Slashdot Mirror

To echo your point on religion, here is another thing Albert Einstein wrote:
http://www.sacred-texts.com/aor/einstein/einsci.htm
"""
For the scientific method can teach us nothing else beyond how facts are related to, and conditioned by, each other. The aspiration toward such objective knowledge belongs to the highest of which man is capabIe, and you will certainly not suspect me of wishing to belittle the achievements and the heroic efforts of man in this sphere. Yet it is equally clear that knowledge of what is does not open the door directly to what should be. One can have the clearest and most complete knowledge of what is, and yet not be able to deduct from that what should be the goal of our human aspirations. Objective knowledge provides us with powerful instruments for the achievements of certain ends, but the ultimate goal itself and the longing to reach it must come from another source. And it is hardly necessary to argue for the view that our existence and our activity acquire meaning only by the setting up of such a goal and of corresponding values. The knowledge of truth as such is wonderful, but it is so little capable of acting as a guide that it cannot prove even the justification and the value of the aspiration toward that very knowledge of truth. Here we face, therefore, the limits of the purely rational conception of our existence.
But it must not be assumed that intelligent thinking can play no part in the formation of the goal and of ethical judgments. When someone realizes that for the achievement of an end certain means would be useful, the means itself becomes thereby an end. Intelligence makes clear to us the interrelation of means and ends. But mere thinking cannot give us a sense of the ultimate and fundamental ends. To make clear these fundamental ends and valuations, and to set them fast in the emotional life of the individual, seems to me precisely the most important function which religion has to perform in the social life of man. And if one asks whence derives the authority of such fundamental ends, since they cannot be stated and justified merely by reason, one can only answer: they exist in a healthy society as powerful traditions, which act upon the conduct and aspirations and judgments of the individuals; they are there, that is, as something living, without its being necessary to find justification for their existence. They come into being not through demonstration but through revelation, through the medium of powerful personalities. One must not attempt to justify them, but rather to sense their nature simply and clearly.
"""

You might like the rest there too.

As I mention here:
http://www.chris-floyd.com/component/content/article/1-latest-news/1937-unnatural-acts-breaking-the-fever-of-militarism.html#comment-2450
We the People, based on deeply held humanistic and spiritual values, need to redefine security in a sustainable and resilient way. Much current US military doctrine is based around unilateral security ("I'm safe because you are nervous") and extrinsic security ("I'm safe despite long supply lines because I have a bunch of soldiers to defend them"), which both lead to expensive arms races. In order to end arms races, promote world peace, and also save money we can direct to civilian needs, we need as a society to move to other paradigms like Morton Deutsch's mutual security ("We're all looking out for each other's safety")
http://www.beyondintractability.org/audio/morton_deutsch/?nid=2430
and Amory Lovin's intrinsic security ("Our redundant decentralized local systems can take a lot of pounding whether from storm, earthquake, or bombs and would still would keep working").

Thanks for the reply, and it's an interesting analogy with the human body and cancer. Still, the human body is about 90% bacterial cells by number, and about 10% bacteria by weight, so it that sense the human immune system is in that sense mostly a legal constitution about getting some bacteria to work well together. :-)

Also, note that populations of living things tend to change over time, so some dissenting cells (mutations) may lead to a very different next generation (though that is rare).

Also, note that classically entropy is about a "closed system". In an "open system" with an energy flux, like the Earth getting thousands of times what our industry uses from solar energy, and with an infinite cosmos for material expansion, different laws or different perspectives may apply, since the energy flux and endless matter can be used to rebuild systems (or duplicate systems, or spread duplicates).
http://www.google.com/search?hl=en&q=entropy+closed+system
http://www.google.com/search?hl=en&q=entropy+open+system

Anyway, the most fundamental issue, as told to me by the late professor Larry Slobodkin (very wise guy) in a course on Philosophy and Ecology, is that even if every organism in the universe behaved a certain way, human still have moral choices to make, and could decide to do things differently. I think the same is true for physics. Whatever we see when we look at the physics of the world, people still make moral choices. Although another way to look at that, as a variant on Einstein's point, is to look at the idea of Memetics.
http://en.wikipedia.org/wiki/Memetics

But, even with that idea, ultimately human reason still rests on emotion (or religion) as Einstein suggest.
http://www.sacred-texts.com/aor/einstein/einsci.htm
Or, George Lakoff saying that:
http://blog.buzzflash.com/contributors/3014
Or, Antonio R. Damasio saying that:
http://en.wikipedia.org/wiki/Descartes'_Error
Or, E.F. Schumacher saying that:
http://en.wikipedia.org/wiki/A_Guide_for_the_Perplexed

Again, science can tell you what is, what was, and even the theoretical limits of what might be possible, but it can't tell you what should be. Only emotion (or some sort of religion) can tell you that. Or, taken to another level, politics.

Although, as is pointed out here:
http://www.disciplined-minds.com/
it seems the biggest political issue is often that professions (including science) usually deny they have politics built in to them, so, stating they actually do have politics of various sorts is a political issue... :-) So, what we have now is a poverty crisis in the USA related to jobs, but people claim it has nothing to do with politics (or religion, or emotion), it is just "economics". Or we have an illness crisis in the US, but people claim it has nothing to do with politics (or religion, or emotion), but again, it is just about professional choices, economics, health science, and so on.

Also related:
"ivan illich: deschooling, conviviality and the possibilities for informal education and lifelong learning"
http://www.infed.org/thinkers/et-illic.htm
"Known for his critique of modernization and the corrupting impact of institutions, Ivan Illich's concern with deschooling, learning webs and the disabling effect of professions has struck a chord among m

You make a good theoretical point about thermodynamics, and it is insightful to link it to guarding. Thanks for that. I'll think on aspects of that more. And, I'll agree that there will be always aspects of our society devoted to guarding (and security) for that reason and others.

