Slashdot Mirror


AbiWord 1.0.1 Released

plam writes "After 3 years of hacking, the AbiWord team has unleashed AbiWord 1.0.1 upon the world. AbiWord is a Free cross-platform word processor which runs on Linux and Windows, MacOS X, QNX, FreeBSD, Solaris and others. AbiWord is small and compact (20 times smaller than OpenOffice!), yet contains most of the features found in larger word processors, including Word and WordPerfect import/export."

295 of 458 comments (clear)

  1. About time by pope+nihil · · Score: 3, Interesting

    Actually three years to write a fully-flegded cross platform word processor is pretty good. I remember back in the .7 days it was still pretty kickass. I haven't tried it in a while, but it would certainly be nice to have some alternatives, especially ones that load as fast as AbiWord.

    1. Re:About time by LordSah · · Score: 1

      Damn right. Consider that releases of Office come every two or years--and that's improving code that already exists.

      Congrats to the AbiWord team.

    2. Re:About time by Waffle+Iron · · Score: 4, Funny
      Consider that releases of Office come every two or years--and that's improving code that already exists.

      The actual coding only takes a couple of weeks. The rest of the time is consumed by product planners trying to think of any new features compelling enough to justify the price of an upgrade.

    3. Re:About time by LordSah · · Score: 1

      It's a little more than a couple of weeks, but you're right. It's certainly not two or three years of straight coding. Quite a bit of time is used by product managers thinking stuff up and testing.

  2. Abiword by harks · · Score: 1, Interesting

    Well.. One less reason I have to boot to Windows

    1. Re:AbiWord by wadetemp · · Score: 2

      From time to time i also use Word 2000 and I don't really care for the window behind a window layout of it at all.

      Uh, whachoo talkin' 'bout, Willis? My copy of Word 2000 has a separate window for each document. Granted, each Window uses 14MB of RAM, but each document DOES have it's own window.

    2. Re:AbiWord by NetGyver · · Score: 1

      After checking, your right. I thought it was Word2000 that did this. I remember seeing that layout before though.

      Thanks for pointing that out, my bad.

      --
      A Penny for my thoughts? Here's my two cents. I got ripped off!
    3. Re:AbiWord by double_h · · Score: 1, Offtopic

      [i]any one know of a easy to use linux distro for an IBM pent 133 Thinkpad 760E 32meg ram/1gb hdd and a 3com etherlink III card?[/i]

      The latest Red Hat would not be a good choice because it has a suggested install size of 1.2 GB, with a 650MB minimum.

      Other than that, a P133/32MB is plenty of machine to run Linux. I'm partial to Debian because it's got a very flexible, powerful packaging system whereby you have a lot of control over what you do and don't install.

      Actually my advice is to do a google groups (deja google) search to see what kinds of Linux experience others have had with Thinkpads -- laptop hardware can be kind of particular, and that way you can find out which distros have a proven track record.

    4. Re:AbiWord by wadetemp · · Score: 2

      Actually, I think Word 97 might have been the one that acted this way. I never really made any use of Word until it hit 2000. Before then, nearly every Microsoft application was single window multiple document. Now they either use multiple window multiple document or "web" style single window.

  3. Must have gotten help by reflexreaction · · Score: 1

    Reminds me of the recent slashdot feature about abiword and their call for help
    It's good to see that new features are still being added.

    --

    We had to destroy the sig to save the sig.
  4. 20 times smaller than OpenOffice! by Anonymous Coward · · Score: 2, Funny

    20 times smaller than OpenOffice!
    Yeah, I tried to download it, and my up link was saturated for a good three hours.

    1. Re:20 times smaller than OpenOffice! by neo8750 · · Score: 1
      Abiword source is 15 MB according to there site

      where as the openoffice source is 128 MB accourding to there site

      on my modem I find downloading 15megs much more appealing then downloading 128 megs. but then thats could just be me.

    2. Re:20 times smaller than OpenOffice! by 0x0d0a · · Score: 1, Offtopic

      I think it should be "1/20th the size".

      20 times smaller would be -19. :-)

    3. Re:20 times smaller than OpenOffice! by grammar+fascist · · Score: 3, Funny

      You know, OpenOffice is actually pretty small. So is KOffice.

      But AbiWord is smaller than both of them put together.

      --
      I got my Linux laptop at System76.
  5. Release announcement by plam · · Score: 5, Informative
    I didn't include it in the story, but here's our AbiWord 1.0.1 release announcement.


    The AbiWord team is proud to announce the release of AbiWord version 1.0.1, a free-software Word Processing program. More than three years in the making, AbiWord is a reliable, cross-platform word processor with many powerful features.

    AbiWord aims at robust inter-operability with existing products, including Microsoft Word(R), Corel WordPerfect(R), and others. AbiWord's goal is to incorporate the most useful features of these competing applications without the fluff, bloat, or slowness that generally accompany them.

    Translations and spell checking are available for more 30 different languages. An English Language Thesaurus for use within AbiWord can also be freely downloaded.

    We have not yet implemented tables or footnotes. Tables and footnotes are the first priority for our next development phase. We have already made impressive progress toward this and other new features.

    AbiWord is available for Linux and other Unix variants, Windows, Mac OSX and QNX.
    You can learn more about AbiWord from our website at http://www.abiword.com/.
    AbiWord can be downloaded from http://www.abiword.com/download/.

    AbiWord was initially developed by SourceGear Inc.; today, AbiWord development has been continued by a worldwide team of volunteer developers. AbiWord is free software available under the GNU General Public License.

    The AbiWord team can be contacted via email at: abi@abisource.com.
    1. Re:Release announcement by colmore · · Score: 2

      The second there's a good OS word processor that supports footnotes, I'm removing word from my computer.

      Heck I don't even really play games that much any more. I might even remove windows (or at least shrink the partition)

      To think the only thing keeping microsoft on my computer is *footnotes* sheesh

      --
      In Capitalist America, bank robs you!
    2. Re:Release announcement by CH-BuG · · Score: 1

      LyX ?

    3. Re:Release announcement by mav[LAG] · · Score: 4, Informative

      You could try using Lyx. It has the best support for layout, tables, equations, code, sections, multiple output formats - and yes, footnotes, of any tool I've seen. It uses LaTeX as the engine but you don't need to know any of the syntax to get started.

      It depends what you want to do. If you're writing small pieces for immediate printing like letters, invoices or articles then Lyx is a bit over the top. But for academic papers, online (and printed) books, dissertations, code documentation and the like, it has no equal IMHO.

      --
      --- Hot Shot City is particularly good.
    4. Re:Release announcement by CH-BuG · · Score: 1

      I think it is a good solution even for letters, but only once you've set up a good template. Then you're certain you'll get all your letters with a correct professional formatting.

    5. Re:Release announcement by gunga · · Score: 1

      OpenOffice Writer supports footnotes, you should check it out

    6. Re:Release announcement by fatphil · · Score: 1

      Ditto - except that my g/f, a proofreader, needs the 'track changes' feature. One feature that forces me to keep one of my machines using MS's shite. Everything she gets is in some MS format, and ABIWord does read/write them correctly but doesn't track changes.
      Whether the latest version does or not, I'll find out, as soon as I can RTDA. :-)

      FP.

      --
      Also FatPhil on SoylentNews, id 863
    7. Re:Release announcement by colmore · · Score: 2

      There's a lesson to be had for Open Source developers.

      A million things that Linux can do that Windows can't will make me want to change. One thing that Windows can that Linux can't will make me stay.

      People are locked into their current feature sets. They can't give up functionality to gain different functionality.

      --
      In Capitalist America, bank robs you!
    8. Re:Release announcement by Soul-Burn666 · · Score: 1

      LyX is great!

      I never ever used Word/Word-clones since I got used to LyX. The fact that it formats everything right without wasting my time is great. It also has a really good hebrew support (with a patch).

      I use it to write homeworks for the university I study in, got only good remarks on this.

      The math support is one of it's greatest features! I don't use paper anymore for calculations. I use it alot as a math editor, even tho it wasn't "meant" to be a "whiteboard" but a word proccessor, it excels in this too :)

      LyX -> ctrl-n -> ctrl-shift-m and start typing... no need to wait 10 secs for Word to load up and then 30 more seconds for the equation editor... also, the fact it has "TeX" mode in Math removes the need for toolbars... It's much faster to type \sum to create a Sigma instead of a toolbar to do that... also, instead of buttons for "subscript" and "superscript", there's the standart ^ and _ ...

      Did I also note that when it rarely crashes, it saves your document intact?

      Oh, and did I mention it's files (not final rendering) is extremly small?

      --
      ^_^
    9. Re:Release announcement by Citizen+of+Earth · · Score: 1

      You can learn more about AbiWord from our website at http://www.abiword.com/.

      It looks like an interesting discussion in the text of the screenshot images. Is there some place to see the full document?

    10. Re:Release announcement by Citizen+of+Earth · · Score: 1

      It looks like an interesting discussion in the text of the screenshot images. Is there some place to see the full document?

      Er, it's at http://www.abiword.com/papers/pr_interview.phtml

    11. Re:Release announcement by fatphil · · Score: 1

      Ever felt your hands are tied, eh?

      However, she gets paid for proofing documents in MS format, that's what the sheep^Wmarket wants. Kill the competition and then you can genuinely say you're the most popular. Top in a list of one - marvelous. However, while there're 50000 geeks telling 50000 mates that there is an alternative, there's still hope.

      Twice a day Linux will make me whoop, and NT will make me weep.
      (I'm a developer/serious bodger)

      Phil

      --
      Also FatPhil on SoylentNews, id 863
  6. need to try this new version by Anonymous Coward · · Score: 2, Interesting

    I'm a high school student and I'm an advocate of open source software. I've installed AbiWord on several machines at school (which run Windows), and most of the people at school are happy with it. It opens most Word documents (at least ones they've come across), and the best part of it, is they don't even have to pay a single dime for Office to do word processing. :-)

  7. is there anything like this coming out?? by josh+crawley · · Score: 4, Interesting

    This is superb, but what'd be really good is a spreadsheet that they could interuse. Perhaps, AbiSpread ?

    Then again, what is an ABI ?

    1. Re:is there anything like this coming out?? by neo8750 · · Score: 2, Informative
      Then again, what is an ABI ?

      ABI is Application Binary Interface

    2. Re:is there anything like this coming out?? by Anonymous Coward · · Score: 2, Informative

      Well, as AbiWord is part of the Gnome office suite, the accompanying spreadsheet program for that environment would probably be Gnumeric. Anything apart from Gnome, I'm afraid I don't know a whole lot about, but I know that decent free spreadsheet applications do exist.

    3. Re:is there anything like this coming out?? by plam · · Score: 5, Informative

      Abi is an ant. She's blue.

      As for spreadsheets, in the near future we release code which is able to embed Abiword files in Gnumeric and allows Evolution to use AbiWord to read emails.

    4. Re:is there anything like this coming out?? by Arandir · · Score: 2

      AbiWord may be a part of Gnome Office, but it isn't a Gnome-only application. It will build and run just fine without Gnome. So knowing if it will eventually integrate with other non-exclusively-gnome office apps is something I a lot of people would like to know. Frankly, I'm not interested in installing Gnome just to get an office suite.

      To keep things fair, I also think it would be great if KOffice could be built as a Qt-only suite as well.

      --
      A Government Is a Body of People, Usually Notably Ungoverned
    5. Re:is there anything like this coming out?? by foniksonik · · Score: 1

      "perhaps they could use some LAbiaSpread. I can't believe it's not butter!

      --
      A fool throws a stone into a well and a thousand sages can not remove it.
    6. Re:is there anything like this coming out?? by josh+crawley · · Score: 2

      AHH OK. I've seen it on the program. I figured that this any was the mascot, but I didn't know it was "ABI". Well.

      Anyways, about the lack of a grammar check engine (some other poster was whining about it...Would this work?

      1: Make a database that has every word in the dictionary. Have a field for Word, Thesaurus, "All Possible types of Grammar". (this is a nasty step)

      2: Write associations code for sentance creation. This is where tense checking will come up. Also nasty is the code for "grammar type" detection. I'm guessing you could use queries to a internal database (internal as in editable file)

      3: Then write the pretties code, like apostrophie addition code, undoubling accidently doubled letters, applying 1 space between words. I'm meaning all the stuff that makes Office2K look pretty.

      I look at this and I see lots of man hours on that huge database. Still if we had that database done, would it be possible for the grammar code be written into ABIword?

      Thank you :_)

    7. Re:is there anything like this coming out?? by msevior · · Score: 2, Interesting
      Checkout linkgrammar.


      http://www.link.cs.cmu.edu/link/


      We plan to work with them for a grammar checker.

    8. Re:is there anything like this coming out?? by dos+equis · · Score: 1

      AbiWord does have extra Gnome-specific features when built as a Gnome application.
      We've also been talking to the Gnome and Gnumeric guys about getting the two tied even closer together.
      If you've got any specific ideas please file bugs or RFEs for them.

    9. Re:is there anything like this coming out?? by plam · · Score: 2, Interesting

      AbiWord may be a part of Gnome Office, but it isn't a Gnome-only application. It will build and run just fine without Gnome. So knowing if it will eventually integrate with other non-exclusively-gnome office apps is something I a lot of people would like to know. Frankly, I'm not interested in installing Gnome just to get an office suite.


      We certainly intend to keep the non-GNOME AbiWord as a viable option. But we don't have the resources to start building our own spreadsheet (or other office apps).

      If there's an interoperability API to code to, there's good chances that someone (probably Martin Sevior, he rocks) will implement the bits AbiWord needs in order to use this API so that Abi can be embedded in other programs.

      I think there was work on other cross-application interfaces e.g. for Windows too. I don't know any details about this.
    10. Re:is there anything like this coming out?? by teslatug · · Score: 1, Offtopic

      Sounds dirty...too bad their mascot is an ant :)

    11. Re:is there anything like this coming out?? by quintessent · · Score: 4, Funny

      Sounds really cool. Just as long as Abi the Ant doesn't appear on my desktop and offer to help me type a letter.

    12. Re:is there anything like this coming out?? by msevior · · Score: 1

      Hey! Great idea! We'll make sure we implement right away :-)

    13. Re:is there anything like this coming out?? by Salsaman · · Score: 1

      Abiword (gtk version) runs just fine for me under KDE 3.

    14. Re:is there anything like this coming out?? by jo42 · · Score: 1

      Abi is a Jewish guy I once knew...

    15. Re:is there anything like this coming out?? by Eythian · · Score: 1

      Well, given the nature of open source, it would only be a matter of time before someone created AbiAntEater

      I'm more curious about what someone said about AbiSpread...would that be Ant porn?

  8. Word Processor Alternatives by KrisWithAK · · Score: 3, Insightful

    Even though people can argue about what software is better to work with, I can see a benefit in having multiple programs that do the same thing. In the case of using AbiWord vs. OpenOffice as a word processor, AbiWord would be great to use as your default viewer for word processor files in your web browser since it is quite a bit smaller and will launch very quickly. On the other hand, if you end up needing to do some hardcore editing and prefer OpenOffice, you can take the extra couple of seconds to launch OpenOffice if it is necessary. There is value in having a choice!

    1. Re:Word Processor Alternatives by Thnurg · · Score: 1

      I have to agree with this.
      Is there work in progress on both Abiword and OpenOffice to read each others files?
      This would make it a joy to have both applications and be able to choose between fast and light, or big, slow and feature rich knowing that I could use either on a single file.
      At the moment it seems that the only common file format between them is the Bletcherous Word Doc.

      --
      The months are just too short. I can count the number of days on one hand.
    2. Re:Word Processor Alternatives by gnugnugnu · · Score: 1

      > Is there work in progress on both Abiword and OpenOffice to read each others files?

      Yes, but Abiword got the short end of the stick. Take at look at the documentation for the OpenOffice.org file format, its huge and it does EVERTHING.
      http://xml.openoffice.org/xml_specification_draf t. pdf

      What is particularly cool about the Abiword file format is that it is uncompressed XML. All it needs is a small stylesheet and XML capable browsers like Mozilla could make a decent attempt at displaying Abiword documents without needing a plugin. (At the moment it just displays the text with line breaks).

