right. If you take up a position like the education director of the Royal Society, you'd better be prepared to fight for what you believe is right. I'm disappointed that he threw in the towel so quickly. I realize the pressure he was under, but come on. You don't establish yourself in the science world by being "polite" and meek.

      That's why you want physicist to take up such position. You won't see many physicist taking shit up their ass so easily. :-)

      --
      Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
  19. The good doctor was a vicar instead by nietsch · · Score: 4, Interesting

    While his message was one of tolerance, he was also an ordained priest (or whatever those men in dresses call it). He just showed them why it is not such a good idea to put a religious person at the head of a science organisation. As Richard Dawkins suggested, he could have given up his religious position too, that would have been much more convincing.

    --
    This space is intentionally staring blankly at you
    1. Re:The good doctor was a vicar instead by moderatorrater · · Score: 4, Insightful

      He just showed them why it is not such a good idea to put a religious person at the head of a science organisation

      Because people will attack him irrationally? That doesn't make sense.

      he could have given up his religious position too, that would have been much more convincing

      How would that have been more convincing? People thought he was asking to teach creationism in school, which he wasn't, and they were refusing to believe the truth even when the option for evidence was out there. Why would his stepping down from his position as a priest have been any more effective? Because scientists are taking an irrational stance towards religious people?

      The point of the matter is that this is a classic example of intolerance because of his beliefs, not his performance. He was put at the head of the science organization for a reason, so presumably he was a good scientist. Why do his religious beliefs and practices suddenly matter if not because of an irrational bias against religion?

    2. Re:The good doctor was a vicar instead by mdwh2 · · Score: 2, Informative

      He just showed them why it is not such a good idea to put a religious person at the head of a science organisation.

      What, by saying that teachers should explain why creationism isn't scientific, when trying to get children to accept evolution?

      Dawkins is making the more general point about whether a priest should be in such a position, which is a matter for debate, but not relevant to this issue. I've generally been a great fan of Dawkins, but would lose respect if he decides to make an issue out of this false version of Reiss's views - especially since usually I'd expect Dawkins to be arguing against the creationists false claims that "leading scientists support teaching creationism"!

      As Richard Dawkins suggested, he could have given up his religious position too, that would have been much more convincing.

      An interesting idea, but not sure it's relevant here, since (a) it wasn't fellow vicars asking him to resign from being a vicar, and (b) as much as I dislike the Church of England for other reasons, they neither support teaching creationism, nor oppose teaching evolution. In fact, in 2002 a group of bishops wrote a letter to the Government to oppose a school which was teaching creationism ( http://richarddawkinsfoundation.org/foundation,questionableFoundations ).

    3. Re:The good doctor was a vicar instead by yali · · Score: 4, Insightful

      Richard Dawkins is an atheist who believes that science and faith are fundamentally incompatible, so it makes sense that he'd think that. But that is not a consensus view among scientists. Plenty of other people think that science is compatible with religion and spirituality because they address different concerns.

      Unless the Royal Society is now taking positions on the acceptability of religion, there should be no consideration given, pro or con, to the religious beliefs or affiliations of its officers.

    4. Re:The good doctor was a vicar instead by GospelHead821 · · Score: 4, Insightful

      You are correct that it would have been convincing if renouncing and denouncing religion altogether were his aim. Clearly, that is not the case. Nor does the tone of his resignation suggest any disrespect for the theory, practice, or establishment of science. I am quite confident that this man retains both a respect for the scientific method and also his religious faith. He resigned to avoid the appearance of impropriety within the scientific community. Most probably, his church does not feel as though his involvement in science tarnished his faith. On the other hand, this incident has caused the scientific community to question his credentials as a scientist. He resigned from the community that was at odds with what he had said.

      --
      Virtue finds and chooses the mean.
      Aristotle, Ethica Nichomachea
    5. Re:The good doctor was a vicar instead by ArsonSmith · · Score: 3, Funny

      It'd be like finding out a Linux admin runs Windows at home. He'd be ridiculed until he had to step down with a tarnished reputation and may not ever be able to work in computers again.

      --
      Paying taxes to buy civilization is like paying a hooker to buy love.
    6. Re:The good doctor was a vicar instead by ArsonSmith · · Score: 1

      He just showed them why it is not such a good idea to put a religious person at the head of a science organisation.

      What, by saying that teachers should explain why creationism isn't scientific, when trying to get children to accept evolution?

      It has nothing to do with him and the knee jerk reaction of those against the idea of him.

      To quote Mel Brooks "A blaaack SHERIFF!!??"

      It's not his qualifications or ability to do the job, but his perception by the people. Like it or not it's how life works.

      --
      Paying taxes to buy civilization is like paying a hooker to buy love.
    7. Re:The good doctor was a vicar instead by RDW · · Score: 1

      'He just showed them why it is not such a good idea to put a religious person at the head of a science organisation.'

      What, you mean like Francis Collins?:

      http://www.genome.gov/10001018

      Dawkins isn't a big fan of his views either:

      http://www.time.com/time/printout/0,8816,1555132,00.html

      but apparently that whole 'human genome project' thing turned out to be quite successful...

    8. Re:The good doctor was a vicar instead by FlyingBishop · · Score: 1

      It's more like a Linux admin spending his spare time working on something like Wubi ( which makes it less scary for Windows users to dual boot Ubuntu. )

      Then he gets flamed in the forums by trolls accusing him of helping people use Windows, because they can use Linux without risking their Windows install.

    9. Re:The good doctor was a vicar instead by Joe+Tie. · · Score: 1

      It'd be like a balloon....and something bad happens.

      --
      Everything will be taken away from you.
    10. Re:The good doctor was a vicar instead by UberDude · · Score: 1

      There may not be a consensus view among US scientists, but the UK is a predominantly atheist/agnostic country. I'd be surprised if there was widespread support for religious equality here in Britain.

    11. Re:The good doctor was a vicar instead by guyminuslife · · Score: 0, Flamebait

      As Richard Dawkins suggested, he could have given up his religious position too, that would have been much more convincing.

      Yes, but, you have to keep in mind, Richard Dawkins is an asshole.

      --
      I don't believe in time. It's a grand conspiracy designed to sell watches.
    12. Re:The good doctor was a vicar instead by Anonymous Coward · · Score: 0

      "... that is not a consensus view among scientists. Plenty of other people think that science is compatible with religion and spirituality because they address different concerns."

      More like plenty of other scientists do not think it is prudent or helpful (esp. in education) to draw attention this conflict -- not when religious belief so widespread and adherents have so much political power. I'd venture to say there are few scientists that *actually believe* science and religion are compatible. The argument can be made that it is better to avoid the issue and let religious people live with some cognitive dissonance, than risk having them reject science altogether and live in unameliorated ignorance.

    13. Re:The good doctor was a vicar instead by exp(pi*sqrt(163)) · · Score: 0, Troll

      it is not such a good idea to put a religious person at the head of a science organisation.

      I'm as anti-religious as they come. I think that religion is a despicable con propagated by evil people for their own nefarious ends. But I still disagree with you. I learned the theory of evolution from an ordained minister and his education was perfectly sound. He was a nice guy actually (besides being evil and nefarious, that is). There are enough safety checks in place in an organisation like the Royal Society that someone's religion is unlikely to cause too much harm. In fact, this event shows that those safety checks may have been a little too easy too trigger.

      --
      Doesn't it make you feel good to know that our freedoms are protected by politicans, lawyers and journalists.
    14. Re:The good doctor was a vicar instead by nawcom · · Score: 1

      There may not be a consensus view among US scientists, but the UK is a predominantly atheist/agnostic country. I'd be surprised if there was widespread support for religious equality here in Britain.

      UberDude - please let me be your monkeyboy!!!!! I will move in and live underneath your bed!!! -- nawcom; American atheist

    15. Re:The good doctor was a vicar instead by JerkBoB · · Score: 3, Insightful

      Plenty of other people think that science is compatible with religion and spirituality because they address different concerns.

      I'm not sure who these "plenty of other people" are, exactly, but I suspect they're not real scientists if they're comfortable with allowing dogmatic religion to coexist alongside science.

      For many folks, religion is a nice story about what happens when we die. And some stuff about not being assholes to each other while we're alive. That's not incompatible with science.

      The problem comes in when religious nutbars (a certain vice-presidential candidate comes to mind) push an agenda that is hostile to scientific evidence which contradicts their worldview. And those people have become an increasingly vocal presence in US politics.

      Please don't forget that it was only 3 years ago, in 2005, that we had serious Federal (!!) court proceedings to decide whether or not a creationist worldview could be taught alongside scientific theory as an equivalently valid explanation for the existence of life as we know it.

      That is scary, scary stuff. Maybe not scary if you believe in that crap, but imagine if a court had ruled that ALL creation "theories" had to be taught alongside evolution. Are you comfortable with the idea of your children being taught that the world came from fragments of a proto-god's egg? Or that we are effectively a supernatural wet spot after an orgy among creator gods? I could go on for a while, or even make up shit on my own. Where do you draw the line?

      The bottom line is that science and religion are compatible in the same sense that science and literature are compatible. If we all agreed on that, the world would be a much less crazy place.

      --
      A host is a host from coast to coast...
      Unless it's down, or slow, or fails to POST!
    16. Re:The good doctor was a vicar instead by nEoN+nOoDlE · · Score: 1

      Plenty of other people think that science is compatible with religion and spirituality because they address different concerns.

      Tell that to Darwin, who the Anglican Church just now apologized to. Where were the critics that said "science is compatible with religion and spirituality" when the fathers of modern science were all discredited or killed for their beliefs? There is a current (and ongoing) war going on between religious people and science in the US because there are still many more people who believe that science is incompatible with religion. It's a real issue. Science goes directly against current religious beliefs in a lot of ways, and in every instance, after decades or centuries pass, religion has to change to accomodate it. This is the only reason why you could sit right now and say "science is compatible with religion" because your religion has changed in order to accomodate modern scientific advances. "God didn't create the earth like it says in the bible, he created the system that made it possible for the earth to be created!" Eventually, science will shine a light on all of the little dark crevices that religion hides in. We CAN know certain things that are explained in the bible. We CAN know where our inherent morality comes from, we CAN know how the universe was created and how long it took. Religion can only attempt to fill in those questions before they're proven by science, but every step along the way in trying to prove them is blocked by the zealots of religion who try and hold on to every dark crevice they still have left with every ounce of their being.

      And yes, I read too much Dawkins and Harris... but they're better than the alternative. I actually learn something from those books. I think it's a sad state of affairs that I went through my whole public school education and didn't know anything about evolution until I got interested in it myself. The extent of my education on probably the most influential discovery in human history was "Oh, and humans came from monkeys."

      --
      Don't trust a bull's horn, a doberman's tooth, a runaway horse or me.
    17. Re:The good doctor was a vicar instead by deepershade · · Score: 2

      What?! No. It's 70 odd percent christian. It may not have as many fundamentalists as other nations, and the ones it does have may not be publically accepted, but that doesn't mean we're predominately atheist or agnostic.

    18. Re:The good doctor was a vicar instead by dasunt · · Score: 1

      He just showed them why it is not such a good idea to put a religious person at the head of a science organisation.

      What does being religious have to do with it?

      Or are you confusing one branch of one religion with all religions?

      Why don't you expand your horizons and hunt down a good liberal place of worship in your neighborhood? If you want a place to start, I'd suggest looking for Unitarian Universalists, assuming you are outside of the Northeast (where UUs seem to average as being more traditional). Go to a service and see if you can find one of the UU atheists (not a contradiction in terms) to tell you why religion, atheism, and science can mix.

      Yes, there are a lot of intolerant religious theologies out there. There's also a lot of asshole sports fan, a lot of self-rightous geeks, and a lot of scumbag politicians. That doesn't mean that all members of those respective groups are the same though.

    19. Re:The good doctor was a vicar instead by theLOUDroom · · Score: 1

      Plently of scientists "think" that religion and science are compatible, BUT extermely few actually put forth a scientific argument to this effect.

      The problem here is, if you're not walking the walk and talking the talk, you're not actually a scientist anymore.
      If you claim that:
      a. You're a scientist.
      b. You believe in a particular religion.
      c. These views are not mutually exclusive.
      THEN YOU SHOULD BE ABLE TO FRAME YOUR FAITH AS A SCIENTIFIC THEORY AND SUBJECT IT TO THE SCIENTIFIC PROCESS.

      If not, then (for the purposes of this discussion) you are not a scientist.
      If you're not following the process, then you are no more a scientist than a person driving a truck is running a marathon. Either you're following the simple, clearly defined rules of the scientific process or you are not.

      Scientific truth is not determined by how many people believe in something. Science is not a popularity contest. Einstein certainly wouldn't have made it very far if that was the case. It is defined by who has the "best" theory. Not who is the most popular, politcally correct, well-funded or well-spoken. The guy who's theory does no get disproven "wins".

      --
      Life is too short to proofread.
    20. Re:The good doctor was a vicar instead by bh_doc · · Score: 1

      That is scary, scary stuff. Maybe not scary if you believe in that crap, but imagine if a court had ruled that ALL creation "theories" had to be taught alongside evolution. Are you comfortable with the idea of your children being taught that the world came from fragments of a proto-god's egg? Or that we are effectively a supernatural wet spot after an orgy among creator gods? I could go on for a while, or even make up shit on my own. Where do you draw the line?

      The impracticality of it aside, I wonder if this path were taken it would result in a great deal of public education.

    21. Re:The good doctor was a vicar instead by Anonymous Coward · · Score: 0

      Windows is like wanking off: it's very convenient, and everyone does it. Including Linux sysadmins (except the ones with beards).

    22. Re:The good doctor was a vicar instead by syousef · · Score: 2, Insightful

      Plenty of other people think that science is compatible with religion and spirituality because they address different concerns.

      People who say that usually do so due to pressure to be politically correct and/or to justify irrational beliefs that they themselves hold.

      No spiritual or moral code can be valid if it is inconsist with the truth. The truth is best understood via the scientific method. Sure if it's not provable or ther is some leeway for interpreting the truth, there is room for a moral code and you could call that religion or spirtuality. However you can't simultaneously hold the belief that the world was created in 6 days by a god and that it was created over billions of years and that life evolved over a long period. Therefore any religion that insists in the former is incompatible with the truth as we best understand it. The trouble then is if a religion is considered wrong about something so fundamental, how do you take the rest of that religion seriously? How much more of that religion is wrong.

      Another fundamental problem with religion is that there are so many competing and mutually exclusive religions and belief sets. Most dismiss the others as flawed or evil (false gods etc.) Which one you are born into is a matter of blind luck. So to believe in a religion based on traditional values makes no sense as opposed to believing in a process that can be improved, includes provability and testability and isn't mutually exclusive with a whole raft of competing belief sets.

      --
      These posts express my own personal views, not those of my employer
    23. Re:The good doctor was a vicar instead by Dhalka226 · · Score: 1

      Speaking as an agnostic (or atheist, depending on how we're defining it--I do not believe there is a god):

      However you can't simultaneously hold the belief that the world was created in 6 days by a god and that it was created over billions of years and that life evolved over a long period.

      This is true, but it's misleading. I see no reason to believe that one cannot simultaneously believe in evolution and a universe millions of years old and a god at the same time.

      What you're essentially saying is that one cannot believe in the Bible as literal truth and science at the same time, and that perhaps if that foundation is unseated then one cannot even believe in Christianity and science at the same time. This I support completely, but it doesn't mean it's impossible or illogical to believe in the existence of a god--perhaps one described by some other religion, perhaps one we know absolutely nothing about except the rules that govern our universe that we determine through science.

      As I said, I do not believe in any god and I absolutely loathe organized religion, so I'm not trying to rationalize my beliefs nor do I feel any pressure toward political correctness here.

    24. Re:The good doctor was a vicar instead by Seraphim_72 · · Score: 1

      Eventually, science will shine a light on all of the little dark crevices that religion hides in. We CAN know certain things that are explained in the bible. We CAN know where our inherent morality comes from, we CAN know how the universe was created and how long it took.

      I congratulate you on your Faith. Try re-reading your post not as from you, but as from someone you are watching in robes at a pulpit. You are becoming the thing you hate. Two quotes for you:

      "No, sir, science has no room for an inquisition of its own, and your desire to purge the heretics is best kept to yourself." - physicsphairy (720718)

      "He who fights with monsters should look to it that he himself does not become a monster." -Nietzsche

      --
      Slashdot, where armchair scientists get shouted down and armchair theologians get modded up.
    25. Re:The good doctor was a vicar instead by FlightlessParrot · · Score: 1
      Jesus Fucking Christ, why don't you drive all theists out of science education all together? Precisely this frenzy over a misquotation, perpetuated in the Slashdot summary that calls him a creationist, when he obviously isn't, is the kind of bigotry that is encouraged by Dawkins, who is too narrow-minded to engage with theists who are not raving fundamentalist loonies, and who chooses to believe that they are just giving cover to them.

