Slashdot Mirror


Organic Matter Found In Canadian Meteorite

eldavojohn writes "From what sounds like the opening of an X-Files episode, Canadian scientists have reportedly found in a meteorite organic matter older than the sun at Tagish Lake in Canada. From the article: '"We mean that the material in the meteorite has been processed the least since it was formed. The material we see today is arguably the most representative of the material that first went into making up the solar system." The meteorite likely formed in the outer reaches of the asteroid belt, but the organic material it contains probably had a far more distant origin. The globules could have originated in the Kuiper Belt group of icy planetary remnants orbiting beyond Neptune. Or they could have been created even farther afield. The globules appear to be similar to the kinds of icy grains found in molecular clouds — the vast, low-density regions where stars collapse and form and new solar systems are born.' The article implies that life could potentially survive in these meteorites and maybe even travel through space — supporting the theory that life may have arrived on earth and evolved from that point on."

226 comments

  1. They're here... by baffled · · Score: 4, Funny

    No, apparently we're here.

    1. Re:They're here... by Goffee71 · · Score: 0, Flamebait

      And the creationists will put it down to giant space whale poo!

      --
      If he's the Walrus then can I be a penguin please?
    2. Re:They're here... by Anonymous Coward · · Score: 1, Funny

      Well, my bible does say, "And on the fifth day He created the giant space whales, a great space coaster, and all manner of space beast." Of course, He refers to the FSM.

    3. Re:They're here... by Anonymous Coward · · Score: 0
      "And on the third day did Jehovah have a mighty orgasm and spread his seed about the Universe."

      "And on the fourth day did Jehovah's Hand become an hairy hand."

    4. Re:They're here... by buswolley · · Score: 1

      And God said, Let the waters bring forth abundantly the moving creature that hath life, and fowl that may fly above the earth in the open firmament of heaven. -King James Genesis - sounds like evolution to me.

      --

      A Good Troll is better than a Bad Human.

    5. Re:They're here... by Dryheat · · Score: 1

      "And on the fifth day he felt pain in his left arm."
      "And on the sixth day he went blind."
      "And on the seventh day he changed hands."

  2. Our new overlords by Anonymous Coward · · Score: 4, Funny

    I for one welcome our new organic material evolved overlords. And by overlords, I mean us.

    1. Re:Our new overlords by Anonymous Coward · · Score: 0

      This post should be modded as flamebait, simply as everyone is fucking sick of hearing it.

    2. Re:Our new overlords by LiquidEdge · · Score: 1

      I have yet to get tired of it. Maybe later.

      --
      Saving the World: One Drink at a Time
    3. Re:Our new overlords by Anonymous Coward · · Score: 0

      ...And by overlords, I mean us.

      By us - you mean US and A? I like...


      .... NOT!!!

    4. Re:Our new overlords by freeze128 · · Score: 1

      Thank you. I'm glad to be here. Now build me a pyramid....

    5. Re:Our new overlords by rhfixer · · Score: 1

      Which design would you like? Cambodian, Egypcian or Mayan?

      We always knew we were the overlords of this planet. I should have a pyramid too!

      --
      Hi.
  3. Extra-solar life? by Ninjaesque+One · · Score: 0

    Since the organic matter is older than the sun, this means that:

    1. Either there is extra-solar life,

    or 2. Stars can create organic material.

    But how would the ordinary life-forms that we know of survive deep space?

    --
    Ninjas and pirates. How piquant.
    1. Re:Extra-solar life? by v1 · · Score: 4, Insightful

      Life is found most everywhere that it can reach. The only reason we have not found life in space yet is because gravity does a good job of keeping life on the planet and out of space. If there were a place on earth where life could encouter vacuum, it would be a very good bet that life would evolve to cope with it. Trees split water and create sugar using sunlight, animals create water and eat sugar. If you can conceive of a lifeform that can do both of these things, vacuum is a perfectly acceptable environment. In fact there are quite a few "anaerobic" microbes that prefer to not be around oxygen - if they could evolve to handle lower pressures they could make a good candidate for interstellar life travel.

      --
      I work for the Department of Redundancy Department.
    2. Re:Extra-solar life? by Jugalator · · Score: 1

      if they could evolve to handle lower pressures they could make a good candidate for interstellar life travel.

      Radiation may get them though...?

      --
      Beware: In C++, your friends can see your privates!
    3. Re:Extra-solar life? by edbarbar · · Score: 3, Interesting

      I don't believe gravity is a huge impediment to life moving around:

      http://en.wikipedia.org/wiki/Fermi_paradox.

      Think about how far humankind will advance in 50 years, and whether we would be able to make a micro-replicator that we could send to other stars.

      --
      Ed Barbar, President and General Manager, Furnit USA
    4. Re:Extra-solar life? by TheZorch · · Score: 4, Insightful

      There are many examples of life that can survive in the most extreme of places.

      Tbere is bacteria that lives quite happily on plutonium fuel rods inside nuclear reactors. The radiation doesn't bother them.

      Thnere is bacteria that can synthesis sugars vital for life without photosynthesis from compounds which are lethal to other forms of life. Examples of this have been found at deep sea hot vents. There is even bacteria which lives off methane. Also many different kinds of bacteria and viruses (the lowest known form of life) which can place themselves into a state of suspended animation for thousands and even theoretically millions of year.

      Thus, life has many ways to survive in deep space.

      --
      Michael "TheZorch" Haney
      thezorch@gmail.com
      http://thezorch.googlepages.com/home
    5. Re:Extra-solar life? by Nf1nk · · Score: 4, Informative

      Evolving to handle high levels of radiation doesn't seem to be a problem for number of of species of bacteria.
      http://www.google.com/search?q=radiation+extremoph ile&start=0&ie=utf-8&oe=utf-8&client=firefox-a&rls =org.mozilla:en-US:official

      --
      I used to have a cool sig, back when I cared
    6. Re:Extra-solar life? by Veilrap · · Score: 1

      Nor does it both cockroaches

    7. Re:Extra-solar life? by Plutonite · · Score: 3, Insightful

      Actually, finding life is very difficult because the necessary conditions for the formation of a single celled organism only exist with very low possibilities.

      Keep in mind that we have never manufactured a single living cell with functional DNA in a lab even with conditions entirely under our human control. Pasteur's Law still holds today. If we can't use thousands of years of engineering, including at least 2 decades of advanced bio-medical technology, to manufacture a single funcional cell from non-organic material, do you really expect it to form arbitrarily in space all the time?

      We are the product of an extremely unlikely physical/chemical event, and we may very well be alone.

    8. Re:Extra-solar life? by StikyPad · · Score: 1

      animals create water and eat sugar

      The phenomenon you appear to be referring to is not the actual creation of water. I'll leave it at that.

    9. Re:Extra-solar life? by Geak · · Score: 0

      Totally beleiveable. There are certain frogs that can survive winter by hibernating in the ice. completely deprived of oxygen and food. The're bodies freeze right through - essentially they are dead. Then they bring themselves right back to life again in the spring. Perhaps this may suggest that those frogs are the oldest species of animal alive on the planet - assuming that all other animals have evolved past that ability.

    10. Re:Extra-solar life? by justo · · Score: 1

      > do you really expect it to form arbitrarily in space all the time?

      who said all the time? all it needs is once, like a flame, to spark a fire.

      quantum entanglement anyone?

    11. Re:Extra-solar life? by Anonymous Coward · · Score: 0

      Viruses are not life forms.

    12. Re:Extra-solar life? by cytg.net · · Score: 1

      "We are the product of an extremely unlikely physical/chemical event, and we may very well be alone." that statement indicates favorable odds, i'd enterpret above 50, that we *are* alone .. based on the empirical dataset of *what* ?
      ill make you a bet .. we're not the only ones! and _you_ get to decide the stakes .. whatever you want!

    13. Re:Extra-solar life? by Thomas+Miconi · · Score: 2, Interesting

      Actually, finding life is very difficult because the necessary conditions for the formation of a single celled organism only exist with very low possibilities.

      This may well be true, or not. Right now we don't know how life emerged (though we have quite a few hypotheses), so we can't say.

      However, you might want to reflect on this: traces of photosynthetic life have been found in the oldest sediments we know of (see Hadean). Fully-formed fossils appear not much later than that. That puts a lower bound for the appearance of modern bacterial lifeforms at about 3.5Gy ago, and we know that bacteria were not the first form of life to emerge (they're just too complicated). Basically, it seems that life appeared on Earth pretty much as soon as it could. That's not quite what you would expect from a "very low possibility" event.

      Keep in mind that we have never manufactured a single living cell with functional DNA in a lab even with conditions entirely under our human control. Pasteur's Law still holds today. If we can't use thousands of years of engineering, including at least 2 decades of advanced bio-medical technology, to manufacture a single funcional cell from non-organic material, do you really expect it to form arbitrarily in space all the time?

      We have never manufactured a star either - despite the fact that we know how stars work. Yet there are billions of stars in the universe. Our inability to build something is no indication of how easy it is for Nature to build it.

      Life is a very, very complicated business, involving the interplay of a large quantity of microscopic compounds. It is quite possible that the easiest way to create a living cell will not be to engineer one in a "top-down" manner, but rather to find a process through which life would originate "on its own".

    14. Re:Extra-solar life? by TimeZone · · Score: 1
      2. Stars can create organic material.

      Well duh. We are all made of stars. (Thanks for the physics lesson, Moby.)

      TZ

    15. Re:Extra-solar life? by dasimms · · Score: 1

      I believe stars make organic material. Life outside of a star's influence seems unlikely but who knows? As for life-forms surviving deep space, google for panspermia (the theory that microbes in space bring life to planets like Earth, or vice-versa, or the process whereby this happens).

    16. Re:Extra-solar life? by RockDoctor · · Score: 1
      If there were a place on earth where life could encouter vacuum, it would be a very good bet that life would evolve to cope with it.


      While I'd hesitate to say that it's impossible, that's a very steep barrier to cross. "Life" that is anything even vaguely like life on Earth is going to involve fairly dilute solutions of molecules and macromolecules in comparatively volatile solvents, and to construct biological films that function as cell membranes, those solvents are going to be exposed to the vacuum. Bye bye, solvents.
      That is a very steep barrier to cross for both origin of life (I'd suspect that origin of life, de novo, in a vacuum is impossible, in the "impossible" sense of "impossible", not in the "inconceivably unlikely" sense of "impossible"), and a very steep barrier to cross for the development of organisms or the evolution of life in vacuum. For transmission of life through vacuum, it's a much more crossable barrier: going inert for a few tens of millions of years seems to be significantly within the capabilities of life as we know it. (There is evidence (disputed) of organisms surviving in isolation for up to 250 million years, though with lesser radiation challenges than in space. I suppose I should "do" this for Wikipedia, when I've time : (from my notes) Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal." Vreeland, Rosenzweig & Powers, Nature, v407, p897- 900, 2000 Further information: If there is a website, it will probably be a descendant from wcupa.edu, where Vreeland and Rosenzweig work. )

      The more chemically sophisticated of Slashdot's readers will have noted that I use the term "solvent", not "water". This is not an accident.

      Trees split water and create sugar using sunlight, animals create water and eat sugar. If you can conceive of a lifeform that can do both of these things, vacuum is a perfectly acceptable environment.

      How are you going to get your nutients into and out of your vacuum-living, non-inert organism? Without running into the vacuum + solvent => vacuum problem discussed above?
      Sorry to piss on your parade, but unless you're going to go to really obscure sf concepts like Dark Star's "Pheonix Asteroids" (self-sustaining plasma fields, yeah, right), you're going to have to do chemistry in the solid phase (extremely slow), or in very high temperature oxide/ silicate liquids (very limited chemistry, compared to [C,H,O,N,S,P]-polymer chemistry in small-molecule solvents).
      In fact there are quite a few "anaerobic" microbes that prefer to not be around oxygen - if they could evolve to handle lower pressures they could make a good candidate for interstellar life travel.

      Anaerobic life is almost certainly the original life on the planet (I'm quite tempted to delete that "almost"; but I'm being cautious). The oxygen rich atmosphere we have this gigayear is a pretty late event in the history of life. The poisoning of the atmosphere by oxygen took a couple of gigayears to complete, courtesy of the polluting output of those filthy cyanobacteria. Look up "banded iron formation". Vacuum does not mean "absence of oxygen", it means "absence of any gas", including all of nitrogen, methane, carbon dioxide, ammonia, hydrogen, helium and oxygen (in decreasing order of their likely contribution to the Earth's pre-oxygen-pollution atmosphere).

      I love sf stories about space-crossing organisms. But I understand what the "f" in "sf" means.
      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
  4. Organic matter != life... by msauve · · Score: 5, Insightful

    it's just carbon compounds.