With that said, one can ask what percentage of our society should go to guarding and defense, under what rationale that has been made up by thinking and feeling human beings, and what part should go into either growth or current enjoyment? Part of that is a fundamental question of what sort of society we choose to build based on the values we choose to celebrate for whatever reasons; from Albert Einstein:
http://www.sacred-texts.com/aor/einstein/einsci.htm
"The knowledge of truth as such is wonderful, but it is so little capable of acting as a guide that it cannot prove even the justification and the value of the aspiration toward that very knowledge of truth. Here we face, therefore, the limits of the purely rational conception of our existence. But it must not be assumed that intelligent thinking can play no part in the formation of the goal and of ethical judgments."

As humans, we make moral choices based on our feelings about a bigger picture. So, you have a scientific truth with entropy (which I will state, in an observer based way as much physics has moved, as entropy is the notion that structures tend to decay relative to our preferences unless we put energy into maintaining them as we would like). But what *should* be, given that truth, is another level of thought connected with emotion and, essentially, religion, about what patterns we want to preserve, destroy, or create.

Let's consider three obvious cases of guarding -- prisons, war, and schooling.

The US currently has about five to ten times more people in prison per capita than most other industrialized countries (part of that is that sentences are way longer in the USA, part of that is that prison is a big part of the "social safety" net in the USA). So, by comparing the US to similar countries, we can see that it does not have to be that way, with so much guarding. We have that much guarding because of ideology. But the profit-motive out of control and legalized corruption via political donations helps explain some of why this is the case:
"Pennsylvania rocked by 'jailing kids for cash' scandal"
http://www.cnn.com/2009/CRIME/02/23/pennsylvania.corrupt.judges/index.html
And also, less dramatically but more at the core of the problem:
http://www.washingtonpost.com/wp-dyn/content/article/2009/03/27/AR2009032702834.html
"The State Assembly in the past had proposed repealing the drug laws, but the effort was always blocked by Senate Republicans, many of whom represent largely rural, Upstate districts where most of the state's prisons are located."
So, we see a profit motive, based on a certain vision of society, as at the hearth of why so many resource in the USA go into the prison system instead of, say, bridge repair.

The USA spends about as much money on "defense" as all other countries combined, where "defense" unfortunately means the extrinsic (soldier-based) unilaterally-dominant military planning intended to defend overly centralized systems against aggression (generally by those unhappy at exploitive US foreign policy or who otherwise feel threatened by the USA). An alternative perception of security would be mutual defensive planning with other nation related to civil defense using intrinsically secure decentralized infrastructures that are sustainable and resilient. Most of that US defense money has been not only wasted, but actually made us worse off though. A policy of mutual security is more stable and effec

The irony of military robots is that we are using them to enforce a global economic system that is based on forcing humans to do labor in exchange for the right to consume the fruits of industry. Why not just build robots to do the work directly instead? Why not use global networks to freely share information about how to make the world a better place that works for everyone? The same is true for nuclear missiles intended to fight over oil and land instead of using the same technologies to build nuclear power plants (or solar ones and wind ones) or to create self-replicating space habitats or seasteads for endless new land. We need to start thinking in 21st century terms now that we have 21st century technology. Otherwise, we will likely accidentally kill ourselves with the tools of abundance.

As Albert Einstein said:
    http://rescomp.stanford.edu/~cheshire/EinsteinQuotes.html
"The release of atom power has changed everything except our way of thinking...the solution to this problem lies in the heart of mankind. If only I had known, I should have become a watchmaker."

Or further:
    http://www.aip.org/history/einstein/nuclear1.htm
"""
"Concern for man himself must always constitute the chief objective of all technological effort -- concern for the big, unsolved problems of how to organize human work and the distribution of commodities in such a manner as to assure that the results of our scientific thinking may be a blessing to mankind, and not a curse."
"""

Or more on how Einstein was more than the disconnected absent minded professor he is made out to be:
    http://www.wsws.org/articles/2002/sep2002/eins-s03.shtml
    http://www.sacred-texts.com/aor/einstein/einsci.htm

It is not the nukes and drones that may kill us all eventually, it is the unrecognized irony.

I decided to post the whole thing as a reply here since it is not easily accessible, even though there are a couple of replies there and additional comments by me.

Embedded software developer Joseph Stack allegedly intentionally flew a small plane into government offices in Austin, TX, in an act that has been labeled as domestic terrorism. He cited, among other things, IRS regulations about independent contractor status as well as other issues related to government corruption.

Could his behavior have been partially due to vitamin D deficiency syndrome from indoor work? Could vitamin D deficiency also have contributed to the violent behavior alleged of Hans Reiser or Amy Bishop? And is part of the problem also that Joe Stack was not talking to anyone about any of this to think through real solutions and find positive things to do that, as Mr. Rogers sang, would not hurt himself or anyone else?

Here are some useful resources for preventing more copycat violence to show how there are plenty of alternatives to violence despite Joe Stack's claim otherwise in his manifesto:

Treating Disease With Vitamin D

Surviving America's Depression Epidemic: How to Find Morale, Energy, and Community in a World Gone Crazy

Dark Nights of the Soul: A Guide to Finding Your Way Through Life's Ordeals

Albert Einstein on: Religion and Science

A wombat talks about a global mindshift

TED | Peter Eigen on moving beyond corruption

The Optimism of Uncertainty

Social Movements and Strategic Nonviolence

As another software developer who has done embedded work, here are some non-programming things I've worked on related to helping people see positive alternatives to violence:

Possible cures for a jobless recovery

Post-Scarcity Princeton, or, Reading between the lines of PAW for prospective Princeton students, or, the Health Risks of Heart Disease

Rebutting Communiqué from an Absent Future

The amazing thing to me is not that stuff like this happens. What is amazing is that it does not happen more often, which is a tribute to most of humanity's basic social nature. In a way, even Joe Stack chose a relatively limited approach; an embedded software developer such as he was could have done far more damage if trying to create general mayhem (he could have tampered with nuclear power plants or medical devices or airplane software). There is also irony here that a person took a very advanced piece of technology — a private airplane, and all that it represents as a technological marvel — and used it to destroy a past instead of to create a future.

What do people think and feel about all this?

