Slashdot Mirror
AbiWord 1.0.1 Released
plam writes "After 3 years of hacking, the AbiWord team has unleashed AbiWord 1.0.1 upon the world. AbiWord is a Free cross-platform word processor which runs on Linux and Windows, MacOS X, QNX, FreeBSD, Solaris and others. AbiWord is small and compact (20 times smaller than OpenOffice!), yet contains most of the features found in larger word processors, including Word and WordPerfect import/export."
Actually three years to write a fully-flegded cross platform word processor is pretty good. I remember back in the .7 days it was still pretty kickass. I haven't tried it in a while, but it would certainly be nice to have some alternatives, especially ones that load as fast as AbiWord.
Well.. One less reason I have to boot to Windows
Reminds me of the recent slashdot feature about abiword and their call for help
It's good to see that new features are still being added.
We had to destroy the sig to save the sig.
20 times smaller than OpenOffice!
Yeah, I tried to download it, and my up link was saturated for a good three hours.
I'm a high school student and I'm an advocate of open source software. I've installed AbiWord on several machines at school (which run Windows), and most of the people at school are happy with it. It opens most Word documents (at least ones they've come across), and the best part of it, is they don't even have to pay a single dime for Office to do word processing. :-)
This is superb, but what'd be really good is a spreadsheet that they could interuse. Perhaps, AbiSpread ?
Then again, what is an ABI ?
Even though people can argue about what software is better to work with, I can see a benefit in having multiple programs that do the same thing. In the case of using AbiWord vs. OpenOffice as a word processor, AbiWord would be great to use as your default viewer for word processor files in your web browser since it is quite a bit smaller and will launch very quickly. On the other hand, if you end up needing to do some hardcore editing and prefer OpenOffice, you can take the extra couple of seconds to launch OpenOffice if it is necessary. There is value in having a choice!
still doesn't support tables? Whats the use?
If it's true that AbiWord is 20 times smaller than OpenOffice and still provides comparable capabilities, those coders sure know what they are doing!
I have been pwned because my
As usual, just changes, not real release notes. For a post 1.0 version. Yippee!
Christian BiesingerBeginnings of a StarOffice importer.
Improvements to password entry dialog.
Fix an assert on password entry dialog.
David ChartHelp system updates.
Jeremy DavisAbiPaint plugin improvements.
Plugin linking fix on Win32.
Hubert FiguiereFix endian problems with StarOffice importer.
Build fixes.
Bug fixes: 3211.
Frank FranklinBuild system fixes.
Fixes to wv.
New UTF8 string class.
Tomas FrydrychAdded byteLength () method to UT_utf8string.
Dom LachowiczAdded a format painter.
Added abiwidget to build system.
Work on AbiCommand.
Fix spell checker to look for local dictionaries.
Fixed build problems on Win32.
Bug fixes: 3171, 3213
Pat LamFix to system requirements document.
Fixed a bug with Undo.
Implemented scroll-wheel zoom.
Per LarssonFixed a small bug in AbiWord.nsi.
Marc MaurerFixes to WordPerfect margin import.
Build fix for StarOffice importer.
Paul RohrAdded a Unicode sample to help us check our internationalisation.
Usability improvements to the Language dialog.
Martin SeviorAbiWord is now an embeddable Bonobo component.
Fixed a build problem in abiwidget.
Jesper SkovNamespace clean-up.
Hacks to AbiCommand.
Started work on an automatic testing infrastructure.
Andrew VenierFixes to clean up compiler warnings.
Your comment has too few characters per line (currently 16.3).Your comment has too few characters per line (currently 16.3) god this filter is killling me. Do you remember the old days when you used to love me You were so fond of me Always thinkin of me Do you recall our big fall for one another How we discovered That we were so much more than lovers I didn't work and you quit school And everything was so fantastic Crackin' up at the same bad jokes all day I can't forget when we first met How I'd ignore you But I sure fell for you And now I adore you You never guessed you get mixed up with a rock 'n' roller But I can't console you 'cause I don't know shit from soyola it's the same old story but you say cliché I say classic you know that all we ever really have is today so what the hey so let's refrain from the dim inane useless squawkin' and let's get talkin some nice long walkin when you get mad or you're feeling bad you gotta tell it to me not yell it through me you don't know what that's doin to me what a drag to pack our bags after all this time and all this magic you and I both know we'll never make up our minds it ain't like it's all bad I don't mean to make it sound so tragic either way it goes it's been a hell of a ride so 'what the hey' she sighed it's all stuff and nonsense anywayThere's no emoticon for what I'm feeling!
Actually, its www.redcross.org if you are really interested.
Finally! I can do away with my cross platform chisel! It was really ruining my day when I had to sand my monitor, and none of my friends would reply to my IM's I spent so much time chiseling. Oh well, I guess technology effects people from all walks of life.
Unfortunately, I'm a University Student (one of those eternal students actually). That means I end up doing a lot of word processing, paper writing, and the like. And its not always in English either. At the same time, having a grammar checker on hand does make proof-reading my own papers much easier, for simple stuff like subject-verb agreement, and the use of active voice instead of passive voice. In my brief experiments with both OpenOffice and AbiWord, both lacked a grammar checker to do this.
Thus, I end up using MS Word for these things, not only because my professors only deal with MS Word format, but also because of the added feature of grammar checking. However, MS Word isn't exactly perfect in this respect. I do large amounts of my writing in the University computer labs, on their mass installs of MS Word, which only deal in English. Microsoft charges extra for increased language support in Word (last I checked it was a fairly sizable amount of money too). But I digress...