    --
    "National Security is the chief cause of national insecurity." - Celine's First Law
    1. Re:Organic matter != life... by Anonymous Coward · · Score: 5, Funny

      Your mom's just carbon compounds.

    2. Re:Organic matter != life... by Ninjaesque+One · · Score: 2, Informative

      My life sci 101 class teached me that organic compounds also usually have hydrogen. Apparently, more than half of all known compounds are organic, according to http://en.wikipedia.org/wiki/Organic_compound .

      --
      Ninjas and pirates. How piquant.
    3. Re:Organic matter != life... by Anonymous Coward · · Score: 0

      Is it possible the meteorite could have had the carbon compounds introduced into it after coming through the atmosphere? Maybe the age they established has outrulled that.

    4. Re:Organic matter != life... by Bloke+down+the+pub · · Score: 2, Interesting

      We are stardust, we are golden.

      --
      It's true I tell you, feller at work's next door neighbour read it in the paper.
    5. Re:Organic matter != life... by theshowmecanuck · · Score: 1
      Is it possible the meteorite could have had the carbon compounds introduced into it after coming through the atmosphere? Maybe the age they established has outrulled that.
      Most of the meteorite's material is about the same age as our solar system--about 4.5 billion years--and was likely formed at the same time (tour a virtual solar system). But the microscopic organic globules that make up about one-tenth of one percent of the object appear to be far older. In a study appearing in tomorrow's issue of the journal Science, Messenger and colleagues report that isotopic anomalies in the globules suggest that they formed in very cold conditions--near absolute zero.

      Yes, the article does say that. And my own observation: A flaming object re-entering the atmosphere is [sarcasm]usually[/sarcasm] a lot hotter, if I recall correctly, than near absolute zero. :-/

      --
      -- I ignore anonymous replies to my comments and postings.
    6. Re:Organic matter != life... by Anonymous Coward · · Score: 0

      Yea, "older than the sun" sort of takes care of that hypothosis.

      Rules of inference:

      Sun > Earth
      Orangic Compound > Sun
      ----------------------
      Organic Compound > Earth

      Of course it's not completely impossible that earth could have already had organic compound that predated it and the sun here, and that this meteorite happened to hit this planet in just the right place so that it would come in contact with them and become contaminated.

      That still doesn't impact the significance of this find though. What is important is that this Organic Compound is older than our Sun and Solar System. I don't believe a substance that old has ever been found before.

      Of course it would be interesting to know which organic compound was found to be that old.

    7. Re:Organic matter != life... by Anonymous Coward · · Score: 5, Funny
      My life sci 101 class teached me

      Unlike your Eng 101 class, which clearly did not.

    8. Re:Organic matter != life... by DrMindWarp · · Score: 4, Informative

      More correctly, organic molecules are not necessarily 'organic matter'. The report does not say it is 'organic matter' - some idiot in the reporting chain just doesn't know the difference. This is one reason why Slashdot should cite the original article rather than second or third hand rubbish.

    9. Re:Organic matter != life... by ichigo+2.0 · · Score: 4, Funny

      What does engineering 101 class have to make with this?

    10. Re:Organic matter != life... by Anonymous Coward · · Score: 0

      I be in favor of eliminating irregular verbs. And so do my homies, so don't fuck with us.

    11. Re:Organic matter != life... by Anthony · · Score: 1

      And we've got to get ourselves

      --
      Slashdot: Where nerds gather to pool their ignorance
    12. Re:Organic matter != life... by MillionthMonkey · · Score: 4, Informative

      Apparently, more than half of all known compounds are organic

      Practically all compounds are organic. You can connect carbons in an infinite number of ways. There are an infinite number of inorganic molecules too, but it's a much smaller infinity. Large inorganic molecules tend to break apart. Most atoms either want more electrons too much or don't know what to do with the ones they have, and the resulting instabilities build up over distance. You don't see many inorganic polymers- only a few, like polyphosphazenes and asbestos needles. Carbon is good at forming large covalent molecules, and its presence stabilizes large molecules with other elements.

      People think organic chemistry is hard because they see all the compounds and freak. In fact organic is actually much easier than inorganic chem. The players are C, H, O, and N, plus phosphate (PO4---) if you're talking biochemistry. Phosphate aside, these are simple, well understood atoms. Being small, they are hard atoms with limited deformation in electrical fields (like from other nearby atoms). They display a small range of behaviors and form covalent bonds in a predictable way. We still sometimes learn new stuff about carbon, for example, like we did with buckyballs and nanotubes. But neither of these involved any fundamental carbon chemistry that we didn't already understand.

      Carbon atoms get 4 bonds each, nitrogens 3, oxygens 2, hydrogens 1. You can connect them up in any way that satisfies those bond number requirements. But each bond should have a carbon on one end (preferably both ends) or you get unstable stuff. (Exceptions: N-H, O-H. You can get away with O=N, O-O, N-N, and N=N sometimes, but not too much, or the results are unpleasant.) Each of C, N, and O can form double bonds. Most double bonds are between C and either O or N. Especially in biochem, where carbon-carbon double bonds are not as common. Both C and N can form triple bonds, such as in nitriles (CN) or alkynes like acetylene (HCCH). Triple bonds are even rarer. (If you're bad you can use F, Cl, Br, or I to make CFCs and similar things. Halogens generally follow the same rules as H, except the bonds are more electron-poor than with H, and more stable. CFCs almost never appear in biochemistry.) Phosphate gets 3 bonds, but they can be anionic. When covalent, the bonds are usually with hydroxyls or other phosphates across shared bridge oxygens. In biochem P never appears outside its phosphate. When it does it gets 5 bonds. Many organophosphates used in industry and agriculture incorporate direct C-P bonds. The nerve agent Sarin for example has a P-CH3 bond as well as a P-F bond with fluorine. Phosphate can appear in organic and bioorganic polymers too, like DNA. In general addition of N or especially O to organic molecules makes them electron poor, and addition of H makes them electron rich. From least to most oxidized: C-OH, C=O, COOH. Heavily oxidized molecules tend to break apart.

      Being mindful of the above restrictions, you can connect C, H, O, N, phosphate, etc. up like tinkertoys to form almost anything you can think of. Mostly stuff like tar and varnish. And that's basically what you learn in organic chemistry. Then they'll have you spend most of the semester memorizing hundreds of quirky little "recipe" type reactions with various bizarre reagents, so that you can eventually synthesize any organic structure in a lab that you want. Most of these little recipes were figured out in the 19th century.

      Inorganic chemistry is less systematic. Consider something like Hg. We find out new stuff about Hg all the time. We don't understand its electronic structure very well. It has lots of excited states available to it, and it displays unexplained absorption lines that appear to be influenced by what's around. Its outer 6s valence electrons fly straight through the nucleus at relativistic speeds, raising their effective mass and shrinking their orbitals below the atom's surface. As a res

    13. Re:Organic matter != life... by kjart · · Score: 1

      it's just carbon compounds.

      Drat, and here I was thinking that there was finally proof of life in Canada.

    14. Re:Organic matter != life... by triffid_98 · · Score: 1
      If there's no life in Canada, who is it that's been clearcutting the forests and building igloos all this time?

      Drat, and here I was thinking that there was finally proof of life in Canada.
    15. Re:Organic matter != life... by coastwalker · · Score: 1

      back to the garden.

      --
      Facts are history now plebs have politics for religion on social media.
    16. Re:Organic matter != life... by bogado · · Score: 1

      compounds are organic. You can connect carbons in an infinite number of ways. There are an infinite number of inorganic molecules too, but it's a much smaller infinity. <nitpick>
      Wrong, both are enumerable so they are the same size.
      </nitpick>
      --
      []'s Victor Bogado da Silva Lins

      ^[:wq

    17. Re:Organic matter != life... by Anonymous Coward · · Score: 0

      -1 ageing hippies all round!

  5. OMGWTFLOLBBQ by Anonymous Coward · · Score: 0

    IT'S THE BLOB!

    1. Re:OMGWTFLOLBBQ by MrHali · · Score: 1

      triber?

  6. More like "Deception Point" than the X-Files by dpbsmith · · Score: 1

    It actually sounds much more like Dan (Da Vinci Code) Brown's bad novel, "Deception Point."

    1. Re:More like "Deception Point" than the X-Files by freefrag · · Score: 5, Funny

      Dan (Da Vinci Code) Brown's bad novel "Bad" implies that he has written good novels.
    2. Re:More like "Deception Point" than the X-Files by owlnation · · Score: 2
      It actually sounds much more like Dan (Da Vinci Code) Brown's bad novel, "Deception Point."
      He has good novels?
    3. Re:More like "Deception Point" than the X-Files by bluephone · · Score: 1, Insightful

      "The Da Vinci Code" wasn't bad, I liked it. I just thought that the hype was entirely overblown. It was a good yarn, just not worthy of all the hullabaloo. But, you write a novel about a major religion's central deity, and you're bound to stir up some publicity when people whine. I haven't read the rest of his books, however, and none really compel me to do so.

      --
      jX [ Make everything as simple as possible, but no simpler. - Einstein ]
    4. Re:More like "Deception Point" than the X-Files by overlordmead · · Score: 1

      Is that the one where the hero, Dan Brown or what ever his "intrepid author" name is this time, saves the world>

      --
      Think Gnole-ish, not prole-ish
    5. Re:More like "Deception Point" than the X-Files by value_added · · Score: 5, Informative

      He has good novels?

      LOL. True story:

      Recently, I was trying to chat up a very attractive girl. I mentioned in our harried conversation (she was at work) that I enjoyed reading but hadn't been to the bookstore in ages, blah blah. She told me that she, too, loved to read, and promised to bring in some of her favourites for me. Great, I thought! This could be the start of something interesting.

      A few days later I stop in to see her and she smiles and points to a small bag 'o books in the corner. How sweet, right? Well, inside the bag were 4 were Dan Brown novels. Cervantes I wasn't expecting, but Dan Brown? I tried reading one of them (maybe I was wrong about him), but the absence of any writing talent in combination with an absurd plot reminded so much of high school that all I could was groan and put the book back in the bag with the others.

      Haven't been back to see her since. It's been a month, but I wonder whether that's not long enough.

    6. Re:More like "Deception Point" than the X-Files by Anonymous Coward · · Score: 0

      Um, no it doesn't.

    7. Re:More like "Deception Point" than the X-Files by From+A+Far+Away+Land · · Score: 0, Troll

      Dissing girls who like mystery novels, is not cool.

      This being Slashdot, dissing girls is not cool, period ;-)

    8. Re:More like "Deception Point" than the X-Files by Anonymous Coward · · Score: 0

      Where did she work again? O:-)

    9. Re:More like "Deception Point" than the X-Files by Qzukk · · Score: 4, Funny

      Cervantes I wasn't expecting

      Nobody expects the Spanish Author!

      --
      If I have been able to see further than others, it is because I bought a pair of binoculars.
    10. Re:More like "Deception Point" than the X-Files by jbofdeath · · Score: 1

      Don't lie. You know she was not attractive.

    11. Re:More like "Deception Point" than the X-Files by Anonymous Coward · · Score: 0

      To lie by omission is not lying.

    12. Re:More like "Deception Point" than the X-Files by cyberon22 · · Score: 5, Insightful

      Free books for you? That was really sweet of her.

      Perhaps you should have judged her by the act of giving rather than the gift. Rather than being condescending and judgmental (way to make her feel good, champ), you could have scored points and broadened her horizons by thinking about what she gave you and suggesting some other books she might have liked. Sounds like she likes shorter, punchier thrillers.

      I'd have given her Gaston Leroux's "Phantom of the Opera", the collected short stories and cartoons of James Thurber, and maybe something short by literary like Ondatjee's "Running in the Family". How on earth can you know she won't like what you like unless you let her read it?

    13. Re:More like "Deception Point" than the X-Files by Redlazer · · Score: 5, Insightful
      You, sir. Are clearly not a virgin.

      Either that, or you must be new here.

      -Red

      (And you're totally right, by the way. WHo gives a crap if she has awful taste in books? That would be like turning a girl away casue she doesnt play video games, or worse, likes the PS3)

      --
      Guns don't kill people, "with glowing hearts" kills people.
    14. Re:More like "Deception Point" than the X-Files by StikyPad · · Score: 1

      That (we men believe) women have terrible taste is neither surprising nor insightful, making your post not far removed from the novels you deride, although fortunately with a much smaller distribution.

    15. Re:More like "Deception Point" than the X-Files by TheRaven64 · · Score: 2, Funny

      That would be like turning a girl away casue she doesnt play video games, I was with you up to here...

      or worse, likes the PS3 ...but you've got to have some standards.

      --
      I am TheRaven on Soylent News
    16. Re:More like "Deception Point" than the X-Files by drsquare · · Score: 3, Funny

      I'm she'd have reacted in a similar way if she found out you read Slashdot.

    17. Re:More like "Deception Point" than the X-Files by thedave · · Score: 1

      Only the people new here are not virgins.