A lot of people become homeschoolers because they tried for decades to change the system from within. From Wikipedia: "John Taylor Gatto (born December 15, 1935) is an American retired school teacher of 29 years and 8 months and author of several books on education. He is an activist critical of compulsory schooling and of what he characterizes as the hegemonic nature of discourse on education and the education professions."

More from there:
"""
What does the school do with the children? Gatto takes this in "Dumbing Us Down", the following propositions:
1. Makes the the children confused. It presents an incoherent ensemble of information that the child needs to memorize, to stay in school. Apart from the tests and trials that programming is similar to the television, fills almost the whole, "free" time of the children. One sees and hears something, to forget it again.
2. It teaches them to accept their class affiliation.
3. It makes them indifferent.
4. It makes them emotionally dependent.
5. It teaches them a kind of self-confidence, which require constant confirmation by experts (provisional self-esteem).
6. It makes it clear to them that they can not hide, because they are always supervised.
"""

Another such person was John Holt, who also tried to improve things for years inside the system. In turn, the have inspired others, like Grace Llewelyn. There are many more. Both boredom and burnout (common in children as well as teachers) can be deadly.

So, this spying with webcams is just a continuation of a general trend for one hundred and fifty years.

Here is a good discussion of the current dynamics of what is going on in the educational world, from an interview with Jerry Mintz on Sustainable Education: " Nevertheless, there is an education revolution going on, and it is long overdue. It is moving in the diametrically opposite direction of the "testing" push. The latter comes from the bureaucrats from within that dying system, who do know there is something wrong. But since they can't think "out of the box," the only remedy they can come up with is longer hours, more homework, and "teaching to the test," in other words, more of the same. The education revolution is coming from people who have created alternative schools and programs, thousands of them, and from others who have checked "none of the above" and have decided to home educate. There are now nearly two million people home educating. The first charter school was started in 1991. Now there are 2500 of them! And there are over 7500 additional alternatives in our database and many thousands more we have yet to discover. All of these fall in the general category of "learner-centered" approaches. We list many of them in our book, The Almanac of Education Choices. These people are steadfastly OPPOSED to the governmental thrust for more "standardization" and testing."

If you are burned out as a schoolteacher (and, in some ways, teachers are the worst victims of all this), here are some resources:
Treating Disease With Vitamin D
Surviving America's Depression Epidemic: How to Find Morale, Energy, and Community in a World Gone Crazy
Dark Nights of the Soul: A Guide to Finding Your Way Through Life's Ordeals
Albert Einstein on: Religion and Science
A wombat talks about a global mindshift

What does showing up in a church say about someone's core beliefs or actions? Lots of people show up in Church for social networking reasons. Still, it is true that many people consider economic social Darwinism to be justified by the Bible, just like many people used the Bible to justify slavery.
http://www.religioustolerance.org/chr_slav1.htm

Still, there remains often a divide between science/technology and religion. Albert Einstein had a lot of good things to say about reconciling the two, and I like to interpret Gatto's comments about religion and values in that context (maybe incorrectly, I don't know):
http://www.sacred-texts.com/aor/einstein/einsci.htm
"""
For the scientific method can teach us nothing else beyond how facts are related to, and conditioned by, each other. The aspiration toward such objective knowledge belongs to the highest of which man is capabIe, and you will certainly not suspect me of wishing to belittle the achievements and the heroic efforts of man in this sphere. Yet it is equally clear that knowledge of what is does not open the door directly to what should be. One can have the clearest and most complete knowledge of what is, and yet not be able to deduct from that what should be the goal of our human aspirations. Objective knowledge provides us with powerful instruments for the achievements of certain ends, but the ultimate goal itself and the longing to reach it must come from another source. And it is hardly necessary to argue for the view that our existence and our activity acquire meaning only by the setting up of such a goal and of corresponding values. The knowledge of truth as such is wonderful, but it is so little capable of acting as a guide that it cannot prove even the justification and the value of the aspiration toward that very knowledge of truth. Here we face, therefore, the limits of the purely rational conception of our existence.
But it must not be assumed that intelligent thinking can play no part in the formation of the goal and of ethical judgments. When someone realizes that for the achievement of an end certain means would be useful, the means itself becomes thereby an end. Intelligence makes clear to us the interrelation of means and ends. But mere thinking cannot give us a sense of the ultimate and fundamental ends. To make clear these fundamental ends and valuations, and to set them fast in the emotional life of the individual, seems to me precisely the most important function which religion has to perform in the social life of man. And if one asks whence derives the authority of such fundamental ends, since they cannot be stated and justified merely by reason, one can only answer: they exist in a healthy society as powerful traditions, which act upon the conduct and aspirations and judgments of the individuals; they are there, that is, as something living, without its being necessary to find justification for their existence. They come into being not through demonstration but through revelation, through the medium of powerful personalities. One must not attempt to justify them, but rather to sense their nature simply and clearly.
"""

That is a deeper reason about the conflict between many conservatives and public education, as regards to values. Of course, where to draw the line between labelling some things positive values and other things harmful dogma is part of the gradually enlightened human condition. But Einstein has some comments on that at the link above, too.

Of course, compulsory schooling trending towards a police state has now become a secular religion in the USA, as evidenced by these cameras (if true). Even if these allegations on how the cameras are use are false, an environment where children are taught for more than a dozen years that they have no right to privacy at school, they have no right to have private school lockers (requiring a

If kids are animals in that sense, why are so many homeschoolers at the same age so well behaved? No group is perfect, of course, just an alternative thing to consider that the environment may be causing a lot of behavior problems.