      No, I'm not a theist. I started reading _The God Delusion_ hoping a distinguished evolutionary scientist might offer some explanation as to why belief in gods, or God, or the supernatural, is so common amongst our species. You know, maybe it's like our intuitive physics, which is wrong, but useful in catching and throwing things. No such luck. Maybe he's just concerned with getting TV time and making money, and he knows that joining in a controversy raging in the US (and almost nowhere else) is a better way to attention and money than thoughtful contributions to knowledge.

      Anyway, here's a guy who says, "Maybe it's better education to engage with a mistaken point of view than rounding on it and trying to just drown it out with censorship." Sounds a bit like the scientific approach to me. And what happens? A rabid pack forms. Ain't just the Christers that can get intolerant, it seems.

    26. Re:The good doctor was a vicar instead by Mike610544 · · Score: 1

      Plenty of other people think that science is compatible with religion and spirituality because they address different concerns.

      I'm not sure who these "plenty of other people" are, exactly, but I suspect they're not real scientists if they're comfortable with allowing dogmatic religion to coexist alongside science.

      Adding the word "dogmatic" really creates a strawman doesn't it? There are two modded up responses here that say basically the same thing: religious people can't be good scientists. That's bullshit. People who understand the separation between the two can be (and have been throughout history) just as effective as atheists/agnostics. The backlash against the "teach creationism as science" thing seems to be getting more and more shrill. There's starting to be a witch hunt vibe that I see undermining our argument.

      --
      ... also, I can kill you with my brain.
    27. Re:The good doctor was a vicar instead by Anonymous Coward · · Score: 0

      Plenty of other people think that science is compatible with religion and spirituality...

      Those people also happen to believe in idols, gods, and deities. Real scientists don't, thus they understand that religion is completely and utterly unscientific.

    28. Re:The good doctor was a vicar instead by drsquare · · Score: 1

      What?! No. It's 70 odd percent christian.

      Perhaps he's not counting 'christians' who only go to church for weddings and funerals.

    29. Re:The good doctor was a vicar instead by Nazlfrag · · Score: 2, Interesting

      Albert Einstein had a lot to say about religion, I'd recommend not bring him into your argument unless you wish to be humbled. Here's some choice quotes:

      "Intelligence makes clear to us the interrelationship of means and ends. But mere thinking cannot give us a sense of the ultimate and fundamental ends. To make clear these fundamental ends and valuations and to set them fast in the emotional life of the individual, seems to me precisely the most important function which religion has to form in the social life of man."

      "All religions, arts and sciences are branches of the same tree. All these aspirations are directed toward ennobling man's life, lifting it from the sphere of mere physical existence and leading the individual towards freedom."

      "The highest principles for our aspirations and judgements are given to us in the Jewish-Christian religious tradition. It is a very high goal which, with our weak powers, we can reach only very inadequately, but which gives a sure foundation to our aspir ations and valuations. If one were to take that goal out of out of its religious form and look merely at its purely human side, one might state it perhaps thus: free and responsible development of the individual, so that he may place his powers freely and gladly in the service of all mankind. ... it is only to the individual that a soul is given. And the high destiny of the individual is to serve rather than to rule, or to impose himself in any otherway."

      Then again, he supports your assertion that a scientist would dismiss many of the trappings of religion.

      "Scientific research is based on the idea that everything that takes place is determined by laws of nature, and therefore this holds for the action of people. For this reason, a research scientist will hardly be inclined to believe that events could be influenced by a prayer, i.e. by a wish addressed to a Supernatural Being." ~ Albert Einstein, 1936, responding to a child who wrote and asked if scientists pray.

      "A man's ethical behavior should be based effectually on sympathy, education, and social ties and needs; no religious basis is necessary. Man would indeed be in a poor way if he had to be restrained by fear of punishment and hope of reward after death."

      He also had a nice prediction for the future:
      "The religion of the future will be a cosmic religion. The religion which based on experience, which refuses dogmatic. If there's any religion that would cope the scientific needs it will be Buddhism...."

      To suggest that the metaphysical is outside the domain of science is to deny the reality of scientific ideas themselves. Reality is more vast than even the wildest imagination can comprehend, and religion is a useful tool to explore the wider realm of the metaphysical.

      As someone once said, judge not, lest ye be judged.

    30. Re:The good doctor was a vicar instead by syousef · · Score: 1

      What you're essentially saying is that one cannot believe in the Bible as literal truth and science at the same time, and that perhaps if that foundation is unseated then one cannot even believe in Christianity and science at the same time. This I support completely, but it doesn't mean it's impossible or illogical to believe in the existence of a god

      It's not impossible but it is illogical to select a religion by birth, location or comfort factor and state that you believe a particular interpretation of it above all other religions.

      perhaps one described by some other religion, perhaps one we know absolutely nothing about except the rules that govern our universe that we determine through science.

      Choosing a religion is like playing a shell game with lots of shells and no peas under the shell. There is nothing compelling about one religion over another. They're all based on mystical untestable nonsense. As for some hypothetical God we know nothing about I'm going to take a pragmatic approach and say that even if one does exist, unless we can get useful contact with this entity we might as well use Occam's razor.

      --
      These posts express my own personal views, not those of my employer
    31. Re:The good doctor was a vicar instead by khanyisa · · Score: 1

      You're assuming that being a scientist has to be your primary definition in life, with all others subject to that.

      Being a scientist should mean that you can apply the scientific process to science. It's not necessarily clear how to apply it to, for example, the existence or otherwise of the human soul (let's see, Take soul, separate from body, observe effect on brain... can I try it on you?). You may not believe that anything other than physical observable matter and energy exist, but that doesn't mean that they don't, or that the scientific method would be the best way of examining them.

    32. Re:The good doctor was a vicar instead by Anonymous Coward · · Score: 0

      You are correct that it would have been convincing if renouncing and denouncing religion altogether were his aim. Clearly, that is not the case. Nor does the tone of his resignation suggest any disrespect for the theory, practice, or establishment of science. I am quite confident that this man retains both a respect for the scientific method and also his religious faith. He resigned to avoid the appearance of impropriety within the scientific community. Most probably, his church does not feel as though his involvement in science tarnished his faith. On the other hand, this incident has caused the scientific community to question his credentials as a scientist. He resigned from the community that was at odds with what he had said.

      Like all the other comments I read with regard to this matter, the reference is to religion. I find this difficult to understand since the word science means just that; however, the word religion means many things to different people.
      How can one argue the right or wrong of religion without knowing what religion one is talking about. If we presume one religion is right we indicate that all the other religions are wrong.
      There is only science which is the proving of things by trial or by investigation and experimentation or religion which is a collection of irrational and unprovable ideas derived as a means to explain science before the actual science had been developed.
      With the advance in understanding of the universe over the past few years, all the many religions are redundant and are actually now an impediment to the further advance of human progress.
      I can't understand how any scientist worth his salt can claim to also be a member of any religion as a true believer?

    33. Re:The good doctor was a vicar instead by nietsch · · Score: 1

      Do you know who you are talking to, or do you just want to spout your version of 'the truth'? Northeast of what country?
      In my view, religion equates to dogma and dogma and science do not mix. It is nice if some religious person is truly free of religious dogma, but I have my doubts if they would be that religious, if at all. Are you still a christian if you don't believe their holy man died for their later sins and was resurrected before he ascended to heaven?

      --
      This space is intentionally staring blankly at you
    34. Re:The good doctor was a vicar instead by nietsch · · Score: 1

      As a vicar, he was clearly not one of the peers of the royal society, and when that became clear, the peers asked for his resignation. I have read nowhere that he also was a scientist, if so, what would be his subject. The debating society does not want to be represented by a strawmen either, or some pacifist org by Bush. Yes he was misquoted, be he had to resign because of the perceived contradiction between his faith and his job.

      --
      This space is intentionally staring blankly at you
    35. Re:The good doctor was a vicar instead by iangoldby · · Score: 1

      I'm not sure who these "plenty of other people" are, exactly, but I suspect they're not real scientists if they're comfortable with allowing dogmatic religion to coexist alongside science.

      I'm afraid you lost me right there. You are setting up a dichotomy between "real scientists" and "dogmatic religionists" as if there were no other category.

      I am a Christian and also a scientist by training. I believe that science is a great way to describe the natural world and that probably the vast majority of what we think we know from science is correct, including evolution by natural selection. I also believe that the Christian Bible is the reliable word of God and I don't think that the Bible, when properly understood, contradicts correct science.

      (By the way, if you think that there is no such thing as a 'proper understanding' of the Bible, would you say the same about the natural world?)

      I suspect that the "plenty of other people" would have broadly similar views to myself. Perhaps that just means that they are not "dogmatic religionists" (whatever that means), but it certainly doesn't mean they don't take the Bible seriously.

    36. Re:The good doctor was a vicar instead by VJ42 · · Score: 1

      Tell that to Darwin, who the Anglican Church just now apologized to. Where were the critics that said "science is compatible with religion and spirituality" when the fathers of modern science were all discredited or killed for their beliefs

      Or perhaps tell that to the farther of modern genetics, Gregor mendel. Oh, wait! He was a religious man, a priest, no less. Science and religion can easily live side by side, and have done for hundreds of years.

      --
      If I have nothing to hide, you have no reason to search me
    37. Re:The good doctor was a vicar instead by iangoldby · · Score: 1

      The truth is best understood via the scientific method. Sure if it's not provable or ther is some leeway for interpreting the truth, there is room for a moral code...

      I'm not sure what you think morality has to do with uncertainty in science or leeway in interpreting it. Science describes what actually happens in the natural world, doesn't it? Morality describes what you or I think ought to happen.

      By the way, Christianity does not insist that the world was created in 6 days by God. This view is largely restricted to an admitedly influential and large group of Christians in the USA, but elsewhere in the world it is not a view commonly held. You are quite right though that this does cause a big credibility gap for Christianity in the minds of those who are influenced by the creationist group.

      Just to briefly address your final paragraph: Would it make science as we know it less credible if there were many competing and mutually exclusive 'sciences' in the world, and that which one you were taught from birth depended on where you were born? I think not, because though difficult, it would be possible for anyone to investigate the matter thoroughly and weigh the evidence. The same is true of Christianity amongst all of the other religions. The existance of many falsehoods does not make a competing truth less true.

    38. Re:The good doctor was a vicar instead by JerkBoB · · Score: 2, Insightful

      I'm afraid you lost me right there. You are setting up a dichotomy between "real scientists" and "dogmatic religionists" as if there were no other category.

      Typical. I'll make it simple for you. There really is a dichotomy between those of us who use logic and reason to shape our thinking, and those of you who pick and choose the bits of science which don't conflict with your faith.

      You say you are a "scientist by training", but that you believe in the Bible as the infallible Word of God. I'll skip the tired old arguments about internal Biblical contradictions and just ask this: Why is it that your personal faith is the correct faith? Have you studied religions other than your own? All your rationalizations about WHY you believe what you believe ultimately boil down to personal faith. It feels right to you.

      You believe what you want to believe, and I have to respect that. What I don't have to respect is an opinion that a faith-based explanation for anything is as equally valid as a scientific-based explanation. That's nonsense.

      I find it interesting and illuminating that you chose not to respond to the rest of my post. I'm sure you shrug off those alternative creation stories as rubbish, not fit for consideration. ... But the idea that some random woman was impregnated by an unseen, all-powerful deity (hello, Greek mythology anyone?), and that the offspring of this union is somehow his own father and who sent himself to be sacrificed as part of some scheme to absolve us all of original sin makes sense?

      Sigh. There's no reaching folks like you. You lack insight, and you are willfully ignorant. A very close friend of mine works as a medical doctor in a locked-ward psychiatric hospital. As she puts it, "The ones who say they're crazy really aren't. Usually they're there to get drugs or get a break from the street. It's the ones who insist that they've got a gold orb in their head to receive transmissions from the Freemasons (actual example) who really need help."

      --
      A host is a host from coast to coast...
      Unless it's down, or slow, or fails to POST!
    39. Re:The good doctor was a vicar instead by Anonymous Coward · · Score: 0
      • Christianity is a subset of all religious people.
      • There are strains of Christianity that don't believe that Christ was divine. Unitarianism, for example, rejects the concept of the holy trinity, and considers Jesus to be a great man and a prophet, but not a God. (Btw, there's a difference between Unitarianism, Universalism, and Unitarian Universalists.)

      Considering that Unitarians are still commonly considered Christians, I'd say yes, you can be a Christian even if you don't think Jesus died for your sins.

    40. Re:The good doctor was a vicar instead by aaron+alderman · · Score: 1

      Or uninstall Windows?

    41. Re:The good doctor was a vicar instead by iangoldby · · Score: 1

      You appear to know what I think better than I do, so I'm probably wasting my time giving you my own opinion since you already know it so well.

      Have you studied religions other than your own?

      Yes.

      All your rationalizations about WHY you believe what you believe ultimately boil down to personal faith.

      To someone whose personal faith rules out the possibility of God then there can be no rational explanation for God. However, my belief in God does in fact rest on a wide variety of evidence. Read the books. Some of them make some good points.

      What I don't have to respect is an opinion that a faith-based explanation for anything is as equally valid as a scientific-based explanation.

      I completely agree with you. Surprised?

      But the idea that some random woman was impregnated by an unseen, all-powerful deity (hello, Greek mythology anyone?), and that the offspring of this union is somehow his own father and who sent himself to be sacrificed as part of some scheme to absolve us all of original sin makes sense?

      No, that makes no sense to me either, but then I'm a Christian; that's not what Christians believe.

      You lack insight, and you are willfully ignorant.

      I honestly don't know how to respond to that. If you can't see your blatant hypocrisy, then I doubt that any further explanation by me is going to help.

    42. Re:The good doctor was a vicar instead by JerkBoB · · Score: 1

      To someone whose personal faith rules out the possibility of God then there can be no rational explanation for God. However, my belief in God does in fact rest on a wide variety of evidence. Read the books. Some of them make some good points.

      In fact, my personal "faith" (oh how religious apologists love that logical diversion) does not rule out the possibility of God. I do not profess to have proof against the existence of God. Nor do I claim to "know" in my heart of hearts that there is no God.

      I am an atheist in the sense that I am a-theist. I am without a belief in a higher power. I don't need it in order to love and be loved. I don't need it in order to get up every morning, appreciate my wife and children, and go to work every day. Belief in a higher power is unnecessary and irrelevant to me.

      I simply reject the premise that I must live my current life in a certain way in order to have any chance at some kind of afterlife. I don't believe in an afterlife, because I see no proof of an afterlife. Since I don't believe in an afterlife, I have no reason to jump through a particular set of hoops designed to get me into a given afterlife.

      In the end, isn't that what all religions boil down to? Yes, there are arguments to be made about doing good while on Earth etc. etc. But really, it's carrot and stick. Believe (and tithe, and spread the meme), and live eternally in God's grace and mercy. Doubt, and go to Hell (or whatever the PC term for not going to Heaven is these days).

      Can you rationalize the "correctness" of your particular brand of Carrot & Stick, without resorting to tautologies? No, you can't. You believe what you want to believe, and you find evidence for your belief system, because that's what the human mind excels at. Evidence which conflicts with your belief system is discarded.

      But the idea that some random woman was impregnated by an unseen, all-powerful deity (hello, Greek mythology anyone?), and that the offspring of this union is somehow his own father and who sent himself to be sacrificed as part of some scheme to absolve us all of original sin makes sense?

      No, that makes no sense to me either, but then I'm a Christian; that's not what Christians believe.

      Oh, no? Please inform me as to what aspect of the Immaculate Conception I've misunderstood. I guess 10 years in private Christian schools wasn't enough to get the "correct" version of the dogma through my thick skull.

      --
      A host is a host from coast to coast...
      Unless it's down, or slow, or fails to POST!
    43. Re:The good doctor was a vicar instead by festers · · Score: 1

      Oh, no? Please inform me as to what aspect of the Immaculate Conception I've misunderstood. I guess 10 years in private Christian schools wasn't enough to get the "correct" version of the dogma through my thick skull.

      The "Immaculate Conception" is a Catholic concept which claims that Mary was born without sin. It is not a universally accepted Christian teaching by any stretch of the imagination.

      You may want to tone down the arrogance in the future, you aren't helping your case.

      --


      -------
      "Every artist is a cannibal, every poet is a thief."
    44. Re:The good doctor was a vicar instead by JerkBoB · · Score: 1

      The "Immaculate Conception" is a Catholic concept which claims that Mary was born without sin. It is not a universally accepted Christian teaching by any stretch of the imagination.