      I guarantee you the oldtimers that stick it out here, are not getting laid.

      Now, some breeder out there will probably chime in with a "I got laid, and the kids to prove it" type remark.

      But, most readers will just nod their heads sadly, and lash out at the next poster that says Dan Brown writes good fiction, or the guy that says he just didn't get Serenity.

      --
      [ .sig removed due to death threats from zealots who seek to control me out of fear for their hidden d
    18. Re:More like "Deception Point" than the X-Files by bdwebb · · Score: 2, Insightful

      The fact that "some of her favorites" included Dan Brown novels points to an obvious character flaw (well..at LEAST one) and a serious lack of intelligence. He made an accurate judgement call based upon the fact that he had never met someone previously who enjoyed a Dan Brown that didn't occasionally have fits of chest slapping/attempts to bite their own ear. While this may be a stereotype, and you are OBVIOUSLY the self-righteous asshole who says "Stereotypes are bad!! You should judge every person you meet for the person they are INSIDE!!!!!1!", I and 95% of the rest of humanity couldn't give a fuck. Stereotypes exist because they work. For example:

      Man sees bear.
      Man recognizes that bear could possibly maul and/or kill man.
      Man finds ways to avoid or escape an encounter with said bear.

      Stereotype is defined as: 4. Sociology. a simplified and standardized conception or image invested with special meaning and held in common by members of a group.

      Just because 1 in 1000 bears may be cuddly and playful rather than deadly and violent does not make the stereotype incorrect.

      Also, by ending things at this point and not "taking a chance" as you would likely put it, he is saving time and possible heartache for her rather than taking advantage of her and presenting himself as a pseudo-cultured, pompous, self-important cock, then using this false image of himself to take advantage of her and use her until he is done with her and kicking her to the curb.

      Did I sum up your method of preying on women correctly or did I miss something?

      Instead of being a prickface about his comment, you could have decided to take it for face value, in the manner that he intended it...in other words, to be humorous.

      Below me.

    19. Re:More like "Deception Point" than the X-Files by Fleeced · · Score: 2, Insightful

      Wow... how wonderfully pretentious of you.

      She like books you don't? Geez, what a dumb bitch!

    20. Re:More like "Deception Point" than the X-Files by johansalk · · Score: 1

      I remember a girl who went on and on about how she liked "literature". I thought, "oh, at last, a smart girl". When I asked her what "literature" she liked she said "Harry Potter". I don't remember what the other ones were but all were similar to "Harry Potter" (LOTR too? can't remember). She got pretty pissed off them I said "that's not literature, that's entertainment".

    21. Re:More like "Deception Point" than the X-Files by mikiN · · Score: 1

      You, sir (or madam, I don't know), are presenting a stereotypical view of stereotypes.
      Not all stereotypes are bad, but that doesn't mean yours is good.
      I do like the idea of meta-stereotypes, however.

      --
      The Hacker's Guide To The Kernel: Don't panic()!
    22. Re:More like "Deception Point" than the X-Files by Anonymous Coward · · Score: 0

      I noticed that you misspelled "judgment", while the gp spelled it correctly (note that I spelled "misspelled" correctly, look it up).

      I believe it is appropriate to assume that you are an idiot, and your opinion is valueless.

      Also; "Below me."?

      Blow me.

    23. Re:More like "Deception Point" than the X-Files by Greg.Rodden · · Score: 2, Insightful

      OK so let me get this straight. You aren't going to give this "very attractive girl" the time of day because she likes Dan Brown novels.... and shes the idiot here.

      So did you happen to pick up 'Angels and Demons', brilliant story even if some of his chapters are only 2 pages long. Most of Dan Browns novels that i've read have an underlying love story where the educated hero ends up with the "very attractive girl"...

      If you ask me, YOU are the fool in THIS story who is so naive as to turn down the "very attractive girl" because of her taste in writers. How many HAPPILY married men do you know enjoy all the movies he gets dragged along to by his better half?

      I think you should get off your high horse, read the books, buy her some flowers and show her a good time, or in the least give her a chance and see if you get along. There are other things to a relationship other than reading books my friend.

      --
      I have ridden the mighty moon worm!
    24. Re:More like "Deception Point" than the X-Files by cthulhu11 · · Score: 1

      Snob.

    25. Re:More like "Deception Point" than the X-Files by Anonymous Coward · · Score: 0

      Your kneejerk anti-stereotype-stereotype bigotry sickens me. I have no tolerance for the intolerant!

    26. Re:More like "Deception Point" than the X-Files by Dabido · · Score: 3, Funny

      NOBODY expects the Spanish Author! His chief weapon is surprise...surprise and fear...fear and surprise.... His two weapons are fear and surprise...and windmills.... Our *three* weapons are fear, surprise, and windmills...

      --
      Sure enough, the cow costume was hanging up next to the superhero outfit and sailors uniform. (S,Spud)
    27. Re:More like "Deception Point" than the X-Files by Anonymous Coward · · Score: 0

      Maybe unlike you he has enough attractive potential girlfriends that he can afford to be selective about them, and is tired of go-nowhere relationships with airheads.

    28. Re:More like "Deception Point" than the X-Files by Lemmy+Caution · · Score: 0

      Gah.

      Bad taste in an anaphrodesiac. I'm sorry, there's only so much effort I can give to pretending to be interested in someone's inane babble in the name of sex.

      Having different tastes is one thing - in fact, it can be healthy. But those different tastes should at least be at the same tier: I could deal with a partner who prefers Joyce, or even Updike or Hemingway, while I prefer Proust or Barthelme. But not with someone who prefers Star Wars novels.

      Unless I was under no obligation to hear them speak or read a word they wrote. Then, there's room for negotiation.

      I think the GP should find someone with comparable (not identical) tastes and sophistication to his own... he should get back on his high horse and find someone else who's also on a good horse. Life is too short to waste it with someone whose inner life bores you.

    29. Re:More like "Deception Point" than the X-Files by HolyCrapSCOsux · · Score: 2, Funny

      "or worse, likes the PS3"

      Turning a girl away because she likes PS3 may be a good thing. If she doesn't already have said console, she may expect you to buy it for her as a tribute. (Diamond earrings are cheaper)

      --
      0xB315AA8D852DCD3F3DCA578FD2E0BF88
    30. Re:More like "Deception Point" than the X-Files by Anonymous Coward · · Score: 0

      What a douche. I'm no fan of Dan Brown, but I'm certainly not going to be prejudiced toward people who enjoy the particular genre he writes in. And seriously, Cervantes? If you are going to compare "writing talent," you sure as hell shouldn't be comparing a translation (assuming you aren't speaking of the original Spanish works) of a non-English work to something that was written in the language--nevermind the fact that he is an absurdly safe author to choose seeing that his works have helped form the foundation of western fiction...

  7. Canadians! by jrwr00 · · Score: 5, Funny

    I knew it! Canadians are from outerspace!

    1. Re:Canadians! by ppc_digger · · Score: 0

      I knew it! Canadians are from outerspace!

      They have to be. Did you ever see a Human with a bouncing head?

      --
      Of all major operating systems, UNIX is the only one originally meant for gaming.
    2. Re:Canadians! by Anonymous Coward · · Score: 0

      Yes. A Canadian.

    3. Re:Canadians! by Superpants · · Score: 5, Funny

      That is right, now bow before us and pay respects at the church of Tim Hortons. There you can partake in the holy consumption of maple-glazed doughnuts and watch the revered sport of hockey while drinking vast quantities of beer.

      Since it is Sunday, a toque is mandatory for all. Those failing to cover ones head with the divine knit-cap will be punished by means of harsh words.
      That is all.

    4. Re:Canadians! by iceborer · · Score: 5, Funny

      Canadians are from outerspace!

      I believe that you mean oater space.

    5. Re:Canadians! by thesergey · · Score: 1

      I dunno, don't give Canadians too much credit.

    6. Re:Canadians! by Redlazer · · Score: 1
      I, for one, welcome our new Canadian touqe-wearing, hockey playing, beer drinking overlords.


      -Red

      --
      Guns don't kill people, "with glowing hearts" kills people.
    7. Re:Canadians! by Anonymous Coward · · Score: 0

      When did Timmies start to serve beer, eh?

    8. Re:Canadians! by rsbng · · Score: 1

      LOLLLL! I know that, AYE!!

    9. Re:Canadians! by Howserx · · Score: 1

      -29C with wind chill today. Failing to cover one's head will be punished by loosing ears to frostbite. The bike ride to work tomorrow is gonna be a bitch.

      http://www.cbc.ca/weather/conditions.jsp?station=Y WG

      --
      I support the troops. I pay f'ing taxes.
    10. Re:Canadians! by 42_Ender · · Score: 1

      Eh?

    11. Re:Canadians! by mkw87 · · Score: 1

      Coffee, out through nose. Freaking halarious, thank you.

      --
      Arguing with an engineer is like wrestling a pig in mud. Soon, you realize the pig is dirty, and he likes it.
    12. Re:Canadians! by Anonymous Coward · · Score: 0

      The Tagish Lake meteorite looks very strange compared to most meteorites. It doesn't look like the usual grey rock or metal. It looks more like a cross between coffee grounds and a charcoal briquette, and has the low density to match. Thus, we might be looking at the ancient equivalent of Tim Horton's coffee, freeze-dried in deep space for eons.

  8. I've seen this before. by lupine_stalker · · Score: 4, Funny

    I've seen this movie... the organisms evolve... then get sprayed with napalm while Canada gets a dose of Head and Shoulders... or was it the other way round?

    --
    Ninjas use italics.
    1. Re:I've seen this before. by DurendalMac · · Score: 1

      No no, it's the story where an undiscernable color erupts from the rapidly dissipating and uncoolable meteorite, then begins eating away at everything, turning it an ashy gray color.

  9. Summary misleading... by CODiNE · · Score: 5, Informative
    From the article text :

    The structures are invisible to the naked eye and resemble minute hollow balls with carbon-rich shells. A chunk of meteorite no larger than a grape could contain a billion of the tiny globules.

    Theoretically, their hollow-ball shape could have presented a homey environment of concentrated organic matter where early cellular life could develop.

    Such theories boast little evidence but raise many intriguing questions.


    So from what I read they structures found COULD assist organic life, but are not actual evidence of them.
    --
    Cwm, fjord-bank glyphs vext quiz
    1. Re:Summary misleading... by osu-neko · · Score: 5, Informative

      So from what I read they structures found COULD assist organic life, but are not actual evidence of them.

      That's one point of view.

      There's a common myth that evidence speaks for itself. It doesn't. It just sits there on the lab table, incapable of speaking. Evidence also neither supports nor refutes any theory, these also being things evidence is incapable of doing unless the evidence is itself sentient. You're anthropomorphizing the evidence when you claim it supports or refutes a theory.

      Now, various interpretations of the evidence can be used by scientists to support or refute theories. Insofar as some scientists interpret this evidence in such a way that it allows them to argue for ET-assisted biogenesis, it is evidence for that. Of course, some scientists will interpret it differently and then it won't be evidence for that.

      All this is perfectly fine. Just don't make the mistake the quoted poster made, where you think there's a fact of the matter about whether this actually is or isn't evidence for one theory or another. Science doesn't work that way, that's just perpetuating a myth.

      --
      "Convictions are more dangerous enemies of truth than lies."
    2. Re:Summary misleading... by Anonymous Coward · · Score: 0

      > Just don't make the mistake the quoted poster made, where you
      > think there's a fact of the matter about whether this actually
      > is or isn't evidence for one theory or another.
      >
      But then there is not a fact of the matter about anything, except perhaps mathematical facts. If I see someone pick up a gun, aim it at me, say "now I am going to shoot you, Bjarke" and then shoots at me and hits, I am going to say that it is a fact that that is very good evidence that he tried to shoot me, and so would any reasonable scientist in the same situation. Perhaps he really did not try to do so, and it is not too hard to come up with some bizarre situation in which that would be true, but still those things I have mentioned are evidence that he did try to shoot me.

      To get out of all such examples, I think you will have to say that there is no such thing as good judgement as opposed to poor judgement, at least not in the absence of me or someone else arbitrarily declaring what is good and poor judgement in some situation. The problem with that is that everyone has to rely on some such notion in order to make decisions.

    3. Re:Summary misleading... by thedave · · Score: 1

      > All this is perfectly fine. Just don't make the mistake the quoted poster made . . .

      I didn't see the poster. I know the poster on my wall made a big mistake by putting too much fabric over the boobies.

      --
      [ .sig removed due to death threats from zealots who seek to control me out of fear for their hidden d
    4. Re:Summary misleading... by khallow · · Score: 1

      There's a common myth that evidence speaks for itself. It doesn't. It just sits there on the lab table, incapable of speaking. Evidence also neither supports nor refutes any theory, these also being things evidence is incapable of doing unless the evidence is itself sentient. You're anthropomorphizing the evidence when you claim it supports or refutes a theory.

