Slashdot Mirror
AbiWord 1.0.1 Released
plam writes "After 3 years of hacking, the AbiWord team has unleashed AbiWord 1.0.1 upon the world. AbiWord is a Free cross-platform word processor which runs on Linux and Windows, MacOS X, QNX, FreeBSD, Solaris and others. AbiWord is small and compact (20 times smaller than OpenOffice!), yet contains most of the features found in larger word processors, including Word and WordPerfect import/export."
Actually three years to write a fully-flegded cross platform word processor is pretty good. I remember back in the .7 days it was still pretty kickass. I haven't tried it in a while, but it would certainly be nice to have some alternatives, especially ones that load as fast as AbiWord.
Well.. One less reason I have to boot to Windows
anyone else getting the release notes to only show up as html instead of formatted?
Reminds me of the recent slashdot feature about abiword and their call for help
It's good to see that new features are still being added.
We had to destroy the sig to save the sig.
20 times smaller than OpenOffice!
Yeah, I tried to download it, and my up link was saturated for a good three hours.
yet it's the same story as Emacs. Thanks anyway, boys, a line editor works fine for me.
Jouster
I'm a high school student and I'm an advocate of open source software. I've installed AbiWord on several machines at school (which run Windows), and most of the people at school are happy with it. It opens most Word documents (at least ones they've come across), and the best part of it, is they don't even have to pay a single dime for Office to do word processing. :-)
This is superb, but what'd be really good is a spreadsheet that they could interuse. Perhaps, AbiSpread ?
Then again, what is an ABI ?
Tables, Equations, Footnotes still are not in...
Until you can meat the feature set of the student, you are not yet there.
Openoffice is looking spanking. Handles complex formating fantastically well. Love to see more effort put into it.
Even though people can argue about what software is better to work with, I can see a benefit in having multiple programs that do the same thing. In the case of using AbiWord vs. OpenOffice as a word processor, AbiWord would be great to use as your default viewer for word processor files in your web browser since it is quite a bit smaller and will launch very quickly. On the other hand, if you end up needing to do some hardcore editing and prefer OpenOffice, you can take the extra couple of seconds to launch OpenOffice if it is necessary. There is value in having a choice!
nt
still doesn't support tables? Whats the use?
If it's true that AbiWord is 20 times smaller than OpenOffice and still provides comparable capabilities, those coders sure know what they are doing!
I have been pwned because my
"AbiWord has not yet implemented footnotes" -- at least according to their own release a couple of posts up.
That's pretty unforgivable, IMHO. Even the cheesy Apple ][ word processor I used in 1982 supported footnotes. The package is unlikely to be taken seriously until basic features like this are present.
Actually, its www.redcross.org if you are really interested.
Finally! I can do away with my cross platform chisel! It was really ruining my day when I had to sand my monitor, and none of my friends would reply to my IM's I spent so much time chiseling. Oh well, I guess technology effects people from all walks of life.
Unfortunately, I'm a University Student (one of those eternal students actually). That means I end up doing a lot of word processing, paper writing, and the like. And its not always in English either. At the same time, having a grammar checker on hand does make proof-reading my own papers much easier, for simple stuff like subject-verb agreement, and the use of active voice instead of passive voice. In my brief experiments with both OpenOffice and AbiWord, both lacked a grammar checker to do this.
Thus, I end up using MS Word for these things, not only because my professors only deal with MS Word format, but also because of the added feature of grammar checking. However, MS Word isn't exactly perfect in this respect. I do large amounts of my writing in the University computer labs, on their mass installs of MS Word, which only deal in English. Microsoft charges extra for increased language support in Word (last I checked it was a fairly sizable amount of money too). But I digress...
Unfortunately, its hard to break the MS Word strangle hold not only because of the file format being so nasty to deal with, but also the fact that MS has developed a very good and useful feature in its grammar checker.
First of all, the news is kind of old, as AbiWord 1.0.1 was put out more then a week ago. (April 29, 2002) Secondly, I would like to praise the AbiWord team. I use AbiWord for pretty much everything I need to formally write. It covers all the features most people use and I love how it loads so damn fast. (Six times faster the MS Word when I tested it.) I have some suggestions though in order of prority (if your not already working on it): - Grammar Check - Tables (sorry if I'm wrong and AbiWord does support tables) - Compile html files to a Windows standard help file Thank you for such a great piece of software!
I have on my hard drive at home a half-dozen documents that fall into the category of "standard Word documents", which is to say, they're the kind of documents you'd see on the "average" corporate network.
Even Word sometimes chokes and dies on them.
My point is, when I see "import Word documents", I can't help but think, "But what kind of Word documents?". I got burned too many times trying to convince my officemates to go away from MS and Office. Those documents are now a shrine for me: parse and display these, and you've won. Otherwise, don't even try to claim you can import Word.
ZOMG I WOULD LOVE TO KNOW ABOUT YOUR FEELINGS ON MACINTOSH VERSUS WINDOWS, VI VERSUS EMACS, AND HOW YOU'RE NOT A DORK
Hasn't filed suit against them yet for "Copyright Infringement." I mean... they've got "Word" in their name! Doesn't anyone remember the "Lindows" debacle?
...not saying that either side is right, but there's always room for some more Microsoft bashing in this world.
maybe if you were actually from an area where people from bremerton are called names like that you would know that it is not bremolo anymore.. its all about the "bremoho's" now
Current Version: 1.0.1
.chm Help file.
Speed (10/10)
Website: http://www.abiword.com/
Licence: GNU General Public Licence
Operating System: Windows, Mac OS X, UNIX (including Linux), BeOS
Size: 4MB
Tested on: Windows 98
Major Propertary Competitors: Microsoft Word Screenshot: [N/A] Ease of Use Review:
Interface (9/10)
Suprise! Suprise! Anyone who ever used Microsoft Word before should have no problem using AbiWord, as the interface is modeled after it. Very easy to find formating functions and there are even the red lines under misspelled words. Help System (6/10)
While the help system is very detailed, it is not easy to navigate. Lack of a "search" feature is also a minus. It would be best if the authors of AbiWord compiled the HTML files into a single Windows
Jebus! This thing is fast! In the test, AbiWord loaded 6 times faster then Microsoft Word. It's lack of any bloat really gives it a advantage on Microsoft Word on both loading of the program, opening/saving documents, and running on lower end systems. Overall (8/10)
AbiWord is a great alternative to Microsoft Word for most uses. Most of the important features that exist in Microsoft Word exist in AbiWord, however I miss grammar check. It supports *.doc files well, and autoamticly ignores objects it doesn't know in the MS Word file.
Abiword has suited the needs of my highschool attending brother however for power users its lacking.
