I think the whole idea of the future being some kind of technological wild west is more accurate than we'd like to believe. Our visions of the future expansion of humanity has largly been influenced by the Star Trek interpretation of how things might be, but Star Trek tends to see the future in its more optimistic sense, with people helping each other, and governments being genuinely interesting in providing its people with the technology and material to expand efficiently and relatively comfortably in regards to shelter and food and medicines. The real future of expansion and colonization is more likely to be people taking what little resources they have and buying a one way passage to a distant planet to try and make a living. And the governments of various nations will likely try to get as many of their people into space to claim land and/or planets for themselves, but once settlers are out there, they aren't likely to receive support from earth. Why would taxpayers want to subsidize outer space colonies?
Even looking beyond the socio-political aspects of the future, the day to day aspects of the show are still plausible. Planets that are suitable for habitation could be in varied different orbits so that they could be hotter or colder on average than earth. Odds are habitable planets are going to be equal to or hotter than earth in average temperature, since colder temperatures might inhibit the ability of plants to develop and make oxygen in the atmosphere. With hotter temperatures, it is likely that people would have to dress appropriately to protect themselves from excessive sunlight. Also, the frontier life would need people to arm themselves against bandits. As for robbing trains, it makes sense that when settlements are made, there wouldn't be an extensive infrastructure structure other than a simple hovertrain rail that could be laid down relatively quickly and cheaply.
Animals would likely be a preferable means of labor saving devices rather than using machines. For a tractor, you'd need a garage to maintain it, spare parts, as well as fuel. If crude oil or a refinary isn't on the planet, then you'd need to import it at even greater expense. Animals would be easier and cheaper to maintain when you're on the frontier. So in all, I think a wild west future isn't completely unlikely - it would be a frontier lifestyle with brief areas of technological punctuation.
Spam, Script, spam, spam, bacon, spam, tomato, and spam
Lobster Thermidor a Crevette with a mornay sauce served in a Provencale manner with shallots and aubergines garnished with truffle pate, brandy and with Best Choreography on top and spam
What Science Really is... (Score:3, Interesting)
by mfh (56)
56??? Geez grandpa, instead of debating the meaning of science, why don't you just tell us whether Evolution or Creationism is the right answer, you must have been around back then.
Big name prizes don't really attract people to science. College scholarships and demonstrations of practical applications of science will atract new students. For example, it's all well and good if Dr. Hoffenheimer wins the Nobel Prize in physics for his work in anti-positron flux through a silicone wafer, but other than physics grad students and Ph.Ds, nobody else is going to understand it, and lack of understanding leads to lack of caring. I think shows like Beakman's World and Bill Nye have done more to attract kids to science by makeing it seem approchable, rather than science being some thing that old guys did in white coats in sterile labratories.
The forums at The Straight Dope moved to a subscription system last year. They claim that it was necessary given the costs involved with maintaining a forum and bandwidth. According to Cecil, they're actually losing money on the forums, even with subscriptions, but the subseciptions to help to minimize the loss.
Plus, what's $20 a year, compared to the $15 a month you pay for online games like WOW or COH?
"PlayStation Portable and Nintendo DS will have similarly successful years, moving 3.5 million and 3.6 million units, respectively."
I don't understand where those numbers are coming from. Are they predicting that the DS is only going to sell 3.6 million units? That's already not true according to this article, which says that the DS has already sold over 5 million units. Or, if they're saying that these numbers are what each unit is going to sell this year, well then I still can't really believe that the DS will outsell the PSP, or that the PSP will be limited to under 4 million sales. Could someone translate all this marketing and sales analysis mumbo-jumbo?
Or, it could just be that Obi-Wan didn't remember them because R2D2 style astromech droids were so commonplace that he didn't have any way of recognising this one as the same droid he had a few adventures with 20 years ago.
