Slashdot Mirror


Using Radiators to Cool CPUs

dan writes "Overclockers Australia have a review up of the CPU Radiator Zen, a new approach to cooling your toasty CPU's. Rather than taking the traditional approach of a heatsink with lots of fins and a noisy 7,000rpm fan it uses radiator/heat pipe technology. The implementation of the unit is a bit flawed, but it is interesting to see where the technology is heading.. and if it can be done right I personally think this is where it will end up."

245 comments

  1. fierce postage! by Anonymous Coward · · Score: -1, Offtopic

    i keep typing slashdot.orgy

  2. first post by O'Bunny · · Score: -1, Offtopic

    First post? Really???

  3. Silent? by chrysalis · · Score: 3, Interesting

    How silent is this? It's cool for overclocking, but if it's silent, it could also be very cool for music makers.

    --
    {{.sig}}
    1. Re:Silent? by Chakat · · Score: 2, Informative
      It looks like its still farily loud. It's got two fans on it, so it's going to make a good amount of noise. Unfortunately, it's not the fanless system I was hoping for when I checked it out.

      Plus, it looks like its not good for OCers. The device is very poorly designed, and busted caused damage to both the CPU and Mobo.

      --

      If god had intended you to be naked, you would have been born that way.

  4. The Turd Report 11/07/2001 by The+Turd+Report · · Score: -1
    I had crab rangoons from Manchurian, in Herndon. They were wonderful. I had them with some green tea I had bought from Chinatown, in DC. This morning, my turds were an unusual color. They were green, bright lime green. It did not take much to get the turd out. It just slid right on out with minimal pushing. There was no smell, which I found to be odd. I will rate this turd a 7.

    On a side note, I would like to talk about Bathroom Etiquate. There are a few cow-orkers who do not know these rules. The first is: Don't take the stall next to another person, if it can be avoided. That middle stall is the buffer stall; consider it to be no-man's land. Second rule is: Don't talk to the person in the next stall. Taking a dump is a time for thinking and meditation, or excremeditation, as I like to call it. Talking disrupts the thought process. The third rule is: Keep the grunting to an absolute minimum if there is another person in the stalls. Nothing worse than hearing some fool trying to take a big dump and grunting like a pig.

    1. Re:The Turd Report 11/07/2001 by Guns+n'+Roses+Troll · · Score: -1

      Those new frozen drinks from Burger King turn your shit green for a week. I can't find the URL now but there is a health webpage out there with documented cases. It's not fatal but I'd be a bit concerned if I was shitting neon.

    2. Re:The Turd Report 11/07/2001 by Anonymous Coward · · Score: 0

      True-dat on the rules.

      When I was in college, guys would come in and have a frickin conversation with you! Jesus christ! I'd always say "I'm concentrating on something here, would you shut up, or should I concentrate on rubbing it in your nose?"

      I'd have to take dumps in the middle of the afternoon when everyone was in class.

      The bathroom stall (or the "Thrown" as I like to call it) was the only place I could understand Physics.

      -DFW : Banned, damnit.

    3. Re:The Turd Report 11/07/2001 by Anonymous Coward · · Score: 0
      Bathroom Etiquate

      I hear you, man.

      It's really annoying when some co-worker takes the next stall and strikes up a conversation with you. Hell, what the hell is wrong with these people? Taking a dump should be an anonymous act, not something you advertise -- especially if you can't keep it quiet (grunting, lots of gas or splashing).

    4. Re:The Turd Report 11/07/2001 by Anonymous Coward · · Score: 0

      You mean "throne" ?

    5. Re:The Turd Report 11/07/2001 by neal+n+bob · · Score: 0, Informative

      amen to that. People are ignorant of the rules all the time here. Lucky for me there are a lot more women than men in my section of the building. There is a nice safe haven bathroom - it has an open window to the outside so it is very serene. But there is one guy who I swear forces himself to take 2 craps a day - grunting, stanky odor, the whole production. I usually try to do a fly by - if it is clear, I go take care of business. One time I went in while he was there - he was in the middle of a pause and I did not know it was him - then right as I sit down he starts grunting and groaning again. A tip for you kids - forcing one out is bad for your colon. You don't need to wait until it is poking its head out but you should not have to force it - you need to eat more fiber.

    6. Re:The Turd Report 11/07/2001 by tt2k1 · · Score: -1

      Too bad the "Thrown" didn't help you understand English.

      --

      Troll Tuesday 2001.

      --The Mess

    7. Re:The Turd Report 11/07/2001 by neal+n+bob · · Score: -1
      you son of a bitch - who modded me up? How dare you move me towards positive karma?

      Some mod must have gotten some of that cheap afghan smack.

  5. another way to do this by avandesande · · Score: 1

    take a large copper cloth flat grounding wire, and attach to cpu. take the other end and attach to case. noisless cooling.

    --
    love is just extroverted narcissism
    1. Re:another way to do this by CausticPuppy · · Score: 3, Informative

      Good idea in theory but that won't move heat quickly enough for powerful cpu's. Also, your case would get very warm and act like an oven around your hard drives and other components. You'd have to drastically increase airflow through the case in order to keep the rest of the system cool, which would defeat the noiseless aspect of the copper wire cooling method. With cpu heatsinks, the heated air is usually vented right out without circulating to the other components.
      Without a real heatsink that has a large air-exposed surface area a relatively short distance from the chip, you'll wind up with an impressive heat gradient across the wire.
      An Athlon chip will get up to roughly 600-700 degrees (F) within just a few seconds of power-on if no heatsink is attached. The copper cloth wire might bring it down a bit but you're still talking about having something exposed inside your case that's hot enough to melt wire insulation and probably catch dust on fire (after your system crashes of course).

      --
      -CausticPuppy "Of all the people I know, you're certainly one of them." -Somebody I don't know
    2. Re:another way to do this by Disoculated · · Score: 1

      You'll also have the unfortunate effect of grounding your processor out through the case. The next time you happen to touch the case in dry weather, ** ZAP! **, game over.

  6. Heat Capacity by Anonymous Coward · · Score: 0

    I'm really surprised we dont see this method more often, and from OEMs. Given that water has the highest heat capacity of just about anything, this only makes sense. Look for more water cooled systems in the future.

    1. Re:Heat Capacity by stilwebm · · Score: 3, Insightful

      Several reasons why water is not commonly found in computers. One, water an electricity do no mix well. Two, it is very expensive to make the many parts required to keep water in the cooling system, keep it flowing, and still allow it to exchange the heat with air. By very expensive, I don't mean hundreds of dollars per CPU, but considering that a heatsink and fan combo are very inexpensive to manufacture...

    2. Re:Heat Capacity by sphealey · · Score: 2
      already been done? I do believe that one of the Cray models had a 'liquid cooled CPU', or something to that effect. I never saw the specifics on how it was done, if it was just the CPU, or if it was the whole machine being cooled that way.
      For suitable values of "commonly", I guess. Mainframes (which probably process the majority of the world's bits, even today) have been water cooled since the 1960's.

      sPh

    3. Re:Heat Capacity by pbur · · Score: 2, Insightful

      IIRC, *pure* water doesn't conduct electricity. It's all the crap found in freshwater that make it conduct.

    4. Re:Heat Capacity by gorilla · · Score: 3, Insightful

      Actually mainframes went away from water cooling, starting with Amdahl in 1979. Nowadays even IBM's highend mainframes are air cooled.

    5. Re:Heat Capacity by archen · · Score: 1

      this is true, but you have to consider you have to make the water 99.9% pure, and you have to make sure it STAYS pure in this situation. Generally I think this would be a pain in the ass, and it would probably be easier to use something else.

    6. Re:Heat Capacity by bluGill · · Score: 2

      True. However pure water picks up impuritieds. Take some 18 megaohm water (the purest we can achive) pour it into a clean glass, and just from the air it will have picked up a lot of impurities. (I've been told how much, but can't recall. puts the water way out of spec though)

    7. Re:Heat Capacity by rhombic · · Score: 1

      The conductivity of your average home source RO water is going to be plenty high enough to allow your mobo to short out. Even if you had a Barnstead at home, the water is going to leach enough stuff out of the piping to bring the resistance down to fry-point pretty quickly. Oh yeah, and ultra-low conductivity water is hell on most metals.

      --
      1984 was supposed to be a warning, not an instruction manual.
  7. laptops already have this, no? by emg178 · · Score: 1

    don't laptop's already have this?

    1. Re:laptops already have this, no? by x-ntric_one · · Score: 2, Informative

      I know that there is a company called Thermacore does it for Dell laptops. I have been able to play around with their heat pipes and they are amazing. I believe Thermacore does product for any laptop product higher than a C600. So to answer the question.. YES! Are there anymore company's like this besides these 2?

  8. not really news by akad0nric0 · · Score: 1

    Althought I don't have a link, I know they've done this as far back as the first pentiums. If I recall correctly, this was the ONLY way they could get the very first [then] brand-spankin-new Pentium's to work.

    --
    akad0nric0

    This sentence no verb.
  9. Noisy Fans? by FortKnox · · Score: 3, Insightful

    a noisy 7,000rpm fan

    Maybe I'm just an old-school style computer guy, but is fan noise really that big of a deal? My computer is in an infants room and it doesn't wake up the baby (counterstrike pumped through 4 speakers does, but that's beside the point). Honestly, who has a huge issue with fan noise?

    And why always complain about CPU fan noise? Doesn't the fans in the power supply make more noise, anyway?

    --
    Good quote, too many chars. Seriously, the slashdot 120 char limit sucks!
    1. Re:Noisy Fans? by FortKnox · · Score: 1

      Another thing...
      By looking at the pictures, it appears that the "radiator" is replacing the heatsink, and they still have fans on top.

      --
      Good quote, too many chars. Seriously, the slashdot 120 char limit sucks!
    2. Re:Noisy Fans? by melquiades · · Score: 2

      I'm just an old-school style computer guy, but is fan noise really that big of a deal?

      I don't think it has anything to do with being "old-school style" -- apparently you're just not a musician! Those of us who do musical work with our machines half the time and have hyper-sensitive ears the rest of the time find fans quite irritating.

      Doesn't the fans in the power supply make more noise, anyway?

      Not in my laptop! :) It's soooo close to silent, but darn, if I could just squeeze it down a few more decibels....

    3. Re:Noisy Fans? by Daniel+Dvorkin · · Score: 2

      Try working with a fanless desktop computer -- e.g., an iMac -- for a while and then go back to your regular desktop. See what a difference it makes. Fan noise never used to bother me until I got an iMac at home; now sitting down at my desk at work bothers the hell out of me for the first hour or so, because I'm always aware of the noise from the CPU. And I'm convinced that even if one isn't aware of it, the constant background noise harms productivity.

      Not that it harms productivity as much as posting to /. when one should be coding, of course ... ;)

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    4. Re:Noisy Fans? by yorgasor · · Score: 1

      I've got a GlobalWin fan for my Athlon that runs about 7k RPM, and when that sucker is on, you know it! My computer didn't use to be nearly that loud, and the power supply noise doesn't come close to touching it (and I have 2 power supplies in my case).

      I would just _love_ to tone down the noise a bit, especially because I have two computers with this fan in my living room. When company is over, the noise does get a little annoying when you're trying to have a conversation.

      --
      Looking for a computer support specialist for your small business? Check out
    5. Re:Noisy Fans? by bstrahm · · Score: 2

      The answer is obviously YES...

      When I left my last company I had a dual Xeon system (3-4 fans if I recall) and a bunch of network switches, other boxen, etc. each with their own fans...

      When I powered down when I left, I was SHOCKED at how quiet my cube got... I just keep a laptop in my cube now and use X/SSH/etc. to get at the "real" work machines that are elsewhere... I love the quiet.

    6. Re:Noisy Fans? by Peter+Dyck · · Score: 2, Interesting
      is fan noise really that big of a deal?

      Fans make noise. Period.

      I'm one of those individuals who are simply driven mad by excessive computer noise which means that anything over 50 dB is intolerable. In fact, some time ago I sold my 600 MHz Duron PC because I couldn't stand the noise the CPU fan alone made. A CPU fanless Sun Blade 100 with a low rpm hard drive was heaven after the previous noise polluter (the power supply still makes noise, though). I'm quite content with the trade-off I had to make between computer speed and noise.

      I still blame the CPU manufacturers for ignoring the heat problem (=noise problem) at the altar of unnecessary performance, though.