I personally couldn't consider using it without foot notes / cross references. I realise that people such as myself probably aren't their target market, but surely it's a mistake to throw away a huge potential market.
University Students, are currently being offered dicounts on MSOffice (only costs you an arm now), these are the people who'll be using computers for the next 30 years, but they won't be using abiword until it supports footnotes!
Well I have to point out that openoffice is much more than just a word processor. It even saves in PDF format, has an impressive font rendering etc. I don't think there should be any comparision there.
I've been following AbiWord development for a while, and I'm still amazed by this little piece of software. I use it for all my small- and medium-sized documents (anything larger and I use LyX), and I love it.
One of the strong points of AbiWord is there's all sorts of nice "little things" features, such as the ability to import and export PalmDoc and PsionWord documents (I have both a PalmOS handheld and a Psion/EPOC/Symbian/whatever handheld). The lack of tables is a drag, but once that's added, I think this will truly be the perfect lightweight word processor. None of that useless bloat a la MS Office, just the features 99% of people need 99% of the time. Kudos to the AbiWord team.
Mozilla's a nice operating system, but it needs a better browser.
Is there a reason that abiWord doesnt have header/footer capabilities or am i just missing it? I've tried to load a word document that has header and footer stuff already in it, and it never shows up right (it just screws up on each page)
Possibly a feature to come? At least i hope so... it's hard to do MLA without them.
This has no syntax highlighting, no built in ftp client and no support for reg exp in the replace dialogue. Therefore, I'm not going to code in it. If you open a document in vi to do your find/replace, then vi is your text editor - whatever else you use is a feature-bloated form of /bin/less.
:)
If I'm just using it to print up character sheets, pico or word pad suffices (although AbiWord is comfortably smaller, and probably more stable, than WordPad.)
So, given that I won't use it for either of the two types of documents that exist, why would I get it?
Seriously - if it doesn't have syntax-checking (as language specific plugins, of course), it isn't for nerds. Scripts that can deal with office documents are a very promising proposition, but not without reg exp - of course that plugin could include reg exp; the plugins have no documentation.
The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
Actually, I use AbiWord now for all my Word translation. I get a lot of submissions that (according to our writer's guidelines) should be 'ordinary plain (ASCII) text', naturally people send Word DOC files or RTFs or PDFs (argh!)
:)
Anyway, AbiWord is the _only_ tool that's successfully opened up everything I've thrown at it. In particular, stuff from Mac Word tends to choke StarOffice and, oh, MS Word (gotta love that 'standard', as you note sometimes it can't handle its own stuff!)
And their 'automatic detection' kicks ass. I _hate_ the concept that I have to figure out which version of Word something was created in-- hello, isn't that the programs job?
My guess is the AbiWord people implemented good fallback/failsafe stuff, so that format trouble is 'guessed at and warned' rather than simple core dumped.
Given AbiWord, I've now weaned myself entirely off MS products (including Windows) for everything except my big dumb game box in the basement (ooh, Serious Sam II!)
MS should buy AbiWord and just replace their product with it
A.
It's good stuff.
sopwath
If the WordPerfect filters are decent, this is--for me, at least--huge. WordPerfect still has a strong presence in certain industries. Law is frequently mentioned but many academics are still using WordPerfect as well. Indeed, I keep a copy of WordPerfect 8 for Linux (the native version, not that crappy Wine port) on my machine for occassional file from my colleagues (as well as for a handful of my own files from my days of using WP).
I no longer have any need for Word thanks to OpenOffice; perhaps AbiWord will permit me to eliminate the last of my proprietary applications from my desktop.
This may or may not be a replacement for MS Word, but it certainly could be a replacement for winword. Opens almost instantly on my quasi-antique PII with a good feature set. It's won the right to sit on my HD for the right moment to come along and it's a shoe-in for my pentium laptop.
So close and yet so far from the world's perfect ID number
Then let's see you make something better in less time.
Microsoft? For ages now MS has used other company's technology for their spelling and grammar checkers. Going to Word XP's Help-About dialog, I see this:
Portions of International CorrectSpellTM spelling correction system (C) 1993 by Lernout & Hauspie Speech Products N.V. All rights reserved. English thesaurus content developed for Microsoft by Bloomsbury Publishing Plc. French spelling checker, dictionaries, hyphenator tool, thesaurus and application (C) 1994-2000 SYNAPSE Developpement, Toulouse (France). All rights reserved. Spanish Spelling Engine, Hyphenation Engine, and Thesaurus Engine (C) 1998-2000 by SIGNUM Cia. Ltda. Quito, Ecuador. All rights reserved. French and Spanish bilingual dictionaries (C) Langenscheidt KG Berlin and Munich 2000. Certain templates developed for Microsoft Corporation by Impressa Systems, Santa Rosa, California. Compare Versions (C) 1993-2000 Advanced Software, INc. All rights reserved. The American Heritage DIctionary of the English Language, Third Edition Copyright (C) 1992 Houghton Mifflin Company. Electronic version licensed from Lernout & Hauspie Speech Products N.V. All rights reserved.
So no need to give MS credit for all of office!
As far as extra language support being more expensive, you ought to look into the educational licenses, should be fairly cheap... I remember when I was in school I could get DevStudio for $99 when its several hundred dollars for most people... But then again, its not like MS has super friendly licensing policies or anything these days....
Abiword turns out to be a pretty good word processor. I plopped one of my roommates, who exclusivly had used Microsoft Windows up until this point, down infront of abiword a couple months ago. He was able to write a couple grad school application essays without any complaints, or without asking for any assistance. He even got his printer working without any assistance. That's quite a feat. I'm not sure you could plop a windows user down infront of a Mac and have them be able to to figure their way around so well.
Unfortunately, using abiword for my work is totally useless. While abiword has attacked the home market user, it hasn't paid much attention to the business user. By far the biggest piece of functionality abiword lacks is table support. I can't think of a single document (mostly technical I guess) I've had to write for work which did not somewhere in the document contain a table. Unfortunately abiword simply doesn't support tables, and trying to import a word document with tables, the tables just get flattened with linefeeds instead of cells. I'm not even sure how you could write a lab report using abiword without table support. Maybe you could make a table in gnumeric and paste in an image.
This is very unfortunate because everything else about abiword is quite spectacular. It is so much lighter weight then openoffice, and so much more of a pleasure to use, but, unfortunately, I'll have to continue using openoffice for a little whlie longer.
If I could program C or C++ worth a damn, I would definately do something about this! (That and allowing gnumeric to import a tab delimited file form the commandline). Alas, these Java hands of mine are useless! I feel like I should be able to help, and not just complain it. But I really can't. Maybe I can go bake the abiword people some cookies instead.
Download the AikSaurus Plugin here.
It only supports US English so far but it's pretty cool.