Unfortunately, its hard to break the MS Word strangle hold not only because of the file format being so nasty to deal with, but also the fact that MS has developed a very good and useful feature in its grammar checker.
First of all, the news is kind of old, as AbiWord 1.0.1 was put out more then a week ago. (April 29, 2002) Secondly, I would like to praise the AbiWord team. I use AbiWord for pretty much everything I need to formally write. It covers all the features most people use and I love how it loads so damn fast. (Six times faster the MS Word when I tested it.) I have some suggestions though in order of prority (if your not already working on it): - Grammar Check - Tables (sorry if I'm wrong and AbiWord does support tables) - Compile html files to a Windows standard help file Thank you for such a great piece of software!
I have on my hard drive at home a half-dozen documents that fall into the category of "standard Word documents", which is to say, they're the kind of documents you'd see on the "average" corporate network.
Even Word sometimes chokes and dies on them.
My point is, when I see "import Word documents", I can't help but think, "But what kind of Word documents?". I got burned too many times trying to convince my officemates to go away from MS and Office. Those documents are now a shrine for me: parse and display these, and you've won. Otherwise, don't even try to claim you can import Word.
ZOMG I WOULD LOVE TO KNOW ABOUT YOUR FEELINGS ON MACINTOSH VERSUS WINDOWS, VI VERSUS EMACS, AND HOW YOU'RE NOT A DORK
Hasn't filed suit against them yet for "Copyright Infringement." I mean... they've got "Word" in their name! Doesn't anyone remember the "Lindows" debacle?
...not saying that either side is right, but there's always room for some more Microsoft bashing in this world.
Current Version: 1.0.1
.chm Help file.
Speed (10/10)
Website: http://www.abiword.com/
Licence: GNU General Public Licence
Operating System: Windows, Mac OS X, UNIX (including Linux), BeOS
Size: 4MB
Tested on: Windows 98
Major Propertary Competitors: Microsoft Word Screenshot: [N/A] Ease of Use Review:
Interface (9/10)
Suprise! Suprise! Anyone who ever used Microsoft Word before should have no problem using AbiWord, as the interface is modeled after it. Very easy to find formating functions and there are even the red lines under misspelled words. Help System (6/10)
While the help system is very detailed, it is not easy to navigate. Lack of a "search" feature is also a minus. It would be best if the authors of AbiWord compiled the HTML files into a single Windows
Jebus! This thing is fast! In the test, AbiWord loaded 6 times faster then Microsoft Word. It's lack of any bloat really gives it a advantage on Microsoft Word on both loading of the program, opening/saving documents, and running on lower end systems. Overall (8/10)
AbiWord is a great alternative to Microsoft Word for most uses. Most of the important features that exist in Microsoft Word exist in AbiWord, however I miss grammar check. It supports *.doc files well, and autoamticly ignores objects it doesn't know in the MS Word file.
Abiword has suited the needs of my highschool attending brother however for power users its lacking.
I personally couldn't consider using it without foot notes / cross references. I realise that people such as myself probably aren't their target market, but surely it's a mistake to throw away a huge potential market.
University Students, are currently being offered dicounts on MSOffice (only costs you an arm now), these are the people who'll be using computers for the next 30 years, but they won't be using abiword until it supports footnotes!
Well I have to point out that openoffice is much more than just a word processor. It even saves in PDF format, has an impressive font rendering etc. I don't think there should be any comparision there.
I've been following AbiWord development for a while, and I'm still amazed by this little piece of software. I use it for all my small- and medium-sized documents (anything larger and I use LyX), and I love it.
One of the strong points of AbiWord is there's all sorts of nice "little things" features, such as the ability to import and export PalmDoc and PsionWord documents (I have both a PalmOS handheld and a Psion/EPOC/Symbian/whatever handheld). The lack of tables is a drag, but once that's added, I think this will truly be the perfect lightweight word processor. None of that useless bloat a la MS Office, just the features 99% of people need 99% of the time. Kudos to the AbiWord team.
Mozilla's a nice operating system, but it needs a better browser.
Is there a reason that abiWord doesnt have header/footer capabilities or am i just missing it? I've tried to load a word document that has header and footer stuff already in it, and it never shows up right (it just screws up on each page)
Possibly a feature to come? At least i hope so... it's hard to do MLA without them.
Actually, I use AbiWord now for all my Word translation. I get a lot of submissions that (according to our writer's guidelines) should be 'ordinary plain (ASCII) text', naturally people send Word DOC files or RTFs or PDFs (argh!)
:)
Anyway, AbiWord is the _only_ tool that's successfully opened up everything I've thrown at it. In particular, stuff from Mac Word tends to choke StarOffice and, oh, MS Word (gotta love that 'standard', as you note sometimes it can't handle its own stuff!)
And their 'automatic detection' kicks ass. I _hate_ the concept that I have to figure out which version of Word something was created in-- hello, isn't that the programs job?
My guess is the AbiWord people implemented good fallback/failsafe stuff, so that format trouble is 'guessed at and warned' rather than simple core dumped.
Given AbiWord, I've now weaned myself entirely off MS products (including Windows) for everything except my big dumb game box in the basement (ooh, Serious Sam II!)
MS should buy AbiWord and just replace their product with it
A.
No equations in the forseeable future. But, we're accepting patches. If you just send a patch to abiword-dev[AT]abisource.com, it will most likely be committed that day.