As for C3PO, gold plated protocol driods were probably commonplace too. At the beginning of episode IV, they even showed a random extra C3PO style droid on the ship. Also when they were on the death star, none of the imperials seemed to react to C3PO like "Whoa, I've never seen that kind of droid before". Just because he was built by Aniken from spare parts doesn't mean that Anakin designed a completely new droid, but rather used a proven and reliable droid design that was already in use. Also, if you think about it, Obi-Wan never met C3PO in episodes I or II. In episode I while on Tatooine, Obi Wan stayed on the ship while Qui Gon and the others went into town. Then in episode II, the only time C3PO and Obi Wan were in the same area was during the arena battle, and C3PO was half battle droid at the time (or rather, two half battle droids). So unless episode III gives some real compelling reason for why Obi-Wan should remember them, I can believe that he honestly didn't remember them in episode IV.
Actually, freefall is a good environment in which to use the stylus. You can let go of it and it'll hover at a constant position relative to you since you're both in freefall.
I don't think this would be all that popular amongst the main stream. Unless you're that creepy guy on the subway reading a Hustler, or that perv downloading porn on the library computer, most people prefer to do their porn viewing in private. And if you are at home, would you rather be looking at porn on a 3x5 screen, or on your 19" monitor?
This isn't to say that there aren't people who have no problem with watching porn in public, but the demographic who is most likely to have the money and the desire to buy a PSP is also a demographic who would know to be a bit more discreet about such things.
So what if Nintendo doesn't show their new system at E3? It's not like the system isn't going to be demonstrated months before it's release anyway. Sure internet nerds like us will be disapointed, but I'd wager that a good majority of video gamers don't really care about who does what at E3, but rather will have their interest piqued by what's advertised in the mainstream media. This could even work to Nintendo's advantage. People get saturated by all the stuff that's released at E3, thus diminishing the impact of the information released. By letting the other guys beat at each other for a while, Nintendo can see where the bar is being set and can have their own press release a month later. This gives the gamers a chance to cool down and get hungry for more information after E3, and Nintendo does have a knack for making interesting and engaging presentations.
Let's face it, Duke is using the IPod to lure students to their school by waving a shiny toy in front of them. They're justifying it by saying people can listen to lectures on them. The student's thing its a great idea, because it doesn't affect them whether they're paying an assload of money, or a slightly larger assload of money for tuition. But really, people who don't care to go to class aren't going to care to listen the the lecture anyway; not that there's anything wrong with not going to class. I infact prefer to study from the book rather than be yapped at for two hours while zoning in and out. Also, consider that listening to audio recordings of lectures in math, science, or engineering is pretty useless without being able to see the equations and diagrams that are so essential to those subjects. The phrase "A picture is worth a thousand words" seems quite aplicable to this situation. Can you imagine trying to learn differential equations without seeing the manipulation of equations first hand by the professor? Audio lectures could be useful for more concept based courses, like history or philosophy.
I rather like the idea of J. Michael Straczynski - he did a great job with Babylon 5
That's not reason enough to cancel it now, just because you think someone can do it better. I agree, JMS could to a spectacular job with it, but just because we want it to be so doesn't mean it'll happen. I know a few months ago he said he would like to do it, but then 1 day later he retracted that statement. If there was a contract saying that enterprise would be taken off the air and in 2007 a new JMS written series would be released, I'd be the first one on the kill enterprise bus, but there's no evidence that it will happen. We might as well speculate that Gene Roddenberry will be resurected from the dead and produce a new show and it would be awesome. I think it's stupid to give up on a show in the present because there's some far flung possibility that it could be done better by someone else.
Why can't Warner Brothers invest the money being used to develop this game into something else? Odds are this game isn't going to be a huge revolution in technology or gaming principles or programming or graphics or anything. This game is more likely to be a mediocre platformer, who's charm is going to be driven more by the story and the characters than the actual game itself. Why oh why can't they instead make more Animaniacs cartoons? That will target their prime audience better than a video game I think. A cartoonish platformer (unless it's done extremely well and elegantly) isn't likely to sell very well to the late teens/early 20's crowd, since these are the people who were the prime audience 10 years ago when Animaniacs was on the air. Since then I don't believe that Animaniacs has had a very big presence, and todays 8-14 year olds aren't as interested in it as we were. However, I don't think you'd find anyone who wouldn't be interested in the propect of new Animaniacs cartoons on TV.