  9. tables???? by johnson25 · · Score: 1

    still doesn't support tables? Whats the use?

    1. Re:tables???? by KrisWithAK · · Score: 1

      Even if AbiWord is missing some features you can find in other word processors such as OpenOffice, you still can take advantage of a program such as AbiWord for its size and speed. This can for applications such as a default viewer for a web browser when you might not want to wait for programs like OpenOffice to load for a quick preview view or whatever.

    2. Re:tables???? by Troodon · · Score: 5, Informative
      According to this manual section it appears to offer very basic table support.

      "This will allow you to create simple tables. More sophisticated table support is the major feature planned for AbiWord 1.2. The developers already know that it is needed, and are already working on it."

      --
      troodon.net
    3. Re:tables???? by dos+equis · · Score: 4, Informative

      Table support is our most-requested-feature and our #1 priority for the next version. It's being worked on now.

      It does support Word 2000 and XP but if you find a feature for those formats that is missing, file an RFE.

  10. AbiWord's size by ObviousGuy · · Score: 1

    If it's true that AbiWord is 20 times smaller than OpenOffice and still provides comparable capabilities, those coders sure know what they are doing!

    --
    I have been pwned because my /. password was too easy to guess.
    1. Re:AbiWord's size by AntiNorm · · Score: 4, Informative

      If it's true that AbiWord is 20 times smaller than OpenOffice and still provides comparable capabilities, those coders sure know what they are doing!

      Keep in mind that OpenOffice has a lot more than AbiWord does, though...like a spreadsheet program, presentation program, etc. To say that AbiWord is 20x smaller than OpenOffice is misleading; it is, but this is because it is just a word processor and not a full-fledged office suite.

      --

      I pledge allegiance to the flag...
      of the Corporate States of America...
    2. Re:AbiWord's size by mark_lybarger · · Score: 4, Informative

      abiword does not provide comparable capabilities. it's more of a lightweight editor. kate w/ font suppport maybe. i'd compare it more to wordpad than open office.

      openoffice is definately a M$ Office alternative for general document handling, unless you've got a marketing department. those guys will create stuff that m$ office doesn't handle properly.

    3. Re:AbiWord's size by ObviousGuy · · Score: 1

      That makes sense. The writeup is sure misleading in that regard. Still, it would be interesting to see a head to head comparison of AbiWord, OpenOffice (word processor), and Microsoft Word. It's not a given that the Open Source renditions will come out ahead of the Microsoft product.

      --
      I have been pwned because my /. password was too easy to guess.
    4. Re:AbiWord's size by spencerogden · · Score: 1

      Shouldn't the size of OpenOffice be: (Assuming There is about the same amount of code in each module) 4*(Size of one module)-code eliminated by shared libraries. This would indicate a fair comparison of OpenOffice being 4-5 times as large as Abiword. Why is it twice as big as this would suggest?

    5. Re:AbiWord's size by JFMulder · · Score: 2

      Last time I checked, Excel was waaaayyyyy bigger than Word and Outlook together, so probably that in OpenOffice the spreadsheet program is a BIG part of the package.

  11. Re:release notes? by i+like+your+eyes · · Score: 1
    1.0.1 Changelog

    As usual, just changes, not real release notes. For a post 1.0 version. Yippee!

    Christian Biesinger

    Beginnings of a StarOffice importer.

    Improvements to password entry dialog.

    Fix an assert on password entry dialog.

    David Chart

    Help system updates.

    Jeremy Davis

    AbiPaint plugin improvements.

    Plugin linking fix on Win32.

    Hubert Figuiere

    Fix endian problems with StarOffice importer.

    Build fixes.

    Bug fixes: 3211.

    Frank Franklin

    Build system fixes.

    Fixes to wv.

    New UTF8 string class.

    Tomas Frydrych

    Added byteLength () method to UT_utf8string.

    Dom Lachowicz

    Added a format painter.

    Added abiwidget to build system.

    Work on AbiCommand.

    Fix spell checker to look for local dictionaries.

    Fixed build problems on Win32.

    Bug fixes: 3171, 3213

    Pat Lam

    Fix to system requirements document.

    Fixed a bug with Undo.

    Implemented scroll-wheel zoom.

    Per Larsson

    Fixed a small bug in AbiWord.nsi.

    Marc Maurer

    Fixes to WordPerfect margin import.

    Build fix for StarOffice importer.

    Paul Rohr

    Added a Unicode sample to help us check our internationalisation.

    Usability improvements to the Language dialog.

    Martin Sevior

    AbiWord is now an embeddable Bonobo component.

    Fixed a build problem in abiwidget.

    Jesper Skov

    Namespace clean-up.

    Hacks to AbiCommand.

    Started work on an automatic testing infrastructure.

    Andrew Venier

    Fixes to clean up compiler warnings.

    Your comment has too few characters per line (currently 16.3).Your comment has too few characters per line (currently 16.3) god this filter is killling me. Do you remember the old days when you used to love me You were so fond of me Always thinkin of me Do you recall our big fall for one another How we discovered That we were so much more than lovers I didn't work and you quit school And everything was so fantastic Crackin' up at the same bad jokes all day I can't forget when we first met How I'd ignore you But I sure fell for you And now I adore you You never guessed you get mixed up with a rock 'n' roller But I can't console you 'cause I don't know shit from soyola it's the same old story but you say cliché I say classic you know that all we ever really have is today so what the hey so let's refrain from the dim inane useless squawkin' and let's get talkin some nice long walkin when you get mad or you're feeling bad you gotta tell it to me not yell it through me you don't know what that's doin to me what a drag to pack our bags after all this time and all this magic you and I both know we'll never make up our minds it ain't like it's all bad I don't mean to make it sound so tragic either way it goes it's been a hell of a ride so 'what the hey' she sighed it's all stuff and nonsense anyway
    --

    There's no emoticon for what I'm feeling!
  12. Re:Give Blood by Hatechall · · Score: 1

    Actually, its www.redcross.org if you are really interested.

  13. Praise be the Gods by KanSer · · Score: 1

    Finally! I can do away with my cross platform chisel! It was really ruining my day when I had to sand my monitor, and none of my friends would reply to my IM's I spent so much time chiseling. Oh well, I guess technology effects people from all walks of life.

    --
    • MOD PARENT UP by Anonymous Coward Wednesday April 20, @4:20
  14. Grammar Checking... by Thomas+M+Hughes · · Score: 4, Interesting

    Unfortunately, I'm a University Student (one of those eternal students actually). That means I end up doing a lot of word processing, paper writing, and the like. And its not always in English either. At the same time, having a grammar checker on hand does make proof-reading my own papers much easier, for simple stuff like subject-verb agreement, and the use of active voice instead of passive voice. In my brief experiments with both OpenOffice and AbiWord, both lacked a grammar checker to do this.

    Thus, I end up using MS Word for these things, not only because my professors only deal with MS Word format, but also because of the added feature of grammar checking. However, MS Word isn't exactly perfect in this respect. I do large amounts of my writing in the University computer labs, on their mass installs of MS Word, which only deal in English. Microsoft charges extra for increased language support in Word (last I checked it was a fairly sizable amount of money too). But I digress...

    Unfortunately, its hard to break the MS Word strangle hold not only because of the file format being so nasty to deal with, but also the fact that MS has developed a very good and useful feature in its grammar checker.

    1. Re:Grammar Checking... by msevior · · Score: 2, Informative
      We have some possibilities for Grammer checking and will work with other open source programs to implement it in AbiWord.



      See: http://www.link.cs.cmu.edu/link/


      We've already discussed collaboration and have the beginnings of a plugin.

    2. Re:Grammar Checking... by great+throwdini · · Score: 4, Funny

      [C]an anybody tell me why the use of active voice is preferred over passive voice?

      I'm certain you meant to ask: Can anyone tell me why people prefer active voice to passive voice?

    3. Re:Grammar Checking... by rubinson · · Score: 5, Informative

      Thus, I end up using MS Word for these things, not only because my professors only deal with MS Word format, but also because of the added feature of grammar checking.

      You might the Unix utilities "style" and "diction." They don't do "grammar" checking per say (i.e., they don't cite passive voice or subject-verb agreement) but this is rather simple stuff that you should catch anyways.

      Diction identifies (and suggests remedies for) commonly misused phrases and lengthy sentences. Style evaluates the complexity of [sections of] your document.

      I don't think that I'm describing them very well, but, as an academic, I've found them (along with wordnet and ispell) to be indispensible. And they're probably already installed on your system. Check 'em out.

      The homepage: http://www.gnu.org/software/diction/diction.html

    4. Re:Grammar Checking... by Anonymous Coward · · Score: 1, Informative

      Don't forget to include a spell checker with that grammar checker.

    5. Re:Grammar Checking... by frantzdb · · Score: 2
      According to Strunk & White:

      The active voice is usually more direct and vigorous than the passive:

      I shall always remember my first visit to Boston.

      This is much better than

      My first visit to Boston will always be remembered by me.

      The latter sentence is less direct, less bold, and less concise. If the writer tries to make it more concice by omitting ``by me,''...it becomes indefinite...

      They go on to point out that active voice is not always better. One good use of passive voice is in emphasizing passivity as in ``the old lady was attacked'' rather than ``someone attacked the old lady.''

      --Ben
    6. Re:Grammar Checking... by dos+equis · · Score: 1

      We've talked about it but I just checked and nobody has officially requested it.
      Why not file an RFE now? Then the rest of you can vote on it and some of you can start hacking it!

    7. Re:Grammar Checking... by hey! · · Score: 4, Informative

      The passive voice is perfectly grammatical and useful in cases where you want to place emphasis on an act rather than who is doing it. It's mainly a usage bugaboo becasue it's all to easy to slip into using it habitually. Excessive use makes your writing sound evasive, wishy-washy, and wordy. A lot of bad government writing abuses the passive voice.

      --
      Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
    8. Re:Grammar Checking... by Anonymous Coward · · Score: 1, Funny

      They don't do "grammar" checking per say (i.e., they don't cite passive voice or subject-verb agreement) but this is rather simple stuff that you should catch anyways.

      Open Source: Proudly scolding ignorant cluebies since 1984.

    9. Re:Grammar Checking... by Docrates · · Score: 3, Interesting

      Unfortunately, its hard to break the MS Word strangle hold not only because of the file format being so nasty to deal with

      I disagree.

      Always save your documents as RTF, which has all the features you need, and send them in that format to any MS Word user. Not a single one will complain, most won't even notice. All word processors translate RTF flawlessly.

      Interoperability is a problem when THEY use Word and YOU have to read their docs, then, if they inserted an image inside a table using a floating picture allignment layout, or some other stupid lazy usagage of Word, you'll have a problem opening them since it'll probably be distorted.

      --

      There are two kinds of people in the world: Those with good memory.
    10. Re:Grammar Checking... by Bronster · · Score: 5, Funny

      You might the Unix utilities "style" and "diction."

      You might the Unix utilities yourself, Yoda.

      Strong in this one the force is.

    11. Re:Grammar Checking... by autechre · · Score: 5, Insightful

      I've never actually seen the grammar checker in Microsoft Office do anything useful. I think it's a bit fiddly to have a computer attempt to do such a thing in the first place (like a spell checker, it certainly won't catch all of the errors). I've often disagreed with it.

      The best method by far (IMHO) is to have someone else proofread your writing. If he is also a writer, you can trade. When proofreading your own work, errors will often slip by, because your brain knows what _should_ be on the page.

      It's also very helpful to read a lot of edited material (books, newspapers, etc.). _The_Elements_of_Style_ is a nice guide.

      --
      WMBC freeform/independent online radio.
    12. Re:Grammar Checking... by mobets · · Score: 1

      Way back in word version 6 is was kind of usefull, although probobly not as 'smart.' It would flag words like 'effect' and 'affect,' tell you the difference, and ask you which one one really meant. There were a few other things about it I was dissapointed to see dissapear in Word 95.

      --

      It was me, I did it, I moved your cheese
    13. Re:Grammar Checking... by rubinson · · Score: 1

      touché

    14. Re:Grammar Checking... by Anonymous Coward · · Score: 1, Informative

      It's preferred because Word flags every use of the passive voice as a grammatical error automatically. Thus some consumers of your writing will think poorly of you.

      Sad but true.

    15. Re:Grammar Checking... by Spaceman+Spiff+II · · Score: 1

      LOL!! Pure literary genius...

      --
      I understand that life's not fair, just why is it never unfair in my favor?
    16. Re:Grammar Checking... by plam · · Score: 1

      I didn't know about these utilities. I just posted a request for enhancement at Bugzilla. It would be really cool to have this as a plugin for 1.0.2; hopefully I (in my copious free time) or someone else can snarf the code and implement the frontend hooks Abi would need.

    17. Re:Grammar Checking... by Chasuk · · Score: 2

      I'm sorry, but as a university student (especially one who describes himself as an "eternal" student), you shouldn't be relying on grammar checkers for simple stuff like subject-verb agreement and active/passive voice.

      I am not a grammar Nazi, but I find a thesaurus more of an enemy than a tool. I've revised hundreds of papers for friends and family, and it always obvious when someone with the vocabulary of a gnat has overdosed on the use of a thesaurus.

      Grammar checkers are only useful tools for people who already have at least a basic understanding of grammar. Too many times, I've watched my wife or my friends blindly make a change suggested by Word because they assumed that Word was infallible.

      Yes, I've probably made numerous grammatical errors above, so there is no need for a wit to point them out.

    18. Re:Grammar Checking... by dos+equis · · Score: 2, Informative
      We already support spell checking for all these languages. We support check-as-you-type too.
      • American English
      • Brazilian Portuguese
      • British English
      • Catalan
      • Czech
      • Danish
      • German
      • Greek
      • Spanish
      • Esperanto
      • Finnish
      • French
      • Galician
      • Hungarian
      • Irish (Gaelic)
      • Italian
      • Lithuanian
      • Latin
      • Dutch
      • Norwegian (Nynorsk and Bokmal)
      • Polish
      • Portugues
      • Russian
      • Slovakian
      • Swedish
      • Swiss German
      • Ukrainian
    19. Re:Grammar Checking... by Metrol · · Score: 2

      ...you shouldn't be relying on grammar checkers for simple stuff like subject-verb agreement and active/passive voice.

      I've got a friend that I webmaster a news site for. He gets all kinds of mail, press releases, editorials, and such coming at him. He's pretty good with grammar, but trying to proof that much information just isn't reasonable for that amount of content.

      For this reason, more than almost any other, I have not fully endorsed the notion that he should run any kind of *nix. It would simply cost him way too much time and effort for this one feature available in Word.

      The only point I'm trying to make here is that there are other uses for grammar utilities than just having a person check their own work. I would imagine many other folks also run sanity checks on written material through Word prior to publishing.

      ...blindly make a change suggested by Word because they assumed that Word was infallible.

      Too sadly true. Thing is, grammar checking in bulk is probably more of a time consuming task for a human than spell checking. Grammatical errors tend to be far more subtle, and many times invisible until the sentence is spoken aloud.

      --
      The line must be drawn here. This far. No further.
    20. Re:Grammar Checking... by codingbytes · · Score: 1

      Some of us didn't **go** to college.

      --

      soul daddies in a firewire tumble dryer

    21. Re:Grammar Checking... by PurpleFloyd · · Score: 2
      I think it's a bit fiddly to have a computer attempt to do such a thing in the first place (like a spell checker, it certainly won't catch all of the errors).
      The "Grammatik" grammar checker in WordPerfect 6 for DOS blew me away. That was one hell of a piece of code! The thing was nearly a mind-reader. It didn't catch everything, but Word still hasn't come close. If you can get a copy of WP6, I encourage you to check it out.
      --

      That's it. I'm no longer part of Team Sanity.
    22. Re:Grammar Checking... by aussersterne · · Score: 2

      If you are relying on the Word grammar checker for correctness, you're in trouble... it is easily confused and often wrong.

      Perhaps you should learn your grammar before going to university?

      --
      STOP . AMERICA . NOW
    23. Re:Grammar Checking... by Permission+Denied · · Score: 2
      Although I hate to do this, I'll have to agree with you.

      When I was in University, I took some French writing classes. Being a CS/Math guy, I did all my papers in LaTeX. I even wrote scripts to translate my ISO-8859-1 text that I input using Emacs to standard LaTeX escape characters, since I didn't want to have to deal with Babyl.