Other aspects of the solution, as a care package of healing-related links. :-)
    "Treating Disease With Vitamin D" (anyone like a school child spending most of their time indoors is at risk)
        http://www.vitamindcouncil.org/treatment.shtml
    "Surviving America's Depression Epidemic: How to Find Morale, Energy, and
Community in a World Gone Crazy"
      http://books.google.com/books?id=bCuC2H-6k_8C
    "Dark Nights of the Soul: A Guide to Finding Your Way Through Life's Ordeals"
        http://books.google.com/books?id=RKZreNYKNHQC
    "Albert Einstein on: Religion and Science"
        http://www.sacred-texts.com/aor/einstein/einsci.htm
    "A wombat talks about a global mindshift"
        http://www.global-mindshift.org/memes/wombat.swf
    "The Orchid Child"
    http://www.theatlantic.com/doc/200912/dobbs-orchid-gene

From the last: "Most of us have genes that make us as hardy as dandelions: able to take root and survive almost anywhere. A few of us, however, are more like the orchid: fragile and fickle, but capable of blooming spectacularly if given greenhouse care. So holds a provocative new theory of genetics, which asserts that the very genes that give us the most trouble as a species, causing behaviors that are self-destructive and antisocial, also underlie humankind’s phenomenal adaptability and evolutionary success. With a bad environment and poor parenting, orchid children can end up depressed, drug-addicted, or in jail—but with the right environment and good parenting, they can grow up to be society’s most creative, successful, and happy people."

Bullying will always be with us, but we can reduce it by having a better society with happier and more fulfilled individuals. Wi-Fi on school buses empowering children to do self-directed learning using networked computers is a big step forward in many ways, even if there are downsides as well (vitamin D deficiency from not walking outdoors, obesity from sedentary behavior, some media content is candy or even toxic, and it displaces other good things like face-to-face interaction, relationships with nature, hands-on hobbies, helping others physically, and so on).

All great points.

Related:
    http://www.timesonline.co.uk/tol/news/science/article1695546.ece
"A study commissioned by the Government that suggests robots could one day have rights was attacked by leading scientists yesterday as a red herring that has diverted attention from more pressing ethical issues."

Related links:
    http://en.wikipedia.org/wiki/Midas_World
    http://www.marshallbrain.com/manna1.htm
    http://www.whywork.org/rethinking/whywork/abolition.html
    http://en.wikipedia.org/wiki/Jobless_recovery (organized mostly by me)

My senior thesis in college about 25 years ago was about intelligence and survival, and argued, as you suggest, that there may be a law of diminishing returns to intelligence.

Still, with that said, the problem today is not so much about intelligence as values (or emotions, like my point on Descartes' Error, or Einstein said a similar thing here).
    http://www.sacred-texts.com/aor/einstein/einsci.htm

Here are some letters I wrote to Ray Kurzweil (and someone else put on their site) about why his vision of the singularity reflects his own (capitalist, competitive) values more than any necessity of how it has to be:
    http://heybryan.org/fernhout/

Thanks for your other replies. Sorry to hear about your ex-girlfriend's negative spiral. Certainly her case should show how wealth has diminishing returns for most people, and things like physical health, mental health, and community become better investments by society at some point than just producing more stuff and and isolated indoors lifestyle to go with that? Some ways past that:
"Surviving America's Depression Epidemic: How to Find Morale, Energy, and Community in a World Gone Crazy"
http://www.amazon.com/Surviving-Americas-Depression-Epidemic-Community/dp/1933392711
"Vitamin D and Depression"
http://www.vitamindcouncil.org/depression.shtml
"Dark Nights of the Soul: A Guide to Finding Your Way Through Life's Ordeals"
http://www.amazon.com/Dark-Nights-Soul-Finding-Through/dp/1592400671

You continue to evade some key points I have made. The most important is that, as Einstein said, there is no objective way to decide what we want to do without considering values and priorities and related assumptions, which are things that stem for essentially a religious impulse.
http://www.sacred-texts.com/aor/einstein/einsci.htm

By the way, a toilet cleaning robot (not that it looks that well worked out):
http://www.youtube.com/watch?v=S9vaqsd1iP4

Here is a better idea, that, using better design, makes a toilet into more of a self-cleaning appliance:
http://www.youtube.com/watch?v=WcpZgp23nzM&NR=1

There are more links in the sidebar. Why do we have to build an entire society and economy around forcing people to clean other people's toilets when we can build robots to do it, or build better toilets that clean themselves? And the same extends to any disagreeable task you can name -- we can either build a robot to do it at this point, redesign the process so it does not need to be done, redesign the process so it is fun, decide it is not as important as we thought, or figure out some equitable way to share the disagreeable parts. But you still seem fixated on this issue that people have to be motivated to do stuff. Healthy humans do stuff because that is what healthy humans do. Granted, between school, TV, authoritarian workplaces, lack of sunlight, broken communities, and so on, most US Americans are not very healthy, as reflected in the skyrocketing depression rates at ever earlier ages, and also as reflected by a growing rich/poor divide that split our society into three classes -- those with no need to work, those who work too much, and those who can't get jobs at all.

As was said in 1964,
http://educationanddemocracy.org/FSCfiles/C_CC2a_TripleRevolution.htm
"The industrial system was designed to produce an ever-increasing quantity of goods as efficiently as possible, and it was assumed that the distribution of the power to purchase these goods would occur almost automatically. The continuance of the income-through jobs link as the only major mechanism for distributing effective demand--for granting the right to consume--now acts as the main brake on the almost unlimited capacity of a cybernated productive system."

That is what you are ignoring, as are most of the other believers in essentially mainstream economics. The "Midas Plague" is totally changing the nature of economics, and the choice are essentially to waste all that productivity to keep a scarcity-based economic model working or to broadly

First off, I have to agree that humans have hierarchical aspects and impressing the opposite sex is always going to be an issue. But James P. Hogan suggests in Voyage From Yesteryear that there are other ways to do that. How about a male impressing women with how compassionate he is? Or how funny? Anyway, different women are impressed by different things (there is a whole ecology and evolution literature on this). So, anyway, there is no doubt a lot of truth to your last point as a statement of fact.