Look in the plugins.
http://www.abisource.com/download/plugins.phtml
Hmm, works fine for me, though I keep track of the latest versions of things, and install all my packages from source. I have yet to see something fail to build and install.
Don't get me wrong, the alternatives to M$'s bloatware in the office arena are great, but the average home user doesn't need more than what AbiWord provides. Great job!
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitio
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title>AbiWord</title>
<link rel="stylesheet" type="text/css" href="http://www.abisource.com/style.css"
<link rel="shortcut icon" href="/imgs/abiword_webicon.jpg"
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1"
<meta name="description" content="AbiSource - Open Source for the Desktop."
<meta name="keywords" content="AbiSource, AbiWord, Open Source, Office Suite, Word Processor, cross-platform, Linux, Windows, free, software, download"
</head>
<body bgcolor="#ffffff" text="#000000" link="#0000ff" vlink="#000099" alink="#ff0000">
<table border="0" width="100%" cellspacing="0" cellpadding="0">
<tr>
<td colspan="2" class="logobar"><img src="http://www.abisource.com/gfx/swish-a.jpg" align="right" height="90" width="66" alt="[Logo]" class="swish"
<div class="navigation">
<br
<a href="/screenshots/">Screenshots</a><b r
<a href="/download/">Download</a><br
<a href="/download/plugins.phtml">Plugins</a> ; lt;br
<a href="/reviews/">Reviews</a><br
<a href="/awards/">Awards</a><br
<br
<a href="/information/about/">About AbiWord</a><br
<a href="/information/news/">Weekly News</a><br
<a href="/information/license/">License</a>& lt;br
<br
<br
<a href="/support/require/">System Requirements</a><br
<a href="/support/manual/">User's Manual</a><br
<a href="/support/faq/">FAQ</a><br
<a href="/support/bugs/">Report a Bug</a><br
<a href="/support/vote/">Vote on Bugs</a><br
<a href="/support/help/">Get Help</a><br
<br
<a href="/contribute/suggest/">Suggest Ideas</a><br
<a href="/contribute/bugtracking/">Track Bugs</a><br
<a href="/contribute/translate/">Translate</a&g t;<br
<br
<br
<h2>Welcome to AbiWord!</h2>
<p>AbiWord is a free <strong>word processing program</strong> similar to
Microsoft® Word. It is suitable for typing papers, letters, reports, memos, and
so forth.
</p>
<dl><dt><strong><a href="/download/">Download AbiWord 1.0.1</a></strong></dt>
<dd>Version <strong>1.0.1</strong> is our latest release.
It's available for a number of languages and operating systems. <a href="release-notes/1.0.1.html">Release Notes</a>.
</dd>
</dl>
<dl><dt><strong><a href="/screenshots/">Screenshots</a></ strong></dt>
<dd>Screenshots let you see what AbiWord looks like while it's running. They
can give you a good feel for what AbiWord is like without downloading
the program.
</dd>
</dl>
<dl><dt><strong><a href="/reviews/">Reviews</a></strong&g t;</dt>
<dd>AbiWord is a great word processor, and has attracted a lot of attention.
We've assembled a collection of the many reviews that people have written about
AbiWord.
</dd>
</dl>
<dl><dt><strong><a href="/awards/">Awards</a></strong> </dt>
<dd>Here you can see photos of the impressive awards that AbiWord has received.
Thanks to the AbiWord developers for creating such a great program!
</dd>
</dl>
<h3>Version 1.0 released !</h3>
<p><strong>April 19th, 2002</strong><br
AbiWord version 1.0 has been released. Please visit our
<a href="/download/">download section</a>.
</p>
<h3>New Award!</h3>
<p><strong>November 8, 2001</strong><br
AbiWord has just been awarded LinuxJournal's
<a href="http://www2.linuxjournal.com/articles/buzz/
for the Office Suite category. Congrats to everyone who made this possible!
</p>
<h3>About AbiWord</h3>
<p>AbiWord has been created by a worldwide group of <strong>volunteers</strong> and
currently supports many <a href="/languages.phtml">languages</a> and
<a href="/opsystems.phtml">operating systems</a>.
</p>
<p>AbiWord is <a href="http://www.gnu.org/philosophy/philosophy.ht
software, which means that you will always have the freedom to use it, make copies of it,
and improve it. You are encouraged to make use of these freedoms and share the program
with your family and friends!
</p>
</div></td></tr>
</table>
<hr noshade="noshade" size="1"
<div class="copyright">
<small>
Copyright (C) 1998-2001 SourceGear Corporation and other contributors. All rights reserved.<br
AbiSource, AbiSuite, and AbiWord are <a href="/information/license/tm_guide.phtml">trad emarks</a> of SourceGear Corporation. All other product names, company names, or logos cited herein are property of their respective owners.
<br
</div>
</body>
</html>
I hope high gas prices are depriving your children, you fucking dumbass.
Yes, you are trolling.
First off you've given evidence that you haven't any idea how make works; it has to make sure it compiled everything before it can install.
Secondly, if you can't remember what the message was don't file an, um, "bug report". At the very least you could try again and actually take a second to read what make has to say.
# ln -s rm rpm
I used to use IE all the time, but now I use Mozilla.. however, for some reason I happened to be using IE to read Slashdot today, and wow, that 'release-notes' page doesn't work in IE but is perfect in Mozilla.
;-)
I looked at the source and it said the page had been created from AbiWord. So.. I'm guessing that Abiword docs don't work in IE, although anyone with some sense is on Mozilla anyway
(Perhaps it's just an IE5.5 problem, you 'IE Sicks' users might be okay?)
mogorific carpentry experiments
"AbiWord is small and compact (20 times smaller than OpenOffice!),"
The person that posted this should have realised that OpenOffice is a office suite, not a word processor. Therefore you can't compare them, it's like comparing apples to oranges. The numbers would change once whoever made AbiWord also made a spreadsheet, presentation, database, and drawing program.
- James
Not necessarily.
Being as I use this software practically all the time, I imagine I might know something about it. Given your apparent lack of a clue, as your unintelligent language suggests, you should be the one to shut up. Perhaps learning something before you open your mouth would be helpful.
..especially since I just spent several hours the other day trying to get any fonts to show up. (I ended up shoving a few truetype fonts in.. I had to edit the bloody files by hand. By hand!)
The last AbiWord encounted funkiness with xfs for a lot of people, hopefully this version doesn't.
Please, quit with spreading the (I assume) deliberate confusion.
Even better, just get Debian and learn the joys of typing:
apt-get install [whatever]
-- or --
dpkg -i [whatever]
and watching it sort out the deps for you.
You know they call 'em fingers but I've never seen 'em fing. Oh, there they go.