      You may want to tone down the arrogance in the future, you aren't helping your case.

      You're right. I used the wrong term for the virgin birth story, where God got some virgin (who may or may not have been born without sin) pregnant with His own Son, who is also Himself, and He did it so that His own Son could be killed and resurrected and believethed in and give us all everlasting life. There goes the rest of my argument!

      You know what? I don't know all the finer points of Scientology or Islam, or Hinduism, or Sikhism either. Does that change my argument that they're all based in arbitrary, inconsistent belief systems? No, it doesn't.

      As for my arrogance... How am I being arrogant, exactly? Am I arrogant because I pointed out that Christian mythology has borrowed heavily from other, earlier mythologies? Or is it because I suggest that clinging to a fixed belief system is irrational? Or what?

      --
      A host is a host from coast to coast...
      Unless it's down, or slow, or fails to POST!
    45. Re:The good doctor was a vicar instead by nEoN+nOoDlE · · Score: 1

      Science and religion can easily live side by side, and have done for hundreds of years.

      Sure, when there isn't really a choice in the matter. It's like saying "Religion has brought us all this amazing art over the history of humanity!" Well, yes... but it kinda was the only game in town for the time.

      --
      Don't trust a bull's horn, a doberman's tooth, a runaway horse or me.
    46. Re:The good doctor was a vicar instead by GospelHead821 · · Score: 1

      I can't understand how any scientist worth his salt can claim to also be a member of any religion as a true believer?

      It isn't unscientific to ask philosophical questions about the nature of the universe. I address scientific matters with science and philosophical matters with faith. I allow science to explain the mechanisms of the universe and religion (Lutheran-flavoured Christianity, in my case) to explain the rationale behind the universe (ie: WHY does the universe exist at all?) You might argue that no scientist worth his salt bothers with a question that defies rational explanation, but I would call that a "no true Scotsman" fallacy.

      You might also argue that using faith as an explanation for anything precludes trying to use the scientific method to explain it. There are several points that I could make against this argument. 1) I give the scientific method precedence over faith. If science contradicts my faith, then I have misinterpreted something. I believe that there is one truth, that God has not set up the universe to confuse us, and that reason is a gift from God. Therefore, when reason concludes something, I believe that it must be true. 2) I understand that my faith is personal and that "because God did it" is never an appropriate explanation in scientific context. 3) Unlike some Christians, I never try to invoke aesthetic reasons against science. "A loving God would never use an ugly tool like evolution" is anathema to me. I am more likely to operate in the opposite direction. I find the beauty of the mechanisms of the universe to be a testimony of the greatness of God.

      --
      Virtue finds and chooses the mean.
      Aristotle, Ethica Nichomachea
    47. Re:The good doctor was a vicar instead by nietsch · · Score: 1

      Does anyone care about the idiotic differences between churches? For I don't. It's more about power than philosophy if you ask me.
      But you are not religious anymore if you skip all religious dogma, IMHO.

      --
      This space is intentionally staring blankly at you
    48. Re:The good doctor was a vicar instead by theLOUDroom · · Score: 1

      You're assuming that being a scientist has to be your primary definition in life, with all others subject to that.

      No I'm treating scientist as a role, not as an all encompassing definition of any particular person.

      There are rules for how a person assuming this role acts. Any person may abandon these rules, but they then cease to be a scientist for the purpose of any discussions where they have abandoned the rules.

      It's not necessarily clear how to apply it to, for example, the existence or otherwise of the human soul

      Actually it's pretty clear. First you need to define a theory. Things like the existence of the soul usually fail at this first step. It similar to my favorite theory: "I have an invisible nerf ball that floats above my head and follows me everywhere I go."
      It's a perfectly valid "concept" but it is not a theory since it is BY DESIGN not falsifyable and makes no predictions. Science = 1, Nerf Ball = 0

      --
      Life is too short to proofread.
    49. Re:The good doctor was a vicar instead by theLOUDroom · · Score: 1

      Albert Einstein had a lot to say about religion

      Which, of course, I knew that in bringing up his name someone would come out of the woodwork and prove me correct.

      So tell me this: How many scientific theories did Einstein have about religion?
      How many did he publish formally or subject to experiments?

      Einstein may have said a lot of things about religion but he was typically not acting as a scientist when he did so.

      If Einstein had made broad sweeping generaizations with no evidence to back them and no coherent theory attached when discussing the migratory habits of Geese, these statments would be dismissed, not treated as great work by a great man. On the subject of religion people seem to accept anything a scientist says as "science" regardless of whether any of the criteria of the scientific process are followed.

      To suggest that the metaphysical is outside the domain of science is to deny the reality of scientific ideas themselves.

      Perhaps in a philosophy class full of crack pots. Many of us actually understand that the equivalent of "I have an invisible nerf ball that floats above my head and follows me everywhere I go." Is simply not science because it fails the basic criteria.

      --
      Life is too short to proofread.
    50. Re:The good doctor was a vicar instead by dasunt · · Score: 1

      Does anyone care about the idiotic differences between churches? For I don't. It's more about power than philosophy if you ask me.

      I care about the difference. I'd like to see more liberal churches who believe in progressive causes and the sanctity of human life, equal rights regardless of gender and sexual orientation, and the plight of the less fortunate. Perhaps you don't care about these issues, but I do.

      But I think that all attempts to explain the differences between different churches, and to point out there are different religions, have been lost on you. I don't know what has colored your perception of Christianity (perhaps some conservative radicals and public figures such as Fred Phelps), but it seems you are unwilling to examine your own assumptions about what religion is or is not.

      So it goes.

    51. Re:The good doctor was a vicar instead by khanyisa · · Score: 1

      The problem with that is that your very existence as a conscious observing entity is taken for granted (but cannot necessarily be explained in terms of the very theories you promote) , which has serious consequences in terms of (for example) your moral and ethical approach to theories :-)

  20. director to professor by zrq · · Score: 2, Informative

    I'm not sure about whether he should have resigned or not, but I found this quote from the Royal Society statement interesting (from the BBC article) :

    Professor Reiss and the Royal Society have agreed that, in the best interests of the society, he will step down immediately as director of education
    ....
    He is to return, full time, to his position as professor of science education at the Institute of Education

  21. Sigh, ... by geekoid · · Score: 5, Informative

    Gravity is a fact, the Theory of gravity is the mechanism by which it works.

    Evolution is a fact, Darwin's Theory of evolution is the mechanism by which it happens.

    --
    The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    1. Re:Sigh, ... by servognome · · Score: 1

      Gravity is a fact, the Theory of gravity is the mechanism by which it works.

      Gravity is not a fact, it is a logical conclusion given a large body of facts (individual observations).
      There is nothing to deny that tomorrow everything could just float away (though extremely unlikely); the facts didn't change, just a new set of facts have been introduced into the discussion set.
      The law of gravity describes the current data data set. The theory of gravity takes things a step further to introduce method for predicting future observations

      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
    2. Re:Sigh, ... by Anonymous Coward · · Score: 0

      Gravity is a fact, the Theory of gravity is the mechanism by which it works.

      Evolution is a fact, Darwin's Theory of evolution is the mechanism by which it happens.

      *SIGH*

      Gravity is a fact, the theory of gravity is the best explanation we've found so far to what we observe.

      Evolution is a fact, the theory of evolution is the best explanation we've found so far to what we observe.

      Unfortunately, neither define "mechanisms." Once we will be sure of the "mechanisms," we won't have theories anymore, we will have Laws.

      A theory is: "I think it works this way."
      A law is: "it works this way."

  22. You slashdotters tend to be Militant Atheists by Anonymous Coward · · Score: 0

    I feel most of the scientific community are closet Militant Atheists, as are a good portion of you slashdotters. As previously written, a scientist should be able to state his ideas without fear of reprisals.

    1. Re:You slashdotters tend to be Militant Atheists by OldFish · · Score: 2, Interesting

      Wrong. I am an irrelevantist. Religion is without value except as a curiosity of human behavioral defects.

    2. Re:You slashdotters tend to be Militant Atheists by couchslug · · Score: 1

      "I feel most of the scientific community are closet Militant Atheists,"

      Logic and reason might well make one antagonistic to superstition.

      --
      "This post is an artistic work of fiction and falsehood. Only a fool would take anything posted here as fact."
    3. Re:You slashdotters tend to be Militant Atheists by Anonymous Coward · · Score: 0

      A scientist should be able to take criticism without accusing everyone else of being "militant atheists" (whatever that means). You have the freedom to talk about creationism all you want, but you can't expect the rest of the world to agree with you.

    4. Re:You slashdotters tend to be Militant Atheists by largesnike · · Score: 0, Flamebait

      Then you may have a problem, since by your own beliefs, you are irrelevant to everything but you. So to any one else who is an irrelevantist, your statements should be disregarded as off-handedly as you have disregarded 5000-odd years of moral teachings and culture.

      --
      "Laugh while you can a-monkey boy!" - Dr Emilio Lizardo
    5. Re:You slashdotters tend to be Militant Atheists by Anonymous Coward · · Score: 0

      Ok, gloves go off, time to forget the scientific aproach and deal with creationism on a pure spiritual level:
      The part of me that agrees with the ideas that Jesus tried to spread cringe at the people who have a need to verify the details of the old book up to the letter. Does the validation of these details validate the words of jesus in some way? Are these validations required to understand the important underlying message? Is your faith and willpower so weak you need pseudofacts to continue living as jesus told you to?

  23. What is their next move? by Anonymous Coward · · Score: 0

    I wonder if they are checking to see who owns Bibles or attends a church, because that is where this is heading...

  24. Yeah leave the good doctor alone... by sneakyimp · · Score: 0, Flamebait

    They should be forcing Sarah Palin to resign instead.

  25. God spoke English in 4004 BC? by mrmeval · · Score: 2, Funny

    Wow, cool. So the KJV is the original word of God.

    --
    I'd go on a Vegan diet but the delivery time from Vega is too long. --brownkitty
    1. Re:God spoke English in 4004 BC? by Cassius+Corodes · · Score: 2, Funny

      English is his preferred language. He could speak Hebrew, but he always had a thick accent.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    2. Re:God spoke English in 4004 BC? by PopeRatzo · · Score: 3, Funny

      So the KJV is the original word of God.

      My neighbor Yoshi disagrees, as does my neighbor Ramanathan and my neighbor Ali. I'd ask my neighbor Steve, but he's an Evangelical, and at the moment he and his wife are getting their nightly word of God from Fox News.

      --
      You are welcome on my lawn.
    3. Re:God spoke English in 4004 BC? by mrmeval · · Score: 1

      I'm partial to the one written on plates...

      with pasta. ;)

      It's fun! You get to throw spaghetti up in the air and let ceiling cat take his share, catch some on your plate which will spell out THE WORD and the rest goes to basement cat though some might go to lap cat.

      Last night's word was bloorglplicly!

      --
      I'd go on a Vegan diet but the delivery time from Vega is too long. --brownkitty
  26. Personal Belief by Anonymous Coward · · Score: -1, Troll

    Personal belief is the dominate, neither creationism or evolutionism should be stated by others as a fact, truth is no one knows.

    Missing links in theorys of evolution, Creationism based on words carried down from our ancestors.

    Neither should be taught as a fact, both should be taught.

  27. No religious tollerance in science!!! by mlwmohawk · · Score: 0, Troll

    I'm sorry, but it is just not acceptable to have someone who can believe in myths and nonsense in charge of science.

    Science takes intellectual honesty. It is too easy to fool one's self. If you have the predilection to believing absurdities, you are automatically disqualified from being a scientist.

    1. Re:No religious tollerance in science!!! by mlwmohawk · · Score: 1

      People may see my post as a troll, but while it is strongly worded, it is not intended as a troll.

    2. Re:No religious tollerance in science!!! by Anonymous Coward · · Score: 0

      They're modding you down because you obviously didn't RTFA.

    3. Re:No religious tollerance in science!!! by Weedlekin · · Score: 1

      "it is just not acceptable to have someone who can believe in myths and nonsense in charge of science."

      I didn't know anyone was "in charge of science"-

      "If you have the predilection to believing absurdities, you are automatically disqualified from being a scientist."

      Ah, I now see I was wrong, because it's obvious from this quote that you are in charge of science by dint of having the power to say who can and cannot be a scientist.

      --
      I'm not going to change your sheets again, Mr. Hastings.
    4. Re:No religious tollerance in science!!! by mlwmohawk · · Score: 1

      They're modding you down because you obviously didn't RTFA.

      Ordained clergy have no place in a scientific organization.

      I would say that the above sentence is true in every respect.

  28. Expelled! by McGregorMortis · · Score: 1

    As far as I can tell, what Prof. Reiss actually said was not very unscientific at all.

    It seems to me that this whole episode has the Royal Society played right into the hands of Ben Stein and the clowns behind that Expelled crap. They couldn't have asked for a better example of the kind of "persecution" they claim they're being subjected to.

  29. Re:What a waste. -- Mod up by mdwh2 · · Score: 5, Insightful

    They can now decry the persecution of this individual (you know they will) and get good millage out of the argument because they would not have be totally wrong in this case.

    That's an excellent point.

    And not just IDers, but also anyone who wants to paint atheists as being unreasonable - for example, I see that the Daily Mail are already at it: http://www.dailymail.co.uk/news/article-1056715/Top-scientist-supported-teaching-creationism-schools-hounded-Royal-Society.html .

    For non-UK readers - the Daily Mail is a conservative right wing tabloid. Whilst it doesn't seem to support Intelligent Design, it is very pro-Christian, and anti-atheism, and this is just the story it loves: look at the references to being "hounded" after a "campaign" by "militant atheists" / "atheist scientists". And the sad thing is that, for once, I can't fault their story for being misleading - despite the biased phrasing, it's one of the few media outlets to be reporting what actually happened.

  30. correct the slashdot story, damn it ! by Anonymous Coward · · Score: 0

    Please correct the slashdot story. Nowhere did he say that creationism should be taught at school. You are doing exactly the same thing as the journalists that misquoted him.

  31. He was NOT misquoted! by mangu · · Score: 4, Insightful

    He was bullied out for a misquote.

    Well, that's not what his blog in The Guardian says. He says: "I feel that creationism is best seen by science teachers not as a misconception but as a world view".

    Anyone who feels that creationism is not a misconception has no place in the direction of such an important scientific body as the Royal Society. Even if he feels that students who have been raised by creationist parents will not change their point of view easily, that's no reason to tolerate such nonsense in a science class. What next, will he say that one must accept criminal behavior from students that have been raised by criminal parents?

    The correct procedure would be, in my opinion, not to accept discussion of creationist nonsense, but to explain why evolution is a scientifically correct theory.

    1. Re:He was NOT misquoted! by JonathanBoyd · · Score: 0, Redundant

      Anyone who feels that creationism is not a misconception has no place in the direction of such an important scientific body as the Royal Society.

      You're doing exactly what the media has done by misunderstanding him. He didn't say it was a misconception, he said it was a bigger more complicated issue. If it was a simple misconception, you could argue that a person's understanding of the scientific method was flawed. As par of a worldview, however, it is possible for someone to understand and be able to employ the scientific method in all areas, except for evolution because here their worldview take priority i.e. they are capable scientists and understand the satnce of scientists on the issue, but reach a different conclusion based on their worldview.

      The trouble is that so many people assume that Creationist = can't do science, but the disagreement doesn't necessarily come down to an inability to 'do' science. In fact, your post is an example of the attitudes that prompted him to speak out in the first place.

    2. Re:He was NOT misquoted! by Tacvek · · Score: 1

      It is clear he thinks it is a misconceived worldview. However, it is the job of teachers to dispel misconceptions, and they would feel that they have failed if they had not. However, for those who have it, biblical fundamentalism is not a misconception that can be generally be cured. So teachers should not put too much effort into trying to dispel it, but should be able to show how it is not falsifiable, and thus is not science.

      --
      Stylish sheet to fix many problems in Slashdot's D3: https://gist.github.com/801524
    3. Re:He was NOT misquoted! by ArsonSmith · · Score: 1

      I feel that higher taxes is best seen by conservatives, not as a misconception, but as a liberal view.

      I feel that smaller government is best seen by liberals, not as a misconception, but as a conservative view.

      I feel that entitlement programs is best seen by conservatives, not as a misconception but as a liberal view.

      I feel that personal responsibility is best seen by liberals, not as a misconception, but as a conservative view.

      If a bunch of people believe something, as in the case of creationism, then there needs to be a better way to approach the changing of public perception than to just say, "Shut the F___ up your wrong." Debating Darwin vs. ID in a science class is as bad as debating vi vs emacs in an A+ certification course. Sure they are related, but they aren't the subject. A science class should be teaching the scientific method, critical thinking and evaluation of evidence. Once these principals are established it's obvious what will prevail.