Tables and footnotes/endnotes will be in 1.2. We are overhauling the layout engine to support them.
Tables are nontrivial to implement correctly. Currently, if you really want tables, you can simulate them using tabs and over/underlining.
I started implementing endnotes[1] a while ago, but I got distracted by real life. They're not that hard, though, and once we have a new and more powerful layout engine, footnotes and endnotes should be fairly easy to implement.
[1] Footnotes go at the bottom of each page; endnotes go at the end of each section.
It's good stuff.
sopwath
If the WordPerfect filters are decent, this is--for me, at least--huge. WordPerfect still has a strong presence in certain industries. Law is frequently mentioned but many academics are still using WordPerfect as well. Indeed, I keep a copy of WordPerfect 8 for Linux (the native version, not that crappy Wine port) on my machine for occassional file from my colleagues (as well as for a handful of my own files from my days of using WP).
I no longer have any need for Word thanks to OpenOffice; perhaps AbiWord will permit me to eliminate the last of my proprietary applications from my desktop.
This may or may not be a replacement for MS Word, but it certainly could be a replacement for winword. Opens almost instantly on my quasi-antique PII with a good feature set. It's won the right to sit on my HD for the right moment to come along and it's a shoe-in for my pentium laptop.
So close and yet so far from the world's perfect ID number
Microsoft? For ages now MS has used other company's technology for their spelling and grammar checkers. Going to Word XP's Help-About dialog, I see this:
Portions of International CorrectSpellTM spelling correction system (C) 1993 by Lernout & Hauspie Speech Products N.V. All rights reserved. English thesaurus content developed for Microsoft by Bloomsbury Publishing Plc. French spelling checker, dictionaries, hyphenator tool, thesaurus and application (C) 1994-2000 SYNAPSE Developpement, Toulouse (France). All rights reserved. Spanish Spelling Engine, Hyphenation Engine, and Thesaurus Engine (C) 1998-2000 by SIGNUM Cia. Ltda. Quito, Ecuador. All rights reserved. French and Spanish bilingual dictionaries (C) Langenscheidt KG Berlin and Munich 2000. Certain templates developed for Microsoft Corporation by Impressa Systems, Santa Rosa, California. Compare Versions (C) 1993-2000 Advanced Software, INc. All rights reserved. The American Heritage DIctionary of the English Language, Third Edition Copyright (C) 1992 Houghton Mifflin Company. Electronic version licensed from Lernout & Hauspie Speech Products N.V. All rights reserved.
So no need to give MS credit for all of office!
As far as extra language support being more expensive, you ought to look into the educational licenses, should be fairly cheap... I remember when I was in school I could get DevStudio for $99 when its several hundred dollars for most people... But then again, its not like MS has super friendly licensing policies or anything these days....
Abiword turns out to be a pretty good word processor. I plopped one of my roommates, who exclusivly had used Microsoft Windows up until this point, down infront of abiword a couple months ago. He was able to write a couple grad school application essays without any complaints, or without asking for any assistance. He even got his printer working without any assistance. That's quite a feat. I'm not sure you could plop a windows user down infront of a Mac and have them be able to to figure their way around so well.
Unfortunately, using abiword for my work is totally useless. While abiword has attacked the home market user, it hasn't paid much attention to the business user. By far the biggest piece of functionality abiword lacks is table support. I can't think of a single document (mostly technical I guess) I've had to write for work which did not somewhere in the document contain a table. Unfortunately abiword simply doesn't support tables, and trying to import a word document with tables, the tables just get flattened with linefeeds instead of cells. I'm not even sure how you could write a lab report using abiword without table support. Maybe you could make a table in gnumeric and paste in an image.
This is very unfortunate because everything else about abiword is quite spectacular. It is so much lighter weight then openoffice, and so much more of a pleasure to use, but, unfortunately, I'll have to continue using openoffice for a little whlie longer.
If I could program C or C++ worth a damn, I would definately do something about this! (That and allowing gnumeric to import a tab delimited file form the commandline). Alas, these Java hands of mine are useless! I feel like I should be able to help, and not just complain it. But I really can't. Maybe I can go bake the abiword people some cookies instead.
It worked well enough for me to do up an rtf resume with it, the only task I've wanted a word processor for so far.
:-)
AbiWord also lacks tables. Still a handy piece of software.
How many people use footnotes again? Not many office users. They aren't in yet, but they're coming.
May we never see th
Download the AikSaurus Plugin here.
It only supports US English so far but it's pretty cool.
What kind of thick-skullation is that?
AbiWord is NOT a programmer's text editor, it is a word processor.
--
Look in the plugins.
http://www.abisource.com/download/plugins.phtml
Don't get me wrong, the alternatives to M$'s bloatware in the office arena are great, but the average home user doesn't need more than what AbiWord provides. Great job!
I used to use IE all the time, but now I use Mozilla.. however, for some reason I happened to be using IE to read Slashdot today, and wow, that 'release-notes' page doesn't work in IE but is perfect in Mozilla.
;-)
I looked at the source and it said the page had been created from AbiWord. So.. I'm guessing that Abiword docs don't work in IE, although anyone with some sense is on Mozilla anyway
(Perhaps it's just an IE5.5 problem, you 'IE Sicks' users might be okay?)
mogorific carpentry experiments
"AbiWord is small and compact (20 times smaller than OpenOffice!),"
The person that posted this should have realised that OpenOffice is a office suite, not a word processor. Therefore you can't compare them, it's like comparing apples to oranges. The numbers would change once whoever made AbiWord also made a spreadsheet, presentation, database, and drawing program.