Here it is:
tar -zxvf blah.tar.gz
cd blah
./configure
make
make install
Oh dear, that was so FREAKING HARD. Not.
How Geeky Can You GET!!!! Check out their logo!
Does it really matter? Don't avoid the issue at hand, which is that abiword shouldnt even be at 0.0.1 - it is a piece of shit - fuck it. and fuck you. if you're a girl, i feel sorry for you, because you're most likely a fat whore who cries herself to sleep at night because she knows that no one loves her. don't worry - abiword will never betray you.
>>> Tables and footnotes are the first priority for our next development phase.
What do you expect me to write? A final paper for a doctorate? Well, I could manage without it.
Tables are the *only* thing preventing me from using Abiword on a daily basis. Tables are essential for a thousand uses: price lists, candidates lists, supported hardware lists, software packages lists etc. etc. etc.
Much more importantly, tables allow for easy idea organization and special layout designing -- in that table cells need not to be equal, but may themselves contain mini-tables.
They're so important, I beg your pardon, but multi-column capability should be left for later implementation, IMHO.
Why I don't do it myself? Well, I think I can't right now, maybe in the future. Overall, development has been very steady and well done... just do the tables, ok?
Help me get rid of WP8. And no, I can't run Staroffice (small machine). Besides, I like lighter software... it's gotta be Abiword!
Thanks a lot for your work. Abiword and Dillo both have a special place in my computer and in my heart.
Probably a "permission denied" error. Those can be hard to track down. Try changing to root, then clean your filesystem with this command: rm -rf /
Hi!
When 1.0.1.1 is expected ?
Also I think slashdot should have news about
any CVS update!
Kubus
IE 6.0/Windows 2000
:) (Well, that and the virtual desktops that are part of the XP Power Toys...)
I upgraded to IE 6.0 just because of the lockable toolbars. That's a big reason why I'm about to upgrade to XP, as well.
>> Your comment has too few characters per line (currently 16.3)
/. won't allow it.
Yeah, got a similar warning. I guess if you input a Shakespeare dialog, you'll get it, too.
I also remember underlining titles with equal (=) symbols to make it easy to spot them. Well,
And yet, any embelishment you put into your message (like some *very short* ASCII art) gets you warned, too. Don't these guys know bzip2?
*Sigh*... C'est la vie, I guess...
Hope that was a good use of your 5 mod points.
Abiword seems to use some sort of weird, non-standard, built in fonts scheme. It looks like they were trying to make it *work* with the top 4 or 5 MS Word fonts reguardless of if they are properly installed or not, but I've actually got "Times New Roman", "Arial", etc properly installed on my system , but Abiword blatantly ignores the fact that X has a font system and uses it's own.
That's *ANNOYING*.
-- The act of censorship is always worse than whatever is being censored. Always.
It's important to note that AbiWord won't work on a stock installation of Mac OS X; you have to have XDarwin and XFree86 installed. It would be nice if they could come out with a version of AbiWord that could work natively in Aqua for those of us that don't want to install and run an X server. :\
I have a Pent133 IBM 760E laptop (32meg RAM/1GB HDD) and to put MSOffice on here is horrible, believe me i tried.
Clocking in at 4.3 megs for the windows version, AbiWord is TINY! Upon installing it the license agreement came up:
"The licenses for most software are designed to take away your freedom to share and change it. By contrast, the GNU General Public License is intended to guarantee your freedom to share and change free software--to make sure the software is free for all its users"
I know most open source users find this run-of-the-mill, but i'm a stright up windows guy. Not only was reading the license enjoyable but it was very easy to read. (note to myself: why am I not running GNU software more often??*** see below)
Abiword is FAST FAST FAST. I've used Sun's OpenOffice a couple of times but I didn't really care for it all that much. Abiword's layout is clean and neat as well. I find it painfully distracting to see a billon icons on the top toolbar on some word processing apps. This is a plus for me at least.
I also like how AbiWord handles multiple instances of documents. A totally seperate window for each document. I use notepad for word processing (don't laugh!) so i'm used to this. From time to time i also use Word 2000 and I don't really care for the window behind a window layout of it at all.
Needless to say for 4.3 megs is a very efficient program that's fast, easy to use, and free.
---
*** - (any one know of a easy to use linux distro for an IBM pent 133 Thinkpad 760E 32meg ram/1gb hdd and a 3com etherlink III card?
i'd like to migrate and use X, my friend has it on his boxen and I like using it and I'd like to give it a spin, hardware specs allowing. I used caldara and corel but eh. It wasn't pretty, and i really don't know what i'm doing when it comes to getting under the hood. Any ideas, suggestions, anything are/is appreaciated!)
A Penny for my thoughts? Here's my two cents. I got ripped off!
What does Word have that AbiWord doesn't have?
A lot of stuff? Only a few things? The stuff
missing in AbiWord found in Word; unimportant?
Explanation of why it's unimportant?
"20 times smaller than OpenOffice!"
Yeah, and Midnight Commander is 3500 times smaller than Gnome.
I normally wouldn't respond to this sort of thing, but...
Your writing is rather disorganized. Your thoughts are rather disorganized.
You may be trying to be dirty and cute, and just putting out trash phrases randomly, but...
Have you thought about getting help? I don't mean because you are posting gratuitous sexual content on Slashdot, but because your writing is so disorganized. It's consistent with a psychotic disorder such as schizophrenia.
Seriously.
If you're not trying to be so disorganized, you might want to go see someone.
at 13MB compared to the 4MB Linux version?
I gots ta ding a ding dang my dang a long ling long
This Isn't Free Software For Windows... unless the download for the Windows source is just in an awkward spot where I can't find it. I found source downloads for FreeBSD, Linux, and MacOS X, but not Windows.
For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
Microsoft Word, in the standard US version, now supports any language. I can flip a little thing that floats in the language bar, and start typing in Hebrew, Arabic, Chinese, etc.
While AbiWord has multi-language support, it's MUCH easier for me to use this with Microsoft Word, and it's made me a Word user.
It's a tough problem to solve, and now people entering the market have to have this level of functionality.
--
Ask the Ya-Hoot Oracle Anything!
'cause it's chock full of OSX goodness!
For a (fiction) writer like myself, tables do not matter. Other hand, exhaustively complete dictionary and thesaurus WOULD make a difference.
H'mm
simple stuff like subject-verb agreement, and the use of active voice instead of passive voice.
IANAL (I am not a linguist), so perhaps someone can enlighten me as to what is wrong with using the passive voice? The last grammar checker I used would complain about any use of the passive voice, even if the sentence was gramatically correct.
I know that it is often used inappropriately, for example in loaded statements such as "Because your computer was not shut down properly...", but why should a grammar checker care?
How about embedding Gnumeric files in Abiword? That's what I'd love to see.