      --
      Paying taxes to buy civilization is like paying a hooker to buy love.
    4. Re:He was NOT misquoted! by Anonymous Coward · · Score: 2, Insightful

      Anyone who feels that creationism is not a misconception has no place in the direction of such an important scientific body as the Royal Society.

      This is not what he stated. Read the citation again.

      "I feel that creationism is best seen by science teachers not as a misconception but as a world view."

      He is suggesting a different approach. Nowhere does he suggest creationism is not a misconception. That's something you are reading into what he has said.

    5. Re:He was NOT misquoted! by Sockatume · · Score: 2, Insightful

      I think a distinction should be made. A misconception is usually small, but a "world view" is a very entrenched thing that can be hard to force someone to reassess. Creationism deserves a different approach than a failure to grasp valence bond theory. He's not asking that we respect the creationism worldview, just that we acknowledge it as a sprawling mess of study, and take it on appropriately.

      --
      No kidding!!! What do you say at this point?
    6. Re:He was NOT misquoted! by againjj · · Score: 2, Insightful

      Assume both the following are true:
      1) Creationism is a misconception, and
      2) Creationism is a world view.
      When discussing creationism, which of the two is more likely to fuel conflict and which is going to foster understanding? When you have a group of people with a world view that differs from yours, discussion will leave both you and them more enlightened, even if they are wrong. In another context, if certain groups view Americans in a particular (wrong) way, it does not work to say that they are wrong, but rather Americans need to understand why they think that way. Otherwise things don't work.

    7. Re:He was NOT misquoted! by Yunzil · · Score: 1

      Well, that's not what his blog in The Guardian says. He says: "I feel that creationism is best seen by science teachers not as a misconception but as a world view".

      Anyone who feels that creationism is not a misconception has no place in the direction of such an important scientific body as the Royal Society.

      I don't think you get it. I think what he was saying is that teachers shouldn't think of creationism as just a little thing that people get wrong. He's saying they should think of it as a way that people look at the world. A misconception is something like, "Water spirals down the drain in different directions in the northern and southern hemispheres". A worldview is something like, "I believe the earth and everything on it were created in entirety by a powerful supernatural being."

      If something thinks water drains in different directions, the teacher can just say, "Nah, it's a myth. The Coriolis effect from the Earth's rotation only really applies to very large things like hurricanes." But if they're going to argue against someone who's been taught from birth that God did it all and evolutionary scientists are evil heathen liars out to subvert our way of life, they need to be well-prepared and know all the arguments and all the rebuttals.

    8. Re:He was NOT misquoted! by mangu · · Score: 1

      he was saying is that teachers shouldn't think of creationism as just a little thing that people get wrong

      Then I have some bad news for you all. People who believe in this "worldview" thing will not be moved by anything less subtle than a baseball bat. What arguments can you present to someone who will not believe in anything that's against his own very narrow preconceived interpretation of the Bible?

  32. Umm by easyTree · · Score: 1, Insightful

    "The Church of England will concede in a statement that it was over-defensive and over-emotional in dismissing Darwin's ideas.

    This seems to imply that the Church's "beliefs" are relevant in today's world. Curious; I was of the opinion that although they clearly control vast quantities of wealth of one form or another and have influence over a certain type of believer, that otherwise the Church's opinions on matters concerning the nature of the universe are considered realistic as those of astrologers (no offence to astrologers.)

    Hasn't science replaced religion? Has religion noticed? Didn't the Church itself stop evolving somewhere back in the dark ages or am I poorly informed?

    1. Re:Umm by againjj · · Score: 1

      I would say that you are poorly informed. The Anglican Church has not stagnated in the Dark Ages, and I would say rides a pretty reasonable line between the fundamentalist nuts and the liberal crackpots, by and large managing to be reasonable with respect to society around them. Please don't confuse the vocal fringes with the mainstream.

      Science is about the "how", religion is about the "why". The creation stories (pl.) of Genesis are stories that say that we are in a special relationship with God. As far as being literal, they are not even consistent with each other if taken truly literally. Science did not replace religion, it augmented it. Many respected scientists are/were religious folk "investigating God's creation". The only reason it took this long to have the Church of England make a statement is that it takes a long time to get people in the Anglican Church to agree with each other.

      Many people make decisions based on the Church's stance on issues, and therefore that stance has import, whether or not you personally believe. Look at the history of almost any western nation. History has been and will continue to be massively shaped by religion. You may be surprised by the number of things coming out of religious beliefs, such as hospitals, orphanages, etc.

      I, for one, am glad to see the Church of England making a public statement, even if it is very late in the making. Perhaps more people will see the more reasonable portion of Christianity instead of the lunatic fringe.

  33. The funny side of "academic freedom" by Anonymous Coward · · Score: 0

    Let's theorise someone holds a post at an educational institution, and makes a controversial statement.

    For example:

    "Western society is endemically a sick culture. People here should appreciate any cultural impulses that comes from elsewhere, because what it replaces is essentially of no value"

    or

    "Men are essentially flesh dildos and less developed than women. It should therefore be a goal for women to become completely independent of men in every way".

    or

    "The people who eat burgers made of meat are essentially ignorant but genocidal murderers. In the ideal society those people are not alive so the animals can be"

    What is the probability that someone making one of these statements would be told to either resign or they would be forced out?

  34. A round of applause for the man. by Sockatume · · Score: 4, Insightful

    He said some really important things about the way we deal with creationism in the classroom, the media and blogosphere misinterpreted, abused and parroted incorrect versions of his comments, and he's got the guts to step down, not only saving the face of the organisation but shouldering blame more rightly levelled at the media, too. I'm sure I speak for all of us when I wish him luck.

    --
    No kidding!!! What do you say at this point?
    1. Re:A round of applause for the man. by Zen+Programmer · · Score: 1

      Well put; exactly my thoughts.

    2. Re:A round of applause for the man. by Anonymous Coward · · Score: 0

      Seriously, I agree with you, but I've read many of the other comments in this article, and you most emphatically don't speak for everyone.

    3. Re:A round of applause for the man. by Sockatume · · Score: 1

      Everyone who's paying attention, then. :p

      --
      No kidding!!! What do you say at this point?
  35. Re:What a waste. -- Mod up by mysidia · · Score: 2, Insightful

    It's beyond unreasonable, they are dogmatic evolutionists to the point where it is a religious point of view of opposing the IDers.

    The facts don't matter; even if some evidence supporting ID appeared, they would hold true to the evolutionist dogma.

    Royal Society behavior makes their mannerism no more concentrated on science and truth than the ID manner of taking their position.

  36. Science by moniker127 · · Score: 2, Insightful

    People are allowed to argue against darwinism. Thats the scientific process. But, darwinism is our best possible explaination for how we are here.

    Religion is not science. In science class, you learn science. If you want to learn religion, you go to religion class (or, church).

    Teaching creationism in science class would make about as much sense as teaching carpentry. Its another subject, one that not all of us care to learn, because not all of us will use it.

    1. Re:Science by adpsimpson · · Score: 1

      Thanks. Interesting thoughts. Glad you agree with Prof Reiss - that's pretty much exactly what he said too.

      --
      Is crushing a suspect's child's testicles illegal?
      John Yoo: "No, [if] the President thinks he needs to do that."
  37. He chickened out!! by Anonymous Coward · · Score: 1, Interesting

    I read the article for the first time after reading parts of the replies here on Slashdot. I have the feeling after reading the article, although I can't know going about this in the wrong order, that I would have been incline to misinterpret the article.

    This being said, I think he chickened out. How can he been chased out of office in 6 days of which only 4 was working days. He could have stand fast and made a difference in the debate.

    His main point is that it's not a science teachers job to change the world view of his pupils, but it could be part of his job to reconcile conflicting ones.

    The human brain doesn't seem to have any problem with this, living in one reality different from another depending on occasion.

    1. Re:He chickened out!! by notrandomly · · Score: 1

      It is a teacher's job to teach the curriculum. It is not a teacher's job to ensure that a student's world view is strengthened. Why would a science teacher reconcile the conflicts between science and religion? That doesn't make sense. The science teacher is supposed to teach science, now how you can re-interpret your religion to fit (some of the) science.

  38. Typical "religion is under attack" argument by hellfire · · Score: 2, Insightful

    ... and it's fallacious. Make it seem like someone who advocates creationism or intelligent design is under attack and that person garners sympathy, but that doesn't make their point of view a valid scientific argument. It's perfectly fine and reasonable in the scientific community for someone to be religious and have religious beliefs. When you start saying that it's okay to pass religion off as a counter argument to science, well then the scientific community has the right to question your credentials as a scientist because you are committing a scientific error, just like if you said the earth is flat.

    Galileo used reason and the scientific method to determine the earth and the planets revolve around the sun. Creationism and intelligent design fail the scientific method's process because they are not something that can be supported by impirical evidence. Under the rules of logic they are merely conjecture.

    Intelligent design is a great thing to discuss in philosophy or theology class in a private institution that is not funded by public money. Governments and scientific institutions should not be in the business of teaching our children religious beliefs and passing them off as biology or physics. Next thing you know, there will be subtle shifts that the government wants us to start believing in a specific religion, to the exclusion of others.

    --

    "All great wisdom is contained in .signature files"

    1. Re:Typical "religion is under attack" argument by Anonymous Coward · · Score: 0

      s/impirical/empirical/

      (Excellent post BTW)

  39. Oh? by SpazmodeusG · · Score: 1

    Which particular theory of gravity is fact?
    Searching for theory of gravity at http://en.wikipedia.org/wiki/Gravity you'll find
    Newtons theory of gravity
    Aristotelian theory of gravity
    Le Sage's theory of gravity
    NordstrÃm's theory of gravity
    Whitehead's theory of gravity
    Brans-Dicke theory of gravity
    Induced gravity by Andrei Sakharov
    Rosen bi-metric theory of gravity
    MOND
    Process Physics theory attempts to address gravity
    The self-creation cosmology theory of gravity
    Nonsymmetric gravitational theory
    Tensor-vector-scalar gravity

    None of which explain observations entirely

    1. Re:Oh? by Joe+the+Lesser · · Score: 1

      The fact is that there is a constant downward force exerted on everything.

      --
      "I only speak the truth"
      Karma: null(Mostly affected by an unassigned variable)
  40. Perhaps more precisely by Chuck+Chunder · · Score: 1

    Gravity is a fact, the Newton's Theory of Gravity is an explanation of the mechanism by which it works.

    Evolution is a fact, Darwin's Theory of evolution is an explanation of the mechanisms by which it happens.

    There are multiple theories attempting to shed light the phenomena of gravity, Newton's theory, general relativity, quantum gravity.

    Evolution is an even more complex phenomena, the result of a whole heap of driving forces and facilitators. It probably makes more sense to talk of the "Theory of Evolution" as a field rather than a single theory.

    --
    Boffoonery - downloadable Comedy Benefit for Bletchley Park
    1. Re:Perhaps more precisely by swordfishBob · · Score: 1

      Gravity is such an observably and repeatable phenomenon that it's accepted globally as fact. There are various theories on how/why it occurs.

      Biological diversity is so observable and extensive that it's accepted globally as fact. Darwin's theory of evolution is a proposed description of how/why it occurs. The theory is supported by many observable artifacts. Evolution not something that has been demonstrated repeatably in a controlled environment, so we shouldn't call it "fact". We can, however, call it scientifically the most plausible and broadly accepted explanation for biological diversity.

      --
      -- All your bass are below two Hz
    2. Re:Perhaps more precisely by The+Famous+Brett+Wat · · Score: 1

      "Falling" is an experience. A particular instance of a thing falling is a fact. (It's a fact that when I dropped my mobile phone earlier, it fell to the floor.) Aristotle, Newton, and Einstein have theoretical models which attempt to incorporate "falling" in their scope.

      "Biological variation" is an experience. A particular instance of generational change is a fact. (It's a fact that lions and tigers have cross-bred and produced viable offspring.) Lamarck and Mendel have theoretical models which incorporate biological variation in their scope.

      The origin of life is not an experience. It was thought to be an experience (known as "spontaneous generation"), but the work of Pasteur was sufficiently persuasive that most people now agree that life comes only from life. It's reasonable to assume, however, that it is a fact of the past that life had an origin. (Presumably, there was at some point nothing that could be called "a living organism", but now there is, and this implies an origin.) Evolution and creation are loose theoretical models (each has plenty of room for specific variation) which incorporate the origin of life in their scope. Evolution is the set of all naturalist theories of origin, and creation is the set of all interventionist theories of origin.

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
  41. Open interpretation != a bad thing. by Anonymous Coward · · Score: 0, Troll

    Science cannot, as of last check, account for the origin of matter in any empirical way. Nor can creationism.

    Furthermore, elements of evolution -can- coexist with creationism. You need not say, "we've evolved, therefore we cannot have been created", nor "we were created, therefore we cannot have evolved".

    Unbelievably sound arguments can be provided against EITHER creationism OR evolution. Creationism need not be true due to a lack of empirical evidence, scientific basis, or an account for the creation of whatever the 'creationary force' may be, or a million other reasons. Evolution need not be true due to its lack of a concrete explanation for the appearance of matter, the fact that things such as color or sound needn't exist in such a model (it's not so you can 'hear' your enemies approaching, as many would say, as there would be nothing to 'hear' at all if such a concept as sound never existed - this implies some level of creative conjuring).

    Nor does it account for the variance of species (there are far fewer disparate environments than disparate species) or food groups (a food 'chain' need not exist), the seeming suitability of our form (blobs would suffice) and our habitat. (There are, after all, things in existence which don't 'need' to -be- in existence, and if evolution were a perfect theory, this would not be the case.)

    And I -do- understand that this post will be received with warring retaliation, regardless of whether it should or should not be (I'm not dismissing or supporting anything). I'm merely pointing out that there is no harm in leaving the unknown open for interpretation, for this is, in fact, the only way science has ever come to fruition.

    If you do wish to retaliate (either way), please do the following:

    - Cover all of the above issues.
    - In addition (creationists): Explain the creation of whatever creationary force you believe in.
    - Or (evolutionists): Explain the evolutionary significance of a pine comb.

  42. and the debate goes on and on and on by Anonymous Coward · · Score: 0

    Unfortunately what Mr. Dawkins and his drones do for science is the same as what creationists do for evolution.
    Without a valid argument how can you hope to ever win over the opposition? One must know their "enemy" if they wish to claim victory.
    I understood what Reiss meant when I first read his article, I didn't need clarification. He is simply stating that in order for one to understand something, in order to be able to fully support your stance, you should know BOTH sides of the argument. How ever silly you may think the opposition is, calling someone a moron or idiot without having factual statistics to support your idea only shows your ignorance of the ideas you are in direct contention of.
    I applaud Reiss for his ideas. Rather then sweeping away what seems to some as fairy tales, embrace it, learn about it, be willing to listen. Hiding from it won't solve anything. The fact is a majority of Americans believe in creationism of some form. They didn't go to college level biology and chemistry classes and are ignorant in most cases, but so are the college graduates who've never opened a bible.
    I am currently pursuing a molecular biology degree and fully believe in the evolution of life on this planet. I also believe in a creator. Say for a moment that God or whatever you want to call him/her/it is real. We know the evolution of life after the big bang is as good as fact. Therefore would there not have to be a way for the two to coexist? I don't believe in ID, I believe in the beautiful chaos of random selection and chance. I've found a way for two seemingly at odd ideas to coexist quite happily. I came to that decision after trying to gather more information to support my atheist beliefs. I think its a shame all we can do is fight with each other when the majority of those fighting are only knowledgeable on their specific belief, as little as it unfortunately may be, and have no way to reasonably debunk or argue the opposing issue.

    1. Re:and the debate goes on and on and on by TheDugong · · Score: 1

      "Say for a moment that God or whatever you want to call him/her/it is real. We know the evolution of life after the big bang is as good as fact. Therefore would there not have to be a way for the two to coexist?"

      If there was any evidence whatsoever for there being a god, this would be a valid point. However, as there is none, it is not.

    2. Re:and the debate goes on and on and on by Weedlekin · · Score: 1

      "If there was any evidence whatsoever for there being a god, this would be a valid point. However, as there is none, it is not."

      Hence the fact that the Higgs Boson has been nicknamed the "God Particle" for it's stubborn insistence on having no evidence for existing despite it being necessary for the Standard Model.

      --
      I'm not going to change your sheets again, Mr. Hastings.
    3. Re:and the debate goes on and on and on by eears100 · · Score: 1

      Obviously not a philosopher......you forget that as for explaining everything out of nothing there is no theory. No one has ever said that there was nothing before the Big Bang because it would be philosophically preposterous. There was always some force that acted on another force. Where on earth (or in heaven) did these forces come from. If there was nothing then there was no energy. And if there was energy before the Big Bang then it would have to be eternal and self-sustaining to not need another theory to explain it. Eternal and self sustaining sounds a lot like a monotheistic God to me.