    7. Re:Noisy Fans? by L-Wave · · Score: 1

      oh how nice it would be to underclock my fan to ten rpms... *sigh* =)

      --
      I SURVIVED THE GREAT SLASHDOT BLACKOUT OF 2002!
    8. Re:Noisy Fans? by moored2 · · Score: 1

      That is why I have my computers rack mounted in a closet at home. Now if I can talk the wife into mounting an air conditioner in the closet.

    9. Re:Noisy Fans? by rbeattie · · Score: 1


      Not that I know fsck-all or am a doctor or anything... But this seems like SUCH a bad idea.

      Though your baby probably won't develop general hearing loss, he/she might lose the ability to hear in a range of sound because of his/her developing ears having constant noise exposure in that range.

      Real hearing loss for adults which can result in being exposed to noise above 85 decibels for 8 hours or so straight and since normal speech is around 55 to 60 db, this probably isn't the case in your baby's room. ;-) But I wouldn't suggest keeping a semi-noisy computer in there humming away all day/night either.

      -Russ

      --
      Me
    10. Re:Noisy Fans? by the_2nd_coming · · Score: 2

      one problem with your reasoning is that babies like soft white noise. at a resurant, babies sleep because the background noise is soothing and hypnotic. ever wonder why all those crib toys come with an option of waves or wind?

      --



      I am the Alpha and the Omega-3
    11. Re:Noisy Fans? by robvasquez · · Score: 0

      If you've got one of those desks where you can put the CPU in a shelf or cabinet...those work great.

      It's the whine of a cheap monitor that gets to me! Or the sounds of a CDROM! Or GeoCities web page MIDI's!

    12. Re:Noisy Fans? by FrankHaynes · · Score: 1

      Call me madcap, but I always thought that a heatsink *is* a radiator.

      As to fan noise, some here seem to be speaking of acoustic noise while others offer solutions to electronic noise.

      My hard drives make way more noise than the cooling fan, so those of you who object to the cooling fan noise should mount the computer in another room or inside a hush cover.

      ---

      --
      slashdot: A failed experiment.
    13. Re:Noisy Fans? by dagashi · · Score: 1


      Doesn't the fans in the power supply make more noise, anyway

      The power supply (fan?)/CPU fan make very very very little noise these days.
      Try starting up your computer without the hdd's plugged in once. They're the ones keeping you awake at night
      (when W4rEz-PuP on the other side of the globe starts leeching those divx off your ftp with too many user accounts)

      Aaah total silence.

    14. Re:Noisy Fans? by eviljav · · Score: 1

      The same imac that has a hard drive loud enough to drown out a dell sitting next to it with 3 fans?

    15. Re:Noisy Fans? by sammy+baby · · Score: 2
      Call me madcap, but I always thought that a heatsink *is* a radiator.


      Well, yeah, it is, in the technical sense. In the article, though, they're using the term "radiator" to describe what you probably have in your house if you're not on central air: a long pipe through which they're moving a refrigerant. Essentially, this is a liquid-cooled system, minus all the crap that's usually involved in putting together a liquid-cooled system (external resevoirs and radiators, along with a couple feet of flexible tubing).



      It's a shame the thing apparently has the worst mounting system in the world, because otherwise, it looks from the test results like the design worked pretty well.

    16. Re:Noisy Fans? by Anonymous Coward · · Score: 0
      Honestly, who has a huge issue with fan noise?


      Well, one group of folks would be musicians(as other posters have suggested). I use 2 PCs in my home recording setup and I'm constantly battling the humming sounds coming out of them. I've spent quite a bit of effort on finding quiet power supplies, cool running drives (so I don't need a case fan), quiet cpu fans, etc. Oh and my biggest lesson learned... if you're concerned about noise, stay far away from sparkle power supplies... stay far far away. They sound like a blender chewing up live rodents.

    17. Re:Noisy Fans? by kaimiike1970 · · Score: 1

      Noise and health

      These reports are very interesting, the first is from the EPA,

      and the second is from an admin conference of the USA.

      http://www.nonoise.org/library/epahlth/epahlth.htm

      http://www.nonoise.org/library/suter/suter.htm

      But, if you only have limited time this is a quick read:

      http://www.pp.okstate.edu/ehs/TRAINING/SSHHH.HTM

      The key thing is that certain noises can raise your level of tension and create more stress.
      Something none of us can use. Also interesting, is that with prolonged exposure to a specific sound
      you can also become 'insensitive' to that frequency. This constitutes a partial hearing loss
      that can be permanent.

      --


      Do a google search before posting.
    18. Re:Noisy Fans? by Sj0 · · Score: 1

      Try a pair of high quality studio headphones. Expensive, but they'll last for decades (unlike the walkman style headphones or the ear buds), and they sound INCREDIBLE.

      --
      It's been a long time.
    19. Re:Noisy Fans? by SumDeusExMachina · · Score: 1
      Pardon me, but do you actually have a 7,000 RPM fan on your CPU? I have a 7,200 RPM Delta fan sitting on top of my Alpha heatsink, and it is undoubtedly the noisiest thing in my computer. This is competing with a 120mm fan and 3 10K RPM SCSI drives, too.

      This is actually an improvement from my previous configuration, which had 2 high-powered 80mm fans blowing out the back. Honestly, it's cool to have a machine that sounds like an idling jet engine for the first 5 minutes, but after that, it gets seriously irritating!

      --

      Is your company running tools written by ma
    20. Re:Noisy Fans? by Alan+Partridge · · Score: 1

      bizarrely, iMacs (like all Apple computers) come fitted with a variety of different HDs - each with it's own acoustic properties. It's strange to think that Apple go to all that effort to remove fans, and then allows the fitment of both loud and quiet HDs. It's a perfectly normal 3.5" ATA device though, so you could swap out for a more silent one if desired.

      --
      That was classic intercourse!
    21. Re:Noisy Fans? by Manaz · · Score: 2

      And why always complain about CPU fan noise? Doesn't the fans in the power supply make more noise, anyway?

      It sounds like you haven't actually HEARD the sound of a 60mm 7,000rpm Delta Black Label fan.

      Imagine a hair dryer. On it's fastest setting. Sitting inside your PC.

      That's the sound one of those fans makes. It takes a LOT of effort for a 60mm fan to move 38cfm in a free-air environment - then add to the fact that you're trying to push that airflow through a heatsink, which creates even MORE noise, and your fan gets louder again. It's not unusual to hear of HSF units with Delta Black Label fans rated at 48dBA. And that doesn't take into account the fact that the noise is very high pitched as well. It makes your PC sound like a jet plane readying itself for takeoff. It can *really* get on your nerves. Trust me.

      Power supply fans tend to be pretty damned quiet in comparison. Especially when Panaflo fans (or similar) are used - they're known for being quiet.

    22. Re:Noisy Fans? by Anonymous Coward · · Score: 0
      is fan noise really that big of a deal?


      It is if you're trying to make music... 'specially if it's quiet music. There are several different tones coming out of my fans, and they completely mask fine details in those pitch ranges.


      Computers are way smaller than refrigerators. But my computer is 5 times louder than my fridge. That seem right?

    23. Re:Noisy Fans? by mesach · · Score: 1

      You apparenty do not own a 7000 rpm fan, it whines so loud you can hear it 3-4 rooms away, i have a 6800rpm delta on my sk6 heatsink and im am considering going to watercooling so i can get a computer that is almost as silent as it used to be.

      --
      moo.
  10. Check out kryotech by gobutit · · Score: 1
    1. Re:Check out kryotech by David+P · · Score: -1

      I use Dictionary.com to spell words correctly.

  11. Has this... by rmadmin · · Score: 2, Informative

    already been done? I do believe that one of the Cray models had a 'liquid cooled CPU', or something to that effect. I never saw the specifics on how it was done, if it was just the CPU, or if it was the whole machine being cooled that way.

    I also remember someone else (Penguincomputing?) having the '1st commercial liquid cooled PC', which was a 1.6 Ghz(2x800Mhz) Dual Athlon.

    Either way, its really cool to see this same technology replicated for private use.

    1. Re:Has this... by sphealey · · Score: 2
      already been done? I do believe that one of the Cray models had a 'liquid cooled CPU', or something to that effect. I never saw the specifics on how it was done, if it was just the CPU, or if it was the whole machine being cooled that way.
      That's one of the most famous design hacks in computer hardware history (although that statement itself is a bit unfair, given the percentage of high performance hacks directly attributable to S. Cray): the entire processing section was submerged in liquid Freon, several hundred liters worth. There was a glass section so you could look in as with an aquarium, too.

      sPh

    2. Re:Has this... by Anonymous Coward · · Score: 0

      IBM 3090 series mainframe had radiator cooled cpus in the vector unit.

  12. Submerging circuit board in an inert liquid by melquiades · · Score: 5, Insightful

    I remember seeing years ago on public television somebody demonstrating this amazing liquid which, I believe, was called "chlorinert". It looked and behaved more or less like water, but it was completely nonconductive. The guy demostrated by plugging in a lamp, submerging it in the liquid, and screwing in a bulb while it was submerged. It was pretty amazing.

    They mentioned its possible application to CPU cooling in supercomputers -- the idea was that you would actually submerge whole circuit boards in the liquid, while pumping it through a conventional refrigeration unit. Heat sinks be damned!

    Apparently it never caught on, though -- I can't find anything about it online. Even mighty google just says, "Did you mean 'chlorine'?" I think it was incredibly expensive; perhaps that's the reason.

    1. Re:Submerging circuit board in an inert liquid by Sir_Real · · Score: 2, Informative

      It was called Flourinert actually, and the reason it isn't used is that at high temps it turns into musturd gas... ;)

    2. Re:Submerging circuit board in an inert liquid by Raptor+CK · · Score: 5, Informative

      You mean Fluorinert?

      I remember seeing an overclocking/cooling experiment with this somewhere. Cool stuff, until it turns to mustard gas.

      --
      Raptor
      "Procrastination is great. It gives me a lot more time to do things that I'm never going to do."
    3. Re:Submerging circuit board in an inert liquid by xcjohn · · Score: 2, Informative

      you may be thinking of flourinert. This is actually used. I remember seeing a setup down at the San Diego Supercomputer Center that cooled itself by litterally passing flourinert over certain parts. iirc they called it, simply, a waterfall... and was on one of the Cray's

      --
      ~~~ They call me Little John, but don't let the name fool you...in real life I'm very big.
    4. Re:Submerging circuit board in an inert liquid by Anonymous Coward · · Score: 1, Informative

      It's also very expensive. Several hundered dollars a gallon. You'd probably be better off just buying a faster processor.

    5. Re:Submerging circuit board in an inert liquid by rschwa · · Score: 1

      expensive, on the order of $500/gallon. I saw a thing where some guys immersed a celeron 500 in a flourinert bath intercooled with liquid nitrogen, clocked it up to like 1.2 gHz, but they got the wrong spec flourinert, and it gelled on them. My wife works at 3M, I keep bugging her to gank a couple of gallons for me so I can try it ;)

    6. Re:Submerging circuit board in an inert liquid by rschwa · · Score: 2, Informative

      aha! here's the link:
      Wacky flourinert fun!

    7. Re:Submerging circuit board in an inert liquid by Anonymous Coward · · Score: 0

      CFCs behave this way ("florinert" may be some brand name for a type of CFC). They are used very commonly for cleaning circuit boards, electronics, etc, because they are non-conductive and don't react much with anything.

      Until, of course, they are disposed of, when they begin to wreak havoc on the environment. CFC use is becoming more and more restricted, due to environmental concerns. Ozone layer, anyone...

    8. Re:Submerging circuit board in an inert liquid by dbc · · Score: 1

      This was done on the ETA 10. The circuit board was submerged in refrigerant. The magic is not the coolant, but the circuit board technology. You have to be able to insert/remove the circuit board without the different thermal expansions rates of the various materials causing the circuit board to de-laminate and the components to sproing all over the place. (Now I feel old -- this is a ridiculously old technology... and I worked on a *predecessor* computer.. sheesh. "Gramps, over and out.")

    9. Re:Submerging circuit board in an inert liquid by archen · · Score: 1

      it's actually sort of scary when you think about what would happen if a building full of computers using this suddenly started on fire. Instead of your normal fire, you have a simulation of a WWI battlefield and haz-mat teams evacuating everyone in the area.

    10. Re:Submerging circuit board in an inert liquid by liquidsin · · Score: 1

      There's no need for expensive, difficult to find chemicals. Mineral oil serves the same purpose (won't fry your computer), and can be cooled to some ridiculous temperature (it's still a liquid at -40 C). Check this out for a story (first one google spit back at me, but there are many others)

      --
      do not read this line twice.
    11. Re:Submerging circuit board in an inert liquid by Anonymous Coward · · Score: 0

      is it not true that you can use distilled water? if I am correct, it will not conduct electricity as long as it is pure water.