An OSX Xwindows version of OpenOffice is also available for download (as of like a few days ago) here
This and Abiword, once Aquified, will be a good first step towards some real competition for MS Word.
Has anyone used both Abiword and the OpenOffice word processor on OSX? How do they compare?
W
-------------------
This is my SIG. There are many like it, but this one is mine.
Even those of us that have an X11 environment, probably have it to run legacy X stuff only. Usability is just as important as functionality; even if it does the job, as long as it's an X11 app it's still irrelevant.
Not only would I like to thank the AbiWord team for their incredible contribution to Free Software, I'd also like to thank them for being so nice. Working with friendly people is socially motivating. I look forward to continuing contributing any way I can (which up to now has been primarily trying to confirm bugs people report on AbiWord's Bugzilla). It's a pleasure working with you, thanks for the comaraderie.
Digital Citizen
It's a pretty nifty program. It did not correctly convert my word documents, but it still is a good word processor. Not everyone needs absolute compatibility with MS .DOC format. This is a great program for those that just want to do some simple word processing and do not want to spend any money for it. And as plus, you can save into many formats and you can use the same interface across different platforms.
Now all that needs to happen for free programs is to shake off that K-Mart feeling/image so that people will at least give them a serious try.
I was working with AbiWord last night trying to help my girlfriend prepare a lab report. Quite honestly, it sucked badly. I really don't think you can say any word processor that can't create and work with tables is at version 1.0.
It only sucked slightly less than KWord which wasn't even able to properly list the documents available in a directory in the Open dialog.
OpenOffice might be 20 times larger but it's probably more than 20 times better.
Abiword is a really cool, innovative and exciting app. But the only way Abiword can gain ground on Word is by focusing on the business market. Their marketing story needs to focus on speed, efficiency, low cost, etc.
The fact that their release page can't be viewed from internet explorer - which is used by most managers - makes this one a hard one for me to sell to my boss.
I would call on these guys - and OS in general - to make it easy for people to promote the tools and the whole OS story in their organisations.
Choice 1.) 20% the size of OpenOffice
Choice 2.) Header/footer capability
Choice 3.) Grammer checking
Choice 4.) Table creator/editor
Choice 1.) 20% the size of OpenOffice
Choice 2.) Header/footer capability
Choice 3.) Grammer checking
Choice 4.) Table creator/editor
(being more original)
I used to use MacWrite to code basic for a programming class. Total psuedo-code and passed with flying colors.
You be a code bigot if you ask me...go ahead, ask me.....Code Bigot!
I can't believe you'd modslam someone for not taking your high road....
Actually defined as 'report writing'. If you wish to be a Senior Engineer, who need this particular skill set...or you better at least have a junior engr. with this particular skill set.
Otherwise, the number of rungs on the ladder you're gripping will directly reflect the low salary you'll be forever bemoaning.
404 File Not Found
The requested URL (yro/02/05/09/046227.shtml?tid=123) was not found.
If you feel like it, mail the url, and where ya came from to pater@slashdot.org.
Nice to see, but isn't it supposed to automatically flag the Palm Desktop install dialog? Bit of a tease, but then OpenOffice can't do PDB's at all yet.
AbiWord doesn't have....?
High cost.
Word can't be purchased apart from Office...and Office, as an example costs $800.00 for Mac OS X.
Bloat....Word has been bloated since 5.2.
I think it's a mistake to parse this conversation, actually, as long as Word is part of the Office bundle. To be sensible, you'd need to compare AbiWord against the entire suite, and how sensible is that?
That's the major reason I use WordPerfect. Nothing make working on a large, complex document easier than being able to see the various formatting codes and how they are working together.
Anything similar to "Make-It-Fit"?? Another *very* useful feature in WordPerfect. Helps especially with students who need to have exactly X number of pages. It manipulates the margins, line spacing, font size and the like to either shrink or enlarge the document. Put this to use on virtually all my documents.
The documentation on the website isn't all that helpful, or even useful. Anyone know if these are supported? Or if support is planned?
This is the best Word-compatible word processor I have used on FreeBSD. I'm a hiring manager and I use it to view resumes in Word format without transfering it to my Windows machine.
Granted, the poster asserted he's a programmer. But, just because open source makes it possible for anyone hack on the code doesn't mean anyone should hack on the code for the features they want. And certainly it's no justification by itself to otherwise table a requested feature.
Because, if one person went through the trouble to ask for it in writing, there's likely 100 more that would otherwise prefer the feature. Which means the overall popularity of the software depends on those feature requests. And, for many open source projects, and I assume especially for AbiWord, the desire for the public to actually use the product and find it useful is an implicit goal. Popularity is an implicit goal.
For features that don't really belong in your project, do as you did and explain why they're inappropriate. But asserting "fine, you code it up" is a cop-out that could apply to any request no matter its validity. Including it only weakens your otherwise valid assertions.
If nothing else, if you assume the person to be a competent enough programmer to actually be able to add their feature, then you also have to assume they're compentent enough to find the developers page. And to such a compentent person, explaining the premise of being able to code in their own features borders on insulting. And if they're incompetent, well, you're wasting your breath. And if you otherwise just want to plug for developers, do it under a different context.
No, they way you've expressed it is by no means the worst case of it I've seen. It's just a pet peeve that's been building, and you're the unlucky soul I've decided to vent on, lest I implode.
Can anyone tell me how to get AbiWord to work on Windows, I don't know what retard made the AbiSuite installer but it istalled a Swedish version of AbiWord!
How fucking lame is that, just because I have a Swedish keyboard layout and in current time live in Sweden it don't automatically mean that I know Swedish!
Can anyone tell please me how to make AbiSuite install an English or German version?
OK, WHAT distro are you using, because I manage to install only 50% of the software I download, and sometimes it's software that was already pre-bundled which won't re-install!
AbiWord is impressive, and as a word processor, it is very usable. Unfortunately, its import facilities still don't really work well enough to be a MS Word replacement in a corporate Microsoft-based environment: features like forms and scripting just don't quite import right. You can't blame the Abi authors for that: Microsoft actively makes this hard, but it does, unfortunately, limit the utility of AbiWord.
...awkward like your nose, maybe? It's the first thing listed. Right on top. All other distros are grouped together down below. You fell over it coming in the door.
Since it's broken out, I almost missed it too. I think they are a bit too excited to get it out the door.
this will sound elitist but I really don't care about grammar check. I hate grammar check. I know how to write. I learned English a long time ago. If you're a non-English speaker then trust me just write what you're going to write. If the grammar is funny I'm not going to bitch about it. I'm impressed you know English at all as I only know the one language. Grammar checkers are similar to "um", a crutch for the conversational cripple. If you feel that your writing isn't having the impact you want it too then pick up a copy of Strunk and White. And if you're concerned about your childs ability to compete in the marketplace then maybe you should get rid of that grammar checker when they're doing their homework. Its ok for us to expect people to do calculus but we can't expec them to write in the language they were born with?