  43. That sucks by c6gunner · · Score: 2, Interesting

    I could post my own opinion here, but I think The Panda's Thumb does a much better job of covering this fiasco.

  44. So he was not misquoted at all. by Anonymous Coward · · Score: 0

    Your Guardian article confirms that he wasn't misquoted at all. Mind you, I don't believe for a minute that he's a creationist, but his attitude to the issue was wrong. As you can see from the links below, there is more than one side to the issue, but on balance, I'm glad he's gone.

    For more diverse and in-depth discussions on the topic than you'll find on Slashdot (mainly because they have been going on longer) have a look at for example:

    http://scienceblogs.com/pharyngula/2008/09/michael_reisss_big_mistake.php
    http://richarddawkins.net/article,3100,n,n
    http://richarddawkins.net/article,3119,n,n

    1. Re:So he was not misquoted at all. by Anonymous Coward · · Score: 0

      thanks, - mod parent UP!!!

    2. Re:So he was not misquoted at all. by mdwh2 · · Score: 1

      Your Guardian article confirms that he wasn't misquoted at all. Mind you, I don't believe for a minute that he's a creationist, but his attitude to the issue was wrong.

      By misquoted, it's meant that the media reported he supported teaching creationism. Where does he say this in the Guardian article? Or if that's not what you mean, what is it about his point of view that makes you think it's right for him to resign?

      Now sure, I can see the viewpoint that perhaps it's better not to mention creationism at all, but when all sides are in agreement that creationism is not science, and we should be trying to get pupils to accept evolution, I don't see why this means he needs to resign simply over a difference in opinion in how to tackle the problem of creationism?

      And yes, I have been following this issue on other forums and blogs too.

  45. How about teaching evolution in church by ikeee · · Score: 1

    I would agree with his approach as long as they teach evolution in church. You know, just to have a philosophical discussion. Like, "There's no scientific proof that God exists", "How can you believe in such BS when millions of kids are dying and being abused." If the church goers are open to that then I don't see why we cannot have a similar discussion in schools about creationism.

  46. A thought. by davidangel · · Score: 1

    Just because creationism cannot be studied scientifically doesn't mean the universe wasn't created. Not much to argue about here. Just a thought.

    1. Re:A thought. by grikdog · · Score: 1

      Actually, creationism can be studied scientifically. It doesn't take long. Maybe an afternoon. Evolution, on the other hand, is breathtaking in its implications, scale, scope, relevance and remaining veils not yet gently pulled aside. It's a lot like Einstein's Theory (heh) of Relativity, in that regard. I love evolution and Charles Darwin is my hero.

      --
      ``Tension, apprehension & dissension have begun!'' - Duffy Wyg&, in Alfred Bester's _The Demolished Man_
  47. Only Yoda... by manoelhc · · Score: 1

    I am a Jedi, only my master, Yoda, can explain the human existence. You usually give credits to God for all the things that you aren't able to explain.

    --
    -- Simon said: Die!
  48. Argghhhh! Flat earth, squaring circles, etc. by mlwmohawk · · Score: 1

    Why is this even an issue?
    You don't see political machines engaged in the fight against spherical earth and a sun centric orbit.

    Creationism and ID are no different. Why are there people clinging to myth and superstition?

    1. Re:Argghhhh! Flat earth, squaring circles, etc. by Fluffeh · · Score: 0, Flamebait

      Many people have small minds. Many people NEED to believe that they are so special that some all powerful being created them in his image.

      Me personally, I think it's cool that we evolved from some sludge in the sea. I don't have an issue with what we are or how we came to be.

      --
      Moved to http://soylentnews.org/. You are invited to join us too!
    2. Re:Argghhhh! Flat earth, squaring circles, etc. by neumayr · · Score: 1

      [...]all powerful being created them in his image.

      So you think it all comes down to narcissm?
      Hm, might be a factor, yes...
      I thinks it's the need to believe in an axiomatic Truth, something reliable you can always hang on to, is what makes people cling to superstition. That Truth might as well be the being created in God's image part.
      I'm sure religion has helped many overcome some very grave situations - something science is by definition rather bad at.
      Is it really that surprising people choose faith over science?

      --
      Truth arises more readily from error than from confusion. -Francis Bacon
    3. Re:Argghhhh! Flat earth, squaring circles, etc. by mlwmohawk · · Score: 0, Troll


      Is it really that surprising people choose faith over science?

      See, I think of it the other way. In what sort of world would you want to live? A world where some arbitrary and capricious god or god-like being determines whether you live or die, succeed or fail, based on one of a large number arbitrary religious teachings of which you must choose correctly in order not to be cursed?

      Or would you rather live in a world where the laws of physics and nature are constant for everyone?

      Personally, I'd prefer option B, thank you very much. The whole god thing is nonsense and the fact that people believe that stuff is disturbing.

    4. Re:Argghhhh! Flat earth, squaring circles, etc. by neumayr · · Score: 1

      Modded troll? Don't see why..
      Anyways, you might prefer an universe governed by constant, amoral laws, but what I was trying to point out was that there are perfectly valid reasons to prefer the other option.

      I don't see what you find so disturbing about that - it's not like they affect you personally. Or at least they shouldn't - you shouldn't let them.

      --
      Truth arises more readily from error than from confusion. -Francis Bacon
    5. Re:Argghhhh! Flat earth, squaring circles, etc. by mlwmohawk · · Score: 1

      I don't see what you find so disturbing about that - it's not like they affect you personally.

      If it didn;t affect me, it wouldn't bother me. The unfortunate thing is that these "believers" want to teach my kids "Intelligent Design" in schools. They want my tax money to go to their churches. They want to otherwise limit my rights in accordance to their belief.

      Worse than that, we currently have christians in the U.S. government who don't give a shit about the future because "rapture" will soon be upon us. Just wiki James Watt.

    6. Re:Argghhhh! Flat earth, squaring circles, etc. by neumayr · · Score: 1

      If it didn;t affect me, it wouldn't bother me. The unfortunate thing is that these "believers" want to teach my kids "Intelligent Design" in schools.

      So let them want to. Everyone wants things. Like ponys.
      What's it to you? It's like you're taking it personally - something "believers", as you call them, sometimes do.

      They want my tax money to go to their churches. They want to otherwise limit my rights in accordance to their belief.

      Yes well, if I recall correctly, you people have this thing about religious freedom or something in your constitution. Maybe things would be more fair if atheism was treated like a religion before the law, but I somehow doubt you'd like that very much.

      Worse than that, we currently have christians in the U.S. government who don't give a shit about the future because "rapture" will soon be upon us. Just wiki James Watt.

      That's the thing about representative democracy - you get total nutjobs trying to bring in their ideas. Nothing you can do about it, unless you want to call the whole system into question.

      --
      Truth arises more readily from error than from confusion. -Francis Bacon
  49. Re:What a waste. -- Mod up by superyooser · · Score: 1, Funny

    For non-UK readers - the Daily Mail is a conservative right wing tabloid.

    That's a contradiction in terms. Tabloids are anathema to social conservatives.

    it is very pro-Christian, and anti-atheism

    I have read scores of stories in the Daily Mail over the years (linked from Drudge), and I'm stunned at your opinion. Pro-Christian? On its site right now, there are no fewer than half a dozen headlined stories focusing on the "pro-Christian" topic of boobs--one of them on male boobs. It's like that every day. The site is almost pornographic. I try to ignore the naughty links on the side, and as a follower of the Bible personally, I'm a little ashamed to admit that I read stories there. The site, over all, definitely promotes an atheistic/humanistic philosophy over a Christian one. If the Daily Mail is what passes for "pro-Christian" in the UK media, the rest must have gone to hell, literally. I know it's not really that bad, but you calling the Daily Mail conservative is like Palestinians calling Bill Clinton a Zionist.

  50. ...hmmmm by Anonymous Coward · · Score: 0

    You're all crazy

  51. "Creationist" Resigns by Mr.+Lwanga · · Score: 2, Funny

    Thank God.

  52. what he actually said by Anonymous Coward · · Score: 1, Insightful

    it is possible for someone to understand and be able to employ the scientific method in all areas, except for evolution because here their worldview take priority...i.e. they are capable scientists...but reach a different conclusion based on their worldview.

    If a person is able to employ the scientific method, but then fails to do so regardless of the reason, they are not a competent scientist, ipso facto. To practice science is to follow the evidence wherever it may lead; *not* to follow the evidence unless or until your "worldview" supersedes it.

    In other words, the qualification you attach to "scientist" is an overwhelming one, negating all the force of the argument.

    The trouble is that so many people assume that Creationist = can't do science, but the disagreement doesn't necessarily come down to an inability to 'do' science.

    The thesis of creationism is outside the purview of science. It cannot be shown that the universe was not created five minutes ago, with all our memories and apparent history created in-place as they now appear. In that way it is not science.

    Concluding, through objectively examining all the available evidence, that the thesis of creationism is a true statement about reality is non sequitur. To reach such a conclusion, one must either be selective about the evidence one considers or use spurious (formally fallacious) logic; in other words, the argument is either invalid or unsound via broken premises or implications. In that way it is not science.

    There's one last refuge for them, and it's the bastion of crackpottery and crank-science. It's called denying the inductive step: "Even though the universe looks one way [like it wasn't created by a deity], it could still actually be another way if more evidence becomes available, or it's just a brute fact of reality. That's how some people justify the claim that "fossils are just testing our faith", and other less extreme examples.

    Creationism makes a very specific claim about the nature of reality: that it was created according to the will of a deity, through the power of that deity. Scientific investigation indicates this is probably not the case. Reiss even stated as much in his blog: [I agree with the statement that] "The ideas offered by intelligent design creationists are not the products of scientific reasoning." If you wanted to defend his position, you could have pointed that out instead; why didn't you?

    The point of science is to figure out what reality actually is. A "worldview" that prevents one from discovering certain states, if they end up being true, blatantly prevents one from actually *doing* science, because you one *doesn't* have any a priori knowledge of such invalid states; from our perspective, there are none. That is exactly the weak point of science, and where crackpots and conspiracy theorists attack it, and why they will always have a beachhead.

    At best, he seems to be saying that he doesn't think a creationist "worldview" can be shaken and that everyone deserves to have their ideas respected no matter how poor or parochial those ideas might be. But some ideas are objectively better than others; certain ideas more closely reflect reality than others, no matter what some humans in a backwater star system in a backwater galaxy in a backwater supercluster might opine.

    At worst, this very "worldview" against which he warns is affecting his own judgement. Most scientists think creationism has no place being associated with science, but that belief in it is a very real social phenomenon that should be discussed for what it is (but *not* what it merely claims to be) in the appropriate class on religion, literature, culture, history, or other sociology. In this worst case, he thinks creationism should be addressed as if it were a scientific issue, in a science curriculum. It is not, but he claims quite exp

    1. Re:what he actually said by TheLink · · Score: 1

      "If a person is able to employ the scientific method, but then fails to do so regardless of the reason, they are not a competent scientist, ipso facto"

      Reiss was talking about _teaching_ _students_ the scientific method.

      You do not have to teach competent scientists how to employ the scientific method.

      You cannot teach all students in your classroom to be a competent scientist in 50 minutes.

      But if at the end of a science lesson you can get nearly all of them to behave like competent scientists in a few more areas/things, you have done some good.

      --
    2. Re:what he actually said by JonathanBoyd · · Score: 1

      If a person is able to employ the scientific method, but then fails to do so regardless of the reason, they are not a competent scientist, ipso facto. To practice science is to follow the evidence wherever it may lead; *not* to follow the evidence unless or until your "worldview" supersedes it.

      Nonsense. It merely means that it wouldn't be appropriate for them to conduct scientific investigations in that field.

      The thesis of creationism is outside the purview of science. It cannot be shown that the universe was not created five minutes ago, with all our memories and apparent history created in-place as they now appear. In that way it is not science.

      I never claimed it was and in fact that seems to be very much his point - it's not a misapplication of science, but a worldview that supersedes science.

      Concluding, through objectively examining all the available evidence, that the thesis of creationism is a true statement about reality is non sequitur. To reach such a conclusion, one must either be selective about the evidence one considers or use spurious (formally fallacious) logic; in other words, the argument is either invalid or unsound via broken premises or implications. In that way it is not science.

      Your logic is severely flawed. The Creationist conclusion requires a particular interpretation of the Bible to be taken and other evidence to then be interpreted in the light of that. It doesn't require anyone to ignore evidence, but rather to interpret it differently. Yes, it's an unscientific manner, but that doesn't make it illogical. At the end of the day, science doesn't tell us anything about reality; all it does is produce models that reproduce observations we take of the world around us. There's nothing to say that scientific models are actually reflective of reality and in theory, if an omniscient being was to reveal the true nature of reality to be different to that suggested by science, that's fine.

      Creationism makes a very specific claim about the nature of reality: that it was created according to the will of a deity, through the power of that deity. Scientific investigation indicates this is probably not the case.

      Science is able to say nothing about the likelihood of supernatural beings intervening in reality.

      Reiss even stated as much in his blog: [I agree with the statement that] "The ideas offered by intelligent design creationists are not the products of scientific reasoning." If you wanted to defend his position, you could have pointed that out instead; why didn't you?

      It was unnecessary. His original quote was quite sufficient, if people just read it right.

      The point of science is to figure out what reality actually is.

      No it's really not. See above. All you can do is build models that are progressively better at reproducing the results of observations. Science can't tell us about the true nature of reality, but that doesn't matter because it doesn't have to.

      At best, he seems to be saying that he doesn't think a creationist "worldview" can be shaken and that everyone deserves to have their ideas respected no matter how poor or parochial those ideas might be.

      No. He's saying that creationism isn't science, therefore people who believe in it do not do so because they cannot do science, but because they there are sources of truth they value more highly than science. Talking about science isn't going to persuade them to believe in evolution but at the same time, being a creationist isn't going to prevent them being capable scientists. They can do the investigation and reach scientific conclusions, but when it comes to deciding whether the scientific answer represents reality or not, they'll say 'No.'

      In this worst case, he thinks creationism should be

    3. Re:what he actually said by Anonymous Coward · · Score: 0

      The Creationist conclusion requires a particular interpretation of the Bible to be taken and other evidence to then be interpreted in the light of that.

      Interpreting evidence "in light of" any alleged a priori truth (that the Bible is literal, that the Bible is allegory, that heavier-than-air flight is impossible, etc.) is not science. Why is that? Continuing:

      It doesn't require anyone to ignore evidence, but rather to interpret it differently.

      It requires either that evidence be ignored (the conclusion follows from sound reasoning on the flawed premise of incompletely-considered evidence) or that, if all the evidence is considered, false logic is employed (formally, "non sequitur": the logic is unsound, so the conclusion does not follow from the premises as the argument claims). I already addressed this very thing. If you disagree with the claim that the evidence implies no work by a theistic deity nor even a deistic deity, it is through simple ignorance. This is exactly why most scientists are not deists, and certainly not theists.

      At the end of the day, science doesn't tell us anything about reality...

      That sounds like the argument of a relativist (as opposed to a realist, philosophically speaking). But how can we tell which of our ideas correspond to reality, and how well? The answer is right under your nose:

      ...all it does is produce models that reproduce observations we take of the world around us.

      Exactly; we must authenticate what reality actually is by judging what it apparently is. That is precisely why some models are better than others; the word "accuracy" has meaning. Science isn't mere curve-fitting (modelling). Science has proceeded so fruitfully by adopting realism because reality is an objective (that is, realistic) truth, not a subjective (relative) one.

      Science is able to say nothing about the likelihood of supernatural beings intervening in reality.

      No, science is able to prove nothing [no qualifiers needed, but let's proceed for the sake of symmetry] about supernatural beings intervening in reality. (You should have stated this as "supernatural beings being part of reality; that is, that reality is actually so.) About the likelihood, it says a great deal. The development of life on Earth is one such example: it looks exactly as if it weren't designed, but the result of simple rules producing consequences from randomness.

      You're doing exactly the thing I warned about: saying "Even though it looks like there's no such deity, one could still be part of reality if reality is other than it appears", which is to deny the inductive step in science. Science works by making wise inductions. If you don't do that "rigorously", you're stuck with solipsism before you even get to bad science.

      There's nothing to say that scientific models are actually reflective of reality and in theory...

      Yes, there is: reality appears not to include any deities. We know that reality could be other than as it appears (science doesn't prove this), but concluding otherwise would be poor induction.

      if an omniscient being was to reveal the true nature of reality to be different to that suggested by science, that's fine.