      However, this teacher wanted Word documents. So I installed Word 2000 on my laptop under VMware. Word didn't like how my text had line breaks - it expected no line breaks within a paragraph. So I wrote another script to translate my normal text into this one-line-per-paragraph format (there's also an emacs mode that does this automatically, but I didn't bother with that). So, I eventually got it so I could just copy over a text file, import into Word, change the style of the whole thing from 'plain text' to 'normal' and send it off.

      Then I discovered Word's spelling and grammar check. I had given up on these for English documents long ago since it can't handle anything more complicated than Hemingway, and my writing looks more like Hawthorne.

      Word's grammar check for French is amazing. Half my papers needed to be emailed and were done in this hybrid write-in-emacs import-to-word-and-grammar-check fashion, and half my papers were just written in Emacs/LaTeX. I received better grades on the papers that had gone through Word's grammar check.

      Now, my French isn't horrible, but, like most non-native speakers, I have lots of problems remembering gender; this isn't really a grammar problem (I know my grammar), but more of a vocabulary problem, since there are a lot of words whose gender you just have to memorize (you can also figure out a lot of words just by their endings, but not all words). Word would catch all of these errors - not just the really simple stuff like articles, but also making adjectives agree when they were in a completely different part of the sentence than the object. It's actually quite impressive.

      I still used Emacs to write my documents, just because I can't stand this idiotic point-and-click editing (I have to use the arrow keys to move the point!?). I had also gotten used to Mule's 'french-postfix' input method, and I couldn't get used to the weird azerty keyboard layout in Windows.

      Honestly, I completely hate Word, and all other "word processors," and would rather avoid them if at all possible. If someone could write a unix command-line grammar check that's as good as Word's, I would be very happy. If someone else could incorporate into Emacs, like how ispell works with flyspell-mode, I would be even happier.

    24. Re:Grammar Checking... by Gorgonzola · · Score: 1

      Isn't the time spend in high school supposed to teach you these skills anyway?

      Now I am even more confused about the US education system than I used to be...

      --
      -- Spelling and grammar errors tend to be a sign of erroneous thinking.
    25. Re:Grammar Checking... by Permission+Denied · · Score: 2
      Isn't the time spend in high school supposed to teach you these skills anyway?

      No, no, no...you've got it all wrong. You obviously don't understand anything about how the American education system works (wink, wink).

      College is were you're supposed to learn this stuff. This is why virtually all serious four-year universities in the US have what they call a "core" requirement (I'm thinking Ivy League schools and their peers). Basically, you spend your first two years of college writing papers on literature, political philosophy and history. You might also get in a couple math classes.

      Your third and fourth year of college is where you start taking only relevant classes.

      Some people call this "liberal" or "liberal arts" education. It's funny because the US is the only country I know of that follows "the great European tradition of liberal education." I don't know of too many foreign universities with a "Great Books" program. French and German engineers don't have to take political philosophy courses in college. In fact, they probably won't take any polisci in the last couple years of high school.

      Now, you try to get into a math grad school in the US with your BS and good grades, and you'll have a good chance; but why? Because schools can only take so many Hungarian and Romanian mathematicians who've actually been doing mathematics since high school.

      But I digress; your question was about what you're supposed to learn in high school. As far as I can tell, the answer is nothing. You're supposed to spend high school "developing your individuality" through "extra-curricular activities," such as driving to McDonald's and playing sports.

    26. Re:Grammar Checking... by Merlin42 · · Score: 1

      Well I went ahead and tried to compile style/diction and it bailed out complaining:
      In file included from /usr/include/math.h:350,
      from style.c:33:
      /usr/include/bits/mathinline.h:427: warning: no previous prototype for `__atan2l'
      /usr/include/bits/mathinline.h:442: warning: no previous prototype for `__sqrtl'/usr/include/bits/mathinline.h:448: warning: no previous prototype for `__fabsl'

      When compiling style.c. WOW! I never realized that you need arctangents in order to do style checking :)

      Pretty cool programs though, I sort of assumed (you know what happens when we assume) these kind of things wouldn't really show as OSS since grammer aint really the domain of most hackers. Thanks for the pointer. I really need to browse gnu.org more often.

    27. Re:Grammar Checking... by n-baxley · · Score: 3, Interesting

      ...if they inserted an image inside a table using a floating picture allignment layout, or some other stupid lazy usagage of Word...

      Just because something is easy to do, doesn't make it stupid or the doer lazy. Software is supposed to make things easier for the user.

    28. Re:Grammar Checking... by coke_nl · · Score: 1

      OK OK, leave that guy alone. He typed the comment in an ordinary browser's textarea which does not support grammar checking. He can't help it!

      *chuckle*

      --
      coke
    29. Re:Grammar Checking... by jcast · · Score: 1

      ``People'' don't prefer active voice.

      Readers do.

      And that's why.

      --
      There are reasons why democracy does not work nearly as well as capitalism.
      -- David D. Friedman
    30. Re:Grammar Checking... by King_TJ · · Score: 2

      It's commonly seen in I.T. also, where nobody wants to accept the blame for the results of their poor management or software development decisions.

      AKA. "The price of software licensing will go up by 30% next year." instead of "Microsoft will raise our prices on software licensing by 30% next year."

    31. Re:Grammar Checking... by walt_huntsman · · Score: 1

      "They don't do "grammar" checking per say (i.e., they don't cite passive voice or subject-verb agreement) but this is rather simple stuff that you should catch anyways."

      First, passive voice is not always bad. As a former business writing instructor, I know that there are times when a writer needs to use passive voice; for instance, when the person performing the action is unknown, or when the author wishes to avoid assessing blame.

      Second, passive voice and subject-verb agreement are not "rather simple stuff that you should catch anyways," especially if you are a non-native speaker of the language. From a former academic who reguarly came in contact with non-native English speakers to one who presumably would have come in contact with similar people, I would say you should know better than to simplify language issues in such a manner.

    32. Re:Grammar Checking... by Richard_Davies · · Score: 1

      I disagree - while I am quite happy typing a document in English (my native language) without the help of a grammar checker but when I am hammering out something in French, I find it invaluable. It is very easy to miss little things (accents, incorrect conjugations, agreement of participles or adjectives) very easily when it is not your native language. I am sure this is just as significant for people who use the grammar checker when English is not their first language.

      I fully agree with the original poster - a good (and in my case French) grammar checker is the only reason why I cannot switch to using OpenOffice full time.

    33. Re:Grammar Checking... by HiThere · · Score: 2

      While I balk at calling the MS grammar checker good, the rest of your argument makes sense. As far as I can tell it is ONLY useful to someone who is composing in a second language. I can't recall ever accepting any of the changes that it suggested.

      Perhaps they would do better if the concentrated on only finding actual mistakes (i.e., reducing their false positive number). This should probably be born in mind by any prospective grammar checking competitor. If your error rate is too high, then you won't be attended to even when you are correct.

      --

      I think we've pushed this "anyone can grow up to be president" thing too far.
    34. Re:Grammar Checking... by pthisis · · Score: 2

      Some people call this "liberal" or "liberal arts" education. It's funny because the US is the only country I know of that follows "the great European tradition of liberal education." I don't know of too many foreign universities with a "Great Books" program. French and German engineers don't have to take political philosophy courses in college. In fact, they probably won't take any polisci in the last couple years of high school.

      Now, you try to get into a math grad school in the US with your BS and good grades, and you'll have a good chance; but why? Because schools can only take so many Hungarian and Romanian mathematicians who've actually been doing mathematics since high school.


      Not really true in my experience. I went to public school (high school) in the U.S. and certainly had my share of mathematics--we finished AP Calculus (AB and BC) and some linear algebra in junior year and did differential equations and more linear algebra senior year. Of course, not everyone opts for the accelerated track which leads to...

      The real difference between school in Europe vs. stateside is that in Europe there's no stigma associated with going to a trade school instead of university. Here in the US, trade schools are viewed as an option for the uneducated and so a lot of people who don't have any need or desire for a university education wind up in university anyway, which means that universities have a high percentage of courses covering things that really ought to be covered in high school. But the top US students, those who would go on to university in a European system, tend to have just as good an education. In my experience, anyway. In other words, the problem isn't that US high schools are that bad, it's that too many people are going to college who might be better served with European-style trade educations.

      Or to put it delicately, most colleges have two tracks; one is those who are in college because it's the thing to do socially, and one is those who actually want/need a college degree. But the second group is about the same size (slightly larger per capita) as the European university group and in my estimation equally well-prepared.

      The reason you stand a good shot at getting into grad school is that the tremendous number of college graduates in the US mostly don't apply to grad school. Only the top few do--there isn't the same social pressure to get a postgraduate degree. Indeed, about the same number of US students apply to grad school each year as the totals for France, Germany, and the UK, which works out to 2/3 as many per capita and less than 1/3 as many per college graduate. Those that apply are among the best prepared and the best qualified and matriculation rates from doctorate programs are actually higher for the Americans than the Europeans (even when grouped by university, though I can only find those numbers for U.S. doctoral programs and not for European or masters programs).

      Handful of facts from the NSF's last study on higher education: U.S. university attendance has skyrocketed over the last 50 years, from 2.5 million enrolled to over 14 million enrolled. 35 out of every 100 college age individuals in the US are enrolled in college, as compared to 24 per 100 in Germany and 13 per 100 in France. The UK, Canada, and Australia are the major exceptions (UK sends 35/100).

      Sumner

      --
      rage, rage against the dying of the light
    35. Re:Grammar Checking... by LetterJ · · Score: 1

      "...when the author wishes to avoid assessing blame..."

      I'd say that constitutes the VAST majority of overuse of passive voice, particularly in business writing. Especially when the author is seeking to avoid the blame being pointed at themselves. While understandable, I wouldn't call using that particular writing crutch "good writing" by any stretch. "Effective"? Yes, but only if the goal was avoiding blame instead of clear communication.

      I do agree though that passive voice can be used in good writing effectively and use it myself when necessary. I just find myself wondering about the culpability of the author when the entire document is written passively.

      (Passive usage intentional in this post).

    36. Re:Grammar Checking... by DunbarTheInept · · Score: 2

      I use passive voice because English doesn't have a gender-neutral pronoun for people (it has "it", but that's not meant for people), and it is considered bad form to overuse "you" as if the document is talking to the reader. So when I want to say things like "To make the Foo do Bar, you have to do Baz.", I render that as "Making the Foo do bar is accomplished by doing Baz.", or "Doing Baz will cause the Foo to do Bar". MS Word kept telling me I was overusing passive voice, so I just told it to go stuff itself and turned off the grammer checker until such a time as MS chooses to let me write technical documents at something above a grade school level.

      Passive voice is not necessarily a bad thing.

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

    37. Re:Grammar Checking... by Docrates · · Score: 2

      When you paste an image in Word, the default alignment layout for that image is "floating". Floating images completely destroy possible compatibility with anything else, including different installation of the same word document. I've seen two computers with the same version of Word, but with different printer drivers (which are used as part of the rendering process) that place those images in different locations. Also manipulating a floating image (as in moving it around) is completely erratic. So yes, it's a stupid lazy usage of Word to paste an image and not "fix" it's alignment layout.

      --

      There are two kinds of people in the world: Those with good memory.
    38. Re:Grammar Checking... by DunbarTheInept · · Score: 2

      His comment is an excellent example of why discouraging passive voice is a dumb idea. His sentence and yours don't say the same thing. His sentence left it open as to who or what prefers the passive voice. You changed the meaning when you assumed falsely that he was talking only about why PEOPLE prefer it. He could just as easily have been talking about why the program prefers it. He left it vague on purpose, since he presumably doesn't know who it is that is preferring passive voice, and that's partly why he was asking.

      Avoiding passive voice universally is a bad idea.

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

    39. Re:Grammar Checking... by DunbarTheInept · · Score: 2

      Your example given was a bad use of passive voice only because the subject of the action was mentioned at the end, and passive voice was therefore unhelpful and needlessly wordy. But this does not mean that using passive voice a lot is a bad thing, as MS Word falsely assumes. Often passive voice is used a lot throughout a document because in that document the subject of the action isn't known. This tends to happen a lot in technical documents that explain what will happen if a particular action is performed, without really caring who it is that performs that action.

      --

      Don't label something "offtopic" unless you know the topic well enough to tell what's on topic.

    40. Re:Grammar Checking... by Richard_Davies · · Score: 1

      I think Word even gets around this - it tells you what the grammatical error it thinks has occurred. The thing is, my french is good enough to know if the grammar checker is right - but it's still far more difficult for me to _see_ the errors myself in French. If I'm reading English, grammatical errors tend to "jump out" more.

  15. Suggestions by Sir+Homer · · Score: 3, Informative

    First of all, the news is kind of old, as AbiWord 1.0.1 was put out more then a week ago. (April 29, 2002) Secondly, I would like to praise the AbiWord team. I use AbiWord for pretty much everything I need to formally write. It covers all the features most people use and I love how it loads so damn fast. (Six times faster the MS Word when I tested it.) I have some suggestions though in order of prority (if your not already working on it): - Grammar Check - Tables (sorry if I'm wrong and AbiWord does support tables) - Compile html files to a Windows standard help file Thank you for such a great piece of software!

    1. Re:Suggestions by ZigMonty · · Score: 2

      First of all, the news is kind of old, as AbiWord 1.0.1 was put out more then a week ago. (April 29, 2002)

      Did you submit the news to slashdot? If you did and it got rejected then your comment is reasonable. If not, why didn't you? If everyone had your mentality then the only stuff on slashdot would be the stuff CmdrTaco finds.

      Do you get a kick out of the elite feeling of knowing news no one else knows or are you just too lazy to fill out a submission?

      Sorry if this sounds harsh, it's not meant to be a troll. I'm just sick of people whining about the fact that slashdot occasionally gets (oh the humanity!) week-old news. I can understand if it's news from the 70s or 1995 or if it's repeated but week-old?

    2. Re:Suggestions by saintlupus · · Score: 2

      I can understand if it's news from the 70s or 1995

      No, that belongs under the "science" topic.

      (20 seconds passing....)

      --saint

    3. Re:Suggestions by smyle · · Score: 1
      Six times faster the MS Word when I tested it.

      Gah! First in the writeup (20 times smaller) and now in the comments.

      20 times smaller would be 1+(-20)=-19 (somebody else here mentioned it and got modded offtopic). 6 times smaller would be 1+(-6)=-5. So if Word takes 20 sec, your claim is that AbiWord would take -100 sec. The appropriate way to phrase it is "one-sixth the time of MS Word when I tested it".

      Sheesh. News for nerds indeed.

      Now, feel free to mod me offtopic. :-)

      --

      Sleep is just a poor substitute for caffeine, anyway. -Bob Lehmann

  16. Cool, but.. by banky · · Score: 3, Interesting

    I have on my hard drive at home a half-dozen documents that fall into the category of "standard Word documents", which is to say, they're the kind of documents you'd see on the "average" corporate network.

    Even Word sometimes chokes and dies on them.

    My point is, when I see "import Word documents", I can't help but think, "But what kind of Word documents?". I got burned too many times trying to convince my officemates to go away from MS and Office. Those documents are now a shrine for me: parse and display these, and you've won. Otherwise, don't even try to claim you can import Word.

    --
    ZOMG I WOULD LOVE TO KNOW ABOUT YOUR FEELINGS ON MACINTOSH VERSUS WINDOWS, VI VERSUS EMACS, AND HOW YOU'RE NOT A DORK
    1. Re:Cool, but.. by Lord+Omlette · · Score: 2

      and now we eagerly await your posting of the results. Will AbiWord pass your stringent criteria? Will it fall like so many office clones before it?

      I'm intrigued by the '20 times smaller than Word' that AbiWord is described as, but if it can't handle nonstandard documents, it's useless to me as well...

      --
      [o]_O
    2. Re:Cool, but.. by AJWM · · Score: 4, Insightful

      So, have you made these doc files available to developers of AbiWord, OpenOffice, KOffice, etc? It's hard to fix what you can't reproduce.

      Come to think of it, I've got a few files like that too -- old files from MS Word for Macintosh circa 5.0 (ie about 10 years old). MS Word (Windows versions) can sometimes be coaxed and coerced into reading them, but only with the proper filters installed (which aren't by default).