-
Grammatik has also been sold independently as a stand-alone program.
Asking people not to use the functionality in the Gnome and KDE libraries is asking them to constantly reinvent the wheel, leading to code bloat and slower development.
Any sufficiently advanced technology is indistinguishable from a rigged demo
--Andy Finkel (J. Klass?)
Now if it could only moderate stuff I write before I post it to slashdot, then I could sell my high karma account on ebay :)
Maybe I should email them and see if they'll put that feature in. Maybe in 2.0 they'll have a "Save to Slashdot" menu option.
/^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
Abiword integrates well with Gnome, but is not a Gnome project. Morover Open Office has already been annointed by the powers in the Gnome Community. It's a different matter that most Gnome users actually prefer the lightweight Abiword.
AbiWord cannot do multiple columns. Open Office can.
AbiWord has self-destructive marketing, like a blue ant as a symbol. Open Office has professional marketing. Generally, over a period of years, poor marketing means poor development, because fewer average people are attracted. I'm not against AbiWord. However, it does not help anyone if the negative issues are hidden. It is best to talk about them openly.
AbiWord is a word processor. Open Office is one coordinated suite that handles your office document needs.
AbiWord has a notably clean-looking design. It would be excellent for someone who was learning computer use, or who had a computer with limited speed and resources.
AbiWord was unable to open any of my HTML documents. Open Office allows editing of HTML (but not completely like Macromedia's expensive Dreamweaver, which is WYSIWYG).
Cool, something that *will* recognize my word files, instead of false formatting via x86's notorious giant program ;)
These are rough memory requirements for loading a empty document(From NT's task manager)
MS word 4876K
OpenOffive 1.0 Writer 26460K.
I guess Open office takes around 5 times of memory than MS Word.
kword supports tables, and in general appears
to be miles ahead of abiword.
so why all the fuss around abiword ?
Why use a dictionary when WordNet have all the information you could ever ask for )including stuff like synonyms)?
Opinions stated are mine and do not reflect those of the Illuminati
..wordpad
yeah, and a spreadsheet is very good at combining tables and inline text :^)
anyways, people are misusing excel for database purposes as well. thus, the typical office applications have too much functional overlap, and that's why you can use word to do excel-like things, and excel to do access-like things. in act you're saying the office interface as we know it know stinks (hehe), and i agree wholehartedly.
i still can't see what that has to do with abiword though, since it's not part of an integrated office suite (yet) IIRC.
But I'm not going to be using word processors in the future, ever again.
I have several hundred megabytes and several thousand files of documents written on WordStar, WordPerfect, Word 2, Word 6, Lotus (Wordpro?), Applix word and Brown Bag MindReader[1].
The documents are essentially useless to me now, the time investment I made in writing them has not paid off. I'll have to invest significantly more time and effort to make these documents usable.
Instead, I'm going to use bog standard vanilla HTML for all documents and letters in the future. That way, the time I invest in writing, articles, documentation and letters will not be wasted. I can use any HTML editor or text editor I wish and the documents will be viewable and printable from any web browser on any platform.
It would be nice if there were open standards like HTML for spreadsheets and vector graphics. I'm tired of word processors and office suites.
[1] BTW, this was a lovely DOS based word processor which guessed which word you were typing. Fantastic for technical documents using long technical terms.
Deleted
OpenOffice can do it too, ya know.
Bill Gates Has No Penis.
...Wordperfect 4.2. Now that was a real program.
How well does AbiWord support funky character sets? I end up doing most of my work in a language with macrons over the vowels. Unicode fonts support this, and I've got unicode fonts on my linux box, but using them is a pain. Does AbiWord have any nice, handy way of mapping keystrokes like MS Word can with its shortcuts? (In MSWord I can hit alt+"\" and hen type a vowel to get a macron over that vowel). I've tried xmodmap with no positive results to date.
The blue ant is cool. Star Office has professional marketing; Open Office, afaik, does not.
HTML: I had some html export problems with the version that shipped with Redhat (.7.x), but after upgrading Abiword handles html without a hitch. If you're having trouble, take a moment to file a bug report and watch it get fixed.
Fist of all kudos to the Abiword people. I have been using their program for almost two years now. It is far more robust program for basic word processing than MS Word.
The only things I still use Word for are lab reports (gotta have those tables and Excel integration) and Japanese word processing. I have never had good luck with using Japanese (Unicode or EUC- shiftJIS is baaaad) in Abiword. Currently I use Word or JWPce (a great GNU freeware Japanese processor) for my Japanese work. As soon as Abiword integrates good Asian language support I will delete Word and use the extra HD space for pr0..er..um.. research.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
Yep, someone give me a call when it actually RUNS on OS-X. If I want to install an X-server I can run it remotely from my Linux box as it is.
small and compact?
Now this I gotta see.
Maybe, but all the apostrophes are in the right places as far as I can tell, which marks it as being in the top 1% of all /. posts for punctuation/grammar/spelling correctness...
graspee
If you install the AikSaurus plugins, located at the abiword plugins page, it will give you a nice integrated Thesaurus!
Autosave in MSWord can *really* mess things up and make parsing the file difficult. Basically all the new stuff you've added goes at the end of the document, so the import filter has to jump all over the place to correctly parse the file.
Try turning that option off and resaving those docs and give it a whirl then.
Apparently it doesn't matter where in the world you are, every language can be ( wnd will be ? ) abused. If OpenOffice is sixty megabytes, does that make AbiWord 1.2 gigabytes smaller than OpenOffice ? Does that in fact mean that if I upload 1.2GB, AbiWord magically appears on my computer ? Or is the fact rather that AbiWord is one twentieth the size of OpenOffice ? ( bitching and rants end ;-)
See:
http://www.abisource.com/download/plugins
The thesaurus (AikSaurus) is the best I know of, no matter how much you'd pay.
Whoever claimed that AbiWord is 20x smaller than OpenOffice is lacking basic arithmetic skills.
OpenOffice source: 128MB
AbiWord source: 15MB
15MB x 20 = 300MB.
300MB != 128 MB
300MB >> 128 MB
They are also comparing a word processor to a complete office suite, but that is another matter.
Its just a word processor, so sure its smaller then a simi-complete 'suite'(OO)...
Not judging if its bad or good.. just dont mislead
people by compairing apples to oranges..
---- Booth was a patriot ----
I found MS grammar checking so appalling I turned it off. On my cersion of word, "world-wide" is a grammatical error, and it suggests a change to "worldwide" - but "worldwide" is a spelling error it recommend hyphonating.
it doesn't work, won't create a new document, won't open existing documents...
oh, and it's still at 0.99...
and yes, i am running the latest version...
of course, i can't complain if it's free, right? but what use is it if it doesn't even work?