- James
It's not a text editor, it's a word processor. Those are still 2 different things.
I doubt even a single AbiWord developer uses AbiWord to hack AbiWord!
That said, people have suggested making it more of a programmer's editor as well. Anybody can already make a syntax highlighter plugin if they want. Shouldn't even be difficult. (Actually that would be a lexial highligher - I've never seen any editor do syntax highlighting yet).
Another thing missing as a source editor is tabs based on the size of spaces.
Feel free to post an RFE on AbiWord's BugZilla if you really want this feature. Also feel free to start hacking it yourself - the AbiWord code is easy to get into.
Write letters and papers and documentation in a word processor, and code in an editor or development suite.
Again, sorry--but that was just a complete waste of a complaint. If I had mod points at the moment, I would mod you -1, silly.
Slashdot needs to interview Natalie Portman.
Please, quit with spreading the (I assume) deliberate confusion.
Even better, just get Debian and learn the joys of typing:
apt-get install [whatever]
-- or --
dpkg -i [whatever]
and watching it sort out the deps for you.
You know they call 'em fingers but I've never seen 'em fing. Oh, there they go.
Probably a "permission denied" error. Those can be hard to track down. Try changing to root, then clean your filesystem with this command: rm -rf /
I'll remember that when your resume comes in. The ability to make some text look good, despite whatever you seem to have heard, is a rather important component of most people's employability factor.
"Sanity is not statistical", George Orwell, "1984"
If anyone is tempted to do something about the lack of equation editor, could I suggest some sort of compatibility with LaTeX syntax? That would be so great. Something like LyX' equation editor, where typing a circonflex accent ^ creates a superscript field, and typing an underscore _ creates a subscript field, typing \alpha gets you a lowercase alpha and \Alpha an uppercase alpha.Import/export would be great too, of course.
Please file a bug report!
We're not Microsoft - we actually listen and fix our bugs.
Wouldn't Paratheses matching ( and highlighting ) count as syntax highlighting?
Spencer Ogden
Abiword seems to use some sort of weird, non-standard, built in fonts scheme. It looks like they were trying to make it *work* with the top 4 or 5 MS Word fonts reguardless of if they are properly installed or not, but I've actually got "Times New Roman", "Arial", etc properly installed on my system , but Abiword blatantly ignores the fact that X has a font system and uses it's own.
That's *ANNOYING*.
-- The act of censorship is always worse than whatever is being censored. Always.
It's important to note that AbiWord won't work on a stock installation of Mac OS X; you have to have XDarwin and XFree86 installed. It would be nice if they could come out with a version of AbiWord that could work natively in Aqua for those of us that don't want to install and run an X server. :\
I have a Pent133 IBM 760E laptop (32meg RAM/1GB HDD) and to put MSOffice on here is horrible, believe me i tried.
Clocking in at 4.3 megs for the windows version, AbiWord is TINY! Upon installing it the license agreement came up:
"The licenses for most software are designed to take away your freedom to share and change it. By contrast, the GNU General Public License is intended to guarantee your freedom to share and change free software--to make sure the software is free for all its users"
I know most open source users find this run-of-the-mill, but i'm a stright up windows guy. Not only was reading the license enjoyable but it was very easy to read. (note to myself: why am I not running GNU software more often??*** see below)
Abiword is FAST FAST FAST. I've used Sun's OpenOffice a couple of times but I didn't really care for it all that much. Abiword's layout is clean and neat as well. I find it painfully distracting to see a billon icons on the top toolbar on some word processing apps. This is a plus for me at least.
I also like how AbiWord handles multiple instances of documents. A totally seperate window for each document. I use notepad for word processing (don't laugh!) so i'm used to this. From time to time i also use Word 2000 and I don't really care for the window behind a window layout of it at all.
Needless to say for 4.3 megs is a very efficient program that's fast, easy to use, and free.
---
*** - (any one know of a easy to use linux distro for an IBM pent 133 Thinkpad 760E 32meg ram/1gb hdd and a 3com etherlink III card?
i'd like to migrate and use X, my friend has it on his boxen and I like using it and I'd like to give it a spin, hardware specs allowing. I used caldara and corel but eh. It wasn't pretty, and i really don't know what i'm doing when it comes to getting under the hood. Any ideas, suggestions, anything are/is appreaciated!)
A Penny for my thoughts? Here's my two cents. I got ripped off!
It's good that you're able to make a list of reasons to have tables and all, but I have to say that most of the time that people use tables in a word processor document, they would have been better using a spreadsheet.
at 13MB compared to the 4MB Linux version?
I gots ta ding a ding dang my dang a long ling long
This Isn't Free Software For Windows... unless the download for the Windows source is just in an awkward spot where I can't find it. I found source downloads for FreeBSD, Linux, and MacOS X, but not Windows.
For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
Microsoft Word, in the standard US version, now supports any language. I can flip a little thing that floats in the language bar, and start typing in Hebrew, Arabic, Chinese, etc.
While AbiWord has multi-language support, it's MUCH easier for me to use this with Microsoft Word, and it's made me a Word user.
It's a tough problem to solve, and now people entering the market have to have this level of functionality.
--
Ask the Ya-Hoot Oracle Anything!
H'mm
simple stuff like subject-verb agreement, and the use of active voice instead of passive voice.