    12. Re:Submerging circuit board in an inert liquid by snookums · · Score: 1

      Quite true. The conductivity of pure water is miniscule. I can't remember the formula for calculating conductivity from ionic strength, but the concentration of ions in pure water at room temperature is only 2x10^-7 M.

      The problem is that it's not pure water once you put your mother board in it...

      --
      Be careful. People in masks cannot be trusted.
    13. Re:Submerging circuit board in an inert liquid by Mark+of+THE+CITY · · Score: 1

      The Cray 2 used Fluorinert. The 8 CPU model from Lawrence Berkeley Laboratory is now at The Computer Museum History Center, http://computerhistory.org

      --
      The clearance system sounds logical. It is not. It is completely arbitrary. -- John Bolton
    14. Re:Submerging circuit board in an inert liquid by the_2nd_coming · · Score: 2

      I think the NSA uses that modle...or at least did use it. I saw an NSA dude talking about computer systems infront of that thing on a PBS show like nova or somthing.

      --



      I am the Alpha and the Omega-3
    15. Re:Submerging circuit board in an inert liquid by Stultsinator · · Score: 1

      That chemical contained CFC's and therefore was discarded.

      I saw the same demo and was pretty impressed. I remember at the time thinking it'd be pretty cool to fill underwater remote sensing machines with this stuff so that they could go deeper.

    16. Re:Submerging circuit board in an inert liquid by RainbowSix · · Score: 2

      It isn't uncommon to see somebody with their computer submerged in Mineral Oil, which is nonconductive, and the bath in turn refrigerated.

      For example, http://www.drffreeze.com/News.htm

      but it hasn't been updated in quite awhile

      --
      --------
      It's OK to be social, just don't tell anyone about it.
    17. Re:Submerging circuit board in an inert liquid by JewFish · · Score: 1

      Why not just use H20, if you get the water pure enough it is not going to conduct electricity. Be careful not to use tap water! I wonder if there are any refrigerants out there that have good electrical properties for this. Well it sure would be cool to have a case full of liquid and I bet it would cut down / eliminate fan noise.

    18. Re:Submerging circuit board in an inert liquid by Anonymous Coward · · Score: 0

      OCTOOLS at www.octools.com wrote two articles on submerging the motherboard in Flourinert with liguid nitrogen cooling. The articles are Mission: Submersible and Mission: Submersible 2.

    19. Re:Submerging circuit board in an inert liquid by AA0 · · Score: 1

      It behaved like water, but it was non conductive?

      since when was water conductive?
      put enough crap in the water, and the particles/ions inside it will conduct electricity, but water itself won't.

  13. Future visit to computer shop by Chairboy · · Score: 5, Funny

    Me: "My computer has been making a strange sound."

    Computer Mechanic crawls under my computer, then slides out a few minutes later and wipes oil off his hands with an old shop towel. "Looks like your radiator fan has lost a bearing. I can replace it, but I also have to put on a new belt. The old one is almost wore down. Also, you need an oil change. These new Septium-6 processors can really eat up an oil filter quick, and the color of this stuff is pretty dark now.

    Me: "Boy, I remember when computers were so simple, I could just pop off the case and swap out components on my own."

    Computer technician: "Ok gramps, whatever you say. You just sit yourself down out in the lobby and I'll have Betsy ring you up once I'm done. Shouldn't take more then a couple hours. Oh, and the tread on your network connector looks a little thin, can I suggest a new pair?"

  14. Fuck it by Guns+n'+Roses+Troll · · Score: -1

    I tried to get the first post but the fucking phone rang. Stupid customers.

  15. Not the first time. by TagrenHawk · · Score: 2


    This is not a new idea. This has been done before.

    1. Re:Not the first time. by Anonymous Coward · · Score: 0

      read the article - it's not the same thing you STUPID FUCK!

  16. Radiator=water=dangerous! by Andreas(R) · · Score: 1, Interesting

    In most cases, using a radiator means pumping water into your computer. And THAT is one big source of trouble. Just imagine what happens if one of the pipes cracks, or if a joint falls off!

    And, my Athlon 1,5Ghz will instantly boil any water because it's ONE HOT MAMA!

  17. Hell, *I* know... by legLess · · Score: 3

    I know where it'll end up: just like Reason in Snow Crash. Boxes will be nuclear powered and you'll have to have the heat exchanger immersed in water the whole time or it'll melt down.

    In all seriousness, I do think this is the way things'll go. Remember all those air-cooled Volkswagen buses? Remember how people bolted radiators onto the side of them so they wouldn't explode in hot climates? Air-cooling will only carry you so far, especially with dinky little fans. For serious cooling you need serious metal-to-metal heat exchange.

    --
    This isn't as much "normalization" as it is "don't take so many drugs when you're designing tables."
  18. Great by British · · Score: 2

    Great, at this rate, we'll have tricked out computers a la The Fast and the Furious

    1. Re:Great by Guns+n'+Roses+Troll · · Score: -1

      That movie is disgusting. A bunch of rice boys with 20" chrome wheels, 4' wings, tin can muffler tips, and stickers plastered everywhere. Those stupid fucks couldn't tell a distributor from a pushrod.

    2. Re:Great by Leven+Valera · · Score: 2

      Great, at this rate, we'll have tricked out computers a la The Fast and the Furious

      "Well damn, you might have pulled 2 MFlop on me, but you have to remember I've got half the MHz of your Dell in this Hewlett Packard."

      "So why'd you put an P4 sticker on it?"

      --
      Woot w00t w007.
    3. Re:Great by tt2k1 · · Score: -1
      True dat. I wouldn't even have that much of an issue with the "looks fast == drives fast" methodology, if these dumbfucks actually had some sense of taste. But they don't. All around DC I see riceboys with kanji stickers, aerofoils of mismatched colors, and headlamp covers, lowered to an inch off the ground and thinking they're the shit. I mean, how can they not see how stupid their cars look?

      Meanwhile, they get their asses whipped by stock Dodge minivans because they know nothing about engine tuning, aerodynamics, transmission adjustment or driving. I have to put up with these riceboys swerving all over the road thinking that they're playing Gran Turismo on the way to work.

      Oh, I almost forgot the Mark of the Rice: the big loud muffler! "It doesn't matter if my car is fast, as long as it sounds like I have a big engine!" Aha ha ha ha ha ha ha...

      These fucktards are an offense to humanity. Every time that I see some 16yo reading a "street racing" (hahaha) magazine and bitching about his rad Civic, I just want to fucking kill him.

      --

      Troll Tuesday 2001.

      --The Mess

    4. Re:Great by freq · · Score: 1

      "loud pipes save lives"

      -bumper sticker i saw on a nicely tuned rx-7

      --
      "Tension is the great integrity" -- R. Buckminster Fuller
    5. Re:Great by tt2k1 · · Score: -1

      By "nicely tuned," you mean that it had purple foglamps and a "No Fear" decal, right?

      --

      Troll Tuesday 2001.

      --The Mess

  19. is overclocking really necessary these days? by El+Puerco+Loco · · Score: 3, Insightful

    it was cool when you could jack a celeron300a up to 450mhz and have it run faster than a pentium 450 at less than half the price, but with most processors today you're looking at maybe a 5 or 10 percent gain and maybe a 20 or 30 dollars in savings. the savings is nil when you have to buy a fancy cooling solution to keep running

    1. Re:is overclocking really necessary these days? by Pyrosz · · Score: 1

      It comes into play now when you buy a new super fast computer and 6 months later its starting to look a little slugish compared to the newest models... you then overclock it and it will be as good as new again. Until you have to buy a new mobo/cpu to get the newest tech that is.

      --

      An optimist believes we live in the best world possible; a pessimist fears this is true.
    2. Re:is overclocking really necessary these days? by denzo · · Score: 2
      It comes into play now when you buy a new super fast computer and 6 months later its starting to look a little slugish compared to the newest models... you then overclock it and it will be as good as new again. Until you have to buy a new mobo/cpu to get the newest tech that is.
      A couple of problems with this. First, computers are hardly getting sluggish after a few months. Before the Athlon/PIII era, new processors actually were significantly faster than their prior versions/ratings, especially with Windows and software bloating almost faster than the hardware. We now see a general levelling off of software bloat, with certain games as an exception, while hardware is only getting better at small percentages. My 900MHz Athlon, which I got almost a year ago, performs admirably well in all my applications, and can even play the latest games just fine.

      Secondly, as the previous poster mentioned, you can't overclock newer processors as much. The older Celeron varieties were underclocked in order to make a big dent in the economy PC market, and overclocked by as much as 100% or more for many people. Pretty much all processors released now are close to their yield. Intel and AMD are ramping out processors as fast as they can make them, there's no time to underclock the processors, especially when it won't result in any market gains.

      With current processors, we can't just simply overclock it by any significant amount when they start to appear "sluggish" compared to newer ones. And just buy a new processor, it'll cost less than a watercooler kit. :P

    3. Re:is overclocking really necessary these days? by Anonymous Coward · · Score: 0

      I would have to say overclocking was never really "necessary", but it is still cool (no pun intended).

      I doubt anybody spends all their money on case mods and cooling *just* to get a couple more MHz. It the thrill of the challenge that comes from pushing the envelope. Plus, they think it will help them to get handjobs from cute blonds in the back of sports car.

      "And, in the end, isn't that what it is all about? I'm asking a question here."

    4. Re:is overclocking really necessary these days? by RzUpAnmsCwrds · · Score: 1

      "it was cool when you could jack a celeron300a up to 450mhz"

      Very cool. 2 and one-half years and my 300a is still ticking along at 450 fine. When you think about it, there is still nothing wrong with a 450mhz CPU. With an IBM 75GXP (yes, I know, failure - I got mine before the batch of bad parts), 256MB of CAS2 100MHZ SDRAM, a Matrox G400 Max, a SB! Live, and a whole mess of other top-of-the-line parts, the processor is probably the weakest link in my computer. But I don't care. It runs Windows XP fine (build 2526, evaluation copy), and most games run fine too.

      So no, we don't need Athlons at 1.6GHZ to surf the web, play MP3s, write email, develop software, play games, or even encode MPEG video. The big rush for CPU power is great in that it lowers prices, but, frankly, developers havn't made software (3D games specificly) that can really take advantage of really fast hardware.

      (this is unrelated to the parent comment except in that they both refer to Celeron 300As.

    5. Re:is overclocking really necessary these days? by FunkyChild · · Score: 2

      Celeron300A -> 450Mhz = 150% speed increase.

      My 1000Mhz Athlon -> 1450Mhz = 145% speed increase.

      I would never say that overclocking is necessary, but it's still giving the same sort of performance boosts today as it did a few years ago. When I got my 1Ghz chip, 1.4Ghz Athlons weren't even available yet. And when they did come out, they were far more expensive than what I paid. My 'fancy cooling solution' is a Globalwin FOP-32. It doesn't sound like a hairdryer and it's quite efficient and cost me about US$15. So the cost benefits are definitely still there too.

    6. Re:is overclocking really necessary these days? by Anonymous Coward · · Score: 0

      Perhaps you didn't hear about the 1GHz Athlons that managed a comfortable 1.5Ghz, which is a 50% increase in speed. I don't know about you, but that seems worth it to me.

      Anyway, in some ways it's like the old climbing saying; you overclock because you can, you try to tweak your system to attain absolutely maximal performance, just to see how fast it can go.

      Of course, you can run linux, read your mail, and surf the web on a 486, so why fork out more than a few notes for anything faster? :)

  20. Cool. Or rather, it will be when they perfect it. by Anton+Anatopopov · · Score: 2
    Wow, this is sort of based on the same principle as refrigerators and airconditioning units. It looks like it will be extremely effective at cooling down an overclocked CPU.

    As someone who has never overclocked my CPU, I have nothing but admiration for those brave souls who risk destroying their hardware, and being prosecuted under the DMCA all for the sake of a few extra MHz. It is this pioneering spirit which shows why time and again hackers (not crackers) are at the cutting edge of computer technology.

    I pity the poor tech support person at CompUSA when someone brings one of these suckers in for repair though. Looks like it will need a plumber as well as an electronics wizard, and we all know how expensive that can be :-)

  21. Heat pipes have been in use for a long time by Sara+Chan · · Score: 4, Interesting
    I've got a 1998 Twinhead laptop that uses heat pipe technology for cooling. The laptop also has a fan, which almost never goes on, due to the heat pipe. (It was for the quiet fanless running that I bought a Twinhead.)