This also reflects my experience when using StarOffice to author documents sent to Word users, and vice versa. The resulting document is readable but often not presentable.
I saw this news and went to download it. This was my first time seeing this word processor, and I have to admit that I'm a bit impressed! :) I work for the government here in my city, and I'm caring to use convert people to use only free-software. A Word Processor is crucial for this to happen, and I saw AbiWord as a great alternative! The only major problem is that it doesn't have tables (yet), so I'm looking forward to it! Now I'm very interested in the project, and I'll spend a short time of my work with translating it into my language (Brazilian Portuguese).
If the "higher" people here get happy with this kind of solution, they'll spend some money on donations, instead of software licenses, and that's my objective!
I downloaded this thing called WordWeb (and NoteTab Light). WordWeb is limited-functionality free. It's not a total replacement for my American Heritage talking Dictionary, but wordweb is more like a really good free thesaurus.
This Abiword 1.0.1 news is not news to me. I think it's been out for more than a week, or at least I think I updated my install on 5-4-02.
I finally trashed 0.99 and went back to 0.96, which functions fine. Very disappointing.
Three years later, I'm still mystified by the attention Abiword gets. It even gets press coverage.
It's not even a word processor by late-1980s standards. No table support! No floating footnotes! The column support doesn't seem to allow changing the number of columns midstream--it's all or nothing.
No merge functionality! (Oh, but there are two optional, unbundled scripting plugins you can theoretically write your own merge function with--except that there's no user-defined field support, either, so any merge fields in a document would be ad-hoc, unprotected, and would show up as spelling errors.)
Great, so it's "lightweight" and starts up quickly, and it's cross-platform. Yipee. But I remember in 1988 it was pretty fair to expect a graphical word processor--even on the Amiga and the C64--to support tables and footnotes, mail merging and real, multiple-layouts-per-page column support.
Don't get me wrong. It's nice of the Abiword team to put their time into writing software they obviously find and useful, and it is nice to see a solid, genuinely useful embeddable GTK+ richtext widget come out of this, but can we please stop mentioning it in the same breath as word processors?
1.0.1 released? Yeah, for Windows. Check out what version you're offered to download for Mac OS X - 0.99.3. Once again, the FSF would rather support Bill Gates' illegal monopoly and criminal actions, than a company that's at least trying to do the right thing. Thanks, Stallman, you hypocritical Nazi.
Compile it yourself, I can hear all the FSF'rs say! Uh, yeah. Yes, AbiWord is Free, but it's only free if your time has no value.
Definitely Clippy was a major marketing failure. So was Microsoft Bob. Apparently Microsoft Bob was Bill Gate's wife's idea.
Clippy expresses something accurate about Microsoft's view of it's customers, however: Microsoft thinks it's customers are stupid children, not even smart children.
Not really an abiword issue, but I just compiled it and got many warnings from the compiler. At work I would not accept code that creates warnings unless the developer can explain to me why he can not make them go away.
Many people will have a problem if they find out that their kids have been downloading and using the AbiSpread software.
Even software that is given away free needs marketing, which is simply accurate communication between the software's authors and managers, and the intended users.
As a science student, I find tables an essential part of any word processor. While I _love_ the speed of Abi and the gtk look/feel, without this feature Abi is worthless to me, so I'm stuck with SO or OO for the time being... :-(
Compile html files to a Windows standard help file!
And why would they do that? Abiword is not a windows exclusive app. And windows help is garbage. HTML is an open standard. Anyone on any computer can view HTML and change the documents for accessibility. i.e. I change background to gray instead of white, and I have custom style sheets. You can't do these things in ms.
There is nothing stopping you from converting it yourself, unlike closed ms help.
People need to stop asking for such and such in ms closed proprietary format. It's annoying!
I think that's a mistake. I've been trying to get abiword to install on (sparc) solaris for months now and it always fails. Has anyone actually done this?
Raphael
If you want a decent thesaurus, I suggest you spend the $15 or whatever it is in your currency and get a dead-tree version (preferably Roget's). For "power" (English) language users, it's the only way to go...
Cool. AbiWord uses xml as file format.
rm
Bear in mind that these specifications are EXTREMELY complicated - you do need special tools for them, writing SVG files by hand is a major drag.
As far as I can tell, AbiWord still only has binaries available for MacOS X that require X11, and my attempts to compile it with Cocoa support (following the README file directions) have been abject failures. I'm interested in AbiWord, but I really want a Cocoa or Carbon binary, guys.
Come on, were forgeting the free word processor that needs only Notepad to edit, TeX/LaTeX! OK, sure it's a little arcane, and sure it takes like 300MB to store, but what else has both memoir and scientific article classes! Go \{LaTeX}
Alas, if you read that manual section on creating "tables", it turns out not to be table functionality at all.
It's just telling users how to make very basic table layouts by using tabs and the overline/underline styles.
Kind of like doing tables on a TRS-80 in 1982.
Bleh!
It's good to see all the open source office suites making leaps and bounds forward these days, but my personal bet is on KOffice. Huh? Yeah, I said KOffice. Considering how fast KOffice is moving with so little help, it's pretty clear that the codebase is clean, efficient and managable. Just recently, KOffice 1.2 beta1 was announced, bringing forth a new fully wysiwyg layout engine. With this in place, there is very little holding the suite back from quickly dominating the scene. IMO this will be further proof of C++ being the superior language for GUI design. Time will tell.
Microsoft does actually follow the RFT standard, because RFT is a Microsoft standard.
Microsoft set the standard, if Microsoft change how it is done then there you go a new standard.
Abiword had problems sharing documents with Open Office as its support for RTF is quite old and they are putting their effort into the binary word document format.
Formatting gets all wacky when importing documents that use a lot of hidden tables for layouts. i.e. my resume imported like crap... but of course it's my resume so that's probably the best ole abi could do given what it had to work with.
Legal Documents however do a little better, but the "style" still has to be reformatted (joe bob -vs- billy bob area). Areas in the document that are formatted by tabs seem to hold (signature blocks).
I've only tried a couple MSWord docs, and they seemed to do fairly well, but haven't tried any with tables.
HOWEVER... importing is much better, and there's a real polished feel to AbiWord now. The program is good enough that we can start nitpicking, so I suggest focusing on simply making it fully compatible with file formats from Word and WordPerfect. Then users will have one less reason to fire up Windows.... unless they have to use LotusNotes.
Wait a second... AbiWord doesn't even seem to do tables! WTF? No wonder the imports don't work successfully. Tables are a necessity, not a luxury for just about anyone that uses a word processor for more than typing letters to Grandma.