      Can there be problems with anthropomorphizing physical phenomena? Of course? Is it a bad idea? No. The human being is capable of a lot of elaborate behavior. Further, as humans we have a decent understanding of humans and can fairly easily relate to models that use human behavior as analogy to describe otherwise difficult to understand physical phenomena. As long as you understand that the scientific method and virtually all physical phenomena isn't human beings and the respective analogies only go so far, then anthromorphization has tremendous value to communicate scientific ideas.
    5. Re:Summary misleading... by zCyl · · Score: 1
      There's a common myth that evidence speaks for itself. It doesn't. It just sits there on the lab table, incapable of speaking. Evidence also neither supports nor refutes any theory, these also being things evidence is incapable of doing unless the evidence is itself sentient. You're anthropomorphizing the evidence when you claim it supports or refutes a theory.

      *scratches head* So am I anthropomorphizing my table leg when I claim that it supports the table?

      Evidence can, of its own accord, support or refute a theory if the evidence is directly related to a prediction made by that theory. Little expertise or interpretation is required in such a case. (Example: I predict that if I drop this rock it will fall. The evidence will then support the prediction, in the same manner as a table leg, with no interpretation required.)
    6. Re:Summary misleading... by Ginger+Unicorn · · Score: 1

      "Is it a bad idea? No."

      It is when it only serves to cloud the public's perception of the scientific method, introduce misconceptions that hamper the acceptance of well supported theories and foster incorrect reasoning enabling charlatans and junk science to take advantage of the fact that the general public aren't aware that "the respective analogies only go so far".

      The fact that anthropomorphisation can made certain complex ideas easier to digest does not mean that it is always a good idea. And the case that was being made is one of those situations where an anthropomorphic analogy was inappropriate, because rather than making a complex idea more accessible, it was lazing attributing humanised characteristics to part of a system which does not actually exhibit those characteristics.

      So, in summary "Is it a bad idea? Sometimes."

      --
      (1.21 gigawatts) / (88 miles per hour) = 30 757 874 newtons
    7. Re:Summary misleading... by mapkinase · · Score: 1

      Using the same logic, buckyballs are organic matter too: (a) they are made of carbon (b) they are, well, balls.

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    8. Re:Summary misleading... by Raenex · · Score: 1

      I really don't understand your point. How would you have phrased the grandparent's post?

    9. Re:Summary misleading... by khallow · · Score: 1

      The fact that anthropomorphisation can made certain complex ideas easier to digest does not mean that it is always a good idea. And the case that was being made is one of those situations where an anthropomorphic analogy was inappropriate, because rather than making a complex idea more accessible, it was lazing attributing humanised characteristics to part of a system which does not actually exhibit those characteristics.

      The reason I posted in the first place was because I thought you were off base. The "evidence speaks for itself" is an example of a good analogy. It ties hypothesis testing to well understood actions and ideas. I grant that good ideas aren't always good ideas and for more complete understanding, you do have to abandon analogy, but often you don't need that level of detail.

      There are IMHO a number of scientific rules of thumb that are routinely misused ("Correlation does not imply causation" is another). Partly, I think it's due to a lack of appreciation for the instinctive or natural thought processes and shortcuts. These aren't fully rational, so they are dangerous to use, but I think it's healthier to train oneself to use them well and understand and perceive the numerous situations when they are grossly in error rather than attempt to route one's thinking around them.
  10. Wow, Life! by Dr.+Eggman · · Score: 0, Flamebait

    Life found in Canada! Wow!

    --
    Demented But Determined.
    1. Re:Wow, Life! by Tim+C · · Score: 1

      Organic matter isn't necessarily life...

    2. Re:Wow, Life! by Dr.+Eggman · · Score: 0, Offtopic

      Yeah, I know. I botched this joke terribly. =(

      --
      Demented But Determined.
  11. Keep in mind... by RyanFenton · · Score: 5, Informative

    Keep in mind that organic does NOT = life, just a precursor to life. Organic molecules/matter are generally just molecules containing carbon and hydrogen making a chainlike skeleton of atoms, with oxygen and/or nitrogen depending on if it is a protein. (Source). This DOES back up the hypothesis that organic molecules can form just as well outside of early earth, as in. It'll be interesting to hear just what the molecules were, but I doubt this will spawn any new theories about the extra-solar genesis of life on earth. It doesn't take special space-dust to provide organic compounds in the early earth - just the atoms from the life cycle of stars spreading heavier elements.

    Ryan Fenton

    1. Re:Keep in mind... by Ruff_ilb · · Score: 2, Interesting

      And heck, there's not any definitive proof that I know of that organisms have to be primarily carbon-based. Sure, it makes the most sense given the properties of the carbon atom, but it would be theoretically possible to have an organism based on something else.

      --
      http://www.TheGamerNation.com/Forums
    2. Re:Keep in mind... by MindStalker · · Score: 1

      Also carbon was very common in the early formation of the universe according to most big bang models. So carbon based lifeforms, while only one possibility, are probably the most likely.

    3. Re:Keep in mind... by Anonymous Coward · · Score: 1, Interesting

      The Big Bang didn't form any appreciable amounts of carbon. Carbon is formed in stars. Stars form more carbon than silicon (which is the element most similar to carbon and the most obvious potential alternative structural basis for life), which is a reason to think carbon based life would be more common. We really can't make any serious judgements about likelihoods at this point as we know very little about extrasolar planets and the conditions for life to arise.

    4. Re:Keep in mind... by schnikies79 · · Score: 1

      As a chemist I have to concede that carbon has some very unique properties, properties that don't exist in other places in the periodic table, but I'm still not convinced that life has to be carbon based. Most of colleges disagree with me, especially biologists, but there is a lot of stuff that we don't know about.

      --
      Gone!
    5. Re:Keep in mind... by StikyPad · · Score: 1

      Silicone based life walks among us.

    6. Re:Keep in mind... by Anonymous Coward · · Score: 0
      And heck, there's not any definitive proof that I know of that organisms have to be primarily carbon-based.

      Well, if it were the case, that would explain why the aliens keep butchering our cows. ;)
  12. Ancient astronouts by ZeroExistenZ · · Score: 2, Funny
    "What's really striking about this is that these globules clearly could not possibly have formed where [the meteorite] itself formed," Messenger said.

    Does that mean the meteorite pulverized some ancient astronouts in a far away galaxy?


    THAT might be the reason we haven't gotten contact yet with them; they would've cancelled their space project after such a PR-disaster...

    --
    I think we can keep recursing like this until someone returns 1
  13. Waaait a second... by Tibor+the+Hun · · Score: 4, Funny

    Does this mean we're all Canadians!!!?

    NOOOOOOOO

    --
    If you don't know what AltaVista is (was), get off my lawn.
    1. Re:Waaait a second... by MaXiMiUS · · Score: 0

      You make it sound like it's a bad thing!

      Bow down to your Canadiam single celled organism overlords!

      Disclaimer: I am Canadian.

      --
      It's never just a game when you're winning. - George Carlin
    2. Re:Waaait a second... by MaXiMiUS · · Score: 0

      I swear I clicked preview, but I guess Canadiam works too. I might have something here..

      --
      It's never just a game when you're winning. - George Carlin
    3. Re:Waaait a second... by Snosty · · Score: 5, Funny

      Nice try, you're not blaming us for George W.

    4. Re:Waaait a second... by Anonymous Coward · · Score: 0

      why do I feel thirsty all of a sudden?

  14. paging captain obvious? by WormholeFiend · · Score: 1, Insightful

    Earth didnt just appear out of nothingness... it had to get its organic compound from somewhere!

    Hence "nothing is created, nothing is lost, all is transformed".

    Still, it's pretty cool to have a piece of hard evidence to back up an obvious explanation.

    1. Re:paging captain obvious? by Kermit870 · · Score: 2, Insightful

      Agreed. But the organic compound has to come from *somewhere*. Even if it came from another planet source, that planet had to somehow receive the materials from somewhere else.

      So where does it start?

    2. Re:paging captain obvious? by Anonymous Coward · · Score: 0

      Matter is neither created nor destroyed.

      the law of conservation. It really doesn't play into affect here. The problem is... its not a matter of it being created or destroyed as in matter or molecules but the energy. You're looking at it in the wrong way. If you used your logic then that material has always existed and must always exist in that form.

      I dunna. I think the whole ET asteroid life sounds like a load of shit to me. I stick with Miller-Urey thank you very much. For those of you that don't know Miller and Urey set out to disprove that life could've formed on it own on Earth and in the end actually PROVED that it COULD have happened that way. Mix a few gases (CHNOPS) and a zip-zap of lightening .... !!!!

    3. Re:paging captain obvious? by Anonymous Coward · · Score: 0

      huh...so ?

      and that somewhere got it from ???

      All this means is that there are carbon based compounds outside of earth too (and about their possible age) . Nothing more nothing less ..( we do know of methane in other planets already ). Big bang does not make a distinction about the initial origins of different bodies, so there is no reason to assume that organic matter in earth has to be from somewhere else in space...

    4. Re:paging captain obvious? by Evan+Meakyl · · Score: 1

      I don't say that it has happened like this, but organic compounds can be created from "basic" elements, see the Urey Miller experiment ( http://en.wikipedia.org/wiki/Miller-Urey_experimen t ).

  15. Oh, boy! by Dorsai65 · · Score: 1

    Andromeda Strain comes to life?

    --
    --- Asking inconvenient questions for over 30 years...
  16. Hoyle's "The Black Cloud" is key novel by Anonymous Coward · · Score: 0

    It is MUCH closer to the science of Fred Hoyle's great novel "The Black Cloud" [Harper & Row, 1964; Science Fiction Book Club; Signet]. Life evolved in Giant Molecular Clouds, became intelligent, one comes to our Solar System, blocks sunlight, causing predecessor to concept of nuclear winter; society restructured in face of climate change. Great, prescient novel by radical astronomer.

    [Sir] Fred Hoyle, famous British astronomer, leading sceptic of (and namer of) the "Big Bang" cosomology and leader of the alternative "Steady State Hypothesis." With Wickramasinghe, originated the theory that bacteria and viruses come from outer space ("panspermia").

    Novels by him and his son exist; now solo novels by his son. For more, see: Science Fiction Writers with last names starting "Ho"

    Professor Jonathan Vos Post

    1. Re:Hoyle's "The Black Cloud" is key novel by Virgil+Tibbs · · Score: 1

      personally, having read the black cloud. This seems more Evolution http://www.imdb.com/title/tt0251075/

      Plot Outline: A firefighting cadet, two college professors, and a geeky-but-sexy government scientist work against an alien organism that has been rapidly evolving ever since its arrival on Earth inside a meteor.

      --
      www.tdobson.net #### Dare to Dream #### blog.tdobson.net
  17. So what. Its happened plenty of times before by Anonymous Coward · · Score: 3, Insightful

    Organic matter has been found in meteorites decades ago.

  18. Canadian! by G_Sus2019 · · Score: 0

    Sounds like the remains of the Canadian who came almost all the way back from the stars

  19. Black oil alien by HangingChad · · Score: 1

    Canadian scientists discovered a black, oily substance inside a meteorite...agh...ah...agh...act normally and await further instructions.

    The truth is out there, aye.

    --
    That's our life, the big wheel of shit. - The Fat Man, Blue Tango Salvage
    1. Re:Black oil alien by mnmn · · Score: 1

      Nice sig.

      Its Genghis Khan (really: Chinggis Khan) , and he fell off a horse, not a pony.

      --
      "Give orange me give eat orange me eat orange give me eat orange give me you." -Nim Chimpsky
    2. Re:Black oil alien by popsicle67 · · Score: 1

      Few of the horses in his cavalcade were said to be over 14 hands, thus it may be inferred that he did indeed die from falling off a pony.

    3. Re:Black oil alien by ViciousAndCruel · · Score: 1

      > The truth is out there, aye.

      You mean "The truth is out there, Eh"

    4. Re:Black oil alien by HangingChad · · Score: 1

      You're right about the spelling, backed up by Wikipedia. Corrected as noted.

      But I've seen steppe horses in real life and despite being tough, sure footed and strong, they're still ponies in my book. Your legs almost drag on the ground.

      --
      That's our life, the big wheel of shit. - The Fat Man, Blue Tango Salvage
    5. Re:Black oil alien by Lennie · · Score: 1
      --
      New things are always on the horizon
  20. Panspermia by symbolset · · Score: 3, Interesting

    Attributed to Anaxagoras ( http://en.wikipedia.org/wiki/Anaxagoras ) in the 5th century BCE. Basically the idea the precursors to life are everywhere in the universe, allowing that life on earth may have sprung from this source.

    It seems plausible. This evidence doesn't prove it though.