    Twinhead advertising claims that their heat pipe technology is patented. I've no further details and couldn't find anything relevant on their web site.


    Buy Windows XP. Give Bill Gates even more of your money.

    1. Re:Heat pipes have been in use for a long time by Anonymous Coward · · Score: 0

      yes, heat pipes have been in use for a long time it was developed years ago mostly for mechanical cooling purposes. Their design may be patented but the actual heat pipe is not

    2. Re:Heat pipes have been in use for a long time by Tibe · · Score: 1

      yeah nuffin that new bout all this humm 20 seconad wait it seems... well thats weird

  22. I still like the homemade jobs by Count · · Score: 2, Interesting

    Not that they are all practical but man they look so cool.

    http://www.overclockers.com/tips672/

    http://www.overclockers.com/tips699/

  23. Images, Images. by programic · · Score: 1

    This is causing me to have "far-side-comic" images of people with their sleeves rolled up in their offices, peeking under the "hood" of their desktop machines, with steam bellowing out of them.

    "Just let it cool down for a few minutes, and start her up again."

    Ever driven through the desert.

    --
    -- yawn. --
    1. Re:Images, Images. by einstein · · Score: 1


      "Just let it cool down for a few minutes, and start her up again."


      you laugh, but I had a programming class in highschool where we worked on a bunch of 486DX4 100 MHz machines... with no air conditioning. On hot days towards the end of the school year, we couldn't compile our programs if the machine had been on a while. it was so hot the system was too unstable, but if we turned our machine off for a few minutes after coding, but before compiling, and we compiled immediately after booting, the program would compile...
      ---

  24. Where "it" will end up by Jeffrey+Baker · · Score: 5, Insightful

    No this is hopefully NOT where it (CPU cooling technology) will end up. Ideally, it will end up with CPUs that consume less power and give off less heat, can withstand higher core temperatures, and can more efficiently transfer heat outside the core. Slapping a vapor refrigerator onto the CPU is the opposite of elegance.

    1. Re:Where "it" will end up by markmoss · · Score: 2

      It's not a "vapor refrigerator" but a heat pipe. It's non-powered, except for the fans that blow air through the radiator part of it. You could eliminate the fans by making the radiator larger.

      Cost/performance ratio doesn't sound so good though. ($85 for cooling 10 degrees C better than an ordinary heatsink/fan, and not quite as good as the best performing (and enormous, I suppose) HSF's. Heat pipes are NASA technology, and there are few cost-effective applications on Earth. But if you really want a _quiet_ Pentium 3 or 4 system, your choices right now seem to be either immersing the motherboard in liquid, or a heatpipe to carry the heat out to a big fan-less radiator. Or else run non-bloated software on a CPU that doesn't need extreme heatsinking...

    2. Re:Where "it" will end up by Pope · · Score: 1
      Ideally, it will end up with CPUs that consume less power and give off less heat

      They're called PPC chips, but none of you guys like them :P
      Recent G3-based iMacs don't need fans despite the higher clock speed over previous designs.

      --
      It doesn't mean much now, it's built for the future.
    3. Re:Where "it" will end up by nick255 · · Score: 1

      At the new computer lab building (Henry William Gatesbuilding) in Cambridge (England), there is a heating system which has an intake at the back of each desk, behind all the monitors and then uses their heat to warm the whole building.

      Nice idea, unfortunately since it was designed flat screens have become popular.

    4. Re:Where "it" will end up by the_2nd_coming · · Score: 2

      I think that oneday, by accident, a chemist will create a room temprature super conductor. this is where computing will go next, since quantom computing is about 50 to 100 years away.

      --



      I am the Alpha and the Omega-3
    5. Re:Where "it" will end up by Anonymous Coward · · Score: 0

      Heat pipes are NASA technology, and there are few cost-effective applications on Earth

      Every laptop built in the last few years has used a heat pipe. What once was NASA technology is now being knocked off by second rate companies all over Taiwan.

  25. um, guys? by b0r1s · · Score: 1, Insightful

    I agree that this is cool, but come on now, why are we posting stories about something that doesnt yet work? Can't we wait until it 1) works well (the page states that other high performance heat sinks with large fans outperform it), and 2)doesnt damage the chips (We first tested the Zen Radiator, then the PAL 6035, and finally the MC462. After the first run we thought it a good idea to run the test again with the Zen Radiator in order to verify our results. This turned out to be a bad idea. The installation was again rather painful. Again a lot of pressure and time was necessary until we finally managed to connect the Zen Radiator with the socket. After powering up, the OS did not boot. To make it short: when mounting the unit on the socket, we had damaged the CPU. Chunks from all 4 corners of the die were broken off.)...

    It's cool and all, but if this were software, it would surely be beta. Do we really need beta announcements? (*cough* mozilla *cough*) ...

    --
    Mooniacs for iOS and Android
  26. Old Idea? by Archanagor · · Score: 1

    Hasn't this been done before, or is it just a different means of water cooling?

    No matter how well-sealed they say it is, I don't trust water flowing around my machine. Call me old-fashioned, but...

  27. Like the Beetle vs Water-pumpers by betis70 · · Score: 1

    A similar change was seen in the auto industry - moving from air-cooled engines like the VW Beetle to the water-cooled VW Rabbit/Golf. I don't know of one air-cooled car left in production, though we still have air-cooled motorcycles (Harley) *sigh* But those Bugs were so easy to work on, and now I have to bring my GTI in to get hooked up to a diagnostic computer ... anyone have a Linux hack for this? Heh heh, talk about voiding warranties ..

    --
    I forget...are we at war with Eurasia or East Asia?
    1. Re:Like the Beetle vs Water-pumpers by TheDick · · Score: 1

      Some high performance cars are still air-cooled. They aren't common, but they do exist. I think Porsche? was making one not too long ago....

      --

    2. Re:Like the Beetle vs Water-pumpers by BigBir3d · · Score: 1

      You can still buy the original bug, in Mexico, and import it to the USA as a kit car/experimental. Similar idea to experimental airplanes...

    3. Re:Like the Beetle vs Water-pumpers by Malc · · Score: 1

      I've used the following to check fault-codes, generate driving logs and re-program the locks on my Passat: http://www.ross-tech.com/vag-com/index.html.

    4. Re:Like the Beetle vs Water-pumpers by Cirvam · · Score: 1

      Acutally I think Porsche stopped making them in the mid 90s, now its all water cooled. The 944 and 928 were some of the early water cooled ones, whereas the 911 has historically been air cooled.

  28. Basically it was the next thing coming. by BuBu_ · · Score: 2, Informative

    Well guys if you sat down and read the article all the way through and saw what was going on you could basically understand that this isn't that much of an innovation, just tweaking an already proven practice. People have been using water cooling for years, and basically this just takes water coolings model and just makes it self-contained (at least how I understood it) the only flaw that they are going to run into is keeping the coolant cool at all times which will be hard since in water cooling setups there is a return pipe to the cooler/recycled water..

    Over all I give em two thumbs up for at least tweaking a proven practice, but then again they need some more work to really get the idea going.

    -bubu

  29. "Why, when I was your age..." by Embedded+Geek · · Score: 0, Offtopic
    BEGIN Old_Codger:

    Can't help remembering the original (128K & 512K) Macs. No fan. I worked at a third party shop in high school and we did a land office business replacing blown flyback transformers in the Summer - dang things had a manufacturing flaw and dropped like flies. Inveitably, I was able to sell the customer a fan, either a pizeoelectric, completlely internal "butterfly" one or the traditional "hole in the case" one.

    The irony, of course, was that the new flybacks didn't have the flaw and, although its always good to have a frosty CPU, the fan's value was questionable.

    END(Old Codger)

    --

    "Prepare for the worst - hope for the best."

  30. Other reviews by alewando · · Score: 4, Interesting
    Other sites have also reviewed the Radiator Zen SCR325-2F:

    The reviews are all favorable, but it's not clear whether this is simply because the reviewers are blinded by the "hey, it's neat!" factor, or whether the Radiator Zen SCR325-2F actually has a legitimate technical advantage. But hey, it is neat, so I can't blame them.
    1. Re:Other reviews by Anonymous Coward · · Score: 0

      You really have to wonder about the ability of the reviewers. First they forced the cooler down onto the CPU when it obviously wasn't fitting properly, second they destroyed PCB traces while doing it. Idiots. All you need to run a hardware review site is a web page and plenty of time on your hands, skill 100% optional.

    2. Re:Other reviews by Skuld-Chan · · Score: 2, Insightful

      Very cool, if it weren't for the fact that they destroyed a motherboard and a processor in the process of installing it I'd be more interested in getting one :).

  31. good looking but... by frankmu · · Score: 1

    ouch. the article mentions breaking both the mother board and the cpu while installing this unit. that, plus the expense of the cooler itself makes it a very expensive overclocking job.

    i'll stick to my alpha's

    --
    Supreme executive power derives from a mandate from the masses, not from some farcical aquatic ceremony.
  32. Watercooling is great... by XRayX · · Score: 1

    A Friend of mine just bought a complete set from Aqua-Computer for his Athlon 1.4 Ghz. It's now running 1.6 at 30C constantly.
    The radiator doesn't make any silence, but the other fans in the tower still do. Okay you can also cool CPU, Notrhbridge and GraphicsCard with one radiator, using Cupley and Twinpley, but the Towerfans still is noisy.
    You can build a realy quiet PC with it, but it's very expensive (my friend paid around 400$)

    --
    Boycot? Blackout? Subscriptions?
    I don't care!
    1. Re:Watercooling is great... by Anonymous Coward · · Score: 0

      what the hell does this have to do with anything?

  33. Less Power consumption has been the answer by snatchitup · · Score: 1

    We ask why isn't this currently in use? The simple answer is that the pace of innovation in the chips themselves far outpaces the demand for newer cooling methods. Sure the newer chips generate more heat, but we're talking millions more transistors, but now each of these transistors in generating far less heat.

    1. Re:Less Power consumption has been the answer by billanderson71 · · Score: 1

      Its not so much the amount of heat, but the heat flux that can be a problem. You're generating less heat per transistor, but there are more transistors, and they've been squeezed into a smaller space. The heat flux off of some chips is getting into the 100 W/cm^2 range, where removing the heat requires careful thermal engineering.

  34. They gave it a positive review? by 512k · · Score: 2, Informative

    and it physically broke their CPU and their mobo..if it were me, I wouldn't have anything positive to say about it.

    --
    ------ Work is so much easier when you don't
  35. Also reviewed... by Daniel+Rutter · · Score: 5, Informative
    ...by, ahem, me, as part of my monster cooler comparison.

    The Zen review is on page four.

  36. And don't forget... by Tharsis · · Score: 1

    And don't forget to water your computer every now and then. Also, they say talking to your computer will make it go faster.

  37. Nice page design by ryanvm · · Score: 0, Troll
    This is totally offtopic, but what kind of moron writes a web page with a black background and grey text?!?

    If anyone went through the trouble of reading this article, let me know what it says.

  38. Over Clocker Cooling Comedy? by Alien54 · · Score: 2
    What comes to mind was that article about the blokes who stuffed their computer into freezer. I can't find the link right now.

    But I can imagine that this would be the logical conclusion of this development trend.

    With the engineering and all, it might be just easier to dump everything into a vat of freon in a deep freeze some place.

    or just make a refrigerated rack system.

    --
    "It is a greater offense to steal men's labor, than their clothes"
  39. Terrible design by DragonWyatt · · Score: 1
    Ok, so the basic premise is sound: build a heat pump to move the heat away from the CPU.
    But they screwed up nearly every design decision they had!
    • Poor clearances on the baseplate;
    • incorrect dimensions on the mounting clips;
    • Plastic mounting clips! (AMD meltdown badness, anyone?)
    • Shoddy construction (the evaporation unit "floats" in the CPU assembly, for example, instead of securely attached)
    no thanks.
    --
    Don't sweat the petty things. But do pet the sweaty things.
  40. so it would work! by xcjohn · · Score: 2, Interesting

    I had used this same basic idea in a project about 2 years ago in a computer project. I've still got the 3d models for it too. My partner for the project and myself were told to design a computer for a specific market and come up with design, info, and a marketing pitch. Let's see if i can find the model.... ha! found it! http://lenin.nu/~jwhite/graphics/gallery/comp. basically we had coolant being pumped through a specialized heatsync, through a set up copper coils with fans next to each coil drawing the heat away and pumped back through the heatsync. I always wanted to see it actually implemented.