I know I would rather have good voice acting from a noname actor rather than getting mediocre voice acting from A-list celebrities. (And by noname actors, I mean the experienced voice actors in the field. I know there are a lot of people in the voice acting field who are pretty prominant, but don't have any recognition outside of that circle). I don't care that the Olsen twins have a handfull of lines in some game that are delivered in a flat monotone voice. I don't feel any particular attachment to a game just because they stuff it with celebrities, with one exception - franchise games which have specific actors for each character. I appreciate it when a Star Trek game has Patrick Stewart doing the voice of Picard, or James Earl Jones does the voice of Darth Vader. Other than that, I don't care who does the voices, and would prefer talent over glitz. Doing voice acting is quite different than regular acting. Regular actors are used to being able to express themselves in their facial expression and actors, but voice actors have a real talent in being extremely expressive using only their voice.
I know that, but he plays a frenchman. Just as how Levar Burton isn't acutually blind, and Michael Dorn isn't actually a Klingon. Walter Koenig wasn't russian either, he just talked with what Americans believe a russian accent is. The diversity comes about from who the characters portray more than who they are in real life.
TNG - Geordi was black. In his original character description, they wanted a black character but in the description they sent to casting agencies, they specifically said they didn't want "street types" for the role, and they even would have prefered a slight Jamacian accent. Levar Burton obviously doesn't have that, but it's a slight consession for getting an actor of his caliber. Not to mention that he plays a blind character. There's also Worf, played by a black actor, but even more important was that he was a Klingon. Remember that at the beginning of TNG, all we knew of the Klingons was all the strife Kirk and his crew had with them. Troi (Marina Sirtis) was greek, or medeterrian or something like that. Picard was french, Riker was american, Data was a robot.
DS9 - Sisko was black. Kira was Bajorian, Dax was Trill, Odo was a changling, Bashir was arabic, O'Brien was Irish. The differences are more fictional about people being different aliens, but the spirit is there.
Voy - Janeway was the first female captain in a starring role. Chakotay was a native american (Or a native something or other, I forget). Tuvok was a black vulcan. Doc was a hologram. Kim was chineese. Paris was american. Torres was half Klingon and from her last name, I imagine she was supposed to be hispanic as well.
Compare all the diversity there to what TOS was, Kirk and Bones were American with McCoy being from the south. Spock was vulcan. And then you had a black woman, a japaneese man, a scot, and a russian. I wouldn't say that numberswise it's more diverse than any of the other series. It's just that society has improved itself that was don't consider a ship with a female captain, and native american first officer, a black alien security officer, chinese ops officer, and holographic doctor as shocking as 1960's america would have considered an educated black woman.
Would radiation blanket the entire planet? The neutron stars colide at point A and send off radiation in all directions. Some of that radiation travels in a straight line towards earth and irradiates the half of the planet currently facing the collision site. However, would the other half of the planet be spared from massive irradiation? Just like the half of the planet not currently facing the sun receives little of the radiation from it at night, could the same principle apply here? Would the critters on the "day" side of the earth relative to the collisioni be the hardest hit and instantly wiped out, and the "night" side critters spared, or does gamma radiation wrap around the planet and consume everything?
Current will also air segments every half hour showing TV viewers what Google searchers are tapping into at that moment
That's going to be kindof X-rated, don't you think? Experience has shown that at any given point, a good portion of people using the internet are searching for porn, or at least naked pictures of celebrities.
I think you'll be surprised at how well you'll do despite having only 12 pixels to identify a superhero's costume. However, I don't think a person who has been blind all his life can make the same interpretations a regular person can. We take for granted how much our brain fills in the gaps of what we can't (or don't) see. A person who hasn't learned to do this would probably have a great deal of difficulty doing this.
Slashdot Mirror
I think the whole idea of the future being some kind of technological wild west is more accurate than we'd like to believe. Our visions of the future expansion of humanity has largly been influenced by the Star Trek interpretation of how things might be, but Star Trek tends to see the future in its more optimistic sense, with people helping each other, and governments being genuinely interesting in providing its people with the technology and material to expand efficiently and relatively comfortably in regards to shelter and food and medicines. The real future of expansion and colonization is more likely to be people taking what little resources they have and buying a one way passage to a distant planet to try and make a living. And the governments of various nations will likely try to get as many of their people into space to claim land and/or planets for themselves, but once settlers are out there, they aren't likely to receive support from earth. Why would taxpayers want to subsidize outer space colonies?