    FTA:

    The structures are invisible to the naked eye and resemble minute hollow balls with carbon-rich shells. A chunk of meteorite no larger than a grape could contain a billion of the tiny globules.

    Fullerene? That would explain a lot about the persistence of these structures through the process of transport and reentry.

    Disclaimer: "God moves in mysterious ways His wonders to perform." - William Cowper ( for varying values of "God", "mysterious", "wonders" - symbolset )

    --
    Help stamp out iliturcy.
    1. Re:Panspermia by alexhard · · Score: 1

      Attributed to Anaxagoras Damn, those ancient Greeks were a pretty smart bunch..
      --
      Infinite time means everything that can happen, will. You being you is absolutely incidental. You do not exist.
  21. so what? by stachu+trawki · · Score: 2, Funny

    Methane (CH4) found for example in vast quantities on the most outer planet, Plutonium, is also an organic compound. But it does not mean that there is, or has ever been, life. First, we need to know when compound it was. Otherwise there's really nothing to talk about.

    1. Re:so what? by Anonymous Coward · · Score: 1, Funny

      Plutonium, is also an organic compound

      So which bit of "organic" or "compound" don't you understand?

    2. Re:so what? by Anonymous Coward · · Score: 0

      you sir, are wrong. Why do you feel you have the ability to even spew a comment so lacking in any understanding? Do you think you are adding to the conversation? You are not. Plutonium an organic compound...seriously??? You really believe that? Methane on the most outer planet (Neptune) I guess is correct. You probably wanted to say most outer planets.

      It would be helpful in the future if you did not comment on anything you have no idea about. It helps the others have stimulating conversations.

    3. Re:so what? by tcc3 · · Score: 2, Interesting

      I think he meant Pluto the (former?) planet, not Plutonium the element.

    4. Re:so what? by Anonymous Coward · · Score: 1, Funny

      Oh come on.. Everybody knows the methane on Pluto came from Uranus.

  22. how to measure the age by Meltir · · Score: 5, Insightful

    Im actually interested, how do you measure the age of an object so old, when its not from earth ?
    I mean the amount of radioactive materials that fall apart a thousand or so years after being 'inserted' into a certain object is valid only if we know the amount on the env surrounding it.
    How do we know how old this thing is without actually being sure where it came from ?

    Maybe there was less of the izotope in the env. ?
    Or maybe there was much, much more of it ?

    This is besides the point if the rock actually contains some fossilized life forms, if its a billion years younger or older, then this fact makes a pretty big difference, right ?

    I understand that the age of stars can be measured by the spectrum (iirc, as light travels further/longer it leans towards one of the edges).

    I also get how we can determine how we check the basic building block of an object a milion light years away by the light spectrum too.

    But the age, when we are not really sure of the exact amount of izotopes in the env. ?

    Could somebody educate this fool with a friendly wikipedia link ?

    1. Re:how to measure the age by Bemopolis · · Score: 5, Informative

      First, just to whip out my creds I have a doctorate in astronomy, although not in this sub-field...

      The typical way to set an age of a very old object is, as you note, by looking at its radioactive decay history. A good chronometer for meteorites is uranium, both U238 and U235. They have different decay rates, so the difference between the starting and ending abundance ratio of the two gives you the age. As you note, the trick is to determine what the starting ratio is; this is largely an educated guess, but presumably the population seen in the meteorite was created in the same supernova explosion, so a little nuclear physics tells you what that should be (Google 'neutron drip line'). A good check on the result is to also look at the isotope ratio of lead: Pb207 is the daughter of U238 decay, and Pb206 the daughter of U235. There are several other useful decays to check (Al26 comes to mind), so while it's admittedly a house of cards (but so is everything in astronomy, really) , it is at least more than one card.

      And, not to be critical, but your description of determining the ages of stars is...off. To be fair, it is a difficult method to both explain and perform for individual stars.

      --
      "I guess the moral of the story is, don't paint your airship with rocket fuel." -- Addison Bain
    2. Re:how to measure the age by Anonymous Coward · · Score: 0

      I'm guessing that you would use the spectrum to measure the distance from Earth, not age of the star.

    3. Re:how to measure the age by scooter.higher · · Score: 1

      I suppose it's time to whip out *my* creds... I am an active member of the Church of the Flying Spaghetti Monster.

      Let me enlighten you with a direct quote from the prohpet (Bobby Henderson) in his open letter (http://www.venganza.org/about/open-letter/):

      "Some find that hard to believe, so it may be helpful to tell you a little more about our beliefs. We have evidence that a Flying Spaghetti Monster created the universe. None of us, of course, were around to see it, but we have written accounts of it. We have several lengthy volumes explaining all details of His power. Also, you may be surprised to hear that there are over 10 million of us, and growing. We tend to be very secretive, as many people claim our beliefs are not substantiated by observable evidence. What these people don't understand is that He built the world to make us think the earth is older than it really is. For example, a scientist may perform a carbon-dating process on an artifact. He finds that approximately 75% of the Carbon-14 has decayed by electron emission to Nitrogen-14, and infers that this artifact is approximately 10,000 years old, as the half-life of Carbon-14 appears to be 5,730 years. But what our scientist does not realize is that every time he makes a measurement, the Flying Spaghetti Monster is there changing the results with His Noodly Appendage. We have numerous texts that describe in detail how this can be possible and the reasons why He does this. He is of course invisible and can pass through normal matter with ease."

      I hope this clears up this little debate.

      --
      Ramen
  23. The forming of the first nations. by Enema · · Score: 0, Troll

    Quite frankly, I fail to see how this affects the recent rise of lolography on the internet. Perhaps we can harvest the organic material to create a device to aid humanity in frying bacon shirtless, without risk of trauama.

  24. I know that it's 'hip' on Slashdot to bash popular by WilliamSChips · · Score: 0

    things, but Dan Brown is actually a good author. I guess the new Slashdot prefers Jerry Falwell.

    --
    Please, for the good of Humanity, vote Obama.
  25. Re:I know that it's 'hip' on Slashdot to bash popu by theshowmecanuck · · Score: 1

    Well Jerry does come up with a lot of good fiction.

    --
    -- I ignore anonymous replies to my comments and postings.
  26. No Intelligent Life at NatGeo by Doc+Ruby · · Score: 3, Insightful

    What kind of "news" story makes such a big deal out of such a fundamentally important claim - "organic matter older than the Sun found in Canadian meteorites", but doesn't say exactly what makes these "globules" qualify as "organic"? The only details about the claimed "organic" matter are that they "resemble minute hollow balls with carbon-rich shells", where "minute" is vaguely implied to be smaller than 10 um^3. (a billionth the volume of a grape).

    There's more info detailing that the Yukon is cold and unpopulated than any info about how this carbon is "organic".

    In fact, practically all carbon on the Earth is older than the Sun. Carbon is produced in the cores of unusually massive stars, then distributed across the Universe after the star explodes in supernova or similarly huge cataclysm. Just composition of carbon, and the other "organic" elements (nitrogen, oxygen and hydrogen) essential to Earth organic chemistry, doesn't make these tiny grains accurately called "organic globules".

    Maybe actual science, written by an actual journalist, could report the more important facts behind this sensational headline.

    --

    --
    make install -not war

    1. Re:No Intelligent Life at NatGeo by Bloke+down+the+pub · · Score: 1
      Maybe actual science, written by an actual journalist, could report the more important facts behind this sensational headline.
      Did you inherit that user-id?
      --
      It's true I tell you, feller at work's next door neighbour read it in the paper.
    2. Re:No Intelligent Life at NatGeo by Doc+Ruby · · Score: 1

      No, I made it up all by myself. Who pushed that sense of humor on you?

      --

      --
      make install -not war

    3. Re:No Intelligent Life at NatGeo by Anonymous Coward · · Score: 0

      In chemistry, organic at the most basic level just means a molecule containing carbon and hydrogen.

      As such, I fail to see the enormity of the implications of this discovery. In fact, I believe it was known from the first examinations that the Taggish Lake meteorite contained organic material. So far, it seems that the fact that material in the interior of the meteorite is largely undisturbed from a very primordial state is interesting, but not very revealing in any sense.

  27. IN THE BEGINNING... by CheeseburgerBrown · · Score: 1, Flamebait

    God created GOO. And He saw that it was GOOD.

    So he sprayed it all over a bunch of his pet shit that was busy coalescing into a webbing of galactic vortices and pinpricks of fusion according to a set of the laws of physics he read out of an ad in the back of a magazine.

    Now what we need is a big, big KLEENEX.

    1. Re:IN THE BEGINNING... by TeknoHog · · Score: 0, Flamebait

      Now what we need is a big, big KLEENEX.

      Yeah, because if you're right about this God thing, then one day Jesus will come.

      --
      Escher was the first MC and Giger invented the HR department.
    2. Re:IN THE BEGINNING... by mikiN · · Score: 0, Offtopic

      Worship the Great Green Arkleseizure! Beware of the Coming of the Great White Handkerchief!

      --
      The Hacker's Guide To The Kernel: Don't panic()!
    3. Re:IN THE BEGINNING... by Anonymous Coward · · Score: 0

      Are you saying: God shot his wad in the Big Bang?

  28. Digital Fortress - especially bad by hey · · Score: 1

    Just a warning, Dan Brown's "Digital Fortress" is especially BAD.
    I found Da Vinci tolerable because I don't know anything about the christian church but since Digital Fortress is about computers (which I and Slashdotters know about) it was excruciating.
    Set in modern times the description of the big computer make it sound more like a steam engine!
    Don't buy this book.

    1. Re:Digital Fortress - especially bad by LaughingCoder · · Score: 1

      I agree heartily. Digital Fortress drove me nuts. I have to say, of the 3 Dan Brown books I've read, Angels and Demons was the best; I enjoyed it much more than Da Vinci Code.

      --
      The more you regulate a company, the worse its products become.
    2. Re:Digital Fortress - especially bad by thedave · · Score: 1

      And, now having read the Da Vinci code, you still know nothing about the christian church.

      That book was the most poorly contriived piece of drivel since the King James Bible.

      --
      [ .sig removed due to death threats from zealots who seek to control me out of fear for their hidden d
  29. Re:Organical matter = lifes by The+name+is+Dave.+Ja · · Score: 5, Funny

    WRONG:
    My life sci 101 class teached me that ...

    CORRECT:
    My life sci 101 class learned me that ...

    Let's get it right, people.

    --
    Oh Yoshimi, they don't believe me
    But you won't let those robots defeat me

  30. great balls of fire by phyruxus · · Score: 3, Interesting

    iirc, only the outermost few centimeters of any incoming meteor are ever heated. If you come upon a just-crashed meteorite that is broken open, it will be cold on the inside, and the outside will be cool to the touch in (again iirc) minutes.

    --
    "A witty saying proves nothing." ~Voltaire
    "d'Oh!" ~Homer
  31. Organic by Anonymous Coward · · Score: 0

    You keep using that word. I don't think it means what you think it means. ;>

    An organic compound is any member of a large class of chemical compounds whose molecules contain carbon and hydrogen. http://en.wikipedia.org/wiki/Organic_compound

  32. Re:Organical matter = lifes by Anonymous Coward · · Score: 0, Funny

    Someone mod down the above moron, please.

    CORRECT:
    My life sci 101 class taught me that ...


    Unless of course we're having some stupid competition for the lamest English possible, in which case I submit the following:

    My life sci 101 class educatified me that ...

  33. Perhaps meteorites explain left handedness by edbarbar · · Score: 1


    Given that almost all life uses left handed amino acids, perhaps that is were life came from: some meteorite that favored left handed forms.

    That there aren't right handed forms also suggests life might be hard to get started (someone help out here, could left handed life forms get calories from right handed life forms?).

    --
    Ed Barbar, President and General Manager, Furnit USA
    1. Re:Perhaps meteorites explain left handedness by primenerd · · Score: 1

      You are correct, all life uses L-amino acids (except glycine which lacks a chiral alpha carbon) and D-sugars. This leads to some fascinating biological implications.
      There have been experiments where an enzyme is re-created using D-amino acids using chemical synthesis. The enzyme is functional, but it will only work on the chiral opposite of the natural enzymes substrate. What this means is that if you were to travel to a planet populated by D-amino acid based life, you could eat as much as possible and still starve (because all the enzymes in your body are tooled for L-aa sand D-sugars).
      In fact one of the tests being considered for detecting life on other planets involves taking a potentially biological sample, running it over a chromatography column to isolate a single species (say a particular amino acid) and checking it for chirality using plane-polarized light. Such tests have been done in the past on organic meteorite samples, they showed a 50:50 racemic mixture, leading to the conclusion that organic deposits in meteorites are abiotic in origin.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    2. Re:Perhaps meteorites explain left handedness by edbarbar · · Score: 1


      That's interesting. Given this,it would seem L and D life forms are orthoganal (outside, perhaps of plant life forms). One might expect "L" and "D" forms in the same bio-sphere if life were common.