      What you mean to say is "that could be a realistic truth about reality. But how would we know this "revelation" wasn't itself an illusion? We must authenticate it right along with everything else we perceive about reality! The Abrahamic faiths (among others) *each* claim that their faith is, in fact so revealed, and are mutually incompatible. How would a person resolve this? By using some authentication mechanism to determine what reality actually is; this is called "science" (more formally, "logic").

      [Reiss claim

  53. It's not science, it's metaphysics. by Perf · · Score: 1

    It's not science, it's metaphysics. Go look up the definition.

    Until someone creates a time machine, no one can prove origins - creation or evolution - with science.

  54. More thoughts... by davidangel · · Score: 1

    I must say that while I agree that creationism, by definition, cannot be scientifically explained or studied, that doesn't convince me that evolution is undeniably the answer to all. I have to say that standing in the Field Museum in Chicago last spring, I watched VIDEO FOOTAGE showing the earth so many millions of years ago. There were volcanoes and lava everywhere. It was crazy to see. I almost thought it was fake. It's so cool that we can watch VIDEO FOOTAGE from a time before we existed. If, and it's a huge if, God created the universe, could he not create it in such a way that it looked old? Could he have created it yesterday and built my memory so that I could "remember" the past 23 years. I agree that none of this is scientific. That doesn't mean it never happened though... I'm not mad that evolution is secular man's best guess. I just don't totally buy it.

    1. Re:More thoughts... by neumayr · · Score: 1

      Of course all that is possible. Can't prove a negative and all that.
      But usually, it makes more sense to start out with some sort of indication that something might be true, and go from there - not the other way around, accept something first and then look for evidence supporting it.

      --
      Truth arises more readily from error than from confusion. -Francis Bacon
    2. Re:More thoughts... by Xybot · · Score: 1

      That looks Neat.... Magic man done it!!!

      --
      God was my co-pilot, but then we crashed and I was forced to eat him.
    3. Re:More thoughts... by notrandomly · · Score: 1

      that doesn't convince me that evolution is undeniably the answer to all

      The answer to all what?

      It's so cool that we can watch VIDEO FOOTAGE from a time before we existed.

      It wasn't actually from a time before we existed. It was supposed to show what that time could have looked like. Surely, you understand that?

      I'm not mad that evolution is secular man's best guess. I just don't totally buy it.

      Best guess at what?

    4. Re:More thoughts... by davidangel · · Score: 1

      The answer to where we came from? Why we're here? Etc. I do understand that. However. That is not how it was presented. It was presented as straight up truth, not guess. Best guess at explaining how the universe works? About how things change? About how we got to where we are today? (I'm really not sure.)

    5. Re:More thoughts... by notrandomly · · Score: 1

      The answer to where we came from? Why we're here?

      Evolution is a model which explains how life changes over time.

      However. That is not how it was presented. It was presented as straight up truth, not guess.

      What was presented as straight up truth, and in what way?

      Evolution is not a guess. If it were a "guess", it would be a hypothesis (although some random guess doesn't qualify as a hypothesis - it needs to be founded in reality). However, Evolution is a scientific theory, which means that it is supported by all known facts, and contradicted by none. Furthermore, it makes true predictions and has practical applications. You can educate yourself about what these terms mean at notjustatheory.com.

      Best guess at explaining how the universe works?

      Evolution deals with biology, not cosmology.

  55. Re:What a waste. -- Mod up by Anonymous Coward · · Score: 0

    May I be the first one who says who gives fuck what IDers want?

    Science is NOT about spiting ID'ers.

  56. That is noz compatibility by aepervius · · Score: 1

    Compatibility would mean there would be significant interfacing and it would be positive or neutral. That is not what has been observed for the last 20,60,120,500 years, take your pick : mostly incompatibility (negative feedback at the interface) or radically perpandicular spaces not intersecting. Science and Religion are definitively NEVER compatible as there cannot be a positive interfacing with an unchanging DOGMA (religion) to a changing face (science). What can happen accidentally/incidentally is that science finding MIGHT correspond to the unchanging dogma, which then religion will embrace science, but when it goes against the dogma, science is then stoned/burned/finger pointed as an evil.

    The bottom line is that there is no compatibility *per see*.

    --
    C. Sagan : A demon haunted world:
    http://www.amazon.com/gp/product/0345409469/
    visit randi.org
  57. This shouldn't... by tumblebug · · Score: 1

    be a discussion about which theory is best, or makes sense or whatever...

    Its about respecting other people's beliefs and being open to other ideas, while being secure with your own. If you are not secure with your own beliefs, then you will not accept any criticism of them, and that's when fights start. I've found that most fights start about religion because people simply arent secure about their own religious beliefs...and the same goes for scientific beliefs, particulary in cases where its all theoretical and proof is very very hard to get.

    I think what the Professor was trying to get across (mainly to other teachers and educators) was that their students may come to their classes with perfectly well-formed views about the world, and as educators, they should accept that and adapt their teaching style accordingly, not just dismiss the student's point-of-view and give their own. The teacher can introduce new ideas/concepts to the student, and the student makes the choice of what to fit into their worldview....esp. if they want to pass the exam at the end ;)

  58. he put himself in this position by Goldsmith · · Score: 2, Informative

    He came into his position as head of education under a lot of scrutiny. Many people in the Royal Society felt it was inappropriate for a member of the clergy to hold one of the most important scientific education positions in the country. They were waiting for him to screw up, and he knew it. His view that time in science class should be used by the teacher to debate evolution with creationist students is not at all in line with most of the Royal Society. He should have kept it to himself.

    It's not like he got into trouble for some offhand remarks to a small press outlet somewhere, it was his blog, and his subtitle: "...discussing creationism and intelligent design as alternatives to evolutionary theory." While his comments in their entirety are perfectly normal for any reasonable person, they don't reflect what the membership and leadership of the Royal Society want out there in their name. Does the oldest and most prestigious scientific organization in the world want it to be attributable to them that "because something lacks scientific support doesn't seem to me a sufficient reason to omit it from a science lesson?"

    Yeah, I'm taking his quotes out of context. He had a high profile position and should have been more careful.

  59. Lets take a vote! by axlr8or · · Score: 0

    Out of context but hey? a being developes over billions of years and his name is Q. A fun loving prankster, he snaps his fingers and creates a planet complete with ecosystem and intelligent life. Stupid can watch Star Trek and accept that. But can't accept a God. On the other hand... You wake up tomorrow and there is no phukIng way this planet was created, it just happened. Stupid is happy to believe that he is the pinnacle of evolution and he was shit out by the Universe like a golden egg. Which hypothetical describes your mental condition? Personally, just like politics, I won't vote. I would be to humiliated to participate in either camp.

  60. Re:What a waste. -- Mod up by fyoder · · Score: 1

    It's beyond unreasonable, they are dogmatic evolutionists to the point where it is a religious point of view of opposing the IDers.

    They're fundamentalist atheists, and yes, they pose at least as great a threat to science as fundamentalist Christians.

    --
    Loose lips lose spit.
  61. Re:What a waste. -- Mod up by Anonymous Coward · · Score: 1, Informative

    Honestly, you have no idea about Britain and what people are like there. I'm not even trolling, or bashing you, it's just as simple as that.

    And yes, by British standards it definitely is conservative, extreme right-wing. Although the right in Britain is completely different to that of the US. A US version of the Daily Mail would be calling for a split-up of the states, would be calling Canadians communists and Mexicans scum. It would also concentrate on public hanging of Paedos and anyone who's stupid enough to be unemployed.

    Everything else in there would just be made up. That's the other thing the Daily Mail does: invent whatever bullshit it likes. But instead of printing anything libelous, they put out whatever correlation is not causation 'facts' they can muster juxtaposed with some nudge-nudge wink-wink punditry. These are the bastards who complained about the number of Jews entering Britain in the late 1930's.

    Monkeydust sums it up best.

  62. Fishies by Anonymous Coward · · Score: 1, Interesting

    Evolution is a fact

    It is? You mean that creature evolve over time due to environmental factors etc?

    OR do you subscribe to the Universe Evolving from nothing, that the perfect order that the world and universe exists in (Without mans intervention) happened by mere chance?

    Where did everything come from? Science cannot answer this.

    Religion (Not a crackpot religion) can answer this but you don't believe what Religion believes to be plausible.

    I myself reject what scientists say is the beginning of all things, something does not just form from nothing, it doesn't happen science itself says it doesn't happen. So why do you believe thats what happened with the Universe?

     

    1. Re:Fishies by gothzilla · · Score: 1

      Please go study evolution, then post. The science of evolution has absolutely nothing to do with the initial origin of life. It doesn't cover it AT ALL. The science of evolution is the study of what happened to life AFTER it originated.

  63. Even simpler by Moraelin · · Score: 1

    Well, it's even simpler.

    The grouping didn't need to form inside a bubble of anything. The whole primordial soup was the first "cell", so to speak. It was a medium in which aminoacids and nucleotids formed by themselves. A self-replicating RNA piece would have just made lots and lots of it right there in the ocean, out of the building blocks available.

    Lipids formed around too, and the funny thing about the kinds of lipids in the cell wall is that they already tend to form curved double walls. Ephemereal bubbles with some of that RNA and some of that "soup" inside would have formed all the time.

    Most likely the first such groupings were actually a nuisance, as they would cut you off from the outside world and leave you without more nucleotids to replicate after a while. The first such mollecules which could assemble a hole in that lipid bubble, would have a huge advantage. (Your immune system does contain a mechanism to do just that, and of course the DNA code for it: assemble 3 proteins which combine to form the border of a hole in a cell wall.)

    At that point already you have the precursor of what a lot of proteins still do: regulate the transfer of substances between the inside and outside. Increasingly more complex proteins would be better than a simple pipe to the outside, and give more and more advantages to whoever can put them on its bubble.

    At some point and given enough such proteins and some changes to the outside world, it would become more of an advantage to stay in the bubble than simply survive until it bursts. Proteins which would form a scaffolding to support that lipid wall would become an advantage.

    And so on.

    --
    A polar bear is a cartesian bear after a coordinate transform.
  64. Well, that's just the thing by Moraelin · · Score: 5, Insightful

    You know, that's the thing makes me wonder the most about the whole christian god thing. Essentially we're taught that the guy is a good and loving god, but if you look at what he does, he actually acts like a complete asshole. He'll:

    - punish people for something their ancestors did. It's a bit like me kicking you in the nuts because one of your ancestors sold slaves 2000 years ago. But, no, if God does it, it's a good and just thing.

    - he plays favourites among his sons, in a major way. See the Abel and Cain episode for the first instance of it. And that was already barely generation 2.

    - is an asshole about accepting gifts. Abel and Cain again. I mean, imagine me as a cranky old guy and two grandsons bring me gifts. And I'd go, "WTF? You give me a tie? What am I supposed to with that? Get out of here, you idiot. Get a hint from your brother. He gave me socks. He's my new favourite. In fact, I'll disown you, you little prick." Seriously, if anyone pulled that kind of a stunt, he'd be seen as an antisocial arsehole, and rightfully so. But if God does it? Nah, he's a good and loving guy.

    - doesn't even bother sorting evil-doers from good guys before doing a genocide or two in the name of good. See Sodom and Gommorah, plus the Noah incident. (I have trouble believing that everyone killed there was a monster, including some thousands of babies who hadn't done anything wrong yet.)

    - if he has to do a miracle, hey, nothing beats a plague or two or killing a few thousand babies to make a point. See, convincing the Pharaoh to let the Jews go. You'd think there would be ways to do flashy stuff that doesn't arbitrarily punish millions of Egyptians peasants and craftsmen who didn't even own slaves, nor have anything to do with the Pharaoh's decision.

    - has no qualms with punishing billions of people for all eternity, for merely not having heard a particular fairy tale. (The recent "anonymous christian" doctrine of Vatican kinda fixes that, but even there many see it as a heresy.)

    - for that matter, if you take it all literally, he seems to care more about whether or not you brown-nose him or his Junior than whether you're a good man and live by the rules. Seriously, we're supposed to believe that essentially a loving and _omnipotent_ God can't possibly forgive you for that original sin, unless you choose Jesus.

    - causes a war or two. Way to set the mood and an example, dude. E.g., that promised land wasn't exactly empty. You'd think an _omnipotent_ god could just snap his fingers and create an empty fertile island for his favourites. But, nah, let's make them kill some thousands of philistines instead and take their land. It's more fun that way.

    - encourage a little genocide, war crimes, rape, etc, while you're at it. Why not?

    - will randomly kick people in the nuts just to see how strong their faith was. Several biblical examples, plus used heavily to explain stuff like the plagues.

    - what better way to make a cryptic prophecy than to ask a father to kill his son, then essentially tell him it was just a practical joke at the last moment. Like being on Candid Camera with a cruel twist, I guess. Bonus points if said son is an adult by now. You know, just for that "how the fuck _am_ I going to kill him?" factor on the way there.

    You'd think that a sealed document to be opened on date X would do the same job of proving you always meant to have your Junior nailed, no? And you're omnipotent, so you _can_ make a seal that can't be broken. But, nah, let's scare the shit out of Abraham instead. It's more fun.

    - playing favourites with some of his children again, for no other merit than being the guys whose ancestor was the random guy chosen for such a cruel prank`

    - blame it on free will, or have it blamed in your name, when the world you created and uncertainty about the future create bursts of overpopulation and thus war, famines, and the like. (Bonus points if it results in witch hunts and pogroms, because, hey, if all evil is the result of free wil

    --
    A polar bear is a cartesian bear after a coordinate transform.
    1. Re:Well, that's just the thing by coastwalker · · Score: 1

      Makes you wonder about the sanity of the followers of this god character doesn't it.

      Its time to reveal the truth (ok lets say we don't quite understand yet, so this is a theory about the truth) Religion is a meme, an idea that is self replicating and has a slight evolutionary advantage (lets burn everyone who doesn't accept the idea shall we). Now the contents of this meme don't have to contain anything useful or true so long as the ideas do not impede the breeding and ability to grow crops and pay taxes to the slave owners.

      Bingo, we have an explanation for Religion and why it is so full of rubbish DNA (or ideas) - the rubbish bits do not impede the important stuff about killing people who do not accept the religion or impede the construction of hierarchical societies that are good at feeding people in times of famine and good at promoting the church leaders to positions of supreme legal authority.

      Now we get into intense discussions about the validity of one of their more barking mad bits of crap idea - the one about how the world was created by a fearsome old bloke with a white beard in a week and that we are all descended from a breeding pair of humans called Adam and Eve that he knocked up in his lab by the power of fiat.

      Frankly I've lost interest in debating the argument and am just busting to let my science meme load up a mini-gun and take out these religious types that are attacking my meme. Hell lets go one step further and see if we can push the superpowers over the edge so they toss off their nuclear weapons at each other and with any luck the nuclear winter will off the entire human race and cleanse the planet of this offensive religion stuff. As a bonus side effect its a sure cure for global warming.

      Maybe not, guess I will just have to carry on arguing the toss with mad people.

      --
      Facts are history now plebs have politics for religion on social media.
    2. Re:Well, that's just the thing by Anonymous Coward · · Score: 0

      Don't forget that this "God" did require Japtha to go through with sacrificing his daughter in exchange for giving Japtha victory over his enemies.

      Blood sacrifice gets you victory. Maybe Bush is missing something.

  65. ... he must have a job offer in the US ... by Uncle+Oswald · · Score: 1

    I can't believe he changed his point of view. Must be about the benjamins.

  66. matter is just a residue by Anonymous Coward · · Score: 0

    of non-matter missing from nothing.

    So, there was nothing. But nothing is the sum of matter and non-matter. And, at one random point, these two things got separated. Things got worse since then.
    We now have multiple gods, flying spaghetti monster, scientologists...
    All possible stuff and their opposite.

    1. Re:matter is just a residue by Oktober+Sunset · · Score: 2, Funny

      All possible stuff and their opposite.

      So somewhere out there is a man called Bush W George, an intelligent and respected man, who is opposed to war and cares deeply about the environment.

      Of course with all things being opposite Bush W George lost the election to the warmongering, environment destroying imbecile Gore Al, so the anti-matter universe is not really all that different too our own in the end.

    2. Re:matter is just a residue by Mr.+Firewall · · Score: 1

      So somewhere out there is a man called Bush W George, an intelligent and respected man, who is opposed to war and cares deeply about the environment.

      Of course with all things being opposite Bush W George lost the election to the warmongering, environment destroying imbecile Gore Al, so the anti-matter universe is not really all that different too our own in the end.

      "Intelligent... opposed to war... cares deeply about the environment" vs. "warmongering, environment[-]destroying imbecile"???

      Whoa, we're not thinking in stereotypes here or anything, are we?

      Which just goes to prove that even people smart enough to see through the lies of "Intelligent Design" can still be idiots when it comes to critical thinking skills.