Even looking beyond the socio-political aspects of the future, the day to day aspects of the show are still plausible. Planets that are suitable for habitation could be in varied different orbits so that they could be hotter or colder on average than earth. Odds are habitable planets are going to be equal to or hotter than earth in average temperature, since colder temperatures might inhibit the ability of plants to develop and make oxygen in the atmosphere. With hotter temperatures, it is likely that people would have to dress appropriately to protect themselves from excessive sunlight. Also, the frontier life would need people to arm themselves against bandits. As for robbing trains, it makes sense that when settlements are made, there wouldn't be an extensive infrastructure structure other than a simple hovertrain rail that could be laid down relatively quickly and cheaply.
Animals would likely be a preferable means of labor saving devices rather than using machines. For a tractor, you'd need a garage to maintain it, spare parts, as well as fuel. If crude oil or a refinary isn't on the planet, then you'd need to import it at even greater expense. Animals would be easier and cheaper to maintain when you're on the frontier. So in all, I think a wild west future isn't completely unlikely - it would be a frontier lifestyle with brief areas of technological punctuation.
Best Musical
Egg and Best Song
Egg, sausage and Best Actor
Egg, spam, and Best Actress
Egg, Costumes, and spam
Egg, bacon, Lighting, and spam
Spam, score, sausage and spam
Spam, egg, spam, Direction, bacon and spam
Spam, Script, spam, spam, bacon, spam, tomato, and spam
Lobster Thermidor a Crevette with a mornay sauce served in a Provencale manner with shallots and aubergines garnished with truffle pate, brandy and with Best Choreography on top and spam
What Science Really is... (Score:3, Interesting) by mfh (56)
56??? Geez grandpa, instead of debating the meaning of science, why don't you just tell us whether Evolution or Creationism is the right answer, you must have been around back then.
Big name prizes don't really attract people to science. College scholarships and demonstrations of practical applications of science will atract new students. For example, it's all well and good if Dr. Hoffenheimer wins the Nobel Prize in physics for his work in anti-positron flux through a silicone wafer, but other than physics grad students and Ph.Ds, nobody else is going to understand it, and lack of understanding leads to lack of caring. I think shows like Beakman's World and Bill Nye have done more to attract kids to science by makeing it seem approchable, rather than science being some thing that old guys did in white coats in sterile labratories.
The forums at The Straight Dope moved to a subscription system last year. They claim that it was necessary given the costs involved with maintaining a forum and bandwidth. According to Cecil, they're actually losing money on the forums, even with subscriptions, but the subseciptions to help to minimize the loss.
Plus, what's $20 a year, compared to the $15 a month you pay for online games like WOW or COH?
"PlayStation Portable and Nintendo DS will have similarly successful years, moving 3.5 million and 3.6 million units, respectively."
I don't understand where those numbers are coming from. Are they predicting that the DS is only going to sell 3.6 million units? That's already not true according to this article, which says that the DS has already sold over 5 million units. Or, if they're saying that these numbers are what each unit is going to sell this year, well then I still can't really believe that the DS will outsell the PSP, or that the PSP will be limited to under 4 million sales. Could someone translate all this marketing and sales analysis mumbo-jumbo?
Here's a copy of the data
t atgactgatcggtagcatatattatgctatagctagcgtgtagctagtat cacatcagctactatgtagctacgatcgagcacactgactacgtagctag tagcggatcgatagctgatctgactgactatatatagcgcgcgatatata gcgcgtagatcgtagccgcgcgatgatatataaggagactgactagc...
acgcggcgatgcgtacatagctagcgctgcatagatcgactatgacgat
Or, it could just be that Obi-Wan didn't remember them because R2D2 style astromech droids were so commonplace that he didn't have any way of recognising this one as the same droid he had a few adventures with 20 years ago.