      I've read some are thinking perhaps meteors have biased amounts of L and D amino acids. The thinking is how can we explain only "L" handed life forms. If that doesn't turn out to be the case, another explanation gains credibility.

      That is, perhaps it is really unusual to get life started in the first place.

      --
      Ed Barbar, President and General Manager, Furnit USA
    3. Re:Perhaps meteorites explain left handedness by mikiN · · Score: 2, Informative

      Wikipedia article on the Murchison meteorite. The entry mentions the idea that "a small amount of chiral amino acids [on meteorites] may explain the evolution of right-handedness of sugars."

      Also, here is an abstract of an article on extraterrestrial chirality w.r.t. the Murchison and Murray meteorites.

      --
      The Hacker's Guide To The Kernel: Don't panic()!
    4. Re:Perhaps meteorites explain left handedness by mikiN · · Score: 1

      Strike my [on meteorites] insertion. Of course, the idea is much more general. It doesn't matter whether the chiral amino acids come from meteorites or not.

      --
      The Hacker's Guide To The Kernel: Don't panic()!
  34. It was probably by JustOK · · Score: 0, Offtopic

    ...Poutine, I'm guessing.

    --
    rewriting history since 2109
  35. Re:Organical matter = lifes by The+name+is+Dave.+Ja · · Score: 1

    *ding*
    We have a winner!

    Even though I am deeply hurt by your insulting tone, I will concede that you are at least open to the possibility of humour. Other hints might be the use of "organical" and "lifes" in the subject line.

    I haven't heard "educatify me" before, but I maybe you can learn me about it.

    Cheers!

    --
    Dave - putting the 'pro' in procrastinate

  36. New summary, sensationalism aside by Yvanhoe · · Score: 2, Insightful

    A Canadian meteorite, dating from the formation of the solar system, has been found in Canada. Like many other meteorites, it contains organic matters. The article doesn't state it, but it is probably something akin to amino acids. Apparently, it is the first time this organic matter is found in spherical bubbles, that the original article misleadingly calls "globules". As usual, the article is light on technical details but heavy on wild crazy sensationalist extrapolation. The journalist would like to make believe that cells could have existed on these meteorites but unfortunately has strictly no evidence of this.

    "The structures are invisible to the naked eye and resemble minute hollow balls with carbon-rich shells. A chunk of meteorite no larger than a grape could contain a billion of the tiny globules.

    Theoretically, their hollow-ball shape could have presented a homey environment of concentrated organic matter where early cellular life could develop.

    Such theories boast little evidence but raise many intriguing questions. " (emphasis mine)

    --
    The Wise adapts himself to the world. The Fool adapts the world to himself. Therefore, all progress depends on the Fool.
    1. Re:New summary, sensationalism aside by Legion303 · · Score: 1

      "Apparently, it is the first time this organic matter is found in spherical bubbles, that the original article misleadingly calls 'globules'. As usual, the article is light on technical details but heavy on wild crazy sensationalist extrapolation."

      The term "globules" is used in the _Science_ article (not the linked National Geographic one) so much that it appears to be a technical term--I'm not familiar with chemistry.

      The speculation that life could have arrived on earth via Meteorite Express came from the paper's authors, who were at least careful enough to say that more studies were needed before we could even contemplate the idea:

      "Microscopic organic globules may thus have been a common form of prebiotic organic matter delivered to the early Earth by comets and meteorites. Further studies of these objects may elucidate whether their composition and membrane-like structures were important building blocks for the origin of life."

    2. Re:New summary, sensationalism aside by Anonymous Coward · · Score: 0

      I'm not sure "Theoretically" means what you think it means...

  37. EM Radiation Interferes with Absolute Dating by pln2bz · · Score: 2, Interesting

    I wouldn't believe the dating results for these types of things. There is a big problem with trying to date asteroids, meteorites and such.

    Absolute dating assumes that isotopes degrade in a purely statistical manner. There is reason to believe, however, that changes in electromagnetic bombardment of an isotope can affect the decay of those isotopes. Using a simple experimental apparatus, decay rates can be correlated with the phases of the moon, the motions of the Sun and the stars. Go to http://www.21stcenturysciencetech.com/articles/tim e.html for the details. This is not some crazy idea. Labs already perform corrections on raw carbon dating data due to electromagnetic bombardment into the atmosphere (which affects the amount of carbon isotopes in the atmosphere, which are then inhaled by living things).

    There is also good reason to believe since the Deep Impact mission to Comet Tempel 1 that comets are merely asteroids on elliptical orbits that have picked up the voltage of deep space and then come into range of the Sun's weak electric field. Rather than being the trail of sublimating ice, the comet's coma and tail are evidence of electric machining. This makes sense because asteroids have occasionally been observed to turn into comets near the gas giant planets. If this is true, then this would mean that asteroids are regularly exposed to potentially large amounts of electromagnetic radiation. For more information, go here: http://www.thunderbolts.info/pdf/ElectricComet.pdf .

    This process of electric machining would almost surely affect the dating ages of these objects *if* the experiment linked to above is true. It might also explain why some craters don't quite date to the years that we think they should.

    This of course causes all sorts of problems for archaeology, geology and astronomy, and this fact alone might induce a lot of scientists to want to look the other way. So, I wouldn't expect a lot of curiosity on these things so long as they pose such a threat to research that has already been done.

    --
    "A man cannot begin to learn that which he thinks he already knows." --Epictetus, 1st Century A.D.
    1. Re:EM Radiation Interferes with Absolute Dating by uid7306m · · Score: 2, Informative

      Uh, you're a bit confused.

      Carbon-13 dating does indeed need corrections for the level of solar activity,
      but that's a bit of an exception. The corrections don't have *anything*
      to do with how fast the Carbon-13 decays, though: they relate to how much
      C-13 is in the atmosphere.

      The way it works is like this:

      Carbon-13 decays in about 5000 years. Why do we still have some around then?
      That's because it's constantly being made as cosmic rays hit the upper atmosphere
      of the earth. Now, as a tree grows, it incorporates carbon from the environment,
      including C-13. When the tree dies, the incorporation pretty much stops.
      So, once the tree dies, no more C-13 comes in, and whatever is there continues
      to decay. Thus, some wood with a lot of C-13 is new because the C-13 hasn't
      had time to decay. Wood with very little C-13 is old, because it has been
      dead (i.e. disconnected from the environment) for long enough for most of the
      C-13 to decay.

      So, how does solar activity come into the picture? If the sun is inactive,
      more cosmic rays come in from outer space and hit the Earth's atmosphere.
      Thus more C-13 is made. Thus, a tree growing in a time with less solar
      activity incorporates more C-13, and thus when you do C-13 dating of it,
      it seems to be newer than it really is. The C-13 always decays at the same
      rate, but if you start with more, you end up with more.

      Vice versa, if the sun is particularly active some decade.

      Now, this explanation doesn't apply to most kinds of radioactive dating.
      Uranium dating, for instance, looks at U-238 that has been there since
      the beginning of the solar system, and cosmic rays just don't matter.

    2. Re:EM Radiation Interferes with Absolute Dating by TapeCutter · · Score: 1

      "This of course causes all sorts of problems for archaeology, geology and astronomy, and this fact alone might induce a lot of scientists to want to look the other way. So, I wouldn't expect a lot of curiosity on these things so long as they pose such a threat to research that has already been done."

      AFAIK scientists spend a considerable amount of time looking for interesting problems, there is very little glory to be found in confirming the status-quo. It's also a good idea to actually understand the status-quo before claiming to have found a problem, it makes it so much more interesting for the reader.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    3. Re:EM Radiation Interferes with Absolute Dating by pln2bz · · Score: 1

      I'm not alleging that the carbon dating decay rate is being affected by EM radiation. I'm alleging that the mere fact that EM radiation affects the amount of carbon isotopes in the atmosphere is reason to believe that EM radiation does interact with these particles in a general sense, and that we should not be surprised if there is more interaction than has been presumed so far.

      Now, this explanation doesn't apply to most kinds of radioactive dating. Uranium dating, for instance, looks at U-238 that has been there since the beginning of the solar system, and cosmic rays just don't matter.

      This is actually the heart of the issue, and after supplying a more detailed explanation of the process for carbon dating, you appear to dismiss the possibility that this might also be happening for the decay rates of isotopes used in other dating techniques without actually reading the article that I pointed to and without providing any actual evidence for why decay rates would be resistant to EM radiation.

      I'd really like to hear what you have to say about the article I linked to. Can you please read and comment on it?

      --
      "A man cannot begin to learn that which he thinks he already knows." --Epictetus, 1st Century A.D.
    4. Re:EM Radiation Interferes with Absolute Dating by pln2bz · · Score: 1

      Can you please comment on the article I linked to in my posting? Threads would also be more interesting if people actually read the links being discussed.

      --
      "A man cannot begin to learn that which he thinks he already knows." --Epictetus, 1st Century A.D.
    5. Re:EM Radiation Interferes with Absolute Dating by TapeCutter · · Score: 1

      IANAP so do not have the time, background or inclination to research your pet theory. My post was responding to your use of blatantly false sterotyping to support said pet theory.

      If you don't want responses that object to your use of ad-hom's then don't post them in the first place, simple huh?

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    6. Re:EM Radiation Interferes with Absolute Dating by pln2bz · · Score: 1

      It's a common misconception that people have to be physicists in order to hold a belief in physics. The fact that you've decided that these issues are beyond your own comprehension is typical, even of intelligent people. It's exactly what the physicists (particularly the astrophysicists) have taught us to believe. We can evaluate their statements though as a whole on the basis of their methodology and a few specific examples. Absolute dating of any object older than the dendrochronological record is questionable and people should treat it that way. But that's not how it's portrayed in the media. People tend to believe that our science works as well as our technology. But the fields of geology, archaeology and astronomy are all based upon uniformitarianism -- this thought that we can understand the past by just looking around us right now. It's a flawed theory. Some phenomenon are transient or difficult to observe in real-time. Also, one should expect that we live in a relatively "safe" region of the universe that is not indicative of the normal violence we see through our scopes.

      I'm going to continue to post on Slashdot about this subject. I feel that I am doing a service by injecting a fresh perspective in spite of the fact that I repeatedly receive verbal abuse for believing something that's out of the mainstream. It's possible that some of the things I'm saying are wrong, but there are very good reasons to believe that my bigger "pet theory" (The Electric Universe Theory) is true. The science of weather control is being born right now and it is based upon Electric Universe Theory. Countries are using this technology right now to edge out their neighbors in crop yields. Scientists will discount the theory because there is no article in a refereed journal to support it. But that's the point: they refuse to consider the theory in the first place. This is what I'm fighting. I just want people to learn about the theory.

      This theory has implications for understanding and controlling earthquakes, tornadoes and hurricanes as well. An amateur picture shows the plasma trail of the Space Shuttle Columbia being hit by upper-atmosphere lightning at the exact moment of its malfunction. The picture was discounted primarily because the Earth is not believed to exchange charge with outer space. But it does, no differently than comets have been observed to do. It's so surreal that saying that receives so much condemnation, and yet people accept that 95% of the universe is invisible to all of our telescopes like mindless drones.

      The flashing of neutron stars bears a striking resemblance to sparking and many neutron stars have observable companion stars right next to them. But we choose to instead believe that neutron stars are stars spinning at up to 300 revolutions per second. The only reason we make this choice is because we believe in the Big Bang. But the Big Bang is still just a theory, right? Can't there be alternative cosmologies still?

      The most disturbing part of the theory is that the Sun is not the benign star that we always thought it was. Sudden coronal mass ejections have been observed on nearby star systems that would have destroyed all life on our planet had they occurred for our Sun. Traditional astrophysics tells us that stars evolve, but we've seen lots of stars in the universe violate their stellar evolutions on multiple occasions. Of course, Big Bang advocates have developed explanations for those observations. But we are seeing our own Sun brighten right now on top of the solar cycles. Neptune is also brightening and even changing color. Conventional astrophysics has no explanation for these things. This makes perfect sense in Electric Universe Theory though. The planets and stars are all electrically connected. The 11-year solar cycle in fact is caused by the movement of the gas giant planets. Those gas giants can become stars in their own right under the right situation.

      Nebulae have been observed to contain electrical fields acting over condu

      --
      "A man cannot begin to learn that which he thinks he already knows." --Epictetus, 1st Century A.D.
    7. Re:EM Radiation Interferes with Absolute Dating by pln2bz · · Score: 1

      Actually, I'm going to add one more thing that you should be able to understand as a non-physicist.