    --
    ~~~ They call me Little John, but don't let the name fool you...in real life I'm very big.
    1. Re:so it would work! by Anonymous Coward · · Score: 0

      A question about this: does the model being reviewed have a pump? If not I would think the design has to be very efficient because you are effectively slowing down the heat transfer by making the heat gradient do work, i.e., making the liquid in the pipes flow, as opposed to just letting the heat dissipate.

  41. Re:Noisy Fans? spanking monkey by Anonymous Coward · · Score: 0

    You need it to be quiet so you can listen for people who might interupt your monkey-spanking session.

  42. Retarded Mods by The+Turd+Report · · Score: -1

    I know saying Retarded Mod is redundant, but none the less... Who was the fuckwit that modded this as (-1, Offtopic)? It is already at -1, cuntstain! No wonder Slashdot is going down the shitter.

    1. Re:Retarded Mods by bowb · · Score: 0, Offtopic
      I know saying Retarded Mod is redundant, but none the less... Who was the fuckwit that modded this as (-1, Offtopic)? It is already at -1, cuntstain! No wonder Slashdot is going down the shitter.

      Heh, Turd Report, don't question the moderators. They are fickle -- who know's what motivates them to moderate one way or the other.

      I wish I could post at a lower score. I face a dilemma: I wish to ask Turd Report a question and common courtesy requires that I be logged-in when doing so; but at the same time I can only post at Score:1, making my post stick out like dogs' balls to those good folks who read at Threshold:1.

      No matter. Turd Report, I don't understand why Tuesday's turd (the chicken) only scored a 2. Here is a fascinating turd, I thought as I was reading the report, but was disapointed to see it score so low. I know it must have been an unpleasant experience, but often artists must suffer for their work.

    2. Re:Retarded Mods by The+Turd+Report · · Score: -1
      I wish I could post at a lower score. I face a dilemma: I wish to ask Turd Report a question and common courtesy requires that I be logged-in when doing so; but at the same time I can only post at Score:1, making my post stick out like dogs' balls to those good folks who read at Threshold:1.
      Well, feel free to email me at my email address shown above. I check that account everyday, as I do get fan mail about my reports.

      No matter. Turd Report, I don't understand why Tuesday's turd (the chicken) only scored a 2. Here is a fascinating turd, I thought as I was reading the report, but was disapointed to see it score so low. I know it must have been an unpleasant experience, but often artists must suffer for their work.
      Boy, did I ever suffer for that one. It didn't stay in me for more than 30 minutes. I base my score on several aspects of the turd. The qualities I look at are:

      1. size
      2. length
      3. color
      4. flushability
      5. odor
      6. amount of work to get the turd out
      So, for the Tuesday turd, the score break down is:
      1. size = 0 (it was liquid)
      2. color = 0 (it was generic turd brown)
      3. flushability = 0 (it flushed w/o problem)
      4. odor = 2 (It reeked, thus a high score)
      5. amount of work = 0 (it just flew out)

      I hope this has helped you understand the rating.

  43. Girls taking a dump by Anonymous Coward · · Score: 0
    At my university the bathrooms for men and women are usually separated only by a thin prefab wall that's pretty much transparent when it comes to sound.

    I don't know if I'm just fucked up but listening to these girls next door grunting while taking a dump (and all those "plop!" sounds don't make it any easier) really screws up my sex drive. Every time I see a gorgeous girl I can't help thinking about her grunting...

    Obviously I've never been in a steady relationship. I guess you guys who have managed to move in with a female have gotten over this.

  44. Health Issues by squaretorus · · Score: 5, Informative

    There is a documented link between low level noise and hearing and stress levels in those spending long times exposed to them.

    The hum of a fan, whatever it is cooling, is often at a level that you might strain to hear clearly. It is these levels that can cause hearing strain. This is similar to eye strain when you need glasses and can give you monster headaches.

    Many articles in New Scientist, among others, have covered this - normally relating to office environments.

    Symptoms can be migranes, and a persistant ringing / humming sound when you are in a silent room / trying to sleep. Its worth checking out if you feel any of these because the long term stress levels can be harmful.

    I don't know if its a problem for babies - but I know the effects are magnified many fold if you are exposed for long periods, i.e. all night. So I wouldn't leave the machine on 24/7 even if the baby doesn't seem bothered by it 'just in case'.

    1. Re:Health Issues by mlong · · Score: 1
      There is a documented link between low level noise and hearing and stress levels in those spending long times exposed to them.

      The hum of a fan, whatever it is cooling, is often at a level that you might strain to hear clearly. It is these levels that can cause hearing strain. This is similar to eye strain when you need glasses and can give you monster headaches.


      Except fans tend to generate white noise, which can drown out other distracting sounds and can also be soothing once you get used to it (like rain). For more info see how stuff works article.

      I leave my computer on at my bed all the time and have no trouble with the fan per say. The thing that drives me mad is the harddrive noise (ie access noise)

      --
      //m
    2. Re:Health Issues by morcheeba · · Score: 2

      After playing around with fans and such in my rig, I finally gave in and bought a set of bose noise cancelling headphones. They work well; the only problem is that you've got a well-sealed headphone on your head (leading to warm sweaty ears!), and they are somewhat spendy ($300). When I put them on, I can still hear the computer, but it's at a reasonable level. When I take off the headphones, I am consistently amazed at how loud the computer is! My comfortable music level I usually less than the computer!

      (Just FYI, it's a dual athlon, 3 hard drive computer in a room with a lot of hard surfaces in an otherwise quiet house) Also, sony has two noise cancelling headphones, but the open-ear design one seemed ineffective, the closed-ear version seemed to add to much 'hiss' of its own.

    3. Re:Health Issues by Pedrito · · Score: 2

      That's why I sleep with the T.V. on. It definitely overpowers the noise of my computer fan.

    4. Re:Health Issues by micromoog · · Score: 2
      The hum of a fan, whatever it is cooling, is often at a level that you might strain to hear clearly. It is these levels that can cause hearing strain. This is similar to eye strain when you need glasses and can give you monster headaches.

      This is jibberish. Comparing this to eyestrain is like claiming that the tiny nightlight at the far end of my well-lit office is causing me to go blind.

  45. great story! by Anonymous Coward · · Score: -1, Flamebait

    why don't you just shut up you freeking dink?

  46. This would be great... by daemonc · · Score: 2, Insightful

    ...if it hadn't DESTROYED their CPU and their motherboard.

    --
    All that we see or seem is but a dream within a dream.
  47. Re:Cray by xcjohn · · Score: 1

    yeah, cray has their "waterfall" system. Basically just letting liquid flow over the processor. And they look insanely cool.

    --
    ~~~ They call me Little John, but don't let the name fool you...in real life I'm very big.
  48. Mr Coffee motherboard by BrentRJones · · Score: 3, Funny

    Now for sale: The Mr Coffeee motherboard. (Patent Pending.) Yes it works well, but only on processors over 400 MHz. Makes up to 6 cups per hour.

    Retailer and investor inquires welcome.

    --
    Help end the use of Sigs. Tomorrow
    1. Re:Mr Coffee motherboard by Galvatron · · Score: 1

      What's all this bubbling? You call this a radar?

      No sir, we call this Mr. Coffee. Care for a cup?

      --
      "The question of whether a computer can think is no more interesting than that of whether a submarine can swim" -EWD
  49. Next time read the article- you'll look better. by Svartalf · · Score: 2

    They're using heat pipe technology to move the stuff about- that doesn't mean water. Furthermore, radiators do NOT mean water is involved- alcohol or ethylene glycol work rather well in radiator applications (which is why I keep wondering what these people are thinking when they run liquid cooling systems with water.

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
    1. Re:Next time read the article- you'll look better. by cloudmaster · · Score: 2

      Water has a higher specific heat capacity than ethylene glycol, and therefore is better for transferring heat. The antifreeze in your car's radiator system is there to 1) stop the water from freezing, expanding, and breaking your engine/hoses/radiator and 2) to keep the aluminum parts from corroding.

      Don't believe me? Drain your car's radiator, then fill it up with pure antifreeze. Your car will now run much hotter than it did before, I promise.

      Alcohol, on the other hand, would be fine, I guess - as long as you keep it away from fire and stuff.

    2. Re:Next time read the article- you'll look better. by sam@caveman.org · · Score: 1

      also, the pure antifreeze will eat through your belts and hoses. this will lead to a VERY hot engine...

      -sam

      --
      burn the computers. go back to the abacus.
    3. Re:Next time read the article- you'll look better. by bluGill · · Score: 2

      Drain your car's radiator, then fill it up with pure

      Doesn't matter. Either pure water or pure anti-freeze will give worse cooling than a proper mixture of anti-freeze and water. the mixture resutls in higher boiling points than either alone, and lower freezing points than either alone. Note that for each of the above you need a different mixture. 50/50 tends to be optimal for most people. In Minnesota we lean closer to 70/30, and in the desert (I think) they lean a little the other way. It turns out that 70/30 is close to the lowest freezing point you can achive with anti-freeze/water mistures. However the boiling point and heat capacity is changed.

    4. Re:Next time read the article- you'll look better. by Svartalf · · Score: 2

      I know that. However, it's NOT conductive (Like with all cases of water except high-purity distilled...) and while it's not as effective as water, it's still more effective than convective cooling (because air has a lousy specific heat capacity even compared to ethylene glycol)- it'd work fine. I'd not take chances with a leak and water...

      Alcohol wouldn't be exposed to fire and stuff inside your computer (unless you've got worse problems... :-)

      --
      I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
    5. Re:Next time read the article- you'll look better. by Svartalf · · Score: 2

      The reason why I suggested ethylene glycol alone in a liquid cooling system is that it's non-conductive with a more than passable heat capacity. Mixing in water brings back the risk of conductivity (any impurities of an ionic nature and it's conductive...)- while it'd work better than water alone or antifreeze alone, it's not what you're striving for with antifreeze alone.

      --
      I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
  50. Who really care? by Racher · · Score: 1

    You know, not to be an annoying b*tch or anything. But, stick a heatsink and fan (if required) on your cpu. Keep it cool.

    Otherwise it's like, I spend 16 hours and over $300 dollars creating the custom case rig with liquid oxegen flowing past every heatsink in my case. Now instead of 45 deg. C I get it down to 42! Shut up already.

    I've never had a cooling problem, worried about my heatsink falling off and anything like that. My 1.4 AMD is at 53 c under full load, after being clocked to 1.533 it's now at 55c. That is well within acceptable limits. I don't have a moded case, or many fans, I have a powersupply, and a fan on the heatsink.

    Some people need to get a life and stop worrying about cooling their cpu down one little degree more. sheesh!

    1. Re:Who really care? by Anonymous Coward · · Score: 0

      No one here is worrying. The same things go one with cars. No one really cares about the extra performance, its just for bragging rights.

      Besides, everyone knows for proper cooling you use water-cooled peltiers.

  51. not really a new idea by cr@ckwhore · · Score: 2

    The idea of using radiant cooling isn't really a new concept in computing... people have been using radiators with liquid cooling implimentations for quite a while.

    --
    Skiers and Riders -- http://www.snowjournal.com
  52. That is a vapor phase refrigeration system by Svartalf · · Score: 2

    i.e. a refrigerator- that's extreme and a commercial company does the same thing (Kryotech). That is not the same thing as a phase change heat pipe and radiator (The device referred to in the article)- it's moving the heat, but it can't get the chip below ambient.

    The vapor phase system CAN.

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
  53. This is the link you're thinking of by Yarn · · Score: 2

    Project Eunuch from the Temple ov thee Lemur.

    It is a joke.

    --
    -Yarn - Rio Karma: Excellent
  54. K.I.S.S. by Anonymous Coward · · Score: 0

    Why not just shrink-wrap your entire CPU and toss it in the freezer? With a small hole in the freezer's side you can run extra long cables and an external CD-ROM to any room in the house. Need to reboot? Then it's time to cook a frozen pizza.

    Cheers,
    LTR

  55. You said it yourself... by 2nd+Post! · · Score: 2

    Your babe tolerates certain levels and sleeps through others.

    For her (him?) it's Counterstrike. For others it's the fan on the CPU. For other's it's the whirring of the CDRW drive.

    Me, I use a PowerBook because I *love* silence. I listen to my music *quiet*, so when the CPU or PS fan is louder than my music, I have issues.