But, what do we do with the facts? There, values come into play. As Albert Einstein said:
http://www.sacred-texts.com/aor/einstein/einsci.htm
"""
For the scientific method can teach us nothing else beyond how facts are related to, and conditioned by, each other. The aspiration toward such objective knowledge belongs to the highest of which man is capabIe, and you will certainly not suspect me of wishing to belittle the achievements and the heroic efforts of man in this sphere. Yet it is equally clear that knowledge of what is does not open the door directly to what should be. One can have the clearest and most complete knowledge of what is, and yet not be able to deduct from that what should be the goal of our human aspirations. Objective knowledge provides us with powerful instruments for the achievements of certain ends, but the ultimate goal itself and the longing to reach it must come from another source. And it is hardly necessary to argue for the view that our existence and our activity acquire meaning only by the setting up of such a goal and of corresponding values. The knowledge of truth as such is wonderful, but it is so little capable of acting as a guide that it cannot prove even the justification and the value of the aspiration toward that very knowledge of truth. Here we face, therefore, the limits of the purely rational conception of our existence.
But it must not be assumed that intelligent thinking can play no part in the formation of the goal and of ethical judgments. When someone realizes that for the achievement of an end certain means would be useful, the means itself becomes thereby an end. Intelligence makes clear to us the interrelation of means and ends. But mere thinking cannot give us a sense of the ultimate and fundamental ends. To make clear these fundamental ends and valuations, and to set them fast in the emotional life of the individual, seems to me precisely the most important function which religion has to perform in the social life of man. And if one asks whence derives the authority of such fundamental ends, since they cannot be stated and justified merely by reason, one can only answer: they exist in a healthy society as powerful traditions, which act upon the conduct and aspirations and judgments of the individuals; they are there, that is, as something living, without its being necessary to find justification for their existence. They come into being not through demonstration but through revelation, through the medium of powerful personalities. One must not attempt to justify them, but rather to sense their nature simply and clearly.
The highest principles for our aspirations and judgments are given to us in the Jewish-Christian religious tradition. It is a very high goal which, with our weak powers, we can reach only very inadequately, but which gives a sure foundation to our aspirations and valuations. If one were to take that goal out of its religious form and look merely at its purely human side, one might state it perhaps thus: free and responsible development of the individual, so that he may place his powers freely and gladly in the service of all mankind.
There is no room in this for the divinization of a nation, of a class, let alone of an individual. Are we not all children of one father, as it is said in religious language? Indeed, even the divinization of humanity, as an abstract totality, would not be in the spirit of that

Except schooling is not the gateway to the hierarchy, it is a way to keep people down, see John Taylor Gatto. And we already have a meritocracy, it is the meritocracy of heredity and sometimes luck and sometimes some other things. Besides, what is the proper way to judge "merit"? Are people who bust their assess running a bagel shop franchise and make a million dollars but neglect their families more worthy than people who spend a lot of time raising well-adjusted children? There is more to valuing worth than dollars.

How does the US have a "higher standard of living" when it is such an unhappy place for many and it is the second worst place to be a child according to the UN report mentioned in that archived article? Standard of living in what sense? Having piles of stuff? There is a lot more to happiness than piles of stuff. That is, when one gets beyond the dogmas, at least a good part of many progressive religious traditions.

The problem with metrics is you get what you measure, and it is hard to measure some really important things like love or caring. That's the problem with any technocratic system. Who gets to set the values of the system? Someone like, say, Jacques Fresco of the Venus Project (well worth looking up if you are in Florida) suggests those values and metrices are essentially self-evident or can be picked scientifically, but Albert Einstein suggests differently:
http://www.sacred-texts.com/aor/einstein/einsci.htm
"""
For the scientific method can teach us nothing else beyond how facts are related to, and conditioned by, each other. The aspiration toward such objective knowledge belongs to the highest of which man is capabIe, and you will certainly not suspect me of wishing to belittle the achievements and the heroic efforts of man in this sphere. Yet it is equally clear that knowledge of what is does not open the door directly to what should be. One can have the clearest and most complete knowledge of what is, and yet not be able to deduct from that what should be the goal of our human aspirations. Objective knowledge provides us with powerful instruments for the achievements of certain ends, but the ultimate goal itself and the longing to reach it must come from another source. And it is hardly necessary to argue for the view that our existence and our activity acquire meaning only by the setting up of such a goal and of corresponding values. The knowledge of truth as such is wonderful, but it is so little capable of acting as a guide that it cannot prove even the justification and the value of the aspiration toward that very knowledge of truth. Here we face, therefore, the limits of the purely rational conception of our existence.
But it must not be assumed that intelligent thinking can play no part in the formation of the goal and of ethical judgments. When someone realizes that for the achievement of an end certain means would be useful, the means itself becomes thereby an end. Intelligence makes clear to us the interrelation of means and ends. But mere thinking cannot give us a sense of the ultimate and fundamental ends. To make clear these fundamental ends and valuations, and to set them fast in the emotional life of the individual, seems to me precisely the most important function which religion has to perform in the social life of man. And if one asks whence derives the authority of such fundamental ends, since they cannot be stated and justified merely by reason, one can only answer: they exist in a healthy society as powerful traditions, which act upon the conduct and aspirations and judgments of the individuals; they are there, that is, as something living, without its being necessary to find justification for their existence. They come into being not through demonstration but through revelation, through the medium of powerful personalities. One must not attempt to justify them, but rather to sense their nature simply and clearly.
"""

That's the one point where

And then there are those who believe in magic and science at the same time.

Well, that depends on what one means by "magic". (And by "believe", I suppose.)

Obviously one can believe that the David Copperfield, stage magic variety sort of magic exists, and also believe in science.

It's also possible to "believe" in ceremonial magic of the Crowley sort, and also believe in science. Before he went bonkers with his Thelma nonsense, Crowley and his mentor MacGregor Mathers wrote in a preface to their version of The Lesser Key of Solomon of their understanding of magic as a psychological art:

...What is the cause of my illusion of seeing a spirit in the triangle of Art?

Every smatterer, every expert in psychology, will answer: "That cause lies in your brain."

...

The spirits of the Goetia are portions of the human brain.

...

If, then, I say, with Solomon:

"The Spirit Cimieries teaches logic," what I mean is:

"Those portions of my brain which subserve the logical faculty may be stimulated and developed by following out the processes called 'The Invocation of Cimieries.'"

...

...There is no effect which is truly and necessarily miraculous.

Our Ceremonial Magic fines down, then, to a series of minute, though of course empirical, physiological experiments, and whoso, will carry them through intelligently need not fear the result.