      I guess by your rules even Word shouldn't claim it can import Word.

      --
      -- Alastair
    3. Re:Cool, but.. by foniksonik · · Score: 1

      You might want to consider that many M$ Office documents contain huge amounts of unrendered and non-formatting information.This could be the last ten edits you did or that your coworkers did to the document or if there is a spreadsheet or table it is most likely now an embedded database from excel, not to mention Powerpoint code for anything image wise.

      If all you are doing is creating a ruch formatted text document you might want to consider copying and pasting the actual text and formatting from Word into a new document, either MSWord or Abiword or whatever and resave... witness the file size and complexity of the document shrivel to a reasonable size.

      M$Word never throws anything away. Try doing a save as to .RTF on a file and see how the size shrinks even then.

      Parseing and displaying the results of bad standards isn't really all that impressive. Kinda like the dog that finally caught it's own tail and proceeded to chew it off.

      --
      A fool throws a stone into a well and a thousand sages can not remove it.
    4. Re:Cool, but.. by plam · · Score: 1

      I have on my hard drive at home a half-dozen documents that fall into the category of "standard Word documents", which is to say, they're the kind of documents you'd see on the "average" corporate network.

      Even Word sometimes chokes and dies on them.

      My point is, when I see "import Word documents", I can't help but think, "But what kind of Word documents?". I got burned too many times trying to convince my officemates to go away from MS and Office. Those documents are now a shrine for me: parse and display these, and you've won. Otherwise, don't even try to claim you can import Word.


      AbiWord has a Bugzilla. If you create a bug on this bugzilla and attach the offending documents, someone will look at the bug; there's a good chance that the bugs will be fixed in short order.

      If you don't, well, it's awfully difficult to fix an unreproducible bug.
    5. Re:Cool, but.. by speaker4thedead · · Score: 1

      So, why not post those somewhere?

      A suite of common office documents can help devlopers know what type of features a non-technical job requires.

      Who knows, it might become the kernel of a set of standards used to compare Word import filters across the board.

      --
      "My religion is to live --and die-- without regret." -- Milarepa
    6. Re:Cool, but.. by banky · · Score: 2

      >So, have you made these doc files available to developers of AbiWord, OpenOffice, KOffice, etc? It's hard to fix what you can't reproduce.

      Most developers I have spoken to generally dismiss it; either "there' just some things that won't work" is the line I always hear.

      >I guess by your rules even Word shouldn't claim it can import Word.

      Yep. Exactly. Of course when I say that, I'm either a zealot or a freak/idiot/etc. Apparently the rest of the world has no problems with documents like this.

      --
      ZOMG I WOULD LOVE TO KNOW ABOUT YOUR FEELINGS ON MACINTOSH VERSUS WINDOWS, VI VERSUS EMACS, AND HOW YOU'RE NOT A DORK
    7. Re:Cool, but.. by Metrol · · Score: 4, Insightful

      Even Word sometimes chokes and dies on them.

      Have you considered the very real possibility that the problem isn't the import filters, but some corrupted doc files? Especially earlier versions of Word did not much care for "open > edit > save > open > edit > save > rinse > repeat". Repetitive edits of the same document tend to start mucking things up.

      You might try copy and pasting your files clean. If offending document can open, copy everything outta there and paste into a new doc.

      I know it sounds like a cheap hack, but I have seen this work. With that fresh, and free of extra cruft, document you might want to try some of those import filters again. They may still not work fully, but at least they've been given a fair test.

      --
      The line must be drawn here. This far. No further.
    8. Re:Cool, but.. by ColaMan · · Score: 2

      One of our computers here has some sort of problem and corrupts word documents to the point that when you open them on another computer, word locks up.

      I had a particular one today that somehow managed to get two lines of text formatted in such a way that each character was allegedly on a separate page, but the two lines displayed perfectly on screem. Only the page counter in the status bar gave it away. Any attempt to open it in Word (97 - 2002) resulted in endless repaginating.

      Staroffice 5.2 however read it fine, and was able to save it back as a word document, good as new.

      This sort of corruption has happend a few times, and SO 5.2 has always managed to open the file fine.

      I guess sometimes it helps to use an import filter.

      --

      You are in a twisty maze of processor lines, all alike.
      There is a lot of hype here.
    9. Re:Cool, but.. by BrokenHalo · · Score: 1

      try:

      strings $filename | less

      or > some_useful_filename - there's no beating the power of ASCII :-)

    10. Re:Cool, but.. by valenti · · Score: 1

      Another possible method to clean these files is to save as rich text format (RTF). I just had someone with a 120 page Word file that wouldn't save (in Word format) anymore. Saving as RTF got them running again without hosing too much of their formatting. The file could be saved as DOC again after this.

  17. I'm surprised that Microsoft... by cliffy2000 · · Score: 2, Insightful

    Hasn't filed suit against them yet for "Copyright Infringement." I mean... they've got "Word" in their name! Doesn't anyone remember the "Lindows" debacle?
    ...not saying that either side is right, but there's always room for some more Microsoft bashing in this world.

    1. Re:I'm surprised that Microsoft... by kraf · · Score: 2, Informative

      Um, that would be trademark infringement.

      But anyway, I don't think Word is a trademark, that would be ludicrous.
      Check this page for more.

  18. My Review of AbiWord for Open CD by Sir+Homer · · Score: 3, Informative

    Current Version: 1.0.1
    Website: http://www.abiword.com/
    Licence: GNU General Public Licence
    Operating System: Windows, Mac OS X, UNIX (including Linux), BeOS
    Size: 4MB
    Tested on: Windows 98
    Major Propertary Competitors: Microsoft Word Screenshot: [N/A] Ease of Use Review:

    Interface (9/10)
    Suprise! Suprise! Anyone who ever used Microsoft Word before should have no problem using AbiWord, as the interface is modeled after it. Very easy to find formating functions and there are even the red lines under misspelled words. Help System (6/10)
    While the help system is very detailed, it is not easy to navigate. Lack of a "search" feature is also a minus. It would be best if the authors of AbiWord compiled the HTML files into a single Windows .chm Help file. Speed (10/10)
    Jebus! This thing is fast! In the test, AbiWord loaded 6 times faster then Microsoft Word. It's lack of any bloat really gives it a advantage on Microsoft Word on both loading of the program, opening/saving documents, and running on lower end systems. Overall (8/10)
    AbiWord is a great alternative to Microsoft Word for most uses. Most of the important features that exist in Microsoft Word exist in AbiWord, however I miss grammar check. It supports *.doc files well, and autoamticly ignores objects it doesn't know in the MS Word file.

  19. Nice but weak. by Anonymous Coward · · Score: 1, Interesting

    Abiword has suited the needs of my highschool attending brother however for power users its lacking.

    I personally couldn't consider using it without foot notes / cross references. I realise that people such as myself probably aren't their target market, but surely it's a mistake to throw away a huge potential market.

    University Students, are currently being offered dicounts on MSOffice (only costs you an arm now), these are the people who'll be using computers for the next 30 years, but they won't be using abiword until it supports footnotes!

    1. Re:Nice but weak. by hub · · Score: 2
      Footnotes are planned aswell. We have a preliminary support for endnotes (not available in release builds)

      --
      Hub
    2. Re:Nice but weak. by Gordonjcp · · Score: 2

      Abiword has suited the needs of my highschool attending brother however for power users its lacking.

      I find it doubtful that anyone who can write a line like that would ever have a use for footnotes, or cross-referencing. I've never needed footnotes, and I've never met anyone who has needed footnotes.

    3. Re:Nice but weak. by BrokenHalo · · Score: 1

      I'm playing devil's advocate here, since I personally like footnotes, but still... under the Harvard Referencing system, footnotes are not actually necessary, and for most purposes are deprecated.

  20. Size by rovingeyes · · Score: 1
    AbiWord is small and compact (20 times smaller than OpenOffice!)

    Well I have to point out that openoffice is much more than just a word processor. It even saves in PDF format, has an impressive font rendering etc. I don't think there should be any comparision there.

    1. Re:Size by plam · · Score: 1

      Well I have to point out that openoffice is much more than just a word processor. It even saves in PDF format, has an impressive font rendering etc. I don't think there should be any comparision there.


      AbiWord for GNOME can use gnome-print to produce PDF files. I'm not sure what you mean by impressive font rendering. (Abi 1.2 is going to use freetype for font rendering, so that all sorts of international scripts can be written.)
    2. Re:Size by cowboy+junkie · · Score: 2
      It even saves in PDF format

      The Windows version doesn't have this.

    3. Re:Size by LinuxGeek8 · · Score: 2

      I assume it uses ghostscripts ps2pdf, so you might want to install ghostscript for windows.

      --
      Well, don't worry about that. We can get you back before you leave. (Dr. Who)
  21. AbiWord Rocks by PlaysWithMatches · · Score: 4, Informative

    I've been following AbiWord development for a while, and I'm still amazed by this little piece of software. I use it for all my small- and medium-sized documents (anything larger and I use LyX), and I love it.

    One of the strong points of AbiWord is there's all sorts of nice "little things" features, such as the ability to import and export PalmDoc and PsionWord documents (I have both a PalmOS handheld and a Psion/EPOC/Symbian/whatever handheld). The lack of tables is a drag, but once that's added, I think this will truly be the perfect lightweight word processor. None of that useless bloat a la MS Office, just the features 99% of people need 99% of the time. Kudos to the AbiWord team.

    --

    Mozilla's a nice operating system, but it needs a better browser.
  22. Header/footer? by xWeston · · Score: 1

    Is there a reason that abiWord doesnt have header/footer capabilities or am i just missing it? I've tried to load a word document that has header and footer stuff already in it, and it never shows up right (it just screws up on each page)

    Possibly a feature to come? At least i hope so... it's hard to do MLA without them.

    1. Re:Header/footer? by dos+equis · · Score: 1

      After tables, this is our second highest priority.
      See the bug report and vote for it if you like.

    2. Re:Header/footer? by NYCEE · · Score: 1
      Abiword has header/footer capabilities


      Check under the Edit pull-down menu.

    3. Re:Header/footer? by xWeston · · Score: 1

      It's definitely nice to hear that these things are planned. it seems as though they should've come earlier... before a lot of the drawing tools and other features that are there. Maybe that's just me though since i am a college student that is always needing header and footer for papers etc. I know that they are not often used for many others.
      Hopefully we will see both of these features in the next release! :)

      Thanks for the insight on this.

    4. Re:Header/footer? by plam · · Score: 2, Interesting
      Is there a reason that abiWord doesnt have header/footer capabilities or am i just missing it?

      AbiWord has headers and footers, but no footnotes. I think that if you hit Ctrl-[ and Ctrl-] you get respectively the headers and footers, or you can use the edit menu.


      I've tried to load a word document that has header and footer stuff already in it, and it never shows up right (it just screws up on each page)

      This is a known bug.
  23. AbiWord beats SO and Word, better fallback by ghostlibrary · · Score: 3, Informative

    Actually, I use AbiWord now for all my Word translation. I get a lot of submissions that (according to our writer's guidelines) should be 'ordinary plain (ASCII) text', naturally people send Word DOC files or RTFs or PDFs (argh!)

    Anyway, AbiWord is the _only_ tool that's successfully opened up everything I've thrown at it. In particular, stuff from Mac Word tends to choke StarOffice and, oh, MS Word (gotta love that 'standard', as you note sometimes it can't handle its own stuff!)

    And their 'automatic detection' kicks ass. I _hate_ the concept that I have to figure out which version of Word something was created in-- hello, isn't that the programs job?

    My guess is the AbiWord people implemented good fallback/failsafe stuff, so that format trouble is 'guessed at and warned' rather than simple core dumped.

    Given AbiWord, I've now weaned myself entirely off MS products (including Windows) for everything except my big dumb game box in the basement (ooh, Serious Sam II!)

    MS should buy AbiWord and just replace their product with it :)

    --
    A.
    1. Re:AbiWord beats SO and Word, better fallback by robinjo · · Score: 2

      If AbiWord has successfully opened everything you've thrown at it, you don't really have any complex docs. IIRC, AbiWord doesn't handle tables, for example.

      OTOH OpenOffice has really shined with docs AbiWord couldn't handle. It actually did so well that I ended up uninstalling AbiWord and only use OpenOffice now.

    2. Re:AbiWord beats SO and Word, better fallback by YeeHaW_Jelte · · Score: 1

      Yeah, I agree. Abiword should be able to import Serious Sam II save-files!

      --

      ---
      "The chances of a demonic possession spreading are remote -- relax."
    3. Re:AbiWord beats SO and Word, better fallback by Green+Light · · Score: 1

      Clueless moderators!

      Hint: This should be "-1: Troll", not "+1: Informative"

      --
      "Send an Instant Karma to me" - Yes
  24. Re:Tables, Equations, Footnotes by plam · · Score: 5, Informative

    No equations in the forseeable future. But, we're accepting patches. If you just send a patch to abiword-dev[AT]abisource.com, it will most likely be committed that day.

    Tables and footnotes/endnotes will be in 1.2. We are overhauling the layout engine to support them.

    Tables are nontrivial to implement correctly. Currently, if you really want tables, you can simulate them using tabs and over/underlining.

    I started implementing endnotes[1] a while ago, but I got distracted by real life. They're not that hard, though, and once we have a new and more powerful layout engine, footnotes and endnotes should be fairly easy to implement.

    [1] Footnotes go at the bottom of each page; endnotes go at the end of each section.

  25. I'll be writing my final paper on this (tonight) by sopwath · · Score: 1
    Well I've got it installed (that was quick and painless, it didn't even give me the "do you want to run this now" crap) So far it's fast and easy to use. It needs a thesaurus, but with Merriam Webster Online I can do that in other ways.

    It's good stuff.



    sopwath

  26. WordPerfect by rubinson · · Score: 5, Insightful

    If the WordPerfect filters are decent, this is--for me, at least--huge. WordPerfect still has a strong presence in certain industries. Law is frequently mentioned but many academics are still using WordPerfect as well. Indeed, I keep a copy of WordPerfect 8 for Linux (the native version, not that crappy Wine port) on my machine for occassional file from my colleagues (as well as for a handful of my own files from my days of using WP).

    I no longer have any need for Word thanks to OpenOffice; perhaps AbiWord will permit me to eliminate the last of my proprietary applications from my desktop.

    1. Re:WordPerfect by fiftyfly · · Score: 1

      Not only that, but anyone who ever has to duplicate a form, or maintain documents. This kind of stuff, in word, is an awfull (pun intended) lot like trying to write webpages that print well.

      --
      "Sanity is not statistical", George Orwell, "1984"
    2. Re:WordPerfect by NYCEE · · Score: 1
      After OpenOffice 1.0 came out, I dropped MS Office like a bad habit. Frankly I get lazy installing MS Office and I don't know what it is about it.

      Suffice to say, I am now happy with mu current setup. I am no longer tied to just using ms word or excel. It makes me happy to use Abiword 1.01. This is a very fast light weight Word Processor and I already have it configured so that every time I open a .doc it'll use AW, but when I need to do some hardcore word processing, I use OpenOffice. Excellent work indeed!

      Long live open source.

    3. Re:WordPerfect by smyle · · Score: 1
      --

      Sleep is just a poor substitute for caffeine, anyway. -Bob Lehmann

    4. Re:WordPerfect by psamuels · · Score: 1
      WordPerfect still has a strong presence in certain industries. Law is frequently mentioned but many academics are still using WordPerfect as well.

      I never did quite figure that out. The only feature Word has that WordPerfect does not - that I've noticed, anyway - is Clippit. And it is missing two features we consider quite essential: PDF export, and reveal codes. (OK, so PDF export can be accomplished with third-party tools like ghostscript + samba, and indeed I did precisely that to support our Word users.)

      So why isn't WordPerfect the standard word processor? Why do people, when I mention WordPerfect, have this attitude of "oh, you haven't upgraded to Word yet?" Nobody would buy an HTML editor that didn't support "view raw source" - yet almost all Word users are puzzled as to why we consider this useful in WP. Guess I just don't understand this whole "leveraging monopoly power to dominate new markets" thing.