As for C3PO, gold plated protocol driods were probably commonplace too. At the beginning of episode IV, they even showed a random extra C3PO style droid on the ship. Also when they were on the death star, none of the imperials seemed to react to C3PO like "Whoa, I've never seen that kind of droid before". Just because he was built by Aniken from spare parts doesn't mean that Anakin designed a completely new droid, but rather used a proven and reliable droid design that was already in use. Also, if you think about it, Obi-Wan never met C3PO in episodes I or II. In episode I while on Tatooine, Obi Wan stayed on the ship while Qui Gon and the others went into town. Then in episode II, the only time C3PO and Obi Wan were in the same area was during the arena battle, and C3PO was half battle droid at the time (or rather, two half battle droids). So unless episode III gives some real compelling reason for why Obi-Wan should remember them, I can believe that he honestly didn't remember them in episode IV.
Actually, freefall is a good environment in which to use the stylus. You can let go of it and it'll hover at a constant position relative to you since you're both in freefall.
I don't think this would be all that popular amongst the main stream. Unless you're that creepy guy on the subway reading a Hustler, or that perv downloading porn on the library computer, most people prefer to do their porn viewing in private. And if you are at home, would you rather be looking at porn on a 3x5 screen, or on your 19" monitor?
This isn't to say that there aren't people who have no problem with watching porn in public, but the demographic who is most likely to have the money and the desire to buy a PSP is also a demographic who would know to be a bit more discreet about such things.
So what if Nintendo doesn't show their new system at E3? It's not like the system isn't going to be demonstrated months before it's release anyway. Sure internet nerds like us will be disapointed, but I'd wager that a good majority of video gamers don't really care about who does what at E3, but rather will have their interest piqued by what's advertised in the mainstream media. This could even work to Nintendo's advantage. People get saturated by all the stuff that's released at E3, thus diminishing the impact of the information released. By letting the other guys beat at each other for a while, Nintendo can see where the bar is being set and can have their own press release a month later. This gives the gamers a chance to cool down and get hungry for more information after E3, and Nintendo does have a knack for making interesting and engaging presentations.
Let's face it, Duke is using the IPod to lure students to their school by waving a shiny toy in front of them. They're justifying it by saying people can listen to lectures on them. The student's thing its a great idea, because it doesn't affect them whether they're paying an assload of money, or a slightly larger assload of money for tuition. But really, people who don't care to go to class aren't going to care to listen the the lecture anyway; not that there's anything wrong with not going to class. I infact prefer to study from the book rather than be yapped at for two hours while zoning in and out. Also, consider that listening to audio recordings of lectures in math, science, or engineering is pretty useless without being able to see the equations and diagrams that are so essential to those subjects. The phrase "A picture is worth a thousand words" seems quite aplicable to this situation. Can you imagine trying to learn differential equations without seeing the manipulation of equations first hand by the professor? Audio lectures could be useful for more concept based courses, like history or philosophy.
I've been using a thumbs only controller for years. Here's a picture...
b .jpg
http://www.gamestop.com/common/images/lbox/900168
I rather like the idea of J. Michael Straczynski - he did a great job with Babylon 5
That's not reason enough to cancel it now, just because you think someone can do it better. I agree, JMS could to a spectacular job with it, but just because we want it to be so doesn't mean it'll happen. I know a few months ago he said he would like to do it, but then 1 day later he retracted that statement. If there was a contract saying that enterprise would be taken off the air and in 2007 a new JMS written series would be released, I'd be the first one on the kill enterprise bus, but there's no evidence that it will happen. We might as well speculate that Gene Roddenberry will be resurected from the dead and produce a new show and it would be awesome. I think it's stupid to give up on a show in the present because there's some far flung possibility that it could be done better by someone else.
Why can't Warner Brothers invest the money being used to develop this game into something else? Odds are this game isn't going to be a huge revolution in technology or gaming principles or programming or graphics or anything. This game is more likely to be a mediocre platformer, who's charm is going to be driven more by the story and the characters than the actual game itself. Why oh why can't they instead make more Animaniacs cartoons? That will target their prime audience better than a video game I think. A cartoonish platformer (unless it's done extremely well and elegantly) isn't likely to sell very well to the late teens/early 20's crowd, since these are the people who were the prime audience 10 years ago when Animaniacs was on the air. Since then I don't believe that Animaniacs has had a very big presence, and todays 8-14 year olds aren't as interested in it as we were. However, I don't think you'd find anyone who wouldn't be interested in the propect of new Animaniacs cartoons on TV.