The 1/3 figure isn't originally from Milton, he took it from the Book of Revelation.

Sorry, but Paul tended to be down on rights for people who weren't him. He is the one that wrote those famous bits about how a woman needs to be subservient to her husband Eph 5:22-24 What he had to say about homosexuality Rom 1:27 I can't find anything on incest, but then I'm at work and I am sure I don't want to find anything.

Sorry, but Paul tended to be down on rights for people who weren't him. He is the one that wrote those famous bits about how a woman needs to be subservient to her husband Eph 5:22-24 What he had to say about homosexuality Rom 1:27 I can't find anything on incest, but then I'm at work and I am sure I don't want to find anything.

The only legitimate excuse for a giant library is if you are an academic researcher or an author. A good writer is a good reader, as they say. I am not a writer so I have no such need to keep things on file like that.

That may be part of it; though I'm a poet, my style is definitely informed by the prose I read. And certainly my book collection has swelled a bit the past few years as I've been doing research for the historical sections of my non-fiction book. Though for that I've also made extensive use of Google Books, the Sacred Texts archive, and Project Gutenberg, as well as some more specialized sites. Nothing like being able to find rare, long out-of-print original sources on-line.

Also many of my books pertain to my "other jobs", references related to martial arts and acupressure and massage. (For the day job, software, I have a few dead trees, but most of them I acquired pre-Web, or at least back in the days of dial-up.)

But I do enjoy just having books around. I prefer "collector" to "hoarder", thank you very much. :-)

Everytime I see OO.o I think of this (Sir Bedimir's line)....

http://www.sacred-texts.com/neu/mphg/mphg.htm#Scene%2034

1. Nicolaus Copernicus "On the Revolutions of [the] Heavenly Spheres" (1543)

2. Galileo Galilei "Dialogues [or Discourses and Mathematical Demonstrations] Concerning Two [New] Sciences" (1638)

3. Johannes Kepler Book Five of "Harmonies of the World" (1618)

4. Sir Isaac Newton "The Mathematical Principles of Natural Philosophy" (1687)

5. Albert Einstein "The Principles of Relativity: A Collection of Original Papers on the Special Theory of Relativity" (1922)

I am not certain how easy it is to "capture" HTML to read on the Kindle later but here are some decent translations in English if you want them.

but it is still a model.

Shhh!

What nonsense. Science is just as dogmatic, and has just as much faith as Religion. As they say, Science progresses one funeral at a time.

http://michaelprescott.freeservers.com/skeptic.htm

"Not only did modernists [i.e., rationalists] believe in the inerrancy of science, they also had a devout faith in progress. The 'modern,' almost by definition, was superior to the past. The future would be even better."

Let me quote from one of the famous priests of Science, Albert Einstein.

Religion of Science
http://www.sacred-texts.com/aor/einstein/einsci.htm

"After religious teachers accomplish the refining process indicated they will surely recognize with joy that true religion has been ennobled and made more profound by scientific knowledge."

"But science can only be created by those who are thoroughly imbued with the aspiration toward truth and understanding. This source of feeling, however, springs from the sphere of religion. To this there also belongs the faith in the possibility that the regulations valid for the world of existence are rational, that is, comprehensible to reason. I cannot conceive of a genuine scientist without that profound faith. The situation may be expressed by an image: science without religion is lame, religion without science is blind."

And this beautiful post by rajafarian (49150), http://science.slashdot.org/article.pl?sid=07/07/02/163252

In my time of studying things since I was little, I undertook the study of physics when I was eleven. When I was in college getting my BS in it I came to the conclusion that at the level where I was in my studies, physics turned to philosophy, for what do things like time mean anyway?

And then after studying philosphy on my own for a few years, I arrived at the conclusion that philosophy turns to religion because if we can never know these things for sure, we still have to make a decision how we are going to live our lives, and that is religion. In my opinion, real religion is when we consciously decide what to believe on our own (although it can be from reading about religions), fake religion is when someone makes the decision for us.

Both Science and Religion are out-dated, and incomplete -- the only reason they are used is because of a) momementum, and b) people think there is nothing better to use. The proper solution is to combine them to compensate for the weaknesses of each other to reach the next level of understanding reality.

--
How can you understand Life if you don't even understand what happens after Death??

In any case, you can accept parts of the Bible as allegorical or poetical (although I'd argue that those are very few) without accepting the whole Bible as allegorical or poetic. I do not believe the creation story is simply allegorical or poetic, I just believe that it is not a fully accurate description of what happened (however, it's no more simplistic than most textbook descriptions of evolution - the issue is much more complex than can be described in a few sentences).

Parts of the bible are poetical. Parts of the bible are literal historic fact. All of the bible contains underlying spiritual truth written in the representational language that was common in pre-ancient times. If chapter 1 of Genesis were written for the purpose of describing the origin of physical land, oceans, the sun and stars, it never would have been considered sacred in the first place. It is sacred because it describes the human soul, its creation, and its development.

http://www.sacred-texts.com/swd/ac/ac001.htm

"...the so-called soul is no more than the unity of consciousness which is liable at any moment to dissolve, and which comes to exist when there is a certain co-ordination of all mental faculties."

and

When we stand before a canvas painted by a great painter, do we not feel the presence of the artist, as his ideas and feelings are embodied in it? Cannot we say that the artist is still living in his work? We do not know whether his soul has gone up to the heavens and is enjoying the celestial happiness, but we do know for certain that he is still living among ourselves and inspiring us to higher ideals of life.

I highly recommend this book if like me, you are not Buddhist and merely want to understand the religion.

man, compared to Letters from the Earth this video is soooo lame, unimaginative and boring.

i wish folk would know their culture better, really.

http://www.sacred-texts.com/aor/twain/letearth.htm

Ah, too bad. At least I was able to get my hands on an unedited 16-volume set of Burton's translation of Arabian Nights. Some pretty racy stuff in there for a 13-year old! Funny thing was, I had no interest in that musty old stuff until my mom told me not to read them. Ever since then I've been on the lookout for anything published before 1900!