      Astrophysicists have convinced the world that that the Sun is benign -- that it will follow an orderly scheduled routine of steps that won't even start happening for billions of years. First of all, think about how you go about disproving something like that: it is not a falsifiable claim. Every time that we see a star break these rules, they propose an additional mechanism for the anomaly -- while retaining the stellar evolution model. This is not rocket science. That's bad science.

      If that was the end of it, then so be it. But it doesn't stop there. Now that they've convinced us that the Sun is benign, they exclude all research that contradicts this claim. Halton Arp tried to publish a paper 30 years ago that definitively disproved the Big Bang model. His reward was that he lost his telescope time. And to this day, his line of research, which continues to gain observational support as time moves forward, is not considered a valid line of research.

      This is the most asinine thing that any culture could do to itself. It's completely self-destructive, and it has caused our society to take our existences for granted. We feel that we are in command of our own existences: so long as we avoid killing ourselves, we will continue to exist. If an asteroid comes our way, we can do things about this. But the Sun could never possibly do anything to harm us. It's such a juvenile thought actually. I mean, what's the limit to a coronal mass ejection? Once again, according to uniformitarianism, we *assume* that there is in fact a limit because the past and future must be *just* like the present. Once again, that's bad science.

      The Sun could turn off tomorrow according to The Electric Universe Theory -- a theory which has not been disproven and which appears to have lots of observational support. As a person who respects life, loves science and is happy to think that I'll be here tomorrow, the thought that humans could take such a gamble seems surreal. We should be investigating it even if we think it's not true so long as it has not been disproven. There are enough telescopes to be investigating multiple cosmologies. Having multiple cosmologies would even be better because it would create a debate and inspire people to actually *think* about the things that they're being told. If astrophysics was the Republican Party, then NASA would be the equivalent of Foxnews. The head of the party sets the tone for the entire party and everybody just nods their heads to the tune of the talking points like a giant echo chamber.

      "IANAP". I'll definitely remember that one. That's so emblematic of the whole problem. I'm not a physicist. I couldn't possibly understand these things because *they* told me so. So it's not my problem. I expect to be here tomorrow. I deserve it.

      Like I said before, think for yourself. If more people were doing that, then we'd all be better off.

      --
      "A man cannot begin to learn that which he thinks he already knows." --Epictetus, 1st Century A.D.
    8. Re:EM Radiation Interferes with Absolute Dating by TapeCutter · · Score: 1

      Like I said IANAP but I do have a BSc, the reason I don't want to look into your theory (apart from it chewing up time) is twofold.

      1. You support it by claiming a conspiracy of silence and disparaging others in the field.

      2. You are confused about what the current theories actually say, ie: you are attacking a straw-man.

      The only method by which you will get scientists to look at your theory seriously is the scientific method and in practice that means peer-review. Can you point to any peer-reviewed papers that describe your pet theory or is it all just star-trek speak?

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    9. Re:EM Radiation Interferes with Absolute Dating by TapeCutter · · Score: 1

      ""IANAP". I'll definitely remember that one. That's so emblematic of the whole problem. I'm not a physicist. I couldn't possibly understand these things because *they* told me so."

      IANA surgeon either, the difference between you and me is that I belive the system "works" and ask questions, you belive the system is slanted against you but would demand a qualified surgeon anyway.

      "Like I said before, think for yourself. If more people were doing that, then we'd all be better off"

      Would you agree "thinking for myself" would include not swallowing the assertions in a slashdot post simply because the authour insults my intelligence?

      BTW: The electric universe theory is not you "thinking for yourself" it is simply repeating someone else's theory. The EU theory uses real observations to attack imaginary problems in physics/cosmology and completely crushes the straw man it builds, so what? I repeat, show me any peer-reviewed article on the electric universe theory and maybe I will be encouraged to spend some time on it.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    10. Re:EM Radiation Interferes with Absolute Dating by pln2bz · · Score: 1
      I can point you to Halton Arp, who attempted to publish a paper explaining that quasars are being ejected from the centers of spiral galaxies. It is clear that a good number of these quasars do not appear to be at their cosmological redshift distances because they appear in *front* of spiral galaxies with lower redshifts. Since his paper was rejected and his telescope time was yanked, he has written about his findings in his book "Seeing Red". The point though is that his research was denied for publication with a note scrawled onto the paper by the editor of the Astrophysical Journal, "This exceeds my imagination". Because his research was contradicting the Big Bang Theory, his telescope time was yanked. This was 30 years ago. Misleading NASA press releases aside, nobody has ever successfully refuted that research. In fact, just recently, a paper came out in *support* of his findings. Here's the info, excerpted from http://www.thunderbolts.info/tpod/2006/arch06/0612 04arpejection.htm:

      Arp's ejection model (1998):
      http://www.journals.uchicago.edu/ApJ/journal/issue s/ApJ/v496n2/36745/36745.html

      As seen in the above illustration, quasars are ejected from their parent galaxy and will evolve into mature galaxies over time. Arp's model is based on observations of active (Seyfert) galaxies that show pairing of identically redshifted quasars predominantly along the minor (rotation) axis of these galaxies.

      In a recent paper by astronomers Lopéz-Corredoira and Gutiérrez (astro-ph/0609514), a statistical investigation was performed to test if there are overdensities of QSOs along the minor axis (rotation axis) of nearby galaxies, as predicted by Arp's model. To this end, the authors selected 71 nearby edge-on spiral galaxies that were sufficiently well-studied and compared the positions of QSOs from a large database. The edge-on constraint was necessary to ensure a clear direction of the rotation axis. Indeed, the authors found an overdensity towards the minor axis. Depending on the magnitude of the quasars, the overdensity was found to be between 13% and 38%, with a statistical significance of 3.9 sigma (chance of this finding being a fluke is roughly 1 in 10,000). While the authors are cautiously describing this result as "tentative", it is the first time that a statistical relation was found in support of Arp's ejection model.

      A lot has actually happened since then -- especially recently with the Deep Impact mission. It would appear that the results of that mission don't match traditional cometary theory *at all*. The curious thing though is that the unusual Deep Impact results did not cause a lot of chatter. And this is the problem with astrophysics today that links these two cases together: there is no interest in understanding anomalies anymore. If Whipple's theory about comets being pushed around by jets appears to be wrong, then comets continue to have unexplained non-gravitational acceleration. This is exactly what EU Theory states -- that there is a link between gravity and electrical charge of a body in space.

      I've spent time learning about the traditional model of astronomy. I didn't start out with EU Theory. But I found EU Theory to be more compelling. The EU guys make some good points and I've thought a lot about them on my own. My own opinion is that astrophysics has made the mistake of attempting a divide-and-conquer strategy. Rather than trying to identify unifying principles of the universe, they have subdivided the universe's components into small parts. Planets and comets are great examples. We know that both planets and comets have plasma tails. But rather than trying to understand the plasma tail in terms that affect them both, they've created completely different terminology for the two things -- even

      --
      "A man cannot begin to learn that which he thinks he already knows." --Epictetus, 1st Century A.D.
    11. Re:EM Radiation Interferes with Absolute Dating by TapeCutter · · Score: 1

      Arp is wrong in his interpretation of redshifts (although the idea was plausible a few decades ago when he first formulated his ideas). Since then the hubble telescope has measued the spectra and redshifts of quasars and importantly nearby objects with similar red shifts. eg: There was a story on slashdot a while back that described a jupiter sized ball of gas ejected from the milky-way balck hole's accretion disk at near light speed.

      The thing that Arp did not have when he formulated his theory was evidence of these nearby objects for comparison against quasars. Rather than accept new evidence Arp has chosen to join the relms of psuedo-science. His book is simply a retelling of many science stories designed to butter you up for his point that everyone makes maistakes except himself. Pity he threw away his education in a failed attempt to gain immortality.

      The other argument in his book is the old holistic/reductionist dichotomy, he is asseting that science is missing the "big picture" or "alternative big pictures" because of it's obsession with details. The choice he proposes here is a straw-man since there is no choice to be made, details by definition are what supports "the big picture", no other "big picture" covers the details as well as the current status-quo. And guess what, the status-quo has changed many times over the last few decades and is continually changing and improving (ie: the definition of science).

      You can turn this into a "life mission" if you like, "the scientific establishment" and I are just suggesting there are better uses for your time.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
  38. Oh, shit... by GhaleonStrife · · Score: 1

    Quickly! Start building the giant robots! The Aerogaters (AKA Balmar Empire) are coming!

  39. Wrong spelling by stunt_penguin · · Score: 2, Funny

    Surely finding organic compounds should change the name of a meteorite to a meateorite. Yummy!

    --
    When the posters fear their moderators, there is tyranny; when the moderators fears the posters, there is liberty.
  40. Nuke um by Nethead · · Score: 1

    So we can nuke Tagish Lake like in the movie?

    --
    -- I have a private email server in my basement.
  41. Why are organic molecules special? by Myria · · Score: 2, Insightful

    Certainly, organic molecules are required for life as we know it. But there are many other possibilities.

    Why do we assume that there is no life in some place we can't explore, like inside the Sun? Certainly there is no life there based on complex carbon molecules. However, what excludes the possibility of life based on such other mechanism?

    --
    "Screw Sun, cross-platform will never work. Let's move on and steal the Java language." - Visual J++ Product Manager
  42. They must be american by rumblin'rabbit · · Score: 1
    You forgot to add following at the end of your post:

    This posting is an attempt at humor If you do not have a sense of humor, or do not appreciate my specific style of humour, then I recommend you limit yourself to moderating or replying to postings that do not contain such humorous elements.
    That'll learn 'em.
  43. oh no! a meteorite! organic matter! by alexultima · · Score: 1

    don't panic!

  44. Oh the injustice! by The+name+is+Dave.+Ja · · Score: 0

    Now I'm modded Flamebait.

    It just gets wronger and wronger.

  45. Re:Organic (MOD PARENT UP) by XdevXnull · · Score: 4, Informative

    Mod parent up. Organic != life. They just tend to go together here on Earth.

    --
    "I'm a Laver, not a Phyto[plankton]"
  46. For the unenlightened... by tubapro12 · · Score: 0, Redundant

    ...all hail the great Flying Spaghetti Monster!

  47. Or in a lovecraftian sense by Xamusk · · Score: 0

    It could also be Cthulhu's spit

    Oh, I already feel the horror

  48. Your mom's by AoT · · Score: 1

    mostly water.

  49. silly question? by bazorg · · Score: 1

    hummm... how do people know how old the Sun is? did archaeologists dig up some samples and carbon-dated them?

    1. Re:silly question? by KillerBob · · Score: 4, Informative

      Actually, it's not a silly question at all. It's a darned good one. The short answer is that it's a "best guess".

      We still don't actually *know* how the solar system formed, and until then, there's no way we can actually definitely say how old the solar system is. What we think is that the system was formed in a nebula as a big cloud of dust that gradually started to clump around a center. As the protostar gathered mass, the cloud started to spin and formed into a disc, called an accretion disc. The theory is that all of the asteroids, planets and comets formed at the same time as the sun. This theory is supported, in that some of our observations have shown accretion discs in nebulae, but we really have no way to actually *prove* that this is how our solar system formed.

      The thing is... if that's how our solar system formed, then we're able to measure the age of the solar system by looking at the age of some of the other objects in the solar system. Fact is that most of the objects out in the kuiper belt and oort cloud (think in the 50-100,000 AU radius) are about 4.5-5 billion years old. Given our current model for how the solar system formed, that would mean that the sun is about the same age. There are almost certainly some objects in our solar system that are older than the system itself... either as captured objects from other solar systems (100k AU is halfway to Proxima Centauri), or as objects that were part of the nursery nebula that we formed from.

      As to the original article, it's really nothing special at all. "Organic" molecules just mean carbon compounds. The solar system is full of organic molecules. Something like 2/3 of the asteroids in the solar system, especially in the outer solar system, are carbonaceous. Organic != Life. It's cool that we've found a meteorite that's older than the solar system is thought to be, and it's cool that it's carbonaceous... but that's because it's extremely rare that a carbon-based meteorite survives entry into our solar system, and it's also very rare to find a meteorite that's older than the solar system. Finding the two in conjunction is a really cool thing. But it's in now ay proof of extra-terrestrial life.

      --
      If you believe everything you read, you'd better not read. - Japanese proverb
    2. Re:silly question? by Oranse · · Score: 1

      The thing is... if that's how our solar system formed, then we're able to measure the age of the solar system by looking at the age of some of the other objects in the solar system. Fact is that most of the objects out in the kuiper belt and oort cloud (think in the 50-100,000 AU radius) are about 4.5-5 billion years old. Are you indicating to the results from the Deep Impact probe?