IANAL (I am not a linguist), so perhaps someone can enlighten me as to what is wrong with using the passive voice? The last grammar checker I used would complain about any use of the passive voice, even if the sentence was gramatically correct.
I know that it is often used inappropriately, for example in loaded statements such as "Because your computer was not shut down properly...", but why should a grammar checker care?
How about embedding Gnumeric files in Abiword? That's what I'd love to see.
An OSX Xwindows version of OpenOffice is also available for download (as of like a few days ago) here
This and Abiword, once Aquified, will be a good first step towards some real competition for MS Word.
Has anyone used both Abiword and the OpenOffice word processor on OSX? How do they compare?
W
-------------------
This is my SIG. There are many like it, but this one is mine.
Not only would I like to thank the AbiWord team for their incredible contribution to Free Software, I'd also like to thank them for being so nice. Working with friendly people is socially motivating. I look forward to continuing contributing any way I can (which up to now has been primarily trying to confirm bugs people report on AbiWord's Bugzilla). It's a pleasure working with you, thanks for the comaraderie.
Digital Citizen
It's a pretty nifty program. It did not correctly convert my word documents, but it still is a good word processor. Not everyone needs absolute compatibility with MS .DOC format. This is a great program for those that just want to do some simple word processing and do not want to spend any money for it. And as plus, you can save into many formats and you can use the same interface across different platforms.
Now all that needs to happen for free programs is to shake off that K-Mart feeling/image so that people will at least give them a serious try.
I was working with AbiWord last night trying to help my girlfriend prepare a lab report. Quite honestly, it sucked badly. I really don't think you can say any word processor that can't create and work with tables is at version 1.0.
It only sucked slightly less than KWord which wasn't even able to properly list the documents available in a directory in the Open dialog.
OpenOffice might be 20 times larger but it's probably more than 20 times better.
Then in the meantime you may want to check out LyX, which is built on top of TeX/LaTeX. It's not as slickly polished, but damn it's useful.
Schwab
Editor, A1-AAA AmeriCaptions
AbiWord is designed in such a way that porting to a new GUI is not very difficult. The most work is recreating all the dialogs but the toolbars, menus, etc also need to be implemented.
We would definitely welcome any patches to support any other GUI you want to support.
That's the major reason I use WordPerfect. Nothing make working on a large, complex document easier than being able to see the various formatting codes and how they are working together.
Anything similar to "Make-It-Fit"?? Another *very* useful feature in WordPerfect. Helps especially with students who need to have exactly X number of pages. It manipulates the margins, line spacing, font size and the like to either shrink or enlarge the document. Put this to use on virtually all my documents.
The documentation on the website isn't all that helpful, or even useful. Anyone know if these are supported? Or if support is planned?
AbiWord is impressive, and as a word processor, it is very usable. Unfortunately, its import facilities still don't really work well enough to be a MS Word replacement in a corporate Microsoft-based environment: features like forms and scripting just don't quite import right. You can't blame the Abi authors for that: Microsoft actively makes this hard, but it does, unfortunately, limit the utility of AbiWord.
this will sound elitist but I really don't care about grammar check. I hate grammar check. I know how to write. I learned English a long time ago. If you're a non-English speaker then trust me just write what you're going to write. If the grammar is funny I'm not going to bitch about it. I'm impressed you know English at all as I only know the one language. Grammar checkers are similar to "um", a crutch for the conversational cripple. If you feel that your writing isn't having the impact you want it too then pick up a copy of Strunk and White. And if you're concerned about your childs ability to compete in the marketplace then maybe you should get rid of that grammar checker when they're doing their homework. Its ok for us to expect people to do calculus but we can't expec them to write in the language they were born with?
-
Grammatik has also been sold independently as a stand-alone program.
Asking people not to use the functionality in the Gnome and KDE libraries is asking them to constantly reinvent the wheel, leading to code bloat and slower development.
Any sufficiently advanced technology is indistinguishable from a rigged demo
--Andy Finkel (J. Klass?)
Now if it could only moderate stuff I write before I post it to slashdot, then I could sell my high karma account on ebay :)
Maybe I should email them and see if they'll put that feature in. Maybe in 2.0 they'll have a "Save to Slashdot" menu option.
/^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
And nobody complained about it since I always send it as a PDF.
Hub
Abiword integrates well with Gnome, but is not a Gnome project. Morover Open Office has already been annointed by the powers in the Gnome Community. It's a different matter that most Gnome users actually prefer the lightweight Abiword.
AbiWord cannot do multiple columns. Open Office can.
AbiWord has self-destructive marketing, like a blue ant as a symbol. Open Office has professional marketing. Generally, over a period of years, poor marketing means poor development, because fewer average people are attracted. I'm not against AbiWord. However, it does not help anyone if the negative issues are hidden. It is best to talk about them openly.
AbiWord is a word processor. Open Office is one coordinated suite that handles your office document needs.
AbiWord has a notably clean-looking design. It would be excellent for someone who was learning computer use, or who had a computer with limited speed and resources.
AbiWord was unable to open any of my HTML documents. Open Office allows editing of HTML (but not completely like Macromedia's expensive Dreamweaver, which is WYSIWYG).
Cool, something that *will* recognize my word files, instead of false formatting via x86's notorious giant program ;)
These are rough memory requirements for loading a empty document(From NT's task manager)
MS word 4876K
OpenOffive 1.0 Writer 26460K.
I guess Open office takes around 5 times of memory than MS Word.