    My *new* PC is an 800MHz Celeron with a low speed fan and a 140W PS in order to supress noise. Tradeoffs of power and heat for noise and performance.

  56. Been used in servers for a long time by Saidin · · Score: 1

    They have been using these things in big servers for awhile now. Not because they perform better, but because you don't want the reliability problem of "What if my fan dies".

  57. A family scene ten years from now... by marijnm · · Score: 0, Offtopic

    "Son, it's so cold in the house"

    "But Mom, I don't want to play quake8 again!"

  58. I wonder... by Atilla · · Score: 3, Interesting

    If you would put a thermal generator on a CPU, would you be able to produce enough juice to run a fan? I mean, modern CPU's produce an enormous amount of heat calories...

    --
    --- sig moved for great justice.
    1. Re:I wonder... by denzo · · Score: 2
      I mean, modern CPU's produce an enormous amount of heat calories...
      So that's why I've been getting fat sitting in front of the computer all day!

    2. Re:I wonder... by Anonymous Coward · · Score: 0

      That might work, but the system is counterproductive. The more power the fan gets, the more it cools, and therefore the less power it gets.

      It's like trying to choke yourself: you start to black out, your hands drop, you can breathe again.

    3. Re:I wonder... by Atilla · · Score: 1

      Yup so the fan will only spin when it gets hot.
      This might add more hours to the fan's lifespan.

      --
      --- sig moved for great justice.
  59. it's all conditioning by Erris · · Score: 2, Interesting

    I have heard of an infant that is calmed by a vacuum cleaner. The child used to cry when it's mother left it to shower. The child stopped crying when it heard the blow drier and knew mom was not far. The mom noticed and put a vacuum cleaner in the room with the child and it worked. The child often falls to sleep with the vacuum cleaner on. No the child is not deaf now.

    --
    DMCA, Hollings, Palladium. What might have sounded like paranoia is now common sense.
    1. Re:it's all conditioning by carlos_benj · · Score: 1

      I have heard of an infant that is calmed by a vacuum cleaner.

      When we had our first child, I had already noticed that infants in other households would awaken at the slightest noise. The parents would only allow soft whispers even when the baby was well down the hall. I suspected they were conditioned to sleep in near silent environments and told my wife that we would conduct ourselves normally, speak in normal tones, listen to music, and allow the baby to learn to be comfortable with everyday sounds. Worked just fine. Three times.

      --

      --

      As a matter of fact, I am a lawyer. But I play an actor on TV.

  60. I doubt this thing actually does anything... by Dr.+Evil · · Score: 4, Interesting

    I mean, you have a radiator which exposes the same surface area as a typical heat sync, but makes less effective contact with the heat source.

    The fluid is probably not doing anything significant at all, the two fans gushing past the aluminum tubes is probably doing all the work.

    I don't even think this thing is actively cooling. There doesn't seem to be any pump... they're relying on the thermal gradient to cause the vapourizing fluid to move to the cool side of the radiator and condense. It doesn't work that way. You need to have some way of forcing the fluid to move in one direction, you need to cause the liquid to vapourize by forcing it through a small opening, pulling heat from the CPU.

    If you can somehow get around that technical wizardry, then you have to find fluids which vapourize at the temperature of the CPU, but condense at the temperature on the other side of the radiator... whatever wimpy thermal gradient that might be... the pressure of the system also remains constant because the whole system is operating passively of course.

    In other words... if you have a CPU at 50 degrees C, and your cooling fluid vapourizes at 40 celcius, then the other side of your heat sync MUST remain lower than 40 celcius, otherwise you just have a bunch of tubes full of pressurized vapour. There is no reason for the cooling side to actually cool especially if the same area is exposed to the CPU as is exposed to the fans.

    On the other hand, if your fluid vapourizes at 60C, it doesn't actually DO anything until the CPU reaches that temperature.

    This is not to say that passive refrigerators do not exist, I just don't think they've built one. They've built a chunk of aluminum full of fluid with two fans blowing through it.

    They should have run another benchmark: Drain the radiator.

    Kryotech has this done right.

    1. Re:I doubt this thing actually does anything... by billanderson71 · · Score: 1

      "There doesn't seem to be any pump... they're relying on the thermal gradient to cause the vapourizing fluid to move to the cool side of the radiator and condense. It doesn't work that way. "

      Heat pipes generally consist of a pipe, a working fluid, and a wick. They work by vaporizing a liquid at the evaporator (cooling the chip with the latent heat of vaporization) The vapor flows along the heat pipe until it reaches the condenser. The vapor condenses back to a liquid, releasing the latent heat. This heat is removed by fans or natural convection. The condensed lqiuid is then pulled back to the evaporator using some combination of gravitational forces and surface tension forces (similar to the way that a sponge can soak up water). No small opening is needed. Temperature differences in the vapor space of the heat pipe are very small, generally much less than a degree (The National Bureau of Standards uses heat pipes for generating temperatures in a region that are uniform to better than 1 milliKelvin)

      "On the other hand, if your fluid vapourizes at 60C, it doesn't actually DO anything until the CPU reaches that temperature. "

      Pure fluids don't vaporize at a single temperature. The boiling temperature depends on the pressure. The heat pipes contain a mixture of fluid and vapor. The temperature (and pressure) of the heat pipe adjust so that the heat pipe is at a temperature between the heat source (chip) and heat sink.

    2. Re:I doubt this thing actually does anything... by Anonymous Coward · · Score: 0

      My question is, if the thermal gradient is doing work, doesn't that mean you will be slowing down the heat transfer that would normally occur if the heat was allowed to freely flow?

    3. Re:I doubt this thing actually does anything... by Anonymous Coward · · Score: 0
      You make the only comment on /. which correctly explains how heat pipes work. You have obviously worked with them, (as have I).

      Your comment gets no up moderation. Just what can be expected of the /. moderation system.

      .sigh.

    4. Re:I doubt this thing actually does anything... by Dr.+Evil · · Score: 2
      Heat pipes generally consist of a pipe, a working fluid, and a wick. They work by vaporizing a liquid at the evaporator
      (cooling the chip with the latent heat of vaporization) The vapor flows along the heat pipe until it reaches the condenser.
      The vapor condenses back to a liquid, releasing the latent heat. This heat is removed by fans or natural convection. The
      condensed lqiuid is then pulled back to the evaporator using some combination of gravitational forces and surface
      tension forces


      So you're saying that this graceful, passive operation can move enough heat to cool a CPU, but is efficient enough to fit in a 2x2x3" cube and can outperform a chunk of aluminum with a fan?

      Oddly, it seems to perform as well as a chunk of aluminum with a fan.... but wait... it happens to be a chunk of aluminum, with two fans.

      Technically you didn't say whether you agreed or disagreed with my opinion, so there is little I can respond with.

      What I was saying was that you can't cram something like this into such a small space and expect to achieve a magical balance where the fans are cooling the vapour in the coils so that it condenses back on the gently warm CPU.

      If the system gets too hot, there will be no condensation, and if the 2"x2" heat source isn't near the boiling point of the fluid, I don't think you can pull enough heat away from it.

      It is quite possible to cool a CPU like this, but I don't think the cooler would look anything like what these guys show. These guys don't even seem to indicate that the 'radiator' needs to be in any particular orientation.

    5. Re:I doubt this thing actually does anything... by billanderson71 · · Score: 1

      "Technically you didn't say whether you agreed or disagreed with my opinion, so there is little I can respond with."

      I was not commenting on whether the system works or not, but trying to address several erroneous assumptions that you made as to why a heat pipe couldn't cool the system. Obviously heat pipes work for cooling the system, Dell (and others) have been using them for over 5 years in laptops.

      "What I was saying was that you can't cram something like this into such a small space and expect to achieve a magical balance where the fans are cooling the vapour in the coils so that it condenses back on the gently warm CPU."

      It's not a magical balance. For a brief description of how heat pipes work, go to http://www.thermacore.com/hpt.htm. There are also technical papers on the site that go into more detail. The liquid doesn't condense gently on the CPU, if it did, the heat pipe would be working backwards, heating the cpu. The liquid evaporates from the cpu area, cooling the cpu. The resultant vapor travels to the condenser (by the fans), and condenses, supplying heat in this area. This heat is removed by the fans. The liquid doesn't drop back, it is pulled back by capillary forces.

      "If the system gets too hot, there will be no condensation, and if the 2"x2" heat source isn't near the boiling point of the fluid, I don't think you can pull enough heat away from it."

      You are thinking that there is a single boiling point for the liquid (water). The boiling temperature is strongly dependent on the pressure. For example, it is 0.006 atm. at 0.1 C, 1 atm at 100 C, and 15.4 atm at 200 C. The pressure in the heat pipe adjusts so that the boiling temperature is in the range required. For electronics cooling, the pressure is usually subatmospheric. For a heat pipe operating at 60 C, the pressure would be about 0.2 atmosphere, or about 3 psia. If the cpu gets hotter, the pressure (and temperature) of the heat pipe also increase, but the heat pipe doesn't stop working (in fact, in this temperature range, it generally transfer heat better as it gets hotter).

      "These guys don't even seem to indicate that the 'radiator' needs to be in any particular orientation."

      That's because a heat pipe, when properly designed, can operate in any orientation. Gravity doesn't return the liquid to the evaporator (next to the chip), capillary forces do. A simple wick design can use surface tension to return the liquid back for several inches against gravity , very complicated designs (not suited for electronics cooling) can return the liquid for ~ 3 meters against gravity.

  61. I've seen this done before.. like 2 years ago... by josquint · · Score: 1

    Or at least similar...

    KryoTech Inc had/has a product that is basically a refridgerator for your PC. Been around for at least 2 years( the first 1gig athlon i saw.. months before the 900's were out was an overclocked 850 with their cooling system)

    Looks like Kryo's a little more expensive, but a much more 'professional' looking system...

  62. HP already does this on their big iron by jbeimler · · Score: 1

    Just took apart a HP 9000 K class server yesterday, its got cooling pipes over to the PA-RISC CPU with a big (approx. 4 cm x 10cm) radiator on each processor board.

  63. Compaq Xeons use this method sometimes by Drakino · · Score: 2

    The Xeons used in Compaq's 8 processor Proliants use a small plate bolted to the processor with two copper pipes. They go up into a radiator assembly, and the server pulls air through them with a very efficient and nice design. I've always liked the design by Compaq on some of their Proliant servers, and how they stay away from putting fans directly on a heatsync. I'll take a hot swappable fan any day.

  64. It's back to the future for you! by Erris · · Score: 1
    I hope these new things are up to code. 1.2 Jigga Hertz is an awful load to bear. Just look at what can happen.

    Heat is a terrible thing to waste. Mine will make coffee.

    --
    DMCA, Hollings, Palladium. What might have sounded like paranoia is now common sense.
  65. Heat pipes != water and other basics by enkidu · · Score: 2, Informative
    First of all the radiator in you car and the type of heat pipes used in this CPU cooler are similar in principle but radically different in construction and efficiency. The radiator in your car is an open system relying on water+antifreeze. The heat pipe used in many industrial applications (including laptop cooling, my Dell CPx has one that I can see through a grill) is a SEALED pipe with a wick and liquid (usually alchohol) inside. The liquid vaporizes at the operating temperature at any place where there is heating going on and condenses where there is cooling going on. The cool thing about heat pipes is that the heat transfer happens REALLY REALLY fast. For home computing applications (<1 meter) it should be instantaneous. This allows you to move the heat away from where it can do damage to any place you want (within the limits of cost and space of course.). This is also why thin laptops don't fry their CPU's instantly: using heat pipes they can spread the heat sink around and away from the CPU.

    Check out a NASA tech brief, Thermacore a company that makes them and MIC another company that makes them for more information.

    --

    There is no trap so deadly as the trap you set for yourself
    -Raymond Chandler, The Long Goodbye
    1. Re:Heat pipes != water and other basics by billanderson71 · · Score: 2, Informative

      Heat pipes have been used to cool laptops since the mid to late 90's. The heat pipe transfers the heat from the cpu to the shield around the bottom of the laptop (which is one reason that our laptop often does a good job of warming your lap). The advantage is that cooling fans can be eliminated, which prolongs battery life.

      Most of the heat pipes used in electronics cooling have a copper envelope, copper wick, and use water as the working fluid (operating under a partial vacuum). The advantage is not that they are really fast (the velocity of the water vapor is on the order of meters/second) but that they are very nearly isothermal. (The temperature drop in the heat pipe is essentially negligible, with small temperature drops occurring due to the heat conduction through the copper walls and wicks). This allows you to transfer heat over relatively long distances before removing the heat.