      I've thought that a direct method to measure the age of the Sun is to analyze its fuel balance from the basis of its spectrum. We know what type of star it is and its mass, so isn't it possible to find out how much hydrogen it has used?
      I thought at least SOHO would have a load of elaborate technology to measure these things.
    3. Re:silly question? by KillerBob · · Score: 1

      I'm not actually referring to Deep Impact so much as I am the analysis of other meteorites that have been found on Earth, as well as analysis on some of the moon rocks. You're right, though. We can also look at the composition of the star to give a rough estimate of its age... but that relies on a few assumptions, just like any other method we have. In that case, the assumption is that the lifecycle of a star is predictable. It also relies on an assumption about the general composition of the nebula that we formed from (and as a consequence, the original composition of Sol).

      Reasonable assumptions, given what our observations have shown. We're fairly sure that Jupiter's atmosphere is about as close to the initial composition as we're going to find, and we're pretty sure what's in the planet's atmosphere. But just as any other method we have, it's a guesstimate of the rough age of the solar system. We really don't know how old the solar system is, and we really don't have a way to definitively measure it.

      --
      If you believe everything you read, you'd better not read. - Japanese proverb
  50. Not even close to true by symbolset · · Score: 1
    Every day millions of micrometeors bounce off of the atmosphere and spin off into space. Many of them dip low enough to scoop up some life on their way by. Many forms of life on Earth can withstand space including mold spores which, BTW, are present high in the atmosphere where micrometeors can scoop them up. Lichens can survive under remarkably hostile conditions, and grow in many. And that's just accounting for the forms of life that are commonly understood and known to be present. Some definitions of "life" allow for rather less familiar configurations.

    I figure the reason why we haven't yet found evidence of life outside of earth is that we haven't properly looked. The cursory and remote search conducted this far could hardly be considered justification for a proper search warrant if we were looking for evidence of a minor crime. For something this much more important a far more thorough look is justified before we call a lack of evidence evidence of lack.

    None of this has to do with TFA. The speculation at this point is, I believe, that the meteorite wherein the mysterious material is found comes from the oort cloud and thus predates the solar system. That would make it remnants of a supernova ~6 billion years ago or so, or something even stranger. Even the investigators aren't calling it life.

    The life or not question aside, this article is a reminder. Our solar system is crossing through the plane of the Milky Way galaxy, as it does every 40 million years or so. Things from outside our solar system are known to fall on the Earth when this happens, as this one did. Not all of these things can be described as small. Perhaps coincidentally, every 40 million years some unpleasantness occurs in the fossil record. Hopefully someone, somewhere, is considering these facts as a collection.

    --
    Help stamp out iliturcy.
    1. Re:Not even close to true by v1 · · Score: 1

      I'm no astrophysicist, but I see a basic problem with the "scoop theory" you present. First yes spores can exist at high altitudes, and you might even find a few hardy enough to survive on another planet. The concentration at those elevations would have to be incredibly small. But then life is so unlikely in the first place we'll just give it that. Second problem is heat, and that's a hard one to argue against. If said meteor was going far enough into the atmosphere to pick up a hitchhiker, AND is going fast enough to maintain escape velocity as it begins to vector away, it's going to be cooking. Really really cooking. Anything on the outside of the meteor will be vaporized, and it's going to go on quite a diet as it passes by. The odds of a spore or anything else organic surviving the heat of reentry/exit is beyond even the incredible odds that brought about the start of life. If you look around you will find video of meteors doing a "fly by" of earth taken by amateur photographers. You'll notice the meteor is glowing and is letting off quite a cloud trail behind it, the stress is often enough to cause them to break up, and the heat is incredible. Can anything on the surface of that meteor survive? Even if it managed to survive the thousands of degrees of heat, the top layer of the meteor is going to get blasted right off, so any hitchhikers are going to be left behind in the atmosphere. Maybe if it's packed in the middle, but the scoop theory places these spores on the surface, and there's just no surviving that.

      --
      I work for the Department of Redundancy Department.
    2. Re:Not even close to true by timmarhy · · Score: 1

      no i believe the scoop theory puts the spores as being caught in the pores of the meteor, the center of which is freezing cold and will therefore mitigate the few hundreds of degrees of heat on the surface (note it's not 1000's). yes it's unlikely, yes interstellar radiation is a problem, but no one is claiming this is going to happen often, the claim is that if it's possible, then it'll happen eventually.

      --
      If you mod me down, I will become more powerful than you can imagine....
    3. Re:Not even close to true by symbolset · · Score: 1

      Exactly. This is only one of many plausible theories about how current life could escape the earth in the present day. Another is impact displacement, where a meteorite or comet strike hits hard enough to eject surface material out of the Earth's gravity well, complete with colonies of organisms. This is known to have happened on Earth several times in the past while life was abundant. High in the atmosphere mold spores become so dry their electrostatic properties can become more of an issue than their mass. Volcanic eruptions can create plumes so high a low flying meteor can pass through them without bouncing off the atmosphere. There are other theories but we really are not creative enough to think of all the ways this might happen. I suspect that planethopping life is much like hacking the vote -- if it is possible at all some germ will find a way.

      I have read there are bacteria that use the radiation of natural nuclear reactors as an energy source (so much for interstellar radiation being a problem). I believe their waste products and the heat generated support large colonies of more conventional organisms. All of this occurs far beneath the ground where the photosynthetic chain is not a factor and the reactors have been present since the formation of the Earth. So much for the cold vacuum of space though I don't think that's as much an issue as many seem to. For complex organisms like us yes, but for "any life"? I think not. I do wonder how those reactor bacteria got to where they are, to evolve into what they are, miles below the surface across boundaries no self-respecting microbe would travel. I believe the reactor bacteria are a recent discovery. How thoroughly have we searched this planet we know so well that we're still finding new and different forms of life? It seems to me that a cumulative few man days less a few hours for golf hardly constitutes a thorough search.

      GP mentioned life falling on planets. My original post didn't specify that, though of course some of the stuff that bounces off Earth does fall on other bodies I would think most of it does not.

      The topic is about pre-solar system organics anyway so let's rejoin the topic: If organic compounds (link http://en.wikipedia.org/wiki/Organic_compound ) are so common among the stars and apparently in this meteorite sample as astronomers would have us believe, what causes them to be so common? Are carbon and hydrogen that attracted to each other or is there some phase of nova/supernova/whatever that causes their creation in proximity to each other? Perhaps there's some sorting process that extracts other material but doesn't affect organic compounds, on a cosmic level? I don't know the science on this one and would be glad for some pointers.

      --
      Help stamp out iliturcy.
  51. NEWS FLASH by Dan+East · · Score: 3, Insightful

    Chemical reactions can occur in places other than Earth.

    Dan East

    --
    Better known as 318230.
  52. Ancient Greeks were pretty smart by symbolset · · Score: 1
    I'll agree with you, though the fact that we're speaking of them in the past tense shows they didn't know everything.

    --- If it harm none do what you will shall be the whole of the law.

    --
    Help stamp out iliturcy.
  53. Organic Matter? by Ten24 · · Score: 2, Funny

    ...This means no Pesticides, right?

  54. Ugh by Chuck+Chunder · · Score: 1

    The "science" in Angels and Demons drove me nuts.

    --
    Boffoonery - downloadable Comedy Benefit for Bletchley Park
  55. Organic does not mean "from life" by ChaoticLimbs · · Score: 3, Informative

    In chemistry, "organic matter" refers to hydrocarbons.

    1. Re:Organic does not mean "from life" by Timberwolf0122 · · Score: 1

      Hydrocarbons! We must invad... I mean liberate these aliens from there oppresive overlord Zeanue! Then rebuild space and sell the oil.

      --
      In the not too distant future, next Sunday A.D.
  56. Life in Space by SpaceLifeForm · · Score: 1
    Life is found most everywhere that it can reach. The only reason we have not found life in space yet is because gravity does a good job of keeping life on the planet and out of space.

    "Scotty, you're right, there is no intelligent life down there! They think they are the only ones.".

    Dude, *you* are life in space.

    Look at it from the perspective of another SpaceLifeForm discovering you on another planet.

    --
    You are being MICROattacked, from various angles, in a SOFT manner.
  57. Definition of organic by mapkinase · · Score: 1
    If you seive throw Wikipedia, you will eventually find that the defining feature separating organic matter from non-organic is a presence of Carbon-hydrogen bonds.

    Article on Organic compound says:

    In this scheme, carbonic acid is inorganic and so is oxalic acid, whereas formic acid is organic.


    --
    I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
  58. age measurement, relativity by gr8dude · · Score: 1

    There is a question I was thinking of, perhaps you can shed some light on the subject... It is known that time is a relative thing, when objects move at different speeds, time 'flows' differently for each of them.

    How do the dating methods deal with this? I mean, doesn't the obtained result simply state how old an object is if it 'spent its entire life' in an environment such as ours (is this a reasonable assumption?)?

    1. Re:age measurement, relativity by Bemopolis · · Score: 2, Interesting

      SImple — they don't. Your last sentence is the assumption used; i.e., that it has spent its life in an environment such as ours. This is a very good assumption, since in order to show any relativistic time dilation before it reaches us an object needs to have had traveled at very high speed or spent time in a very strong gravitational field. In the former case the speed involved would have to incredible; for example, if the meteorite had spent its entire life travelling at 10% of the speed of light (30,000 km/sec), that would only slow down the decay rate by 1%, well within any margin of error. In the latter case, the meteorite would have had to spend its time very close to a black hole (a few km away for a black hole the mass of the Sun), in which case it would be unlikely to escape to get to us anyway.

      --
      "I guess the moral of the story is, don't paint your airship with rocket fuel." -- Addison Bain
  59. Yes, LoTR is entertainment, not literature . . . by ysaric · · Score: 2, Insightful

    [/sarcasm] dumbass. What strikes me even moreso is these various posts involving people jumping to conclusions about strangers they've just met, then placing ridiculous value judgements on them. She likes Harry Potter and that makes her not smart? Are you some authority on literature? I know I'm coming off abrasively but it's not solely directed at you, particularly given the other responses to this part of the thread. Maybe there is something to be said for not being so intellectually snobby, you're (once again not just you, but including you) closing a lot of doors that might have really great things behind them.

    --
    Happy goldfish bowl to you.
  60. Trying to think beyond carbon-based life. by Anonymous Coward · · Score: 0

    When you look at a system like Conways 'Game of Life' it's common to find things that reproduce themselves. Add in the ability of a cell on the grid to occasionally 'mutate' by changing state in contravention to the basic rules and it's not hard to imagine sooner or later, a self-reproducing pattern would spontaneously emerge - and that could eventually evolve intelligence. So it seems reasonable that life (and possibly even sentient life) could emerge in a system that's as simple at that. Whether it's possible in practice must depend on the detailed chemistry of whether a system with enough rules to function like that could emerge in situations other than a water-based but hydrocarbon-rich environment.

    I don't see why life could not spontaneously arise in interstellar gasses or in the center of a star - I doubt we'd recognise it though - something that worked like the "game of life" in interstellar gasses might take thousands of years to form a single 'thought' whilst life forms in the center of a star might live brief, energetic lives at rates of a fraction of a second per generation.

  61. I hate to be an rude... by Anonymous Coward · · Score: 0

    ...but love advice on slashdot? Yeah right!

    Go back to arguing about linux distros, spouting perpetual motion nonsense, or something you're at least marginally qualified to comment on.

  62. Aand only natural sourced fertilizer ie: bullshit by wilec · · Score: 1

    And only natural sourced fertilizer, a common form is bullshit.

    Wabi-Sabi
    Matthew

  63. canadian space meteorite goo by Magdalene · · Score: 1

    and aI cannot beleive one of you didnt grab the classic line

    "Well it should be okay as long as we don't LICK it!' from creep show"

    or am I just showing my age...

    -m

    --
    -Magdalene --"there are 10 types of people in the world, those who read binary, and those who don't"
  64. Ya know what this means? by GSolomon · · Score: 1

    As a Native North American, and, as I am certain beyond some type of reasonable doubt, indigenous cultures throughout the world will concede to a single notion independently: "we've always been here" This discovery gives (in my view of the Grander Scheme of things) a tremendous boost to a theory that life evolved in MANY places throughout the globe independently of each other. I am from the Pacific Northwest and I have heard many oral stories depicting life coming from the water. Sound familiar? You see, languages WILL change over time...The symbolism remains rock steady. Time can be rendered irrelevant so long as life prevails. I for one am a firm believer that time is irrelavent, and, that life evolved all over, not out of one place. Just becase one set of data (i.e. human and homin and hominid type) points to a particular place, does it HAVE to be that way? You tell me what is more likely: God chose one place on earth to seed life and let the natural forces do the rest, i.e. time, environment, et. and the hominid line went abot 12 million years basically unchanged then KA-BAM! Here we are now wondering how so much biodiversity could have evolved so much in so little time. OR The "debris" fell on earth and the hydro carbons substantiated in this find "fraternized" with the world around it and constantly reorganized itself to make the environment around it more habitable, hence we get the definition of evolution. No matter how one wants to interpret it, it's pretty remarkable.