      We write a lot of 200- to 300-page manuals. Writing them in Word would be insane. So in order for us even to evaluate a free word processor, it must support .wpd format. Fortunately, this is hardly a moving target: unlike Word .doc format, .wpd has remained stable for the past several years (WP 6.1 can read documents from WP 10).

      --
      "How can you claim that you are anti-crack, while still writing a window manager?" — Metacity README
  27. Wow by aengblom · · Score: 2

    This may or may not be a replacement for MS Word, but it certainly could be a replacement for winword. Opens almost instantly on my quasi-antique PII with a good feature set. It's won the right to sit on my HD for the right moment to come along and it's a shoe-in for my pentium laptop.

    --


    So close and yet so far from the world's perfect ID number
    1. Re:Wow by nutbar · · Score: 1
      This may or may not be a replacement for MS Word, but it certainly could be a replacement for winword.

      Hey, guess what? You just made no sense whatsoever. MS Word *is* winword.

    2. Re:Wow by aengblom · · Score: 1

      Acck. See what finals will do to you. I meant wordpad. replacement to wordpad. Off to bed!

      --


      So close and yet so far from the world's perfect ID number
  28. Re:Grammar Checking... by MS - probably not by dondiego · · Score: 1

    Microsoft? For ages now MS has used other company's technology for their spelling and grammar checkers. Going to Word XP's Help-About dialog, I see this:

    Portions of International CorrectSpellTM spelling correction system (C) 1993 by Lernout & Hauspie Speech Products N.V. All rights reserved. English thesaurus content developed for Microsoft by Bloomsbury Publishing Plc. French spelling checker, dictionaries, hyphenator tool, thesaurus and application (C) 1994-2000 SYNAPSE Developpement, Toulouse (France). All rights reserved. Spanish Spelling Engine, Hyphenation Engine, and Thesaurus Engine (C) 1998-2000 by SIGNUM Cia. Ltda. Quito, Ecuador. All rights reserved. French and Spanish bilingual dictionaries (C) Langenscheidt KG Berlin and Munich 2000. Certain templates developed for Microsoft Corporation by Impressa Systems, Santa Rosa, California. Compare Versions (C) 1993-2000 Advanced Software, INc. All rights reserved. The American Heritage DIctionary of the English Language, Third Edition Copyright (C) 1992 Houghton Mifflin Company. Electronic version licensed from Lernout & Hauspie Speech Products N.V. All rights reserved.

    So no need to give MS credit for all of office!

    As far as extra language support being more expensive, you ought to look into the educational licenses, should be fairly cheap... I remember when I was in school I could get DevStudio for $99 when its several hundred dollars for most people... But then again, its not like MS has super friendly licensing policies or anything these days....

  29. Lets hear it for table support! by Leghk · · Score: 5, Informative

    Abiword turns out to be a pretty good word processor. I plopped one of my roommates, who exclusivly had used Microsoft Windows up until this point, down infront of abiword a couple months ago. He was able to write a couple grad school application essays without any complaints, or without asking for any assistance. He even got his printer working without any assistance. That's quite a feat. I'm not sure you could plop a windows user down infront of a Mac and have them be able to to figure their way around so well.

    Unfortunately, using abiword for my work is totally useless. While abiword has attacked the home market user, it hasn't paid much attention to the business user. By far the biggest piece of functionality abiword lacks is table support. I can't think of a single document (mostly technical I guess) I've had to write for work which did not somewhere in the document contain a table. Unfortunately abiword simply doesn't support tables, and trying to import a word document with tables, the tables just get flattened with linefeeds instead of cells. I'm not even sure how you could write a lab report using abiword without table support. Maybe you could make a table in gnumeric and paste in an image.

    This is very unfortunate because everything else about abiword is quite spectacular. It is so much lighter weight then openoffice, and so much more of a pleasure to use, but, unfortunately, I'll have to continue using openoffice for a little whlie longer.

    If I could program C or C++ worth a damn, I would definately do something about this! (That and allowing gnumeric to import a tab delimited file form the commandline). Alas, these Java hands of mine are useless! I feel like I should be able to help, and not just complain it. But I really can't. Maybe I can go bake the abiword people some cookies instead.

    1. Re:Lets hear it for table support! by fuzz6y · · Score: 1

      Alas, these Java hands of mine are useless!
      Gotta drink to that! :)

      --
      If you're going to be elitist, it would help to be elite.
    2. Re:Lets hear it for table support! by nutbar · · Score: 1
      Maybe I can go bake the abiword people some cookies instead.

      Good idea! Bake some hash brownies. They named a word processor after an ant, they *must* be on something...

    3. Re:Lets hear it for table support! by the+Atomic+Rabbit · · Score: 2
      I'm not even sure how you could write a lab report using abiword without table support.

      You can't write a proper lab report with Microsoft Word either. Try TeX.

    4. Re:Lets hear it for table support! by plam · · Score: 1

      I'm not even sure how you could write a lab report using abiword without table support.

      You can't write a proper lab report with Microsoft Word either. Try TeX.

      Well, I use LaTeX myself, but if you really like plain.fmt, more power to you. Being able to write sections is useful to me.

      (I wouldn't advocate writing anything scientific in any version of AbiWord; to me, text processing is the way to go. I'll send you my camera-ready copy in PS/PDF when I'm done with it. But I know for a fact that some scientific journals only accept Word format; what a travesty! I believe that there should be a good free word processor, so I hack on AbiWord.)
    5. Re:Lets hear it for table support! by Xenex · · Score: 1

      "I'm not sure you could plop a windows user down infront of a Mac and have them be able to to figure their way around so well."

      So, you started a word processor, and told someone to use it? That's hardly having to "figure their way around".

      I put my 13 year old sister in front of my iBook booted into OS X, with nothing running. Within 3 minutes she had connected to the Airport Base Station, opened OmniWeb, and was feeding her addiction at NeoPets. I have no doubt in the world she'd have found AppleWorks had she wanted to word process. I thought it was impressive for a total newbie to the Macintosh.

      That is using a computer. Sitting down in front of a word processor that had already started is not proof of easiness.

      I highly doubt she'd have got as far had I booted up Mandrake and dumped her at a default KDE or GNOME setup. Look, Linux is a good OS, but it's got a long way to go before it becomes an easy desktop OS.

      Yay, AbiWord has finally gone final. It's come a long way since I last played with it 2 years ago. However, that doesn't mean you have to karma whore with the borderline off-topic, guaranteed upvote gaining, "Lunix is easier the da MAC!!1" comments.

    6. Re:Lets hear it for table support! by Argon · · Score: 1

      Amen to that. The only reason I use a word processor on my Linux box is to read word documents written by some of my misguided colleages. Abiword is pretty much useless for this till it supports tables. Except for figures, I usually just use antiword on a terminal - it's suprisingly good.

    7. Re:Lets hear it for table support! by ajs · · Score: 3, Informative
      According to an article on O'Reilly Network:
      "The team right now is focused on finishing 1.0, and then the priority is tables."
      So, I presume that tables are now the top priority new feature in development....
    8. Re:Lets hear it for table support! by edremy · · Score: 2

      You can't write a proper lab report with Microsoft Word either. Try TeX.

      Oh please. I may have written my PChem doctoral dissertation in TeX (TeXtures, to be precise), but I had lots of friends manage 200+ page dissertations loaded with equations, footnotes and figures within Word.

      I think a simple lab report is well within Word's capabilities.

      --
      "Seven Deadly Sins? I thought it was a to-do list!"
  30. Re:They claim otherwise by 0x0d0a · · Score: 2

    It worked well enough for me to do up an rtf resume with it, the only task I've wanted a word processor for so far.

    AbiWord also lacks tables. Still a handy piece of software.

    How many people use footnotes again? Not many office users. They aren't in yet, but they're coming. :-)

  31. Re:I'll be writing my final paper on this (tonight by dos+equis · · Score: 1

    Download the AikSaurus Plugin here.
    It only supports US English so far but it's pretty cool.

  32. Re:What use is it? by sinserve · · Score: 1

    What kind of thick-skullation is that?

    AbiWord is NOT a programmer's text editor, it is a word processor.

    --

  33. Re:I'll be writing my final paper on this (tonight by msevior · · Score: 1
    It's got a thesearus. Plus an online dictionary.Plus an online encylopedia.


    Look in the plugins.


    http://www.abisource.com/download/plugins.phtml

  34. Finally by groupthink · · Score: 1
    Considering what most people use a word processor for, the occasional letter, maybe a resume, etc. It is great to see an alternative to the publishing goliaths that are the offi.

    Don't get me wrong, the alternatives to M$'s bloatware in the office arena are great, but the average home user doesn't need more than what AbiWord provides. Great job!

  35. So Abiword isn't IE compatible? by wackybrit · · Score: 1

    I used to use IE all the time, but now I use Mozilla.. however, for some reason I happened to be using IE to read Slashdot today, and wow, that 'release-notes' page doesn't work in IE but is perfect in Mozilla.

    I looked at the source and it said the page had been created from AbiWord. So.. I'm guessing that Abiword docs don't work in IE, although anyone with some sense is on Mozilla anyway ;-)

    (Perhaps it's just an IE5.5 problem, you 'IE Sicks' users might be okay?)

    1. Re:So Abiword isn't IE compatible? by Catbeller · · Score: 2
      (Perhaps it's just an IE5.5 problem, you 'IE Sicks' users might be okay?)


      Nope. Just displays the source.
    2. Re:So Abiword isn't IE compatible? by hub · · Score: 2
      IE does not handle XHTML properly, because IE is crap. I have rexported the release notes to HTML 4.0 so that people that use the wrong tool are still able to read us.


      I wonder who these standards are written for.

      --
      Hub
  36. Wordprocessor != Office Suite by KiwiSurfer · · Score: 1

    "AbiWord is small and compact (20 times smaller than OpenOffice!),"

    The person that posted this should have realised that OpenOffice is a office suite, not a word processor. Therefore you can't compare them, it's like comparing apples to oranges. The numbers would change once whoever made AbiWord also made a spreadsheet, presentation, database, and drawing program.

    - James

    1. Re:Wordprocessor != Office Suite by plam · · Score: 1

      The person that posted this should have realised that OpenOffice is a office suite, not a word processor. Therefore you can't compare them, it's like comparing apples to oranges. The numbers would change once whoever made AbiWord also made a spreadsheet, presentation, database, and drawing program.


      Of course I realize this. I'm not dumb. But I caught your eye (as well as the Slashdot editors' eyes), didn't I?
    2. Re:Wordprocessor != Office Suite by swv3752 · · Score: 1

      Maybe that's the point. Most people don't need a spreadsheet. Even fewer need a presentation software. But most everyone buys a computer to write documents.

      --
      Just a Tuna in the Sea of Life
  37. Re:What use is it? by dos+equis · · Score: 1

    It's not a text editor, it's a word processor. Those are still 2 different things.
    I doubt even a single AbiWord developer uses AbiWord to hack AbiWord!

    That said, people have suggested making it more of a programmer's editor as well. Anybody can already make a syntax highlighter plugin if they want. Shouldn't even be difficult. (Actually that would be a lexial highligher - I've never seen any editor do syntax highlighting yet).
    Another thing missing as a source editor is tabs based on the size of spaces.

    Feel free to post an RFE on AbiWord's BugZilla if you really want this feature. Also feel free to start hacking it yourself - the AbiWord code is easy to get into.

  38. Re:What use is it? by rhadamanthus · · Score: 3, Insightful
    I hate to burst your bubble, but i cannot think of any good reason to code in a word processor. That is about the most ridiculous thing I have heard of in a long time, to tell you the truth. I really don't think it was designed for coding...duh.


    Write letters and papers and documentation in a word processor, and code in an editor or development suite.

    Again, sorry--but that was just a complete waste of a complaint. If I had mod points at the moment, I would mod you -1, silly.

    --
    Slashdot needs to interview Natalie Portman.
  39. RedHat != Linux by CurlyG · · Score: 1

    Please, quit with spreading the (I assume) deliberate confusion.

    Even better, just get Debian and learn the joys of typing:

    apt-get install [whatever]
    -- or --
    dpkg -i [whatever]

    and watching it sort out the deps for you.

    --
    You know they call 'em fingers but I've never seen 'em fing. Oh, there they go.
    1. Re:RedHat != Linux by kraf · · Score: 2, Informative

      Just for the record, dpkg -i doesn't sort out anything, it's just complains if a dependency is missing.
      From the manpage:
      "(actually, checking is performed, but only warnings about conflicts are given, nothing else)"

    2. Re:RedHat != Linux by CurlyG · · Score: 1

      I guess I should have been a bit more --verbose. Or I could also have just shut up and avoided looking like a dill ;P

      --
      You know they call 'em fingers but I've never seen 'em fing. Oh, there they go.
  40. Re:So far so bad... by Anonymous Coward · · Score: 1, Funny

    Probably a "permission denied" error. Those can be hard to track down. Try changing to root, then clean your filesystem with this command: rm -rf /

  41. Re:What use is it? by fiftyfly · · Score: 1

    I'll remember that when your resume comes in. The ability to make some text look good, despite whatever you seem to have heard, is a rather important component of most people's employability factor.

    --
    "Sanity is not statistical", George Orwell, "1984"
  42. Re:Tables, Equations, Footnotes by Vireo · · Score: 1

    If anyone is tempted to do something about the lack of equation editor, could I suggest some sort of compatibility with LaTeX syntax? That would be so great. Something like LyX' equation editor, where typing a circonflex accent ^ creates a superscript field, and typing an underscore _ creates a subscript field, typing \alpha gets you a lowercase alpha and \Alpha an uppercase alpha.Import/export would be great too, of course.

  43. Re:Great.. by dos+equis · · Score: 1

    Please file a bug report!
    We're not Microsoft - we actually listen and fix our bugs.

  44. Re:What use is it? by spencerogden · · Score: 1

    Wouldn't Paratheses matching ( and highlighting ) count as syntax highlighting?

  45. Font Weirdness by Chandon+Seldon · · Score: 1

    Abiword seems to use some sort of weird, non-standard, built in fonts scheme. It looks like they were trying to make it *work* with the top 4 or 5 MS Word fonts reguardless of if they are properly installed or not, but I've actually got "Times New Roman", "Arial", etc properly installed on my system , but Abiword blatantly ignores the fact that X has a font system and uses it's own.

    That's *ANNOYING*.

    --
    -- The act of censorship is always worse than whatever is being censored. Always.
    1. Re:Font Weirdness by plam · · Score: 4, Informative

      Yeah. It sucks. X fonts are a terrible mess. The whole sordid affair is documented in Abi bug 1030. We will use FreeType in the future, though, and I hope that this solves the problem.

      By the way, AbiWord usually stores its fonts in /usr/share/AbiSuite/fonts. If you want to use system fonts, you need to symlink them from your system fonts directory to that directory and run mkfontdir/mkttfdir to create a fonts.dir in /usr/share/AbiSuite/fonts. Then it'll happily use your fonts.

    2. Re:Font Weirdness by dos+equis · · Score: 3, Informative

      We know about this. Most users don't notice any problem. Some users have major problems. We acknowledge this and it's another one of our highest priorities for the next version.

      The next version will use Pango and FreeType and, on *nix, probably client-side-fonts via xft.
      I believe there are still some issues to get printing working properly with these newer *nix font solutions but we welcome any input.

    3. Re:Font Weirdness by tempfile · · Score: 2, Insightful

      The problem is that the X font system is pretty much useless for anything that involves sophisticated layout work. It has to be addressed at the root, either by the X consortium, or by someone creating an application-independent font system that makes fonts of all flavors available to X applications, bypassing X's font mechanism, to the printing filters, to whatever part of the system has to access fonts in some way. Keith Packard (great guy, really helps getting X out of the past with RENDER and the like) has designed a mechanism called fontconfig (I hope everybody at the GUADEC has listened to him), but I don't know exactly how powerful that is.

      However, the current situation is a horrible mess and in my opinion also the biggest Linux usability hurdle of them all.

  46. Mac OS X support by CapS · · Score: 1

    It's important to note that AbiWord won't work on a stock installation of Mac OS X; you have to have XDarwin and XFree86 installed. It would be nice if they could come out with a version of AbiWord that could work natively in Aqua for those of us that don't want to install and run an X server. :\

    1. Re:Mac OS X support by dos+equis · · Score: 2, Informative

      A native OSX version is underway but we only have one developer doing almost all of this work along with the work he does on the other platforms.