      A second advantage is that heat pipes can be used to reduce the heat flux. The heat flux (watt/cm^2) out of the chip is fairly high. On the other hand, air cooling is relativley inefficient, so a low heat flux is preferred. By using a larger condenser than evaporator, the heat flux can be adjusted to match the capacity of the cooling media. This will become more important in the future, as the heat flux from the chips continues to rise. Some experimental designs water designs have cooled several hundred W/cm^2, which is higher than chips should reach in the near future (high temperature heat pipes - have removed in excess of 50,000 W/cm^2)

      The best introductory book is Heat Pipes, by Chiu, but it is out of print. Dunn and Reay have a reasonable book on heat pipes, but it is quite expensive (~ $100).

  66. Heat Pipes by Pyrosz · · Score: 1

    Heat pipes are a simple yet usefull tech. They are currently being used by a mining company in the Canadian artic to make a dam to hold back water. They needed a way to hold back water in a lake without the expense and problems of a large concrete damn, they opted to create an earth damn that used the permafrost to keep it in place. In order to keep the permafrost as permafrost they used heat pipes. The idea is to draw out any heat from the surrounding ground and lose it in the air. Its very effective due to the rather cold climate and the fact that it requires no upkeep other than simple monitoring. I did a fast search on google but I couldnt find a reference to this specific use.

    --

    An optimist believes we live in the best world possible; a pessimist fears this is true.
  67. What you don't know.... WAS : Hell, *I* know... by firewort · · Score: 3, Informative


    You never owned an air-cooled VW, did you?

    Those radiators are oil coolers. Air cools the cylinders, which are finned like motorcycle cylinders. Oil does the rest of the job, besides lubricating, it soaks up much of the heat. Running the oil through a small radiator makes a large difference in some climates, but is usually unnecessary. Shoot, in Israel (commonly accepted as a pretty hot climate) they run without 'em just fine.

    The reasons to add the radiator for oil-cooling are:
    exposing the oil to a finned, air cooled radiator cools the oil off faster, leading to a cooler engine, and

    having greater oil capacity means that the oil is more resistant to heating up, and adding the oil cooler adds more oil capacity.

    And remember, the air-cooling on the VW is the same as it is on air-cooled porsches, a fan on the back of the generator (alternator) driven by a belt off the crankshaft. Pretty darn efficient.

    --

  68. are you sure? by Erris · · Score: 0, Offtopic
    Mineral Oil + Fiber Glass = ?

    Better ?flourinate? it.

    --
    DMCA, Hollings, Palladium. What might have sounded like paranoia is now common sense.
  69. why not ... by drjzzz · · Score: 1

    peltier cooling? No moving parts and easily controlled.

    --
    to err is human, to forgive is divine, to forget is... umm...
  70. 7000 rpm ? by death_denied · · Score: 1
    I wonder if you could construct a computer in such a way that only ONE motor rotates your hard drive platters, optical discs (stacking perhaps?), metal platter floppies (????), and circulate and decompress the coolant for the hot areas. This way, almost all the noise will be isolated to that one motor and you might even be able to exploit the decompression of the coolant as a means for rotating the axle system.

    Just my $.02

    1. Re:7000 rpm ? by An+Onerous+Coward · · Score: 1

      Great idea. A computer with a fan belt. Next they'll be asking that the I/O streams be governed by cam shafts.

      --

      You want the truthiness? You can't handle the truthiness!

  71. Liquid cooled mainframes are obsolete by Animats · · Score: 3, Informative
    IBM mainframes used to be water-cooled. Cray mainframes used to be Freon-cooled. One Cray machine of the early 1990s actually ran immersed in Fluorinert. All those machines were plumbing nightmares. IBM considered it a big step forward when the water-cooled mainframes were replaced by air-cooled mainframes. Far fewer maintenance headaches. You don't want to go to liquid cooling on the desktop unless there's no alternative.

    Solid-state Peltier-effect coolers are much more promising. They actually refrigerate, they have no moving parts, and they don't make noise.

    1. Re:Liquid cooled mainframes are obsolete by Anonymous Coward · · Score: 0

      Solid-state Peltier-effect coolers are much more promising. They actually refrigerate, they have no moving parts, and they don't make noise.

      The Peltier-effect junctions themselves may not make noise, but the heat from the CPU (and the considerable extra heat the Peltier itself adds) still have to be disposed of somehow. Peltier CPU coolers usually come with super-sized extra-noisy fans, since they have to dispose of something like 3x the original un-Peltierized heat load. Peltiers are neat, but they're terribly inefficient, to the point where the electric bill could actually become an issue.

      If they can keep liquid-cooling solutions as simple as this one - a small, self-contained, sealed unit - we should have no more plumbing trouble with our PCs than we do with the average Sno-Globe.

    2. Re:Liquid cooled mainframes are obsolete by Manaz · · Score: 2

      Solid-state Peltier-effect coolers are much more promising. They actually refrigerate, they have no moving parts, and they don't make noise.

      Except that they don't work if they're not themselves cooled. So you're still stuck with using alternative heat removal techniques anyway. Which generally comes down to water cooling (messy and expensive), or very good air cooling (we're back to being noisy again). And if your ancilliary cooling fails, your peltier becomes a *really* good insulator. Meaning you end up with a fried CPU.

      Due to the laws of physics, you also have to remove more heat from the hot side of a peltier than it removes from your CPU.

      And the clamping pressure requires by a peltier to function at it's most efficient is significantly greater than the recommended maximum clamping pressure on the top of either AMD or Intel processors.

      Then there are also problems with condensation. Which is bad when mixed with computer components.

      Peltiers aren't sounding so crash hot all of a sudden, are they... :(

  72. Wow by jesseraf · · Score: 0, Offtopic

    I needed to read the title twice. I thought it said "Using RADIATION to Cool CPUs."

    I was thinking, what are these guys crazy. All in the name of CPU cycles I guess eh?

  73. Re:Cool. Or rather, it will be when they perfect i by radish · · Score: 2
    being prosecuted under the DMCA

    why? I really don't follow...

    --

    ---- Den ene knappen er powerknapp, den andre er Bender voice knapp "Bite My Shiny Metal Ass"

  74. Possible applications by t0qer · · Score: 1

    I think in the not to distant future, some open source geek is going to write an autononymous robot program for linux. Maybe it will grab you a beer or get the newspaper, possibly even mow your lawn. I can see heat transfer become really useful outdoors on a hot summer day.

    Also what about steel factories? Those places get red hot. How about volcano monitoring on Mt. Kilauea in Hawaii?

    Potential customers:
    Military
    Aerospace
    Petroleum
    Geological Research

    Development of these systems shouldn't just be marketed to the overclockers. People that are overclocking can't afford (or are too cheap to) buy a faster processor. I'm not knocking them, I think they are really cool beans. Yet I think these companies don't have a clue to who their target market should be. Instead of targeting the poor money less overclockers they should be going after customers where a cool CPU is a life or death situation, an absolute necessity.

  75. Now, now...no need to be ugly with them... by Svartalf · · Score: 2

    There's always a better way to clue-by-four people- what you just did isn't it...

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
  76. conductivity of water by Alien54 · · Score: 3, Interesting
    One, water an electricity do no mix well

    Minor nit pick

    The conductivity of water is based purely on the impurites in it. If you had truely pure distilled water, it would not conduct.

    I used to work on a transmitter that had water cooled voltage regulator tubes. They regulated many tens of thousands of volts with big wattage. You measured the purity of the water by the measuring the electric conductivity in fractions of micro-mhos

    --
    "It is a greater offense to steal men's labor, than their clothes"
    1. Re:conductivity of water by rabidcow · · Score: 1

      Does the dust on the mb count as impurities?

      I know in the general case you need ions in the water, but does it really matter if the stuff with the electricity has lots of free particles laying around?

  77. Radiator .. my wishes.. by hebertrich · · Score: 0

    Simple before you mold the CPU you add INSIDE the chip casing itself a small array of liquid carrying tubes .With two small adapters for hoses.Yup directly in the cpu casing.
    just plug the chip in it's socket..connect a few hoses and there you go.
    people will ask how to fill the cpu
    how to keep a filled cpu from dripping all over the place when removed etc..
    One way valves and connectors anyone ?

    richard

  78. The Sega Dreamcast has liquid cooling. by Flat+Feet+Pete · · Score: 1

    The Sega Dreamcast has liquid cooling.
    It was seen as a major design flaw when first announced, but I've had no problems with mine.

  79. vacuum by Anonymous Coward · · Score: 0

    we have fans to blow the heat away. the motor for the fan adds to the heat

    but has a vacuum ever been tried to suck the heat away? the motor for this could be further away from the real heat problem.

    someone attach a shopvac to their cpu and tell me the results. i've seen crazier things on here.

  80. try this: by brad3378 · · Score: 1, Insightful

    Instead of using a conventional radiator to cool the fluid, why not use a large reservoir of fluid that will cool via natural convection? Besides, a radiator would require a fan just to keep the fins cool.

    My proposal:
    Use a water block on your processor(s)
    and recirculate water from a large fish tank.
    I think large aquariums use a water pump for the filter system anyway.

    Even a dual AMD box would have a hard time boiling off the water from a 30 gallon aquarium.

    --

    1. Re:try this: by Atilla · · Score: 3, Funny

      Good idea. Why not hook up a whole bunch of Athlon/P4 PC's to the same tank...

      This will provide a good source of goldfish snacks for a Q3 fragfest.. Feed the critters with some cheddar flakes for a few days prior.

      --
      --- sig moved for great justice.
  81. Universal Solvent by primenerd · · Score: 1

    Indeed, DI H2O is a non-conductive liquid. The difficulty with water is its incredible abilities as a solvent. DI water would rapidly obtain ions fron the components submerged in it (metals such as lead, tin, silver come to mind). Eventually one of two things would happen. 1: The water obtains enough ions and becomes conductive, shorting the machine. Or 2: The water eats away some connection or component damaging the machine.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  82. Air cooling has it uses by Anonymous Coward · · Score: 0

    Water cooling means you're carrying around water, which is a fairly heavy substance, and unlike fuel, water does no work for you. Granted there are advantages to water cooling, but it does have costs.

    For ground pounding autos, the extra weight is not that big a deal, but getting rid of water in an piston-driven airplane means you can carry more cargo. A pound less of engine is a pound of something else you can carry. Also, you can devote more volume to processing fuel, which means for the same space, you can crank out more horsepower.

    You'll find the majority of aircraft piston engines are air cooled.

    1. Re:Air cooling has it uses by Alan+Partridge · · Score: 1

      eh? aircraft tend to move quite fast, so that's air in high volumes and at low temps - ideal for cooling. the same approach would be MUCH less effective at low speeds on the ground - or in a computer.

      --
      That was classic intercourse!
  83. This got bad reviews, but look here! by Daath · · Score: 2

    If you read the article (broken ad software - phpAdsNew by the way :) - they said it wasn't the best, but it was probably getting there...

    How about utilizing the Peltier Effect - a.k.a. thermo electric cooling? =) Here is a little info here!
    Granted, they use a lot of power - I've seen from around 50W to 200W...

    Water cooling! I remember reading somewhere about Leufken - Gotta find a link... Just a sec... ;)
    Here it is! - Leufken Technologies - They got both watercooling and thermoelectric cooling, regular fans and heatsinks :)

    I myself is using a twin cooler (CoolTium) for my Athlon 900 - but it is SOOOOOOOOOO noisy!

    --
    Any technology distinguishable from magic, is insufficiently advanced.
    1. Re:This got bad reviews, but look here! by carm$y$ · · Score: 2, Informative

      How about utilizing the Peltier Effect - a.k.a. thermo electric cooling?

      You still have to get rid of the heat somehow - and thus the peltiers come with bulky radiators plus noisy fans themselves.
      As a bonus, you also have to handle somehow the condensation problem - the peltiers being able to refrigerate (or at least to go down to pretty low temperatures, close to zero Celsius).

      So, it's a promising technology, but it's not ready yet.

      --
      -- No sig today
  84. Probably end up with more noise by barzok · · Score: 2

    All that transmission gear (belts, clutches, driveshafts, "splitters" and so on) would make more noise than a group of individual motors. Plus, moving parts = wear & tear = maintenance.

    Not to mention the headache when your single point of mechanical failure goes out.