Of course, now you can get at least most of it on the Internet.
http://www.sacred-texts.com/neu/burt1k1/
http://www.gutenberg.org/browse/authors/b#a5414

You'd still be walking in a 'straight line' in one dimension at least, even if the overall vector is constanting changing. Sure the world itself is curved, but that doesn't mean we can't build a flat platform (such as a roof) and walk in an almost perfectly straight line over it. People have probably known for longer than you think that if you keep walking you will travel around the world btw. The idea that until very recently people thought of the world as 'flat' is a myth - the greeks have known about the world being round for at least 1600 years. Apparently Columbus thought the world was pear shaped. Anyway, your point is still valid, but I think people too often like to assume that our ancestors were all idiots. If you look out to sea at the horizon and compare it to a flat surface (like a fence alongside a boulevard) then you can see the curvature quite clearly.

Actually it turns out that narrative poems are particularly prone to certain types of changes, because -- at least in pre-classical Greece -- they're not recited by rote. There's overwhelming evidence that early Greek epics were re-told using an enormous set of conventions (formulaic language, typical scenes, typical plot elements); so stories were driven partly by how the story is known to go, partly by the individual storyteller's creative imagination, and partly by these conventions. Basically, what we now refer to as "poetry" was for an early Greek poet "the special kind of language that you use for telling certain stories and which happens to come out in good meter almost automatically".

The poets were professionals who went from house to house, village to village, to entertain people. They were paid for exciting stories. The poetic form helped the poets memorize the long stories but didn't prevent them from adding new verses for better pay.

This is stated directly in the
introductory poem of the Finnish epic the Kalevala:

That shall echo forth the praises

Of the beer that I have tasted,

Of the sparkling beer of barley.

Bring to me a foaming goblet

Of the barley of my fathers,

Lest my singing grow too weary,

Singing from the water only.

Bring me too a cup of strong-beer,

It will add to our enchantment,

To the pleasure of the evening,

Northland's long and dreary evening,

For the beauty of the day-dawn,

For the pleasure of the morning,

The beginning of the new-day.

The Finnish original is even more direct: the better you feed me, the longer the story.

The first search result for Qur-an and kill popped this up, FWIW

http://www.sacred-texts.com/isl/pick/002.htm

"54 And when Moses said unto his people: O my people! Ye have wronged yourselves by your choosing of the calf (for worship) so turn in penitence to your Creator, and kill (the guilty) yourselves. That will be best for you with your Creator and He will relent toward you. Lo! He is the Relenting, the Merciful."

Yes, I know, this isn't strictly related to the topic, but it proves the parent's point. There are books from many religions far outside of the norm there, but no Scientology.

that through history the catholic church has in fact persecuted scientists like Galileo, whose trial the current Pope considered "fair"

Dude: I thugged the basic text here http://sacred-texts.com/bib/kjv/gen006.htm and cruised it a couple times in modern wise-ass mode.
OK, I've read the Bible enough to know right where to look...

When I say 'there is no god', what I mean is that I havn't seen anything to suggest there is one. Much like if I'm looking at an empty table and say 'there is no spoon'. I think it comes down to human learning and culture. If a human is told 'x is true' by everyone around them since birth, then that person tends to hold to that truth quite dearly, even when they come of age and begin thinking for themselves.

Years ago, before scientific method and the knowledge we have today, people tried to explain what they didn't/couldn't understand. Various cultures have passed these beliefs down in such a way that people grow up with a belief in things they can't prove (or that others can't disprove ie. invisible flying spaghetti monsters).

So where should I be looking? books written by men in an age when superstitions were rampant and general education/intellect were far less than today? or somewhere else?

"After religious teachers accomplish the refining process indicated they will surely recognize with joy that true religion has been ennobled and made more profound by scientific knowledge."

"But science can only be created by those who are thoroughly imbued with the aspiration toward truth and understanding. This source of feeling, however, springs from the sphere of religion. To this there also belongs the faith in the possibility that the regulations valid for the world of existence are rational, that is, comprehensible to reason. I cannot conceive of a genuine scientist without that profound faith. The situation may be expressed by an image: science without religion is lame, religion without science is blind."

ARTHUR: Go and tell your master that we have been charged by God with a sacred quest. If he will give us food and shelter for the night he can join us in our quest for the Holy Grail.
GUARD: Well, I'll ask him, but I don't think he'll be very keen... Uh, he's already got one, you see?

John Wesley (7th paragraph from linked location) and Emmanuel Swedenborg beg to differ. Also: James chapter 20 is all about that.

If someone is interrested in the original http://en.wikipedia.org/wiki/Kullervo, here is a translation to english: http://www.sacred-texts.com/neu/kveng/kvrune31.htm http://www.sacred-texts.com/neu/kveng/kvrune32.htm http://www.sacred-texts.com/neu/kveng/kvrune33.htm http://www.sacred-texts.com/neu/kveng/kvrune34.htm http://www.sacred-texts.com/neu/kveng/kvrune35.htm http://www.sacred-texts.com/neu/kveng/kvrune36.htm Specially interresting is how Kullervo kills himself, in the last part, somehow familiar to those who have read the Silmarillion...

If someone is interrested in the original http://en.wikipedia.org/wiki/Kullervo, here is a translation to english: http://www.sacred-texts.com/neu/kveng/kvrune31.htm http://www.sacred-texts.com/neu/kveng/kvrune32.htm http://www.sacred-texts.com/neu/kveng/kvrune33.htm http://www.sacred-texts.com/neu/kveng/kvrune34.htm http://www.sacred-texts.com/neu/kveng/kvrune35.htm http://www.sacred-texts.com/neu/kveng/kvrune36.htm Specially interresting is how Kullervo kills himself, in the last part, somehow familiar to those who have read the Silmarillion...