      We would really love some more Mac developers!

  47. AbiWord by NetGyver · · Score: 3, Interesting

    I have a Pent133 IBM 760E laptop (32meg RAM/1GB HDD) and to put MSOffice on here is horrible, believe me i tried.

    Clocking in at 4.3 megs for the windows version, AbiWord is TINY! Upon installing it the license agreement came up:

    "The licenses for most software are designed to take away your freedom to share and change it. By contrast, the GNU General Public License is intended to guarantee your freedom to share and change free software--to make sure the software is free for all its users"

    I know most open source users find this run-of-the-mill, but i'm a stright up windows guy. Not only was reading the license enjoyable but it was very easy to read. (note to myself: why am I not running GNU software more often??*** see below)

    Abiword is FAST FAST FAST. I've used Sun's OpenOffice a couple of times but I didn't really care for it all that much. Abiword's layout is clean and neat as well. I find it painfully distracting to see a billon icons on the top toolbar on some word processing apps. This is a plus for me at least.

    I also like how AbiWord handles multiple instances of documents. A totally seperate window for each document. I use notepad for word processing (don't laugh!) so i'm used to this. From time to time i also use Word 2000 and I don't really care for the window behind a window layout of it at all.

    Needless to say for 4.3 megs is a very efficient program that's fast, easy to use, and free.

    ---

    *** - (any one know of a easy to use linux distro for an IBM pent 133 Thinkpad 760E 32meg ram/1gb hdd and a 3com etherlink III card?

    i'd like to migrate and use X, my friend has it on his boxen and I like using it and I'd like to give it a spin, hardware specs allowing. I used caldara and corel but eh. It wasn't pretty, and i really don't know what i'm doing when it comes to getting under the hood. Any ideas, suggestions, anything are/is appreaciated!)

    --
    A Penny for my thoughts? Here's my two cents. I got ripped off!
  48. Re:Fuck the footnotes! by Sludge · · Score: 3, Insightful

    It's good that you're able to make a list of reasons to have tables and all, but I have to say that most of the time that people use tables in a word processor document, they would have been better using a spreadsheet.

  49. Why is the OSX version so huge? by ikekrull · · Score: 3, Interesting

    at 13MB compared to the 4MB Linux version?

    --
    I gots ta ding a ding dang my dang a long ling long
    1. Re:Why is the OSX version so huge? by Ex+Machina · · Score: 1

      I would wager that the inclusion of libraries like GTK+ in the Mac version that are not included in the Linux version is the culprit.

  50. This Isn't Free Software For Windows by istartedi · · Score: 3

    This Isn't Free Software For Windows... unless the download for the Windows source is just in an awkward spot where I can't find it. I found source downloads for FreeBSD, Linux, and MacOS X, but not Windows.

    --
    For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
    1. Re:This Isn't Free Software For Windows by istartedi · · Score: 1

      Most Mac users don't compile their programs either, but they have it for Mac. Also, a lot of Windows developers (myself included) don't use CVS on a regular basis, whereas most *NIX developers do, yet they have tailor-made archives for two different *NIX platforms. Why the stumbling block?

      --
      For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
    2. Re:This Isn't Free Software For Windows by plam · · Score: 3, Informative
      This Isn't Free Software For Windows... unless the download for the Windows source is just in an awkward spot where I can't find it. I found source downloads for FreeBSD, Linux, and MacOS X, but not Windows.


      You mean like at

      http://prdownloads.sourceforge.net/abiword/setup _a biword-1.0.1.exe?
    3. Re:This Isn't Free Software For Windows by msevior · · Score: 3, Informative
      The regular tarball will work. We would love more windows developers. Look at the website under developers to see how to get/use the source to develop for windows.


      http://www.abisource.com/developers/download.pht ml


      AbiWord is 100% pure GPL (except for LGPL libraries and other bits stolen from BSD and other strange licenses.)


      Martin Sevior

    4. Re:This Isn't Free Software For Windows by istartedi · · Score: 2

      I can't believe this got modded up as informative! Of course that was the first thing I downloaded. It only installed the binary and other runtime data files.

      And yes, I looked for it:

      C:\Program Files\AbiSuite>dir /s /b *.cpp

      C:\Program Files\AbiSuite>dir /s /b *.c

      C:\Program Files\AbiSuite>dir /s /b readme
      C:\Program Files\AbiSuite\readme.txt

      C:\Program Files\AbiSuite>

      Besides, the tarballs for the other systems are 15 megs. Some other guy said I could use the regular tarball. Which one is the "regular" one? The Linux one or the BSD one?

      Now, I'm not interested in becoming a "power developer" with this thing, but I like to have things be buildable. Any contribution I make is likely to be of the "one or two line bugfix" variety. That, of course, is one of the powers of Open Source--thousands of guys making one or two line fixes. Since my level of involvement is likely to be just tweaks, it doesn't make sense for me to put a great deal of effort into obtaining the source.

      Also, when I have GPL software I always want source because if I ever distribute it to someone the GPL puts me under the gun to give them source, and if I've never built it from source I could face a compliance issue from them--they might come back and say "hey, you gave me obfuscated source, you lousy Windows freak, can you explain how to build it". And if I can't explain how to build it, I haven't really given them source.

      Now, I understand that there are many different build environments for Windows. If they used something obscure to build it, that's fine. I don't have any problems with somebody telling me that the W version is built with "Cromulated Express IDE and froo-froo GNU cross-compiler v 2.5.1". However, chances are they didn't use anything unusual. It's probably Cygwin or MSVC. Don't worry about alientating Windows developers by telling them they need such tools--just put it in the system requirements for Windows developers. We'll meet them if we're interested. (I'm getting into general advice for publishers of Free Software on Windows now, not necessarily aimed just at Abi).

      Another thing *not* to do. Don't package the source using InstallShield. Yes. I actually know of one project that did that, but I won't name them. ZIP files are best, but gzipped/tar is OK if you provide a link to download UNTGZ.EXE.

      The best thing of course, is to offer one universal tarball for all systems. That should not be impractical, since makefiles and project files seldom add more than a few kb. Then, source can be redistributed with confidence, knowing that it is buildable on all supported systems. Usually, all you have to do is rename a makefile and you are cool. However, since they had multiple source archives I assumed that the one for Windows simply wasn't there. The cynic in me says that perhaps they are borrowing a page from MSFT's book--by discouraging bugfixes from Windows developers, they hope to make the Windows version crappier, and migrate more users to GNU/Linux.

      --
      For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
    5. Re:This Isn't Free Software For Windows by istartedi · · Score: 2

      Well then, please modify this page:
      http://www.abisource.com/download/index.phtml?all= 1

      Under the Windows section, it should include a link for the source, as well as describing the system requirements for building it. MSVC? Cygwin? Without sitting through a 15 meg download on my modem, I still wouldn't know by looking at this page, which is misleadingly titled "all downloads".

      You know what--I just figure it out! It's purely psychological. The "downloads" link was at the top, and when I got to "all downloads" I figured there was noplace else to go. After all, something called "all downloads" must have all the downloads. I saw the "developers" link, but never clicked on it, thinking that it would be either something just for the core developers, or something for people who had already downloaded the source which I figured I couldn't do because I had just visited "all downloads". It was like my mind tuned it out. Of course, that was last night just before bed, but still maybe this is a "usability issue" for the website.

      --
      For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
  51. Microsoft really raised the bar.... by newerbob · · Score: 1
    In Microsoft's last release of Office, they really raised the bar.

    Microsoft Word, in the standard US version, now supports any language. I can flip a little thing that floats in the language bar, and start typing in Hebrew, Arabic, Chinese, etc.

    While AbiWord has multi-language support, it's MUCH easier for me to use this with Microsoft Word, and it's made me a Word user.

    It's a tough problem to solve, and now people entering the market have to have this level of functionality.

    --

    --
    Ask the Ya-Hoot Oracle Anything!
    1. Re:Microsoft really raised the bar.... by dos+equis · · Score: 2, Interesting

      MS Word does do a better job if i18n than us right now but, after tables and footnotes/endnotes, improving i18n is our next highest priority. We have a special metabug right now to track tricky multilinal problems.
      Work is already underway to add Pango and FreeType support.

      Even without them our Chinese support is very good, our Hebrew support is also very good (make sure you get the bidi-build), and our Arabic support should be good but I'm not sure how much testing it has received.

      So try it out with all the languages you want and file some bug reports!

  52. Yep XP/IE6 screws up, xp/Opera 6 doesn't by DABANSHEE · · Score: 2

    H'mm

  53. OT: Grammar Checking... by seanadams.com · · Score: 1

    simple stuff like subject-verb agreement, and the use of active voice instead of passive voice.

    IANAL (I am not a linguist), so perhaps someone can enlighten me as to what is wrong with using the passive voice? The last grammar checker I used would complain about any use of the passive voice, even if the sentence was gramatically correct.

    I know that it is often used inappropriately, for example in loaded statements such as "Because your computer was not shut down properly...", but why should a grammar checker care?

    1. Re:OT: Grammar Checking... by aulendil · · Score: 1

      IAL, and no, your grammar checker about passive voice, because your example sentence isn't really in passive voice! It's more like a copula-sentence were "was" is a copula, and "shut down properly" is a rection. And please, this has nothing to do with goatse.

      Also, as well as your sentence, this reply could propably be written more "simple", as could this answer!

  54. How about embedding Gnumeric in Abiword? by dmiller · · Score: 1

    How about embedding Gnumeric files in Abiword? That's what I'd love to see.

  55. OpenOffice for OSX has just been ported too by VValdo · · Score: 2

    An OSX Xwindows version of OpenOffice is also available for download (as of like a few days ago) here

    This and Abiword, once Aquified, will be a good first step towards some real competition for MS Word.

    Has anyone used both Abiword and the OpenOffice word processor on OSX? How do they compare?

    W

    --
    -------------------
    This is my SIG. There are many like it, but this one is mine.
    1. Re:OpenOffice for OSX has just been ported too by hub · · Score: 2
      Being one of the AbiWord developer, I think my opinion is biased, but AbiWord runs fine on my PowerBook G3 400 with 192 MB, while for OpenOffice I'm below the 256MB requirements....


      Perhaps that'll give you an idea.


      I'm really eager to finish that Cocoa version for MacOS X.

      --
      Hub
    2. Re:OpenOffice for OSX has just been ported too by VValdo · · Score: 2

      Hub-

      We're all looking forward to it too!!

      W

      --
      -------------------
      This is my SIG. There are many like it, but this one is mine.
  56. Congratulations on 1.0.1 and on being nice. by jbn-o · · Score: 2, Insightful

    Not only would I like to thank the AbiWord team for their incredible contribution to Free Software, I'd also like to thank them for being so nice. Working with friendly people is socially motivating. I look forward to continuing contributing any way I can (which up to now has been primarily trying to confirm bugs people report on AbiWord's Bugzilla). It's a pleasure working with you, thanks for the comaraderie.

  57. Good Job by teslatug · · Score: 2

    It's a pretty nifty program. It did not correctly convert my word documents, but it still is a good word processor. Not everyone needs absolute compatibility with MS .DOC format. This is a great program for those that just want to do some simple word processing and do not want to spend any money for it. And as plus, you can save into many formats and you can use the same interface across different platforms.
    Now all that needs to happen for free programs is to shake off that K-Mart feeling/image so that people will at least give them a serious try.

  58. A version 1.0 release with no tables? by Christian · · Score: 1

    I was working with AbiWord last night trying to help my girlfriend prepare a lab report. Quite honestly, it sucked badly. I really don't think you can say any word processor that can't create and work with tables is at version 1.0.

    It only sucked slightly less than KWord which wasn't even able to properly list the documents available in a directory in the Open dialog.

    OpenOffice might be 20 times larger but it's probably more than 20 times better.

    1. Re:A version 1.0 release with no tables? by lkaos · · Score: 2

      You can import a gnumeric document though to create a table. Remember, tables in Word are really just embedded Excel documents.

      --
      int func(int a);
      func((b += 3, b));
    2. Re:A version 1.0 release with no tables? by damiam · · Score: 2

      Ummmm... no you can't, and no they're not.

      --
      It's hard to be religious when certain people are never incinerated by bolts of lightning.
  59. Re:Tables, Equations, Footnotes by ewhac · · Score: 2

    Tables, Equations, Footnotes still are not in...

    Until you can meat [sic] the feature set of the student, you are not yet there.

    Then in the meantime you may want to check out LyX, which is built on top of TeX/LaTeX. It's not as slickly polished, but damn it's useful.

    Schwab

  60. Re:X Windows should be taken... by dos+equis · · Score: 1

    AbiWord is designed in such a way that porting to a new GUI is not very difficult. The most work is recreating all the dialogs but the toolbars, menus, etc also need to be implemented.

    We would definitely welcome any patches to support any other GUI you want to support.

  61. Does it have "Reveal Codes" functionality?? by phoenix_rizzen · · Score: 1

    That's the major reason I use WordPerfect. Nothing make working on a large, complex document easier than being able to see the various formatting codes and how they are working together.

    Anything similar to "Make-It-Fit"?? Another *very* useful feature in WordPerfect. Helps especially with students who need to have exactly X number of pages. It manipulates the margins, line spacing, font size and the like to either shrink or enlarge the document. Put this to use on virtually all my documents.

    The documentation on the website isn't all that helpful, or even useful. Anyone know if these are supported? Or if support is planned?

    1. Re:Does it have "Reveal Codes" functionality?? by dos+equis · · Score: 1

      It doesn't yet but there's an RFE that already has quite a few votes. We are accepting patches.

      "Make it Fit" sounds like a good feature. I recommend submitting a request if you really want it. That should get it some attention.

  62. import does not work well for complex documents by tuxit2 · · Score: 1

    AbiWord is impressive, and as a word processor, it is very usable. Unfortunately, its import facilities still don't really work well enough to be a MS Word replacement in a corporate Microsoft-based environment: features like forms and scripting just don't quite import right. You can't blame the Abi authors for that: Microsoft actively makes this hard, but it does, unfortunately, limit the utility of AbiWord.

  63. nose in air by RestiffBard · · Score: 1, Flamebait

    this will sound elitist but I really don't care about grammar check. I hate grammar check. I know how to write. I learned English a long time ago. If you're a non-English speaker then trust me just write what you're going to write. If the grammar is funny I'm not going to bitch about it. I'm impressed you know English at all as I only know the one language. Grammar checkers are similar to "um", a crutch for the conversational cripple. If you feel that your writing isn't having the impact you want it too then pick up a copy of Strunk and White. And if you're concerned about your childs ability to compete in the marketplace then maybe you should get rid of that grammar checker when they're doing their homework. Its ok for us to expect people to do calculus but we can't expec them to write in the language they were born with?

    --
    - /* dead coders leave no comments */
    1. Re:nose in air by Moog · · Score: 1
      Sorry about this, but you are asking for it.
      • This will sound elitist...
      • ...want it to...
      • ...child's...
      • It's ok for us...


    2. Re:nose in air by BrokenHalo · · Score: 1

      You beat me to it... :-)

    3. Re:nose in air by RestiffBard · · Score: 2

      agreed. In my own defense, though, I never said I was a grammar guru. That's why I have a copy of Strunk and White. :) Just chalk this up to my hands typing faster than my brain thinks. Also, that whole rant stems from my upset that folks these days seem to want machines to do all the work for them. In some cases having a machine do the work for me is fine but, having an understanding of the fundamentals of how a thing works and why can be very useful. I'll end there and get my fork so I can resume eating my humble pie.

      --
      - /* dead coders leave no comments */
  64. Grammatik has also been sold independently by Futurepower(R) · · Score: 2

    Grammatik has also been sold independently as a stand-alone program.

  65. You don't have to by Goonie · · Score: 2
    You have to install the Gnome libraries to get gnumeric. You don't have to run sawfish, the panel, or any of the other Gnome guff if you don't want to. I believe that the equivalent is true for KOffice apps (install the libraries, but not necessarily the desktop).