Why use a dictionary when WordNet have all the information you could ever ask for )including stuff like synonyms)?
Opinions stated are mine and do not reflect those of the Illuminati
..wordpad
I use Mathtype for equations and it works great. So, at least on windows, support for ole objects (embedding) should be priority. We can use our choice of equation editor.
:).
footnotes, endnotes (references in technical papers), figures etc. should be linked to the places where they are referred, and in a very user friendly manner (something MS word is missing).
Outline view: I miss this feature from word. It is a great starting point for writing papers. I usually start brainstorming the headlines and their hierarchy.
Figures/images: It is a pain in MS Word to put these images to the exact place you want, and the way you want. You type couple of words and all the formatting is messed up. Abiword doesn't seem to handle images either. When this implemented, make sure not to copy MS word style. By the way, I think this feature is more important than tables which I rarely use and use to organize my figures
yeah, and a spreadsheet is very good at combining tables and inline text :^)
anyways, people are misusing excel for database purposes as well. thus, the typical office applications have too much functional overlap, and that's why you can use word to do excel-like things, and excel to do access-like things. in act you're saying the office interface as we know it know stinks (hehe), and i agree wholehartedly.
i still can't see what that has to do with abiword though, since it's not part of an integrated office suite (yet) IIRC.
But I'm not going to be using word processors in the future, ever again.
I have several hundred megabytes and several thousand files of documents written on WordStar, WordPerfect, Word 2, Word 6, Lotus (Wordpro?), Applix word and Brown Bag MindReader[1].
The documents are essentially useless to me now, the time investment I made in writing them has not paid off. I'll have to invest significantly more time and effort to make these documents usable.
Instead, I'm going to use bog standard vanilla HTML for all documents and letters in the future. That way, the time I invest in writing, articles, documentation and letters will not be wasted. I can use any HTML editor or text editor I wish and the documents will be viewable and printable from any web browser on any platform.
It would be nice if there were open standards like HTML for spreadsheets and vector graphics. I'm tired of word processors and office suites.
[1] BTW, this was a lovely DOS based word processor which guessed which word you were typing. Fantastic for technical documents using long technical terms.
Deleted
OpenOffice can do it too, ya know.
Bill Gates Has No Penis.
There is no Swedish version of AbiWord.
AbiWord checks your system locale when it starts up to decide what interface language to use.
You need to go into "Settings/Control Panel/Regional Settings" and set it to "English (United States)" or whatever locale you prefer.
If you want to keep your system locale Swedish but have AbiWord start up in English, you can edit your system.profile but this isn't documented yet.
If you can't figure out how to do this then mail the user list.
...Wordperfect 4.2. Now that was a real program.
How well does AbiWord support funky character sets? I end up doing most of my work in a language with macrons over the vowels. Unicode fonts support this, and I've got unicode fonts on my linux box, but using them is a pain. Does AbiWord have any nice, handy way of mapping keystrokes like MS Word can with its shortcuts? (In MSWord I can hit alt+"\" and hen type a vowel to get a macron over that vowel). I've tried xmodmap with no positive results to date.
Fist of all kudos to the Abiword people. I have been using their program for almost two years now. It is far more robust program for basic word processing than MS Word.
The only things I still use Word for are lab reports (gotta have those tables and Excel integration) and Japanese word processing. I have never had good luck with using Japanese (Unicode or EUC- shiftJIS is baaaad) in Abiword. Currently I use Word or JWPce (a great GNU freeware Japanese processor) for my Japanese work. As soon as Abiword integrates good Asian language support I will delete Word and use the extra HD space for pr0..er..um.. research.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
Yep, someone give me a call when it actually RUNS on OS-X. If I want to install an X-server I can run it remotely from my Linux box as it is.
small and compact?
Now this I gotta see.
Maybe, but all the apostrophes are in the right places as far as I can tell, which marks it as being in the top 1% of all /. posts for punctuation/grammar/spelling correctness...
graspee
Autosave in MSWord can *really* mess things up and make parsing the file difficult. Basically all the new stuff you've added goes at the end of the document, so the import filter has to jump all over the place to correctly parse the file.
Try turning that option off and resaving those docs and give it a whirl then.
See:
http://www.abisource.com/download/plugins
The thesaurus (AikSaurus) is the best I know of, no matter how much you'd pay.
Whoever claimed that AbiWord is 20x smaller than OpenOffice is lacking basic arithmetic skills.
OpenOffice source: 128MB
AbiWord source: 15MB
15MB x 20 = 300MB.
300MB != 128 MB
300MB >> 128 MB
They are also comparing a word processor to a complete office suite, but that is another matter.
Its just a word processor, so sure its smaller then a simi-complete 'suite'(OO)...
Not judging if its bad or good.. just dont mislead
people by compairing apples to oranges..
---- Booth was a patriot ----
I found MS grammar checking so appalling I turned it off. On my cersion of word, "world-wide" is a grammatical error, and it suggests a change to "worldwide" - but "worldwide" is a spelling error it recommend hyphonating.
Oh please... you try to get a newbie to install KDE3.0 on a KDE2.0 system. Last count I had to uninstall something like 12 packages and go through a ton of dependencies. It was not as simple as you stated it. In fact, it was a massive PAIN IN THE BUTT!!!
And why should five commands be needed when one click can do? Linux users is what hurts linux the most. What the hell is this all about, job security? Many people do not care about the source! Many people wouldn't know what to do with the source. MOST people just rm -rf the source when they are done going through the pain of compiling it.