I know I would rather have good voice acting from a noname actor rather than getting mediocre voice acting from A-list celebrities. (And by noname actors, I mean the experienced voice actors in the field. I know there are a lot of people in the voice acting field who are pretty prominant, but don't have any recognition outside of that circle). I don't care that the Olsen twins have a handfull of lines in some game that are delivered in a flat monotone voice. I don't feel any particular attachment to a game just because they stuff it with celebrities, with one exception - franchise games which have specific actors for each character. I appreciate it when a Star Trek game has Patrick Stewart doing the voice of Picard, or James Earl Jones does the voice of Darth Vader. Other than that, I don't care who does the voices, and would prefer talent over glitz. Doing voice acting is quite different than regular acting. Regular actors are used to being able to express themselves in their facial expression and actors, but voice actors have a real talent in being extremely expressive using only their voice.
I know that, but he plays a frenchman. Just as how Levar Burton isn't acutually blind, and Michael Dorn isn't actually a Klingon. Walter Koenig wasn't russian either, he just talked with what Americans believe a russian accent is. The diversity comes about from who the characters portray more than who they are in real life.
I was refering to Marina Sirtis herself, and not so much about Diana Troi. But you raise some good points too.
TNG - Geordi was black. In his original character description, they wanted a black character but in the description they sent to casting agencies, they specifically said they didn't want "street types" for the role, and they even would have prefered a slight Jamacian accent. Levar Burton obviously doesn't have that, but it's a slight consession for getting an actor of his caliber. Not to mention that he plays a blind character. There's also Worf, played by a black actor, but even more important was that he was a Klingon. Remember that at the beginning of TNG, all we knew of the Klingons was all the strife Kirk and his crew had with them. Troi (Marina Sirtis) was greek, or medeterrian or something like that. Picard was french, Riker was american, Data was a robot.
DS9 - Sisko was black. Kira was Bajorian, Dax was Trill, Odo was a changling, Bashir was arabic, O'Brien was Irish. The differences are more fictional about people being different aliens, but the spirit is there.
Voy - Janeway was the first female captain in a starring role. Chakotay was a native american (Or a native something or other, I forget). Tuvok was a black vulcan. Doc was a hologram. Kim was chineese. Paris was american. Torres was half Klingon and from her last name, I imagine she was supposed to be hispanic as well.
Compare all the diversity there to what TOS was, Kirk and Bones were American with McCoy being from the south. Spock was vulcan. And then you had a black woman, a japaneese man, a scot, and a russian. I wouldn't say that numberswise it's more diverse than any of the other series. It's just that society has improved itself that was don't consider a ship with a female captain, and native american first officer, a black alien security officer, chinese ops officer, and holographic doctor as shocking as 1960's america would have considered an educated black woman.
Would radiation blanket the entire planet? The neutron stars colide at point A and send off radiation in all directions. Some of that radiation travels in a straight line towards earth and irradiates the half of the planet currently facing the collision site. However, would the other half of the planet be spared from massive irradiation? Just like the half of the planet not currently facing the sun receives little of the radiation from it at night, could the same principle apply here? Would the critters on the "day" side of the earth relative to the collisioni be the hardest hit and instantly wiped out, and the "night" side critters spared, or does gamma radiation wrap around the planet and consume everything?
Current will also air segments every half hour showing TV viewers what Google searchers are tapping into at that moment
That's going to be kindof X-rated, don't you think? Experience has shown that at any given point, a good portion of people using the internet are searching for porn, or at least naked pictures of celebrities.
Indeed. Your brain can do a lot of interpretation based on just a little input. For example, take this little flash quiz.
w f
http://www.onceuponadime.com/gold/12pixelheroes.s
I think you'll be surprised at how well you'll do despite having only 12 pixels to identify a superhero's costume. However, I don't think a person who has been blind all his life can make the same interpretations a regular person can. We take for granted how much our brain fills in the gaps of what we can't (or don't) see. A person who hasn't learned to do this would probably have a great deal of difficulty doing this.
If it cost only $100 to get that, then every guy would have done it at least 5 times...
Before graduating from high school.
So ... you're knocking Nintendo because someone else made a game that was off the mainstream, and therefore since Nintendo didn't make it, they suck?
I'm positive its funding won't be cut right when it gets to the edge of the solar system. Honest...