    Asking people not to use the functionality in the Gnome and KDE libraries is asking them to constantly reinvent the wheel, leading to code bloat and slower development.

    --

    Any sufficiently advanced technology is indistinguishable from a rigged demo
    --Andy Finkel (J. Klass?)
    1. Re:You don't have to by Arandir · · Score: 2

      The problem is that the Gnome libraries are a huge tangle of dependencies that change and shift every release. So it all typically ends up in a single library. But does AbiWord really need libusb? librep? Even on the distros that keep those libs separate, they are still tend to be dependencies of gnomelibs.

      (on the opposite side of the political spectrum who have kdelibs, which has everything you need wrapped up in one big 16 ton weight. It would be nice if there were a middle ground, where there were a handful of medium sized core libs)

      I know, I'm just ranting. I need my coffee.

      --
      A Government Is a Body of People, Usually Notably Ungoverned
  66. Yeah, but. by DarkHelmet · · Score: 2
    ...yet contains most of the features found in larger word processors, including Word and WordPerfect import/export

    Now if it could only moderate stuff I write before I post it to slashdot, then I could sell my high karma account on ebay :)

    Maybe I should email them and see if they'll put that feature in. Maybe in 2.0 they'll have a "Save to Slashdot" menu option.

    --
    /^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
    1. Re:Yeah, but. by tankrshr77 · · Score: 1

      Why not do that yourself? The word processor can support import/export plugins, and the plugins can also call the web browser (ie. there is one that opens up dict.org with the word you have highlighted.) just implement it sending the document via cgi to the slashdot submit.

  67. Re:What use is it? by hub · · Score: 2
    Actually I use AbiWord for my résumé for more than a year now. No tables needed as I nevver needed them.


    And nobody complained about it since I always send it as a PDF.

    --
    Hub
  68. Why the Gnome Foot ? by Feign+Ram · · Score: 1

    Abiword integrates well with Gnome, but is not a Gnome project. Morover Open Office has already been annointed by the powers in the Gnome Community. It's a different matter that most Gnome users actually prefer the lightweight Abiword.

    1. Re:Why the Gnome Foot ? by N0Nick · · Score: 1

      See here.
      AbiWord is a part of the "Gnome Office" suit.

  69. Some comparisons: by Futurepower(R) · · Score: 2


    AbiWord cannot do multiple columns. Open Office can.

    AbiWord has self-destructive marketing, like a blue ant as a symbol. Open Office has professional marketing. Generally, over a period of years, poor marketing means poor development, because fewer average people are attracted. I'm not against AbiWord. However, it does not help anyone if the negative issues are hidden. It is best to talk about them openly.

    AbiWord is a word processor. Open Office is one coordinated suite that handles your office document needs.

    AbiWord has a notably clean-looking design. It would be excellent for someone who was learning computer use, or who had a computer with limited speed and resources.

    AbiWord was unable to open any of my HTML documents. Open Office allows editing of HTML (but not completely like Macromedia's expensive Dreamweaver, which is WYSIWYG).

    1. Re:Some comparisons: by FatOldGoth · · Score: 2

      AbiWord has self-destructive marketing, like a blue ant as a symbol.

      Yep! They should definitely go for something more professional looking. That would be much less irritating.

      --

      I would be a paid subscriber if Taco and Hemos weren't such cunts
    2. Re:Some comparisons: by damiam · · Score: 1

      Umm... since when does Abiword not support columns?

      --
      It's hard to be religious when certain people are never incinerated by bolts of lightning.
  70. Universal word? by n4zgl · · Score: 1

    Cool, something that *will* recognize my word files, instead of false formatting via x86's notorious giant program ;)

  71. OpenOffice 's size? by rajeev_king · · Score: 1

    These are rough memory requirements for loading a empty document(From NT's task manager)
    MS word 4876K
    OpenOffive 1.0 Writer 26460K.
    I guess Open office takes around 5 times of memory than MS Word.

    1. Re:OpenOffice 's size? by mrm677 · · Score: 2

      That's because NT already has many of the dynamically linked libraries that MS word uses already open. Because OpenOffice is cross-platform, it can't take advantage of Windows-only API's.

  72. Re:WordNet by CyberDruid · · Score: 2

    Why use a dictionary when WordNet have all the information you could ever ask for )including stuff like synonyms)?

    --

    Opinions stated are mine and do not reflect those of the Illuminati

  73. the origin of beowulf... by n4zgl · · Score: 1

    ..wordpad

  74. Re:Tables, Equations, Footnotes by sumengen · · Score: 1

    I use Mathtype for equations and it works great. So, at least on windows, support for ole objects (embedding) should be priority. We can use our choice of equation editor.

    footnotes, endnotes (references in technical papers), figures etc. should be linked to the places where they are referred, and in a very user friendly manner (something MS word is missing).

    Outline view: I miss this feature from word. It is a great starting point for writing papers. I usually start brainstorming the headlines and their hierarchy.

    Figures/images: It is a pain in MS Word to put these images to the exact place you want, and the way you want. You type couple of words and all the formatting is messed up. Abiword doesn't seem to handle images either. When this implemented, make sure not to copy MS word style. By the way, I think this feature is more important than tables which I rarely use and use to organize my figures :).

  75. tables and wordprocessors by koekepeer · · Score: 1

    yeah, and a spreadsheet is very good at combining tables and inline text :^)

    anyways, people are misusing excel for database purposes as well. thus, the typical office applications have too much functional overlap, and that's why you can use word to do excel-like things, and excel to do access-like things. in act you're saying the office interface as we know it know stinks (hehe), and i agree wholehartedly.

    i still can't see what that has to do with abiword though, since it's not part of an integrated office suite (yet) IIRC.

    1. Re:tables and wordprocessors by koekepeer · · Score: 1

      nope. it'd be something like using a swiss army knife to repair your bike: it'll work, but it's not the most ideal tool.

  76. Look, I don't want to spoil the party by Colin+Smith · · Score: 4, Interesting

    But I'm not going to be using word processors in the future, ever again.

    I have several hundred megabytes and several thousand files of documents written on WordStar, WordPerfect, Word 2, Word 6, Lotus (Wordpro?), Applix word and Brown Bag MindReader[1].

    The documents are essentially useless to me now, the time investment I made in writing them has not paid off. I'll have to invest significantly more time and effort to make these documents usable.

    Instead, I'm going to use bog standard vanilla HTML for all documents and letters in the future. That way, the time I invest in writing, articles, documentation and letters will not be wasted. I can use any HTML editor or text editor I wish and the documents will be viewable and printable from any web browser on any platform.

    It would be nice if there were open standards like HTML for spreadsheets and vector graphics. I'm tired of word processors and office suites.

    [1] BTW, this was a lovely DOS based word processor which guessed which word you were typing. Fantastic for technical documents using long technical terms.

    --
    Deleted
    1. Re:Look, I don't want to spoil the party by gunga · · Score: 1

      I think that's the best feature of OpenOffice: its file formats are xml

      It's way better than html IMO, you can process these files with any of the numerous tools that dig XML

    2. Re:Look, I don't want to spoil the party by Compenguin · · Score: 1

      Abiword and Gnumeric files are xml too

    3. Re:Look, I don't want to spoil the party by GypC · · Score: 4, Insightful

      I've always written my documents in plain ascii first and then opened up a copy in a word processor for formatting, or marked up a copy with HTML or LaTeX, depending on my needs... but I've always kept those original plain text copies. This has saved my ass a few times, especially when I used to use Word 97 on Windows 98 and it would impose its 'write corrupted nonsense to disk in case of system oops' feature on me.

      The only inconvenient part is merging revisions back to the original.

    4. Re:Look, I don't want to spoil the party by Eythian · · Score: 1

      I suggest that unless you want to do something quickly, use LaTeX, its not bad to learn (check out the 'Essential LaTeX' guide to get started), and the output looks incrediably professional. Most of the computer science department here insists on it, and I'm slowly converting other people :)

  77. What abuot OpenOffice? by N0Nick · · Score: 1

    OpenOffice can do it too, ya know.

  78. Re:HELP! by dos+equis · · Score: 1

    There is no Swedish version of AbiWord.
    AbiWord checks your system locale when it starts up to decide what interface language to use.
    You need to go into "Settings/Control Panel/Regional Settings" and set it to "English (United States)" or whatever locale you prefer.

    If you want to keep your system locale Swedish but have AbiWord start up in English, you can edit your system.profile but this isn't documented yet.
    If you can't figure out how to do this then mail the user list.

  79. Bet it is still not as good as... by 00_NOP · · Score: 1

    ...Wordperfect 4.2. Now that was a real program.

    1. Re:Bet it is still not as good as... by BrokenHalo · · Score: 1

      Actually, 5.1 under AOS/VS (or even DOS) was pretty good too... it all went downhill with WYSIWYG. I prefer YAFIYGI (You Asked For It, You Got It).

  80. Language Support? by Telemakhos · · Score: 1

    How well does AbiWord support funky character sets? I end up doing most of my work in a language with macrons over the vowels. Unicode fonts support this, and I've got unicode fonts on my linux box, but using them is a pain. Does AbiWord have any nice, handy way of mapping keystrokes like MS Word can with its shortcuts? (In MSWord I can hit alt+"\" and hen type a vowel to get a macron over that vowel). I've tried xmodmap with no positive results to date.

  81. Foreign Language Support by primenerd · · Score: 1

    Fist of all kudos to the Abiword people. I have been using their program for almost two years now. It is far more robust program for basic word processing than MS Word.
    The only things I still use Word for are lab reports (gotta have those tables and Excel integration) and Japanese word processing. I have never had good luck with using Japanese (Unicode or EUC- shiftJIS is baaaad) in Abiword. Currently I use Word or JWPce (a great GNU freeware Japanese processor) for my Japanese work. As soon as Abiword integrates good Asian language support I will delete Word and use the extra HD space for pr0..er..um.. research.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    1. Re:Foreign Language Support by dos+equis · · Score: 2

      I thought our CJK support was pretty good. We seem to some problems with Korean but we know our Chinese support is good because we have at least one Chinese developer and we get feedback from our Chinese users.
      Most of us who work on the internationalization of AbiWord don't know any non-European languages very well. I try the CJK support and it seems okay to me but hey I'm only a gaijin (:
      Please file some bug reports so we know what the problems are and can attempt to fix them!

  82. MacOS-X surrrre by Anonymous Coward · · Score: 1, Interesting
    MacOS X with an X11 server

    Yep, someone give me a call when it actually RUNS on OS-X. If I want to install an X-server I can run it remotely from my Linux box as it is.

  83. Size Matters. by Spunk · · Score: 1

    small and compact?

    Now this I gotta see.

  84. Re:g asshole vagina mouth by Graspee_Leemoor · · Score: 2

    Maybe, but all the apostrophes are in the right places as far as I can tell, which marks it as being in the top 1% of all /. posts for punctuation/grammar/spelling correctness...

    graspee

  85. It's autosave... by nxg125 · · Score: 1

    Autosave in MSWord can *really* mess things up and make parsing the file difficult. Basically all the new stuff you've added goes at the end of the document, so the import filter has to jump all over the place to correctly parse the file.

    Try turning that option off and resaving those docs and give it a whirl then.

  86. Re:tables???? What tables ! by msevior · · Score: 1
    We have both excellent dictionary and an advanced thesaurus via plugins.


    See:
    http://www.abisource.com/download/plugins. phtml


    The thesaurus (AikSaurus) is the best I know of, no matter how much you'd pay.

  87. Someone must be a product of public schooling by Anonymous Coward · · Score: 1, Insightful

    Whoever claimed that AbiWord is 20x smaller than OpenOffice is lacking basic arithmetic skills.

    OpenOffice source: 128MB
    AbiWord source: 15MB

    15MB x 20 = 300MB.

    300MB != 128 MB
    300MB >> 128 MB

    They are also comparing a word processor to a complete office suite, but that is another matter.

  88. Of Course is smaller .... than an Office Suite by nurb432 · · Score: 2, Interesting

    Its just a word processor, so sure its smaller then a simi-complete 'suite'(OO)...

    Not judging if its bad or good.. just dont mislead
    people by compairing apples to oranges..

    --
    ---- Booth was a patriot ----
  89. grammar checking... by ahdok · · Score: 1

    I found MS grammar checking so appalling I turned it off. On my cersion of word, "world-wide" is a grammatical error, and it suggests a change to "worldwide" - but "worldwide" is a spelling error it recommend hyphonating.

  90. Re:You need a clue by maunleon · · Score: 1

    Oh please... you try to get a newbie to install KDE3.0 on a KDE2.0 system. Last count I had to uninstall something like 12 packages and go through a ton of dependencies. It was not as simple as you stated it. In fact, it was a massive PAIN IN THE BUTT!!!

    And why should five commands be needed when one click can do? Linux users is what hurts linux the most. What the hell is this all about, job security? Many people do not care about the source! Many people wouldn't know what to do with the source. MOST people just rm -rf the source when they are done going through the pain of compiling it.

    Please understand: I do not care about the source if I'm not installing it on a development system. I could care less about the source for apache. If i do care, I will get it separately. But 9/10 times, I just want the freaking web server up and running.

    I am afraid that there is one use for Linux source code however: make up for laziness and piss poor documentation out there. Too many times people will say "read the code, stupid!" in lieu of providing goood documentation. Comments in source code should never be substitute for good documentation.

    I have found that many people do not agree with me here. Poor linux. It could be so much farther along, if it wasn't for all the geeks who want to be masters of their domain and relish the arcane processes they can hold over the heads of their less techy counterparts.

  91. RTF format by ThatTallGuy · · Score: 1
    I would love to agree with you but unfortunately experience will show that MS's RTF implementation is nonstandard. (What a surprise, huh?) I cite a support document from Adobe (at http://www.adobe.com/support/techdocs/a87a.htm):

    Because of incompatibilities with the way Word saves documents to RTF ..., FrameMaker returns an error when you import an RTF file saved from Word.

    This also reflects my experience when using StarOffice to author documents sent to Word users, and vice versa. The resulting document is readable but often not presentable.

  92. Great Alternative! by Eitch · · Score: 1

    I saw this news and went to download it. This was my first time seeing this word processor, and I have to admit that I'm a bit impressed! :) I work for the government here in my city, and I'm caring to use convert people to use only free-software. A Word Processor is crucial for this to happen, and I saw AbiWord as a great alternative! The only major problem is that it doesn't have tables (yet), so I'm looking forward to it! Now I'm very interested in the project, and I'll spend a short time of my work with translating it into my language (Brazilian Portuguese).

    If the "higher" people here get happy with this kind of solution, they'll spend some money on donations, instead of software licenses, and that's my objective!

  93. Mac OS X version 0.99 doesn't work by burgburgburg · · Score: 1
    I downloaded the Mac OS X version yesterday. I fired up XDarwin/XFree86 and then started Abiword. It didn't work properly. There were two menus, File and Help. The file had New and Open ... options, but neither actually opened/created anything.

    I finally trashed 0.99 and went back to 0.96, which functions fine. Very disappointing.

    1. Re:Mac OS X version 0.99 doesn't work by dos+equis · · Score: 2

      Please file a bug report.

  94. It's WORDPAD with spellcheck! by hatless · · Score: 4, Insightful

    Three years later, I'm still mystified by the attention Abiword gets. It even gets press coverage.

    It's not even a word processor by late-1980s standards. No table support! No floating footnotes! The column support doesn't seem to allow changing the number of columns midstream--it's all or nothing.

    No merge functionality! (Oh, but there are two optional, unbundled scripting plugins you can theoretically write your own merge function with--except that there's no user-defined field support, either, so any merge fields in a document would be ad-hoc, unprotected, and would show up as spelling errors.)

    Great, so it's "lightweight" and starts up quickly, and it's cross-platform. Yipee. But I remember in 1988 it was pretty fair to expect a graphical word processor--even on the Amiga and the C64--to support tables and footnotes, mail merging and real, multiple-layouts-per-page column support.

    Don't get me wrong. It's nice of the Abiword team to put their time into writing software they obviously find and useful, and it is nice to see a solid, genuinely useful embeddable GTK+ richtext widget come out of this, but can we please stop mentioning it in the same breath as word processors?