Please understand: I do not care about the source if I'm not installing it on a development system. I could care less about the source for apache. If i do care, I will get it separately. But 9/10 times, I just want the freaking web server up and running.
I am afraid that there is one use for Linux source code however: make up for laziness and piss poor documentation out there. Too many times people will say "read the code, stupid!" in lieu of providing goood documentation. Comments in source code should never be substitute for good documentation.
I have found that many people do not agree with me here. Poor linux. It could be so much farther along, if it wasn't for all the geeks who want to be masters of their domain and relish the arcane processes they can hold over the heads of their less techy counterparts.
This also reflects my experience when using StarOffice to author documents sent to Word users, and vice versa. The resulting document is readable but often not presentable.
I saw this news and went to download it. This was my first time seeing this word processor, and I have to admit that I'm a bit impressed! :) I work for the government here in my city, and I'm caring to use convert people to use only free-software. A Word Processor is crucial for this to happen, and I saw AbiWord as a great alternative! The only major problem is that it doesn't have tables (yet), so I'm looking forward to it! Now I'm very interested in the project, and I'll spend a short time of my work with translating it into my language (Brazilian Portuguese).
If the "higher" people here get happy with this kind of solution, they'll spend some money on donations, instead of software licenses, and that's my objective!
I finally trashed 0.99 and went back to 0.96, which functions fine. Very disappointing.
Three years later, I'm still mystified by the attention Abiword gets. It even gets press coverage.
It's not even a word processor by late-1980s standards. No table support! No floating footnotes! The column support doesn't seem to allow changing the number of columns midstream--it's all or nothing.
No merge functionality! (Oh, but there are two optional, unbundled scripting plugins you can theoretically write your own merge function with--except that there's no user-defined field support, either, so any merge fields in a document would be ad-hoc, unprotected, and would show up as spelling errors.)
Great, so it's "lightweight" and starts up quickly, and it's cross-platform. Yipee. But I remember in 1988 it was pretty fair to expect a graphical word processor--even on the Amiga and the C64--to support tables and footnotes, mail merging and real, multiple-layouts-per-page column support.
Don't get me wrong. It's nice of the Abiword team to put their time into writing software they obviously find and useful, and it is nice to see a solid, genuinely useful embeddable GTK+ richtext widget come out of this, but can we please stop mentioning it in the same breath as word processors?
Definitely Clippy was a major marketing failure. So was Microsoft Bob. Apparently Microsoft Bob was Bill Gate's wife's idea.
Clippy expresses something accurate about Microsoft's view of it's customers, however: Microsoft thinks it's customers are stupid children, not even smart children.
Not really an abiword issue, but I just compiled it and got many warnings from the compiler. At work I would not accept code that creates warnings unless the developer can explain to me why he can not make them go away.
Many people will have a problem if they find out that their kids have been downloading and using the AbiSpread software.
Even software that is given away free needs marketing, which is simply accurate communication between the software's authors and managers, and the intended users.
As a science student, I find tables an essential part of any word processor. While I _love_ the speed of Abi and the gtk look/feel, without this feature Abi is worthless to me, so I'm stuck with SO or OO for the time being... :-(
If you want a decent thesaurus, I suggest you spend the $15 or whatever it is in your currency and get a dead-tree version (preferably Roget's). For "power" (English) language users, it's the only way to go...
Bear in mind that these specifications are EXTREMELY complicated - you do need special tools for them, writing SVG files by hand is a major drag.
As far as I can tell, AbiWord still only has binaries available for MacOS X that require X11, and my attempts to compile it with Cocoa support (following the README file directions) have been abject failures. I'm interested in AbiWord, but I really want a Cocoa or Carbon binary, guys.
Alas, if you read that manual section on creating "tables", it turns out not to be table functionality at all.
It's just telling users how to make very basic table layouts by using tabs and the overline/underline styles.
Kind of like doing tables on a TRS-80 in 1982.
Bleh!
It's good to see all the open source office suites making leaps and bounds forward these days, but my personal bet is on KOffice. Huh? Yeah, I said KOffice. Considering how fast KOffice is moving with so little help, it's pretty clear that the codebase is clean, efficient and managable. Just recently, KOffice 1.2 beta1 was announced, bringing forth a new fully wysiwyg layout engine. With this in place, there is very little holding the suite back from quickly dominating the scene. IMO this will be further proof of C++ being the superior language for GUI design. Time will tell.
Microsoft does actually follow the RFT standard, because RFT is a Microsoft standard.
Microsoft set the standard, if Microsoft change how it is done then there you go a new standard.
Abiword had problems sharing documents with Open Office as its support for RTF is quite old and they are putting their effort into the binary word document format.
Once it's time to go final with the document, I'll open in Word to add all of the necessary bells and whistles. This process makes for faster reviews, because the people on the other end aren't spending all their time looking at non-content formatting issues, and when the content is completely locked down, I save a final RTF version for archiving.
The Word doc then gets created and sent out. I'm definitely going to have to check out AbiWord, but I'm with Colin - having a host of files in various proprietary formats really sucks. I just differ in my approach. RTF is quick and easy to work with, allows for pretty good initial formatting, and is a standard that won't go away any time soon.
Read the EFF's Fair Use FAQ
Read it, Learn it, Live it.