      --
      In times of universal deceit, telling the truth gets you modded -1 Troll
    3. Re:matter is just a residue by Anonymous Coward · · Score: 0

      >> All possible stuff and their opposite.

      > So somewhere out there is a man called Bush W George, an intelligent and respected man, who is opposed to war and cares deeply about the environment.

      No, it only means somewhere out there is a man called George W. Bush, who is left-handed and wears a pointy little beard.

    4. Re:matter is just a residue by Oktober+Sunset · · Score: 1

      Hey, it's not my fault that Bush is walking semi-talking stereotype.

  67. Theory of which evolution is a fact? by OwlWhacker · · Score: 1

    There was a theory that the sound barrier could not be broken, and this was considered a fact. Obviously we now know that this is completely wrong.

    There is a theory of evolution, but because there are two types of evolution people usually confuse them, and arguments are pointless.

    Micro Evolution is where species can adapt and change appearance due to environmental circumstances.

    Macro Evolution is where one species changes to another species.

    Micro evolution is factual, but macro evolution is purely speculative, having no facts behind it - which even Darwin himself concluded.

    1. Re:Theory of which evolution is a fact? by Yunzil · · Score: 1

      Micro Evolution is where species can adapt and change appearance due to environmental circumstances.
      Macro Evolution is where one species changes to another species.
      Micro evolution is factual, but macro evolution is purely speculative, having no facts behind it - which even Darwin himself concluded.

      I don't know if you're aware of this, but a lot has happened in the 149 years since Origin of Species was published.

      For instance, speciation has since been observed.

    2. Re:Theory of which evolution is a fact? by OwlWhacker · · Score: 1

      I don't know if you're aware of this, but a lot has happened in the 149 years since Origin of Species was published.

      For instance, speciation has since been observed.

      I suppose that my point should really be that we haven't seen evidence of a dog turning into a horse, or one diverse species turning into another.

      Usually any physical changes within a species are slight mutations. You can get humans that are three feet high, seven feet high, some with six fingers/toes, etc. This does not mean that they are evolving into another creature.

    3. Re:Theory of which evolution is a fact? by Yunzil · · Score: 1

      Maybe you missed it, so here it is again: Speciation (ie, one species splitting into two) has been observed

      If you're expecting a dog turning into a horse in one go, you're not going to get it, because that's not what evolution does. In fact, if we saw that happen, it would be a nasty blow against evolution.

    4. Re:Theory of which evolution is a fact? by OwlWhacker · · Score: 1

      Of course a dog wouldn't directly turn into a horse, we would expect it to gradually change:

      For an example, its feet would turn into hooves over a period of time, and we would also expect to find fossils of this change at various stages.

      This brings up a point that Darwin mentioned: there is a distinct lack of fossils at these intermediary stages.

      Speciation is one thing, but changing form completely (e.g. flippers turning into legs) in order to produce a different kind of creature is only speculated.

      The speciation that is factual is merely a change of shape, behaviour, colour, etc. Darwins Finches have different beak shapes, but they are all still finches. Insects remain insects, even though they may completely change appearance.

      There is no evidence in the world today which can prove that all land creatures evolved from fish. There is no evidence supporting the theory that one kind of creature can evolve into another (e.g. mammals evolving into birds).

  68. Royal Society did the right thing... by PinkyDead · · Score: 2, Insightful

    Firstly, he's not being drummed out on a criminal charge and dragged away in legs irons - he being removed from a position that needs to be untainted by such non-scientific suggestions. I read about what he "said" elsewhere, and was appalled by it. Did I research it further and scientifically - no, because it is a political issue and so depends on interpretation.

    I'm glad to see that he was misquoted, but damage has been done - the creationists will exploits these statements, and the word 'misquote' won't appear on any of their websites. The best that Royal Society can do, is to ensure that the quotes are attributed to the 'Former Education Director' as opposed to the 'Current Education Director'.

    From the original /. posting:

    The thing the Royal Society does not appreciate is the true nature of the forces arrayed against it and the Enlightenment for which the Royal Society should be the last champion.

    This is unfortunately quite true.

    Secondly, as Richard Dawkins states, religion should keep its nose out of science. Equally, science should keep its nose out of religion - a sentiment that I think the good professor would agree with. Let philosophy heads discuss whether creationism should be taught in philosophy classes, that's their business - but its none of the Royal Society's. If there was some suggestion, as in the US, that it should be taught as a science - that's a different matter.

    --
    Genesis 1:32 And God typed :wq!
    1. Re:Royal Society did the right thing... by VJ42 · · Score: 1

      >This is unfortunately quite true.

      Secondly, as Richard Dawkins states, religion should keep its nose out of science.

      Dawkins is very wrong on this, if religious people had kept out of science, Dawkins wouldn't have a job today; the father of modern genetics was a priest.

      --
      If I have nothing to hide, you have no reason to search me
  69. Because secondary school is for teaching by Anonymous Coward · · Score: 0

    A science class is for teaching science, english literature class for teaching english literature, maths for teaching mathematical equations.

    They are already full with that task.

    So you take fifteen minutes out explaining the creationism is not scientific. Then another fifteen minutes on each of the thousand different other creation myths.

    Then you've taught no science.

    1. Re:Because secondary school is for teaching by achenaar · · Score: 1

      Nice try, but I don't buy it.
      The reasons why creationism is not science apply equally to each of the "thousand different other creation myths" for a start.
      Plus, since this is the UK we're talking about, and I happen to have gone to school in the UK, I can say that even at the Roman Catholic high school that I attended, barely anyone (can't think of one to be honest) in my year gave a shred of credence to creationism.
      I'm not religious at all, but R.E. was one of my favourite classes, and we discussed many aspects of many faiths.
      Probably only liked it so much because the teacher was kick ass cool, but hey.

  70. Randi Hour by tinkerton · · Score: 1

    Schools need something I'd call a Randi Hour. that's a lesson where an authoritative person takes some pseudoscience subject, and tries to make a convincing case for it. And it leaves you on your own to see what you do with it. It's easy to disregard pseudoscience when you only hear it from helpful sources who ridicule it.

    i wouldn't introduce it too early though, and as part of a course in hardcore skepticism. (unfortunately not-)Needless to say, this would be a very different proposal than the creationist proposal to just introduce creationism in the curriculum.

    Yeah, I

  71. at least by unity100 · · Score: 1

    as an idiot, i have the balls to post my opinions with my identity attached. you, on the other hand, insult people while remaining anonymous. lets see, in my book that trumps up whatever you have to say.

  72. So does this mean it's time to... by diegocn · · Score: 1

    ...spread the gospel of the flying spaghetti monster to our next generation of pirates?

  73. Re:What a waste. -- Mod up by mdwh2 · · Score: 1

    Fundamentalist? What fundamentalism is this? Atheists blowing themselves up in the name of their beliefs? States persecuting people for their religious beliefs? Atheists trying to force others to believe, or persecuting others, either through laws or violence? Atheists stifling criticism of their beliefs, again either through laws or violence? Perhaps you means people who take everything 100% literally true from a particular Atheist book?

    What rubbish. Yes, people here are guilty of being misled or even possibly intentionally misrepresenting the facts, but this isn't anything to do with fundamentalism. Nor is it specifically an atheist issue - plenty of religious people oppose ID (remember this is the UK, where even though many are religious, hardly anyone believes in Creationism). A large amount of the media misrepresented Reiss's views, and it's not clear that atheists are in control of the media.

    Trying to paint this as an atheist v. religious issue as the Daily Mail does is misleading, and is just as damaging when it comes to giving support to Creationists - it means they can hide in with the religious group, saying "Look how atheists oppress us!" In fact, many if not most religious people oppose Creationism is schools too. The issue here is "People getting the wrong end of the stick", where "people" includes both atheists and religious people.

  74. Re:What a waste. -- Mod up by mdwh2 · · Score: 1

    And your post is a perfect example of using this issue to give support to Creationism.

    It's beyond unreasonable, they are dogmatic evolutionists to the point where it is a religious point of view of opposing the IDers.

    There is nothing wrong with opposing IDers, and this is done based on overwhelming scientific evidence.

    But that is not what happened here. Scientists are not opposing IDers, because, for the millionth time, Reiss is not a Creationist. Both Reiss and those arguing against him agree that ID should be opposed, but unfortunately his views were misrepresented.

    If Reiss really had supported teaching ID, then asking him to resign would have been perfectly fine.

    The facts don't matter; even if some evidence supporting ID appeared, they would hold true to the evolutionist dogma.

    Complete rubbish. Scientific theories are always modified or even discarded if new evidence suggests they are wrong. If evidence existed for ID, it would be accepted - but evidence does not exist. You might as well criticise zoologists for not accepting existence of unicorns, claiming "even if evidence of unicorns existed, they wouldn't accept their existence".

    ID is not science, and it is unfalsifiable, and it is not something that can be easily tested anyway.

  75. Re:What a waste. -- Mod up by mdwh2 · · Score: 1

    I have read scores of stories in the Daily Mail over the years (linked from Drudge)

    First of all, it should be noted that their print edition is in my opinion worse than their online articles - although occasionally there are rather biased and prejudiced articles online, many of them are much more reasonable than the equivalent articles that's in the print edition (I read it for years, as my parents read it).

    As for pro-Christian, I do not mean in the same sense as a committed Christian (e.g., a regular church goer), nor in the sense that people in the US are usually Christian. For the Daily Mail, it's more the sense that Christianity is seen as a fundamental part of our culture - yet they are unable to distinguish between the religion, and the cultural aspects of religion. So even whilst they aren't necessarily promoting Christian views, they think that everyone should be Christians and criticise anyone who isn't (in this case, atheists, but Muslims are another obvious target). They're representative of the people who believe in God, identify as Christian and will insist that faith is important, but who never go to Church except for christenings/weddings/funerals, and it's not clear whether they really believe anything specifically Christian, beyond a general belief in God. There seem to be quite a lot of these people in the UK.

    So yes, pro-Christian isn't perhaps the right word for this - I'm not sure what is (pro-cultural Christian?) And I know plenty of Christians (actual Christians like you, not the ones I describe above) who hate the Daily Mail.

    And as for porn, actually they do often take a rather prudish pro-Censorship issue, for anything more than a clothed woman showing a bit of cleavage. (The fact that they shove images of women's cleavage everywhere, whilst demonising porn, is just another example of their hypocrisy. Indeed this is true of the UK tabloid media in general - they shove sexualised images of women all over their articles, in some cases underaged women, but love to demonise porn, especially material on the Internet, even though the latter is often less likely to be seen by those who don't want to see it.)

    I disagree that they have an atheistic or humanistic philosophy - what makes you think that?

  76. the politicization leads to odd views by Trepidity · · Score: 1

    Traditionally, the liberal view on science has been one of a fair amount of skepticism. Especially from the mid 20th century, this was largely a reaction to a whole bunch of junk science that had somehow gotten into the mainstream, from phrenology to racial science, leading to a rethinking of the relationships between science as a fallible sociological process and science as a truth-uncovering process.

    Now that things have become politicized in the sense of two hot-button "liberal" issues being supported by science. with "conservatives" happening to be on the "anti-science" side on those two issues, it leads to an odd reversal. I hear things from political liberals about accepting scientific conclusions as dogmatic and un-questionable (except perhaps by people with PhDs and specialized training in the specific area), which until quite recently would've been seen as a highly reactionary and conservative viewpoint. And I hear conservatives talking about things like respecting "different truths" that come from different cultural traditions that until quite recently would've been more likely to come from a left-wing post-colonial theory academic than a right-wing politician.

    1. Re:the politicization leads to odd views by Cassius+Corodes · · Score: 1

      As you note, its more a matter of which deeply held views are contradicted by science that determines which side of politics is anti-science. I know that for evolution (and sociobiology in particular) was quite violently denounced by the left as being evil (as it challenged the notion that all people were created equal; that everyone started off with a blank slate). Now that the issues are religious and environmental its the right that is anti-science.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    2. Re:the politicization leads to odd views by TapeCutter · · Score: 1

      Yes, politics is the art of winning a debate regardless of wether you actually belive the argument or not, it's unfortunately a nessacary distortion if society of semi-rational individuals is to function. Before anyone takes offence my argument is that we are all semi-rational and it takes a consious effort to be skeptical of your own emotions, just as it takes a consious effort for a religious person to be critical of their own "faith".

      All sides of politics at some time or another accuse science of being bias, this in my mind says that over a long enough time science is unbiased. In a democracy when a politician makes it to the top they have done so by winning debates. The emporer ALWAYS has no clothes but pointing that out is like tossing the first turd in a shitfight. The reaction is emotional (see the rest of this thread for examples, or just phyco analyse this one). Regardless of training reason doesn't come into it when someone starts removing the foundations of your world view, well at least not until you contemplate fixing them.

      I'm no different and my only excuse is we ALL do it, the 'secret' is to acknowledge that before you have spent the next 10yrs typing profanities at strangers. Science comes in the form of stories, you may know a lot about one corner of a page but to all of us science on the whole is told to us with stories. Religion comes in the form of stories and morals that often match our naturally evolved sense of cooperation that formed societies in the first place. There's also an invisible guy who really wants you to learn the morals not the details of the stories, oh and btw he can see in your head and crush you like a grape. - ie: let he who hath not sinned cast the first troll. ;)

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
  77. good riddance by nimbius · · Score: 1

    why go to all the trouble of building a large hadron collider if all we're going to do is teach everyone god is at the center?

    the money may as well have been spent on restorations to big butter jesus.

    --
    Good people go to bed earlier.
  78. Statement from the Royal Society by Xybot · · Score: 1

    Some of Professor Michael Reiss's recent comments, on the issue of creationism in schools, while speaking as the Royal Society's Director of Education, were open to misinterpretation. While it was not his intention, this has led to damage to the Society's reputation. As a result, Professor Reiss and the Royal Society have agreed that, in the best interests of the Society, he will step down immediately as Director of Education a part time post he held on secondment. He is to return, full time, to his position as Professor of Science Education at the Institute of Education. The Royal Society's position is that creationism has no scientific basis and should not be part of the science curriculum However, if a young person raises creationism in a science class, teachers should be in a position to explain why evolution is a sound scientific theory and why creationism is not, in any way, scientific. The Royal Society greatly appreciates Professor Reiss's efforts in furthering the Society's work in the important field of science education over the past two years. The Society wishes him well for the future.

    --
    God was my co-pilot, but then we crashed and I was forced to eat him.
  79. Expelled by Anonymous Coward · · Score: 0

    Anyone seen the movie Expelled?

  80. Adios! by Orleron · · Score: 0

    Don't let the door hit ya where the good lord split ya!

  81. Science.....the new Pope by eears100 · · Score: 1

    I do find it funny that Galileo fought so hard to overthrow the tyranny of the Catholic Church being so closed minded to different ideas and yet little did he know that he was paving the way for the tyranny of scientists who refuse to allow equal expression of different ideas.....why can't we let the kids decide for themselves?.....i thought that was the beauty of a an educational system.....equipping people to make decisions not just be handed them.

    1. Re:Science.....the new Pope by mdwh2 · · Score: 1

      why can't we let the kids decide for themselves?.....i thought that was the beauty of a an educational system.....

      Kids can decide for themselves. If they want to go away still believing in creationism, or that Paris is the capital of Australia, that's up to them. But the purpose of the education system is to educate them.

      equipping people to make decisions not just be handed them.

      Exactly. That includes learning what science is, so they can tell the difference between scientific theories, and made up fairy tales that some people happen to believe.

    2. Re:Science.....the new Pope by eears100 · · Score: 1

      I love the fact that you compared scientific theories - a proposed explanation whose status is still conjectural, in contrast to well-established propositions that are regarded as reporting matters of actual fact - with made up fairy tales. The truth is that science was never designed to testify for historical events. Think about it for a moment. The scientific theory only "proves" what is likely to happen in the future. The scientific theory "proves" that the magnetic needle in a compass will always point north, yet there are legitimate scientific evidence that proves that the poles flip flop also. Supposedly within the next 1000 years a scientific fact as sure as the compass on a needle pointing north will change. Science can not even prove that George Washington was the president of the United States. You know what proves that? Historical testimony, that is something that creationism has much more of on it's side. I think that testimony should weigh into the discussion some and not be completely discredited for the sake of science. If you want to explain what is going to happen tomorrow with science that might be ok, but science can not and was never ment to explain the past.

    3. Re:Science.....the new Pope by mdwh2 · · Score: 1

      Your science lessons obviously didn't include scientific terminology - it makes things much easier if we understand what is meant by the terms.

      a proposed explanation whose status is still conjectural

      A proposed explanation for evidence is a hypothesis. Conjecture is, well, conjecture.

      well-established propositions that are regarded as reporting matters of actual fact

      A scientific theory is a model that explains facts, and is supported by evidence, and has been tested. Moreover, evolution refers to both a theory and a fact. So my comparison was spot on.