If someone is interrested in the original http://en.wikipedia.org/wiki/Kullervo, here is a translation to english: http://www.sacred-texts.com/neu/kveng/kvrune31.htm http://www.sacred-texts.com/neu/kveng/kvrune32.htm http://www.sacred-texts.com/neu/kveng/kvrune33.htm http://www.sacred-texts.com/neu/kveng/kvrune34.htm http://www.sacred-texts.com/neu/kveng/kvrune35.htm http://www.sacred-texts.com/neu/kveng/kvrune36.htm Specially interresting is how Kullervo kills himself, in the last part, somehow familiar to those who have read the Silmarillion...

If someone is interrested in the original http://en.wikipedia.org/wiki/Kullervo, here is a translation to english: http://www.sacred-texts.com/neu/kveng/kvrune31.htm http://www.sacred-texts.com/neu/kveng/kvrune32.htm http://www.sacred-texts.com/neu/kveng/kvrune33.htm http://www.sacred-texts.com/neu/kveng/kvrune34.htm http://www.sacred-texts.com/neu/kveng/kvrune35.htm http://www.sacred-texts.com/neu/kveng/kvrune36.htm Specially interresting is how Kullervo kills himself, in the last part, somehow familiar to those who have read the Silmarillion...

If someone is interrested in the original http://en.wikipedia.org/wiki/Kullervo, here is a translation to english: http://www.sacred-texts.com/neu/kveng/kvrune31.htm http://www.sacred-texts.com/neu/kveng/kvrune32.htm http://www.sacred-texts.com/neu/kveng/kvrune33.htm http://www.sacred-texts.com/neu/kveng/kvrune34.htm http://www.sacred-texts.com/neu/kveng/kvrune35.htm http://www.sacred-texts.com/neu/kveng/kvrune36.htm Specially interresting is how Kullervo kills himself, in the last part, somehow familiar to those who have read the Silmarillion...

If someone is interrested in the original http://en.wikipedia.org/wiki/Kullervo, here is a translation to english: http://www.sacred-texts.com/neu/kveng/kvrune31.htm http://www.sacred-texts.com/neu/kveng/kvrune32.htm http://www.sacred-texts.com/neu/kveng/kvrune33.htm http://www.sacred-texts.com/neu/kveng/kvrune34.htm http://www.sacred-texts.com/neu/kveng/kvrune35.htm http://www.sacred-texts.com/neu/kveng/kvrune36.htm Specially interresting is how Kullervo kills himself, in the last part, somehow familiar to those who have read the Silmarillion...

Yeah it's a little embarrassing that they don't have the English version.

A few seconds of Googling turns up the standard English language translation by Sir Richard Burton, available here. Seeing as it was translated in 1883, I think it's suitably out of copyright.

Anyone have any idea how you go about submitting something to Project Gutenberg?

What's this?! The great hacker god Eric Raymond is not in this list?!

http://geekz.co.uk/lovesraymond/archive/show-them- the-code
http://catb.org/jargon/html/S/suit.html
http://www.self-gov.org/celebrities/images/eric-ra ymond2.jpg
http://pepelucho.blogsome.com/images/eric_raymond. jpg
http://www.sacred-texts.com/bos/bos086.htm
http://www.catb.org/~esr/writings/sextips/sexy.htm l

Don't stop at Wikipedia, it's a starting point ! Zeus bound Promethus as punishment for sharing fire with us humans; but eventually Zeus relented and hinted to his son, Heracles, that it wouldn't be terrible if 'someone' freed him (hint hint). So Heracles killed the eagle, freed the god, and there was much rejoicing. See Theogony, line 526-543.

"And ready- witted Prometheus he bound with inextricable bonds, cruel chains, and drove a shaft through his middle, and set on him a long- winged eagle, which used to eat his immortal liver; but by night the liver grew as much again everyway as the long-winged bird devoured in the whole day. That bird Heracles, the valiant son of shapely-ankled Alcmene, slew; and delivered the son of Iapetus from the cruel plague, and released him from his affliction -- not without the will of Olympian Zeus who reigns on high, that the glory of Heracles the Theban-born might be yet greater than it was before over the plenteous earth. This, then, he regarded, and honoured his famous son; though he was angry, he ceased from the wrath which he had before because Prometheus matched himself in wit with the almighty son of Cronos." - Theogony of Hesiod

What's knowledge of basic classical Greek mythology coming to?!

Coincidentally, I've been reading Ouspensky's Tertium Organum where he also suggests (borrowing from Kant) that space is an attribute of our empirical experience of matter and energy, not characteristic of the universe itself. He then cites Hinton, who proposes that our 3D space + time is actually the "surface" between two higher dimensional objects, likening the laws of physics as we know it to the exceptional physics of surface tension. If our physical laws are an exceptional case, then the massive unaccounted energy we predict may be the general rule in the larger scheme of things.

And it may well be that the laws of our universe are the surface tensions of a higher universe.

If the surface be regarded as a medium lying between bodies, then indeed it will have no weight, but be a powerful means of transmitting vibrations. Moreover, it would be unlike any other substance, and it would be impossible to get rid of it. However perfect a vacuum be made, there would be in this vacuum just as much of this unknown medium (i.e., of that surface) as there was before.

Matter would pass freely through this medium . . . vibrations of this medium would tear asunder portions of matter. And involuntarily the conclusion would be drawn that this medium was unlike any ordinary matter. . . . These would be very different properties to reconcile in one and the same substance. (Hinton)

I'm not a physicist and neither was Ouspensky AFAIK, so here's a bag of salt. I do, however, wonder if theoretical physicists read this kind of stuff, if not for insight then at least for an interesting mind trip. Imagine if we could somehow be conscious of more dimensions and apply that consciousness to travel great distances or perceive an entire timeline as one moment. In fact, the anthropological literature suggests that seers and shamans have been doing this since the caveman days.

I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here

Maybe it's time to re-read the works of one Charles Hoy Fort?

einstien would not have believed in a god that is "pathiestic" in the normal sense of the work. That there is more then one god.

In fact he does not seem to fall very far from his Jewish background in his theology. He proposes that it is perfectly possible to have both religion and science without conflict.

http://www.sacred-texts.com/aor/einstein/einsci.ht m

Man, next you'll be telling us that we stopped going to the moon because the aliens don't want us to be there.