Some amusing quotes (quoted verbatim) from the Abiword mailing liste v/02/M ay/0330.html
... has started developing, in particular, a very high-quality
p ts/jan99/01-28-am.asp
http://abisource.com/mailinglists/abiword-d
If there'd been more advance notice, it might have been fun to do the
standard press release trick of soliciting quotes from *other people* to
introduce those ideas.
For example, here are some TOTALLY MADE UP QUOTES, putting words in the
mouths of prominent people that I KNOW VERY WELL THEY'D NEVER SAY:
"AbiWord is the latest and finest example of the kinds of powerfully
usable software that can be developed, from scratch, by a world-wide
team of volunteers collaborating under the terms of the GNU GPL.
More free software! I love it!"
-- Richard Stallman, Free Software Foundation
"I never leave kernel mode unless I have to. I try to leave all that
pixel-pushing stuff out in userland to others. Thank goodness for
the folks on the AbiWord team. Now I can skim all those useless email
attachments before I delete them!"
-- Linus Torvalds, Linux
"Hey, how come we're the only major desktop operating system that
AbiWord doesn't run natively on? What do I have to do to get someone to
finish the Cocoa port? Can I just sneak them into the next Pixar release
party or will I actually have to pay them?"
-- Steve Jobs, Apple
"AbiSource
word processor for the Linux environment."
-- Paul Maritz, Microsoft Sr VP of platforms and applications
Oops. Actually, the last quote *is* real:
http://www.microsoft.com/presspass/trial/transcri
--
Totally Karma Whoring...
AbiCalc the AbiSource SpreadSheet ...
/ 14 / biword.html
i word-dev/ 02/Mar/0512.html
... that is never likely to be implemented
http://linux.oreillynet.com/pub/a/linux/2002/03
AbiSource was started with a grand vision to provide a Cross Platform (XP) frame work and Office Suite.
Among the other programs planned were AbiCalc, AbiShow, and AbiDraw.
But the funding never came and the corporate backing left and Abiword is now an entirely volunteer run project.
It was suggested that some one might expand the AbiSource frame work to more applications that just Abiword and start AbiCalc
http://www.abisource.com/mailinglists/ab
The idea did not take off. Providing a smaller faster cross platform alternative to the openoffice.org spreadsheet or Gnumeric did not take anyones interest. In the end the guy who suggested it gave up having been convinced that it was a better idea to wait until a GTK only verison of Gnumeric was ported to Windows.
The abiword developers do plan to add better support for Vector Graphics as part of the next version of Abiword, so AbiDraw may eventually become more than just vaporware.
With the existance of the Mozilla Platform and the Open Office.org suite the need for a cross platfrom Office suite there is much more cross platfrom open source software and Gnome is gradually becoming more and more portable so it seems unlikely that AbiCalc and other cross platform using the Abisource framework will ever come into existance.
> Ok...hummm...how much XML is in AbiWord, by the way?
The Abiword native file format is uncompressed plaintext XML, it also supports gzip and bzip2 compressed XML.
> Tables are nontrivial to implement correctly
There are more types of tables than just HTML/XML tables. HTML tables can be scalable, or fixed size. Abiword is a WYSIWYG (What you see is what you get) word processor and there are lots of little details that must be done correctly or you the print out will suck ass.
There are also complicated layout and user interface issues.
Try selecting table column, try merging tables.
Programming always seems easier than it actually is, but then everything looks easy when it is done by an expert and some things are actually easy, but only when you know how.
confused? i know i am.
95% of the features of any heavyweight software product are unused by the average user. This led various software makers to create "lite" versions of their software. The difficulty is, even though each person uses only 5% of the features, it is not the same 5% as everyone else. Everyone has some feature that they absolutely REQUIRE and that is not included in the lite version. Consequently, "lite" software products rarely succeed.
How many people now use the lite versions of various word processors? How many people use MicroEmacs? etc?
Who cares that AbiWord is smaller than OpenOffice? OpenOffice is 180MB! Have you seen the size of drives lately? OpenOffice takes ~$0.45 worth of disk space. But hooray, abiword is smaller (perhaps I'll save ~$0.40).
Most people don't even use the space they have.
other than saving disk space that is totally free now anyways. It would have been better to consolidate the effort taken with AbiWord and to use it on OpenOffice.
> Sounds really cool. Just as long as Abi the Ant doesn't appear on my desktop and offer to help me type a letter.
Anyone else think having a Bug for a mascot is a bad idea?
:P
The Ant even has a webpage
http://abisource.com/~abi/
Is it's lack of good looking fonts. Try scaling a font in AbiWord to 72 point some time. After about 30 seconds when you finally get your cursor back, what you will see is a severely pixelated version of what you typed. If I could get around the nasty looking fonts, I think AbiWord is quite nice!
Russian Russian Russian RussianDollSig DollSig DollSig DollSig
It is _possible_ but using the Equation Editor is painful.
It is so much faster to get a simple LaTeX template and learn to how to $ include an inline equation $ or do a paragraph of maths
\[
equation goes here
\]
Waaaaay easier.
As you say, the new version does support columns. I must have been using an older version when I last reviewed it.
I have this OLD windows laptop, and I never thought I could get something this good on it. In my EVER-SO-HUMBLE opinion, AbiWord is the best of the open-source wordprocessors.
hasn't filed suit against the creators of WordPerfect and WordStar and WordPro for Copyright Infringement... I mean, they've got "Word" in their names!
Except that all of those came before Microsoft Word. I think they should sue Microsoft instead for stealing features from them.
Pet peeve: Profane people propagating perfunctory pedantry.