      The truth is that science was never designed to testify for historical events.

      Well first of all, I disagree that we can't say anything about the past - historians do this all the time, as do courts of law. Clearly we can decide that some things are very likely to be true, and this is the case for evolution. The methods we use to judge such evidence can themselves be tested.

      And evolution can be tested, because it (including speciation, before you draw out the micro vs. macro distinction) can and has been observed.

      Historical testimony, that is something that creationism has much more of on it's side.

      Historical testimony is still something that involves science (how reliable are witnesses? Are the things they claim likely to be true?) Historians and archaeologists use scientific methods - indeed, archaeology is a science. What on earth do you think counts as historical testimony for creationism, dare I ask?

      If someone claimed he wasn't the murderer, when all evidence pointed towards the fact, are you telling me you'd trust his word, because you think evidence can't be obtained for the past (other than "historical testimony", which for some reason you think is different)? What if two people claimed you committed a crime, when there was no evidence for it, or even evidence against it - would you think the court should find you guilty?

  82. I hate that you people mod crap like this up by QZTR · · Score: 1

    "Abuse of word "actually", requires that following sentence is factually accurate."

    You failed to demonstrate that it was not accurate.

    " What you mean is that science still can't explain it to you."

    No, I think he means that it can't be explained beyond what are considered, at best, marginal hypotheses. YOu have yet to demonstrate that he is inaccurate, yet are still assuming so.

    "Don't assume that knowledge doesn't exist just because you don't possess it personally."

    So where is it? As far as I'm aware, "marginal hypotheses" more accurately reflects the state of thinking on the subject, and you still haven't done anything other that accuse GP of being ignorant. You've berated him plenty, now where is the actual information?

    I hope you're seeing my point now, mods. This guy pandered to your biases, provided nothing beyond a thinly veiled attack, and you modded him to +5.

    Your point is wrong, Gp os correct, at right now, the state of science does NOT have an explanation about the origin of DNA that rises above a very weak hypotheses. Any researcher who works in the area will tell you that.

    Of course, this in no way supports creationism, but you don't get to jump all over the guy when you're demonstrably wrong.

    You got played mods. Own it.

    --
    To quote LongNoi "QZTR was right and won't leave me alone because I called him a moron when I was wrong" FYS
    1. Re:I hate that you people mod crap like this up by Anonymous Coward · · Score: 0

      Eh, so what's new? Mods always favour those that side with their views, and creation/evolution is the single most polarising and overwhelmingly one-sided subject discussed on Slashdot. It just showcases the personal bias inherent in the system. After all, a +5 mod typically means, "three or four more people modded this up than modded it down".

  83. Re:What a waste. -- Mod up by notrandomly · · Score: 1

    And not just IDers, but also anyone who wants to paint atheists as being unreasonable

    If so, they must simultaneously claim that science == atheism.

  84. IMHO both should be taught by ILongForDarkness · · Score: 1
    I know public education systems get criticized every time they teach anything that some consider to be a personal/parent choice (sex ed, religion etc). The argument is usually that the parent will teach the kid what they think they need to know and the state/schools should stay out of it.

    I think that is complete and utter crap. Who decides what information is important? Say a kid is born to complete atheist parents, God/gods etc don't get mentioned in school so the child will never get exposed to those ideas. At best it slows the kid's exposure and adoption of the beliefs that he/she will chose, at worst it condones ignorance.

    We as a society have gone far of course when we teach people that some knowledge shouldn't be taught. It seems contradictory that most of the western countries have a "freedom of religion" clause while at the same time they help enforce bias in the children towards the parents' beliefs. The child truly isn't free if they don't get equal access to information from which to make their own minds up.

  85. Re:What a waste. -- Mod up by notrandomly · · Score: 1

    It's beyond unreasonable, they are dogmatic evolutionists to the point where it is a religious point of view of opposing the IDers.

    You are mistaken, since science goes where the evidence leads. Evidence is not "dogma".

    The facts don't matter; even if some evidence supporting ID appeared, they would hold true to the evolutionist dogma.

    There is no "evolutionist dogma". Evolutionary scientists are arguing and sometimes even fighting over details like what this fabulous new fossil should be categorized as.

  86. Being open to evidence is a threat to science? by notrandomly · · Score: 2, Interesting
    From your link:

    Fundamentalist atheists deify science, and believe that they possess "THE TRUTH" by virtue of science, without the "vice of faith" as Richard Dawkins characterizes it in his essay Is Science a Religion?.

    That is interesting, considering that Dawkins has repeatedly stated that he is open to the existence of God, as long as someone can provide him with evidence. If Dawkins is a good representative of "fundamentalist atheists", the author of that text has bigger problems than anyone can imagine.

    Dawkins, a man who says that he's open to anything as long as there is evidence for it, is a threat to science? Good one.

  87. Indictments on the Church... by shliddle · · Score: 1

    "It will call 'anti-evolutionary fervor' an 'indictment' on the Church." ... Exactly how many indictments does that make? At what point do we convict it?

  88. Please read this before posting by gothzilla · · Score: 1

    It gets really old seeing the same old tired arguments against evolution from people who completely fail to understand the basics of what science even is.

    http://www.uwgb.edu/dutchs/PSEUDOSC/Top10MythsEvol.HTM

    1. Re:Please read this before posting by tinkerton · · Score: 1

      This list is not a fair case of debunking.

      1. believing that humans evolved from a kind of monkey is not hugely inaccurate. It gets the point of evolution sufficiently across. It's a bit worse if they think it's from an actual contemporary monkey. But why is the argument used? To point at the big differences and claim they can't be bridged with evolution. There's the rub.

      3. The criticism is valid but it's good to point out that there are many degrees of certainty.

      4. Darwinism can't tell about origins. Since creationism only cares about attacking science it will attack prebiotic science as well as Darwin.

      6. If people claim there are no intermediate forms, it's indeed completely false. But there are gaps. Small gaps, big ones.

      7. there are a few problems indeed with hindsight justification of why a property evolved, and the mechanics of a belief system are present. There are testability problems.

      8. yes. The answer would be "So?"

      9/ that evolution is neutral or partly neutral is an existing theory of Motoo Kimura. It is not a stupid theory. It's not exactly the same as random but the comparison is useful.

      10. there are indeed huge problems in building up the necessary complexity, and eg Robert Shapiro has pointed them out. It's a problem and many darwinists have tried to ignore it. Meanwhile concepts of selforganisation at least point in the direction of an answer, but they mean selection is degraded from prime source of order to secondary.

      The point with arguments from creationists is not that these arguments are wrong(although they often are), but that they're used against science. Creationists can dig up problems in the literature and build a case with them against science. The sequence works a bit like this:

      - Scientists makes theories. Creationists stand on the side and claim God did it all.
      - Scientists find problems, creationists try to use them to show the failure of science and that there is only one explanation possible.
      - Science finds solutions, creationists still try to make a case, possibly adjusting their story.
      - Science finds more problems, creationists use them to strengthen their case with.
      - Science finds solutions and new problems...

      One is a development process, the other is just partisan advocacy. But that doesn't mean all the arguments are false.
      Maybe I should have used Intelligent Design here, because Creationists generally are a bit more hm, challenged. But you can imagine a smart ID'er making up a strong case about the weaknesses in current theory - using all the arguments scientists have made. The foggy part is that last big jump they make.

      What this also means is that ID might convince many smart people if they are listening open and honestly.

  89. Science is NOT a democracy by wisebabo · · Score: 1

    Scientists don't sit around and take votes to decide what is true or is not; NATURE decides. Rather a scientist will run an experiment to see if it supports his pet theory. If it does and if it is REPEATABLE by others, then depending on how well his theory is supported and how strongly the results refute other theories HIS THEORY BECOMES ACCEPTED.

    Of course, scientists being human, this may take a while because of misunderstandings, ego, professional jealousy, investedness in another theory but eventually the theory with better supporting evidence wins out. IT MAY TAKE AWHILE, sometimes as long as waiting until the old stubborn scientists to DIE OUT and be replaced by younger ones who come in "unbiased". See Thomas Kuhn "The Structure of Scientific Revolutions". Not perfect but the best method we've got for discerning OBJECTIVE TRUTH.

    1. Re:Science is NOT a democracy by The+Famous+Brett+Wat · · Score: 1

      You're being inconsistent. You say that nature decides, but you then go on to explain about how scientists decide what it is that nature is saying. This depends on misunderstandings, ego, and a whole bunch of other irrational stuff. It is not "democratic" (as you point out), but is ultimately some kind of political struggle for the acceptance of ideas, and it involves persuading people to see the evidence of nature your way. You take it as given that eventually we come to a greater knowledge of the truth through this largely irrational, political process.

      Pardon my scepticism, but how does this process differ from religious folk who start with, "the Bible decides what is right and wrong", but then have a professional class of scholars who decide what it is that the bible means, and those professionals have a shifting interpretation based on their own personal upbringing, pet theories, and a bunch of external influences in society? It seems to me that the two processes are very much alike, even if the objects they study are different. I'm not convinced that the process is inherently likely to get us closer to any kind of truth, whether it's truth about nature or truth about the Bible.

      If you liked "The Structure of Scientific Revolutions" (did you actually read it?), then try Paul Feyerabend's "Against Method" for a real paradigm shift.

      --
      proof, n. A demonstration that a conclusion is implied by certain premises and axioms.
  90. Gravity is a fact by snowwrestler · · Score: 1

    There is nothing to deny that tomorrow everything could just float away (though extremely unlikely); the facts didn't change, just a new set of facts have been introduced into the discussion set.

    As you rightly note, existing facts don't change or disappear just because new facts are introduced. Gravity is a fact today; if it disappeared tomorrow that would not change the fact that it existed today. The theory of gravity would have to change, to encompass and explain its sudden absence. But the theory would also have to encompass and explain its former existence as well--because that happened too. A working theory has to explain all known facts, past and present.

    The law of gravity describes the current data data set. The theory of gravity takes things a step further to introduce method for predicting future observations.

    The "law of gravity" is just an older name for the theory of gravity. Two different names for the same thing. Scientists today recognize your main point (that all knowledge is provisional), and thus have shied away from using the word "law" anymore.

    --
    Build a man a fire, he's warm for one night. Set him on fire, and he's warm for the rest of his life.
    1. Re:Gravity is a fact by servognome · · Score: 1

      As you rightly note, existing facts don't change or disappear just because new facts are introduced. Gravity is a fact today; if it disappeared tomorrow that would not change the fact that it existed today. The theory of gravity would have to change, to encompass and explain its sudden absence. But the theory would also have to encompass and explain its former existence as well--because that happened too. A working theory has to explain all known facts, past and present.

      If new data significantly violates existing assumptions, the idea can be abandoned completely. The key aspects of gravity are attraction and mass. If, for example, it is discovered that there are massive bodies that do not attract, then the fundamental idea of gravity is not a rule and something else is going on.
      There's a difference between new data showing the specific relationship like F=G(m1m2/r^2) is incorrect, and new data that shows that the relationship doesn't apply at all.

      --
      D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
  91. The meaning of faith by franz · · Score: 1

    Well, that is a highly coloured definition of faith, and just one of the senses offered by Wiktionary.

    It's late in the day to be adding to this discussion, but what I really wanted to get at is this: that though you may like that definition of the word, it's not the one your creationist friend has in mind when he says that it is "faith" that leads him to the conclusion that Darwinian evolution is wrong.

    For what it's worth, I think creationists are mistaken in their conclusion that Christian belief is inconsistent with evolution. This must be due to a false premiss or faulty reasoning, but we must avoid in turn the worse error of supposing that all religious premisses are false or all religious reasoning faulty: that's absurd.

    -- Mike

    PS. I read some of the Origin a couple of years ago, and I must say I was bowled over by the richness of Darwin's perception of the ecological complexity of nature. It is beautifully subtle and yet completely accessible.

  92. Re:What a waste. -- Mod up by mysidia · · Score: 1

    In principal, science should normally go where evidence leads. But that assertion is irrelevent to the situation.

    In practice, it does not always go that way.

    Ye must remember that science is practiced by humans, not machines. I'm saying the association of scientists has become so dogmatic and shown so much antagonism for ID, that they may act with strong bias.

    Humans are vulnerable to biases. Humans are vulnerable to ignoring evidence.

    Humans are vulnerable to failing to draw the most likely conclusions warranted by that evidence due to bias.

    Humans are vulnerable to drawing unwarranted conclusions due to bias.

    When you put multiple humans together into larger groups, they become even more vulnerable to these things -- groupthink, and any "theory", whether reasonable/or not that goes against the group theory is automatically wrong.

    I'm saying they sound so dogmatic, that even if evidence strongly favoring ID could be soundly shown through repeatable experiment, they would in all likelihood continue to reject it.

  93. Re:What are Junior High? by Anonymous Coward · · Score: 0

    Heck, what about ELEMENTARY school??? Isn't philosophy the foundation of *all* education??? Why are we not teaching this in kindergarten??? Isn't this *the* problem that is wrong with our educational system???

  94. Re:What a waste. -- Mod up by notrandomly · · Score: 1

    In principal, science should normally go where evidence leads. But that assertion is irrelevent to the situation.

    In practice, it does not always go that way.

    In practice, it does go that way because science does not depend on humans, it depends on the process. Unlike religion, there are not unquestionable authorities, and as long as your research is done correctly, the results will speak for themselves.

    Ye must remember that science is practiced by humans, not machines. I'm saying the association of scientists has become so dogmatic and shown so much antagonism for ID, that they may act with strong bias.

    But this is patently false, because what humans think or believe is irrelevant. All that matter is what the evidence shows.

    Humans are vulnerable to biases. Humans are vulnerable to ignoring evidence.

    Humans are vulnerable to failing to draw the most likely conclusions warranted by that evidence due to bias.

    Humans are vulnerable to drawing unwarranted conclusions due to bias.

    Which is why we have peer review.

    When you put multiple humans together into larger groups, they become even more vulnerable to these things -- groupthink, and any "theory", whether reasonable/or not that goes against the group theory is automatically wrong.

    This is a dishonest argument on your part. There is no creationist/ID theory. Not even a hypothesis. All it is, is an attack on Evolution. Something which is not reasonable is not a theory. If it is reasonable, the facts will speak for themselves, and the peer review process can confirm that the research is indeed sound, which means that it will be accepted by other scientists.

    The huge conspiracy about groupthink is nonsense. Creationism isn't kept out because of groupthink. It's kept out because it isn't science. It has no research, no explanations, no nothing.

    I'm saying they sound so dogmatic, that even if evidence strongly favoring ID could be soundly shown through repeatable experiment, they would in all likelihood continue to reject it.

    No, they would not. They could not, because the scientific process would dictate it.

    Remember, there are a lot of religious scientists out there, including one of the biggest defenders of Evolution, Dr. Ken Miller, a devout Catholic. Do you really think all these scientists are going to insist on evidence which points to the existenfe of God? Of course not.

    The argument you are using is nothing but a dishonest red herring, based on your own ignorance of the scientific process.

    There is no conspiracy to keep creationism out of science. There is only the brutal machine that is the scientific process, which discards claims that do not hold up to scrutiny.

  95. Why was this post labelled 'Troll'? by OwlWhacker · · Score: 1

    Evolution is still a theory until proven a fact.

    Why was this post labelled as 'Troll'?

    It's true!

    If anybody could prove, beyond any doubt, that all life evolved from simple organisms which miraculously appeared via the accidental collision of a few atoms, and that mankind evolved from apes, there would be no arguments on this subject!

    The only reason there is such a commotion about evolution (where one kind of species changes to a completely different kind - e.g. fish to dogs) is because it has not been proven.

    If it is a fact, why are people trying so desperately to prove it? Why are they getting so excited when new 'evidence' emerges?

    We don't have perpetual arguments about gravity, so obviously the 'proof' of evolution is lacking.

    If I get a few bird skulls and line them up from the smallest to the largest it doesn't mean that they evolved from one another. This is really the level of proof that scientists offer us.

    There are black people, white people, asian, etc. It is obvious that changes and/or mutations in species can occur, but this does not prove that my great*billions grandfather was plankton.

    "There are only two possibilities as to how life arose. One is spontaneous generation arising to evolution; the other is a supernatural creative act of God. There is no third possibility. Spontaneous generation, that life arose from non-living matter was scientifically disproved 120 years ago by Louis Pasteur and others. That leaves us with the only possible conclusion that life arose as a supernatural creative act of God. I will not accept that philosophically because I do not want to believe in God. Therefore, I choose to believe in that which I know is scientifically impossible; spontaneous generation arising to evolution." -- George Wald, PhD, Harvard University (Nobel Prize Winner), Scientific American Vol. 199, 1958