    1. Re:It's WORDPAD with spellcheck! by marauder404 · · Score: 1

      I agree. It's a nice application and looks great -- probably of real use to some people. But a MS Word competitor? It's not ready for the Big League yet. I'll wait for 2.0 on this one.

    2. Re:It's WORDPAD with spellcheck! by msevior · · Score: 1

      For a start, Look at the screenshot at:
      http://www.ph.unimelb.edu.au/~msevior/abiword /evol ution-abi2.png

      See the multiple columns/single columns on the same page (embedded in evolution of course)?

      In addtion normal different columns per page we also allow fixed column height to allows easy generation of labels and posters (on A0 paper for example)

      Then remember abiword does do multiple pages types A0 -A6, letter, legal, 20 million evolope sizes, custom page sizes) Landscape/Portrait, ruler control of tabs, left,right,center, bar -tabs, tab leaders, paragraph control, infinitely nested lists,numerous different list types, non-modal list control, an advanced thesaurus,full justification, drag and drop toolbar controls, auto-updating word count, auto-updating fields, hyperlinks, bookmarks, print preview, print to pdf, non-modal insert symbol (OO can't do that even now), simultaneous multi-lingual on-the-fly spell check, online encylopedia, on-line dictionary, image editing, drag and drop of yperlinks and images from web browsers, headers, footers, different header/footer types for first, facing and last pages, Directly editable header/footers, multiple views per document in seperate frames (we had this before MS Word 2000 copied it), fully editable styles, normal, print and web views, full control over ruler and toolbar viewing and positioning, export to HTML, XHTML and about 15 other formats, can read about 10 different document formats plus of course embedding and full external scripting.

      I perfer the merging/scripting support we provide over MS Word because it's all external to the document so there is no possibility for viruses living in documents to propagate. Having a command-line interface to a word processor where can optionally pop up a graphical view is an extremely powerful way to easily generate sophisticated automation. You can single step through scripts written in your favourite language (perl, python, tcl, C, Java whatever) and see the effect on the document.

      Now all these features not in wordpad and some aren't in MS Word (especially the scripting!).

      Now look at the document at:
      http://www.ph.unimelb.edu.au/~msevior/abiword /next _generation.zabw

      That outlines in detail how we will do tables, frames, positioned objects, text wrapped around objects etc.

      We should be done in 6 months.

      I wouldn't have been able to write that document
      without the experience of developing the current framework. Having done that, these more sophisticated layout possibilities are straight forward.

      What will have then? A genuine competitor to MS Word, faster, cheaper, more extensible and free. More over we can integrate Word Processing into any bonobo aware application that wants it. Now that is something MS can't do without significant loss of revenue.

      In the meantime, I and many, many, other people find abiword a useful desktop tool. It is currently ideal for schools, church secretaries, on PDA's and for people in server rooms. Why not make a stable release before launcing on the next phase.

      Martin Sevior.

      PS. I don't even know of another cross platform Word Pad.

  95. Clippy expresses something accurate... by Futurepower(R) · · Score: 2

    Definitely Clippy was a major marketing failure. So was Microsoft Bob. Apparently Microsoft Bob was Bill Gate's wife's idea.

    Clippy expresses something accurate about Microsoft's view of it's customers, however: Microsoft thinks it's customers are stupid children, not even smart children.

  96. lots of warnings by twms2h · · Score: 1

    Not really an abiword issue, but I just compiled it and got many warnings from the compiler. At work I would not accept code that creates warnings unless the developer can explain to me why he can not make them go away.

    1. Re:lots of warnings by dos+equis · · Score: 2

      I think we'd accept a bug report that listed warnings that need to be fixed.

  97. Outraged mothers call out against AbiSpread by juank1 · · Score: 1

    Many people will have a problem if they find out that their kids have been downloading and using the AbiSpread software.

  98. One last thought... by Futurepower(R) · · Score: 2

    Even software that is given away free needs marketing, which is simply accurate communication between the software's authors and managers, and the intended users.

  99. Nice but not useful yet... by BrokenHalo · · Score: 1

    As a science student, I find tables an essential part of any word processor. While I _love_ the speed of Abi and the gtk look/feel, without this feature Abi is worthless to me, so I'm stuck with SO or OO for the time being... :-(

  100. Re:I'll be writing my final paper on this (tonight by BrokenHalo · · Score: 1

    If you want a decent thesaurus, I suggest you spend the $15 or whatever it is in your currency and get a dead-tree version (preferably Roget's). For "power" (English) language users, it's the only way to go...

  101. SVG for vector graphics by IamTheRealMike · · Score: 2
    Well, as the subject says, SVG does fine for vector graphics and can be embedded inside XHTML (or vice-versa). AFAIK the only open (well documented) standard for spreadsheets is the OpenOffice one, which is also based on XML.

    Bear in mind that these specifications are EXTREMELY complicated - you do need special tools for them, writing SVG files by hand is a major drag.

  102. MacOS X by Watts+Martin · · Score: 2

    As far as I can tell, AbiWord still only has binaries available for MacOS X that require X11, and my attempts to compile it with Cocoa support (following the README file directions) have been abject failures. I'm interested in AbiWord, but I really want a Cocoa or Carbon binary, guys.

    1. Re:MacOS X by dos+equis · · Score: 2

      We want it too! Problem is we really on have one dedicated Mac developer and he also works on the other ports. All our attempts to attract other Mac developers haven't worked. Mac open source hackers seem to be very rare.
      If you can find us some, everybody will appreciate it.

  103. Nope. No tables. by hatless · · Score: 2

    Alas, if you read that manual section on creating "tables", it turns out not to be table functionality at all.

    It's just telling users how to make very basic table layouts by using tabs and the overline/underline styles.

    Kind of like doing tables on a TRS-80 in 1982.

  104. Tables for layout by crisco · · Score: 2
    most of the time that people use tables in a word processor document, they would have been better using a spreadsheet.
    No way. Any of those reasons the AC lists better off in a spreadsheet? Sure, it would be nice to have something more elegant than tables for simple layout. But spreadsheets have even less control over layout. How about forms that combine instructions and explanations with fields that need to be filled out? Don't tell me thats one for a spreadsheet.
    --

    Bleh!

  105. Cool, but.. by Ogerman · · Score: 2

    It's good to see all the open source office suites making leaps and bounds forward these days, but my personal bet is on KOffice. Huh? Yeah, I said KOffice. Considering how fast KOffice is moving with so little help, it's pretty clear that the codebase is clean, efficient and managable. Just recently, KOffice 1.2 beta1 was announced, bringing forth a new fully wysiwyg layout engine. With this in place, there is very little holding the suite back from quickly dominating the scene. IMO this will be further proof of C++ being the superior language for GUI design. Time will tell.

  106. RTF "standard" by gnugnugnu · · Score: 1


    Microsoft does actually follow the RFT standard, because RFT is a Microsoft standard.

    Microsoft set the standard, if Microsoft change how it is done then there you go a new standard.

    Abiword had problems sharing documents with Open Office as its support for RTF is quite old and they are putting their effort into the binary word document format.

    1. Re:RTF "standard" by ThatTallGuy · · Score: 1
      Microsoft does actually follow the RFT[sic] standard, because RFT[sic] is a Microsoft standard.
      Just because the same company that wrote the software wrote the standard doesn't mean the software follows the standard.
      In a recent discussion here on /. about SAMBA, for example, it was stated that MS network clients do not follow the (published!) CIFS standards documents, a product and standard MS invented.

      And if one product that implements the standard changes, regardless of who the author of that product is, that by itself does not change the standard -- or else it wasn't a "standard" in the first place. The "standard" exists in its own right and is independent of any single implementation. In this case, MS (as the owner) can change the standard, but not just by changing the product, and the new standard is not just "whatever the product happens to do."

  107. Why not RTF? by Infonaut · · Score: 2
    Rich Text Format is a great "lowest common denominator" format. I create initial docs using TextEdit in OS X. It's particularly good when you're sending files via email, because although you can't do things like pagination or footnoting, you can style text to a fair degree, apply colors, and so forth.

    Once it's time to go final with the document, I'll open in Word to add all of the necessary bells and whistles. This process makes for faster reviews, because the people on the other end aren't spending all their time looking at non-content formatting issues, and when the content is completely locked down, I save a final RTF version for archiving.

    The Word doc then gets created and sent out. I'm definitely going to have to check out AbiWord, but I'm with Colin - having a host of files in various proprietary formats really sucks. I just differ in my approach. RTF is quick and easy to work with, allows for pretty good initial formatting, and is a standard that won't go away any time soon.

    --
    Read the EFF's Fair Use FAQ
    1. Re:Why not RTF? by dos+equis · · Score: 2

      Along with MSWord.doc and our native.abw formats, RTF is our most important format for all the reasons you cite. We really want it to be perfect and it's getting very very close.

  108. lyx by phpdeb · · Score: 1

    Read it, Learn it, Live it.

  109. TOTALLY MADE UP QUOTES by gnugnugnu · · Score: 1

    Some amusing quotes (quoted verbatim) from the Abiword mailing list
    http://abisource.com/mailinglists/abiword-de v/02/M ay/0330.html

    If there'd been more advance notice, it might have been fun to do the
    standard press release trick of soliciting quotes from *other people* to
    introduce those ideas.

    For example, here are some TOTALLY MADE UP QUOTES, putting words in the
    mouths of prominent people that I KNOW VERY WELL THEY'D NEVER SAY:

    "AbiWord is the latest and finest example of the kinds of powerfully
    usable software that can be developed, from scratch, by a world-wide
    team of volunteers collaborating under the terms of the GNU GPL.
    More free software! I love it!"
    -- Richard Stallman, Free Software Foundation

    "I never leave kernel mode unless I have to. I try to leave all that
    pixel-pushing stuff out in userland to others. Thank goodness for
    the folks on the AbiWord team. Now I can skim all those useless email
    attachments before I delete them!"
    -- Linus Torvalds, Linux

    "Hey, how come we're the only major desktop operating system that
    AbiWord doesn't run natively on? What do I have to do to get someone to
    finish the Cocoa port? Can I just sneak them into the next Pixar release
    party or will I actually have to pay them?"
    -- Steve Jobs, Apple

    "AbiSource ... has started developing, in particular, a very high-quality
    word processor for the Linux environment."
    -- Paul Maritz, Microsoft Sr VP of platforms and applications

    Oops. Actually, the last quote *is* real:

    http://www.microsoft.com/presspass/trial/transcrip ts/jan99/01-28-am.asp

    --
    Totally Karma Whoring...

  110. AbiCalc the AbiSource SpreadSheet ... by gnugnugnu · · Score: 1

    AbiCalc the AbiSource SpreadSheet ...
    ... that is never likely to be implemented

    http://linux.oreillynet.com/pub/a/linux/2002/03/ 14 / biword.html

    AbiSource was started with a grand vision to provide a Cross Platform (XP) frame work and Office Suite.
    Among the other programs planned were AbiCalc, AbiShow, and AbiDraw.

    But the funding never came and the corporate backing left and Abiword is now an entirely volunteer run project.

    It was suggested that some one might expand the AbiSource frame work to more applications that just Abiword and start AbiCalc
    http://www.abisource.com/mailinglists/abi word-dev/ 02/Mar/0512.html

    The idea did not take off. Providing a smaller faster cross platform alternative to the openoffice.org spreadsheet or Gnumeric did not take anyones interest. In the end the guy who suggested it gave up having been convinced that it was a better idea to wait until a GTK only verison of Gnumeric was ported to Windows.

    The abiword developers do plan to add better support for Vector Graphics as part of the next version of Abiword, so AbiDraw may eventually become more than just vaporware.

    With the existance of the Mozilla Platform and the Open Office.org suite the need for a cross platfrom Office suite there is much more cross platfrom open source software and Gnome is gradually becoming more and more portable so it seems unlikely that AbiCalc and other cross platform using the Abisource framework will ever come into existance.

  111. Re:Tables, Equations, Footnotes by gnugnugnu · · Score: 1

    > Ok...hummm...how much XML is in AbiWord, by the way?

    The Abiword native file format is uncompressed plaintext XML, it also supports gzip and bzip2 compressed XML.

    > Tables are nontrivial to implement correctly

    There are more types of tables than just HTML/XML tables. HTML tables can be scalable, or fixed size. Abiword is a WYSIWYG (What you see is what you get) word processor and there are lots of little details that must be done correctly or you the print out will suck ass.

    There are also complicated layout and user interface issues.
    Try selecting table column, try merging tables.

    Programming always seems easier than it actually is, but then everything looks easy when it is done by an expert and some things are actually easy, but only when you know how.

    confused? i know i am.

  112. Lightweight software rarely succeeds by cartman · · Score: 1

    95% of the features of any heavyweight software product are unused by the average user. This led various software makers to create "lite" versions of their software. The difficulty is, even though each person uses only 5% of the features, it is not the same 5% as everyone else. Everyone has some feature that they absolutely REQUIRE and that is not included in the lite version. Consequently, "lite" software products rarely succeed.

    How many people now use the lite versions of various word processors? How many people use MicroEmacs? etc?

  113. Why bother saving disk space? by cartman · · Score: 1

    Who cares that AbiWord is smaller than OpenOffice? OpenOffice is 180MB! Have you seen the size of drives lately? OpenOffice takes ~$0.45 worth of disk space. But hooray, abiword is smaller (perhaps I'll save ~$0.40).

    Most people don't even use the space they have.

  114. Abiword offers no benefit beyond OpenOffice... by cartman · · Score: 1

    other than saving disk space that is totally free now anyways. It would have been better to consolidate the effort taken with AbiWord and to use it on OpenOffice.

    1. Re:Abiword offers no benefit beyond OpenOffice... by dos+equis · · Score: 2

      When I felt like doing some hacking I looked at both OpenOffice and AbiWord.
      I didn't like that OpenOffice wasn't even attempting to support Mac.
      OpenOffice code was very difficult to get into and there internationalization web pages didn't seem very helpful. Internationalization was the aspect I was most interested in with a word processor.
      AbiWord code was very easy to get into and I had my first patch working the first day. Hacking AbiWord was very pleasurable and scratching my itches was very rewarding.

      Oh and my German is terrible so I couldn't even read OpenOffice's comments ):

      I will try to hack OpenOffice again some day though.

  115. Abi the Ant by gnugnugnu · · Score: 1

    > Sounds really cool. Just as long as Abi the Ant doesn't appear on my desktop and offer to help me type a letter.

    Anyone else think having a Bug for a mascot is a bad idea?

    :P

    The Ant even has a webpage
    http://abisource.com/~abi/

  116. The main thing I notice when I open AbiWord... by daveman_1 · · Score: 1

    Is it's lack of good looking fonts. Try scaling a font in AbiWord to 72 point some time. After about 30 seconds when you finally get your cursor back, what you will see is a severely pixelated version of what you typed. If I could get around the nasty looking fonts, I think AbiWord is quite nice!

    --
    Russian Russian Russian RussianDollSig DollSig DollSig DollSig
    1. Re:The main thing I notice when I open AbiWord... by dos+equis · · Score: 2

      AbiWord can use whatever fonts are in your system.
      It does come with a few fonts that most documents tend to use but you can use the better ones on your system instead.
      Good quality free fonts are still scarce and we don't know about making fonts - only about makind applications.

  117. Possible yes, but not easy. by gnugnugnu · · Score: 1

    It is _possible_ but using the Equation Editor is painful.
    It is so much faster to get a simple LaTeX template and learn to how to $ include an inline equation $ or do a paragraph of maths

    \[
    equation goes here
    \]

    Waaaaay easier.

  118. It does support columns. by Futurepower(R) · · Score: 2

    As you say, the new version does support columns. I must have been using an older version when I last reviewed it.

  119. New AbiWord by JebusTheImpaler · · Score: 1

    I have this OLD windows laptop, and I never thought I could get something this good on it. In my EVER-SO-HUMBLE opinion, AbiWord is the best of the open-source wordprocessors.

  120. I'm surprised that Microsoft... by ericvids · · Score: 1

    hasn't filed suit against the creators of WordPerfect and WordStar and WordPro for Copyright Infringement... I mean, they've got "Word" in their names!

    Except that all of those came before Microsoft Word. I think they should sue Microsoft instead for stealing features from them.

    --
    Pet peeve: Profane people propagating perfunctory pedantry.