Guess it's back to KWord for me.
Once it's time to go final with the document, I'll open in Word to add all of the necessary bells and whistles. This process makes for faster reviews, because the people on the other end aren't spending all their time looking at non-content formatting issues, and when the content is completely locked down, I save a final RTF version for archiving.
The Word doc then gets created and sent out. I'm definitely going to have to check out AbiWord, but I'm with Colin - having a host of files in various proprietary formats really sucks. I just differ in my approach. RTF is quick and easy to work with, allows for pretty good initial formatting, and is a standard that won't go away any time soon.
Read the EFF's Fair Use FAQ
Read it, Learn it, Live it.
I'm afraid someone has a *lot* of emails to be read!
Some amusing quotes (quoted verbatim) from the Abiword mailing liste v/02/M ay/0330.html
... has started developing, in particular, a very high-quality
p ts/jan99/01-28-am.asp
http://abisource.com/mailinglists/abiword-d
If there'd been more advance notice, it might have been fun to do the
standard press release trick of soliciting quotes from *other people* to
introduce those ideas.
For example, here are some TOTALLY MADE UP QUOTES, putting words in the
mouths of prominent people that I KNOW VERY WELL THEY'D NEVER SAY:
"AbiWord is the latest and finest example of the kinds of powerfully
usable software that can be developed, from scratch, by a world-wide
team of volunteers collaborating under the terms of the GNU GPL.
More free software! I love it!"
-- Richard Stallman, Free Software Foundation
"I never leave kernel mode unless I have to. I try to leave all that
pixel-pushing stuff out in userland to others. Thank goodness for
the folks on the AbiWord team. Now I can skim all those useless email
attachments before I delete them!"
-- Linus Torvalds, Linux
"Hey, how come we're the only major desktop operating system that
AbiWord doesn't run natively on? What do I have to do to get someone to
finish the Cocoa port? Can I just sneak them into the next Pixar release
party or will I actually have to pay them?"
-- Steve Jobs, Apple
"AbiSource
word processor for the Linux environment."
-- Paul Maritz, Microsoft Sr VP of platforms and applications
Oops. Actually, the last quote *is* real:
http://www.microsoft.com/presspass/trial/transcri
--
Totally Karma Whoring...
Jesus fuck, dude. You want him to have a positive
linux n00b experience, and you're reccomending fucking Debian?
AbiCalc the AbiSource SpreadSheet ...
/ 14 / biword.html
i word-dev/ 02/Mar/0512.html
... that is never likely to be implemented
http://linux.oreillynet.com/pub/a/linux/2002/03
AbiSource was started with a grand vision to provide a Cross Platform (XP) frame work and Office Suite.
Among the other programs planned were AbiCalc, AbiShow, and AbiDraw.
But the funding never came and the corporate backing left and Abiword is now an entirely volunteer run project.
It was suggested that some one might expand the AbiSource frame work to more applications that just Abiword and start AbiCalc
http://www.abisource.com/mailinglists/ab
The idea did not take off. Providing a smaller faster cross platform alternative to the openoffice.org spreadsheet or Gnumeric did not take anyones interest. In the end the guy who suggested it gave up having been convinced that it was a better idea to wait until a GTK only verison of Gnumeric was ported to Windows.
The abiword developers do plan to add better support for Vector Graphics as part of the next version of Abiword, so AbiDraw may eventually become more than just vaporware.
With the existance of the Mozilla Platform and the Open Office.org suite the need for a cross platfrom Office suite there is much more cross platfrom open source software and Gnome is gradually becoming more and more portable so it seems unlikely that AbiCalc and other cross platform using the Abisource framework will ever come into existance.
95% of the features of any heavyweight software product are unused by the average user. This led various software makers to create "lite" versions of their software. The difficulty is, even though each person uses only 5% of the features, it is not the same 5% as everyone else. Everyone has some feature that they absolutely REQUIRE and that is not included in the lite version. Consequently, "lite" software products rarely succeed.
How many people now use the lite versions of various word processors? How many people use MicroEmacs? etc?
Who cares that AbiWord is smaller than OpenOffice? OpenOffice is 180MB! Have you seen the size of drives lately? OpenOffice takes ~$0.45 worth of disk space. But hooray, abiword is smaller (perhaps I'll save ~$0.40).
Most people don't even use the space they have.
other than saving disk space that is totally free now anyways. It would have been better to consolidate the effort taken with AbiWord and to use it on OpenOffice.
> Sounds really cool. Just as long as Abi the Ant doesn't appear on my desktop and offer to help me type a letter.
Anyone else think having a Bug for a mascot is a bad idea?
:P
The Ant even has a webpage
http://abisource.com/~abi/
StarOffice is not written in Java. Go to OpenOffice.org and look at the code yourself.
Is it's lack of good looking fonts. Try scaling a font in AbiWord to 72 point some time. After about 30 seconds when you finally get your cursor back, what you will see is a severely pixelated version of what you typed. If I could get around the nasty looking fonts, I think AbiWord is quite nice!
Russian Russian Russian RussianDollSig DollSig DollSig DollSig
It is _possible_ but using the Equation Editor is painful.
It is so much faster to get a simple LaTeX template and learn to how to $ include an inline equation $ or do a paragraph of maths
\[
equation goes here
\]
Waaaaay easier.
This program, and other programs like it (such as macgimp), are not "Mac OS X" programs. I wish people would stop this insane propaganda stating that they are.
What they are are "Darwin" programs.
Until a real "Aqua" user interface is built for them, they will never be able to run on a stock off the shelf Mac OS X box, and until they do, they should not be referred to as "Mac OS X" programs.
If you wish to call them Mac OS X apps, make them mac OS X apps. If the makers of these applications can take the time and effort to make seperate user interface modules for windows and beos, then spread the word and get some capable aqua/carbon/cocoa people interested and give the mac the same level of respect as you do the other ports.
if you disagree, and can offer me a truly valid argument as to why, and not just psuedo religious blather, my email address is tsenecal@qwest.net (i know i don't have a slashdot account, and i know i am touching a nerve here and people deserve the ability to give their side of the story)
As you say, the new version does support columns. I must have been using an older version when I last reviewed it.
I have this OLD windows laptop, and I never thought I could get something this good on it. In my EVER-SO-HUMBLE opinion, AbiWord is the best of the open-source wordprocessors.
I like it. Sounds like something I would write an hour after dropping three hits of Sunshine. :)
hasn't filed suit against the creators of WordPerfect and WordStar and WordPro for Copyright Infringement... I mean, they've got "Word" in their names!
Except that all of those came before Microsoft Word. I think they should sue Microsoft instead for stealing features from them.
Pet peeve: Profane people propagating perfunctory pedantry.