  85. Design question. by ahfoo · · Score: 1

    I'm planning a new home and I will have access to a ground loop heat transfer system as the house will be on some acerage as opposed to say an apartment or something of that nature.
    I want to use three vertically stacked car radiators circulating water outside the house in a small loop that dischrges heat into the ground at about six feet.
    The boards will still have fans on the CPUs. They'll be stacked in a rack that is accessible inside the house as opposed to being in a separate room.
    The idea of using automotive radiators will just be supplemental cooling. The question is, is it better for the overal HVAC equation to blow fan from behind the automotive radiators onto the board and out into the room, or is it better to blow the heat from the boards into the radiator and have the radiator extract the heat as a heat pump? I thought the latter made more sense, but folks I've mentioned it to say blowing from behind the radiator will provide better cooling.

  86. Why is this such a big deal? by Bad+Mojo · · Score: 2

    We allready use air-cooling for our CPUs. A radiator is the next logical step in cooling. It's a simple matter of efficiently moving heat arround. Something that car manufacturers have been doing for ages with good success.

    --
    Bad Mojo
    "If you can't win by reason, go for volume." -- Calvin
  87. A problem with one of the graphs. by flatcat · · Score: 2, Informative


    Anyone else notice that the graphic on page 2 that shows the processor under load is messed up? The coloration for the MC462+delta and zen radiator are swapped. This graph shows the Zen as the worst of the coolers.

  88. Alpha prototypes had this too. by Jeff+Bell · · Score: 2, Interesting

    There was work done by Hamurgen and Fitch at DEC where they experimented with using heat pipe technology to cool chips way back in 1992.

    They needed a liquid with a high heat of vaporization, and a boiling point in the 30-50C range. They tried mixtures of water and alcohol, but settled on just water, pumped down to 1/3 ATM.

    They went looking through the "steam tables" and found that nobody had ever looked at the sub-atmospheric range of pressures, and had to derive all of the thermodynamic properties themselves.

    It was pretty quiet, but made a funny little 'tick' noise right when it started boiling.

    More details at http://www.research.compaq.com/wrl/techreports/abs tracts/92.1.html
    and http://www.research.compaq.com/wrl/techreports/abs tracts/90.9.html

    -Jeff Bell

    1. Re:Alpha prototypes had this too. by billanderson71 · · Score: 1

      "They went looking through the "steam tables" and found that nobody had ever looked at the sub-atmospheric range of pressures, and had to derive all of the thermodynamic properties themselves"

      That's funny, I have a copy of the ASME Steam Tables, copyright 1936, that goes down to 0.088 psi absolute pressure at 32 F, which is as low as it goes, unless you are dealing with ice. :)

  89. Hack your car's computer... by freq · · Score: 1

    You can't hack your car's ecu with linux, but you can hack your car's ecu with your palm :)

    --
    "Tension is the great integrity" -- R. Buckminster Fuller
  90. So by Anonymous Coward · · Score: 0

    It's got *2* fans instead of one. How is that more quiet?

  91. Re:Cool. Or rather, it will be when they perfect i by Anonymous Coward · · Score: 0

    What the HELL does the DMCA have to do with overclocking?

  92. Sega Dreamcast by Anonymous Coward · · Score: 0

    .. has liquid cooling using an extremely similar method and was a mass manufactured games console in thousands of peoples homes. Suprised that no one else noticed :-)

    Matt Bland

    no login... no surrender

  93. Noisy Fans = Deafness? by hakkikt · · Score: 1

    I've been said that sleeping under such kind of noise (similar to white noise) makes you deaf slowly, because of the permanent ear stimulation in a wide range of frecuencies. Has anyone any information about this?

    My mind is open, so unleash the ideas

  94. Its 2020.... by Anonymous Coward · · Score: -1, Troll

    Intel relelase their "80986 DX Noctioum IV + Pro" processor which reach speeds of 666Phz and its liquid nitrogen cooled and a hyper freeze DX heatsink and a gaint 1 mile radius fans at 1,000,000 rpm costing $666,666,666,666.66!

    Microsoft Windows 2020 Still runs as slow as a snail yet the BRAND NEW Linux 6.6.6 runs FASTER than the speed of light!
    FUCKING SHIIIIIIIIIITTTTT!!!!!!!!

    Click here

  95. Peltiers are not appropriate by billanderson71 · · Score: 1

    "Solid-state Peltier-effect coolers are much more promising. They actually refrigerate, they have no moving parts, and they don't make noise"

    Peltier coolers are generally a bad idea, _unless_ the chip has to operate below the temperature of the cooling stream. The problem is that they are inefficient, i.e., you need 70 or 80 Watts of electric power to remove 10 watts of thermal power. All of the electric power supplied ends up as thermal power, so you now have to get rid of 8 times the heat that you originally had.

    A great book for understanding thermal cooling issues is "Hot Air Rises and Heat Sinks" by Tony Kordyban (www.asme.org). He explains peltiers shouldn't normally be used, and explains electronics cooling is an easily understood and humourous fashion.

  96. Brrrrr by Anonymous Coward · · Score: 0

    Ive been in a server room and its freezing cold! Someone should invent a chip that *stays* cool!

  97. Awesome... by Pedrito · · Score: 2

    Just what I've been waiting for: A CPU cooling device that physically breaks my CPU. Sounds like instead of a review of the product, they should have just had a 1 paragraph summary in large bold letters warning people from buying this defective product. Giving it a review almost gives it legitimacy.

  98. Water cooling has its value by Anonymous Coward · · Score: 0

    HP uses water cooling sometimes. Fans are cheaper, and actually less expensive, but water systems are less likely to break, and easier to rapidly fix without opening the whole system.

  99. To pass this off as an informative piece...blah! by Anonymous Coward · · Score: 0

    This is a wannabe site, and their reports are
    re-hashes of other crap. Useless as the Anarchist's
    Cookbook. Juvenile and assinine. Warez puppies and douche-bag wannabe's. Waste of thread. Get a mufkin life or give up the code.

  100. Dreamcast was liquid cooled! by Steveftoth · · Score: 1

    Yes, the dreamcast had a liquid based cooling system for it's graphics processor. Rather then have a HUGE heatsink, they had liquid filled pipe that circulated over the processor and then a fan. Unlike the Largest heatsink in the world that the PS2 has. The X-Box probably has a huge HS as well. ( not as big as the one they would be using if the had gone with athlon ).

  101. Let's improve the CPU, not the cooling system by Flufmunkey · · Score: 1

    While it is very fun to engage in Tim Allen-esque computer hot-rodding projects like liquid cooling and all, maybe we should instead focus on making CPU's that don't run so stinkin hot and use so much electricity.

  102. Why go to the trouble of using a radiator by chrisatslashdot · · Score: 1

    Why does it need to be a closed system. Just pipe in your household cold water supply and dump to a drain or a resivoir or you hot water heater.

    --


    Simple people talk of people, better people talk of events, great people talk of ideas.
  103. Old news? by jmatlock · · Score: 2, Interesting

    Uhm... my Dell Inspiron has a water tube cooled CPU, it links to a radiator/heatsink near the back of the machine... and I got it almost a year ago... this isn't really anything new and spectacular. Intel developed it to work with the M series of Pentium III's... it's even listed on their site under technology.

    --
    ... and all I wanted for xmas was a magic 8 ball, but i got this lousy ./ t-shirt instead.
  104. How about using Space Shuttle Tiles? by thewils · · Score: 1

    Or at least heatsinks made from the same ceramic stuff that they coat the outside of the shuttle with. I've seen one of those suckers cool down from red hot to hand hot in about 2 seconds.

    --
    Once I was a four stone apology. Now I am two separate gorillas.
  105. Thermal generator runs against thermodynamics by SysKoll · · Score: 4, Informative
    Atilla,

    The average Intel CPU dissipate a waste heat much greater than the few watts absorbed by your average fan. So the idea seems reasonable.

    Alas! The laws of thermodynamics often fly in the face of reasonable ideas. See, if you want to passively cool off the CPU, all you have to do is let it radiate its heat. But what you seem to wish for here is some kind of device that actively cools off that CPU, by taking some of that waste heat as its energy source. That's called a thermic engine. And here, thermodynamics get you: You can generate power from a heat source only if you have a cold "sink". All thermic engines work by getting heat from a heat source and moving it to a heat sink. E.g., for a car, the heat sink is the radiator.

    Here, your contraption would use the CPU as a heat source and would require some sink, such as, oh, a radiator. Maybe with a fan. Which is exactly what we are trying to avoid.

    So it's a nice catch-22. But think about it: if it worked, we would have big ships moving smoothly on all oceans, powered by the extracted heat of sea water and leaving a trail of ice cubes in their wake...

    -- SysKoll
    --

    --
    Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/

    1. Re:Thermal generator runs against thermodynamics by muffel · · Score: 2, Interesting
      Actually, thermodynamics wouldn't forbid this, as the cpu is not running at ambient temperature (in which case we wouldn't need cooling anyway).

      E.g. with a cpu running at ~50C, and a liquid with a boiling point of, say, 40C, you could build a little steam engine, letting the steam condense at room tmperature for the 'refill'. Voilà.

      --

      bla
    2. Re:Thermal generator runs against thermodynamics by SysKoll · · Score: 1

      That's right, evaporator coolers are a variety of steam engine.

      Which are a variety of thermic machine. They evaporate something (here, coolant) at the heat source and drop that heat at the sink (the radiator) to liquefy the coolant. My point was that this class of machines are not one-source thermic machine, which would defy thermodynamics.

      So I rest my case. :-)

      -- SysKoll
      --

      --
      Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/

  106. Check out an ever better case design by enkript · · Score: 0

    www.koolance.com has a new version of there water cooled case. this thing can water cool your cpu video card and hard drives. no fans in the case ( you may want one for air circulation) there a few temperture controlled fans on the top of the case, but im willing to bet this case is quieter then most cases. not to mention its great for overclocking.

  107. Distilled Water is electrially inert by NevarMore · · Score: 1

    Water out of the tap, or water that has had some contact with conductive materials is conductive. Pure distilled water is not conductive at all. Im not sure if this is offtopic, but it was in a thread talking about inert fluids good for heat transfer.

  108. My friend already does it by PigeonGB · · Score: 1

    It is actually kind of funny. When he turns his computer on, it sounds like an aquarium.
    He basically took a car radiator as I understand it.
    Basically whenever we go to the computer store, he goes next door to the hardware store to pick up some tubing.
    Pretty awesome.

    --
    I have 3656.9 Bogomips. How many Bogomips do you have?
  109. My car doesn't even have a radiator by Anonymous Coward · · Score: 0

    so why should my puter? Yes my car is considered a little bit odd these days. Its a '63 Volkswagen Beetle. But still... I think I'll stick with the good old fashion simple puters.

  110. Old news... by SevenTowers · · Score: 1

    Vapochill did this over 2 years ago. Check out cpu bongs or Kryotech for real cpu cooling! This chills it down to -40 degrees C.

    --
    Imperium et libertas
    Autocracy and freedom
  111. easier to route fishtank water through by Anonymous Coward · · Score: 0

    a tube which is attached to cpu heatsink...

    you get a fishtank + fish + computer + fish screensaver...

  112. Nothing new... by Anonymous Coward · · Score: 0

    Well, Kryotech has been doing this for quite a long time. They worked with AMD to create the first 1GHz PC. I first heard about them when the 300MHz comps were new, but they were probably doing this before then.

  113. Why not jet cooled by wadey · · Score: 1

    As Jet power has been used as a beer cooler, why not go against the recommendation therein and apply the technology to CPU cooling. Certainly would give the neighbours something to complain about.

  114. I like this other one better by Anonymous Coward · · Score: 0

    The idea is awesome, but the zen cooler is just too goofy. kendon This one looks sweet to me. It doesn't try to look like a sneaker. -- duffahtolla

  115. Re:Cool. Or rather, it will be when they perfect i by Manaz · · Score: 2

    ...and being prosecuted under the DMCA all for the sake of a few extra MHz.

    Um, please DO tell me you're kidding.

    What I, or anyone else, chooses to do with my processor after I buy it is MY business. We're not talking about art, or artistic license here, but a consumer electronics product.

    The only time it becomes illegal is if, through the process of overclocking, I damage the CPU, and then try to claim warranty - that's fraud. Otherwise, if I want to run my 1GHz Athlon @ 1.5GHz, there's no-one who has the right to stop me.

  116. Liquid cooling by Deadstick · · Score: 1

    This has been common among overclockers for a couple of years at least, and I'm using it on a 1.3GHz Athlon running at normal speed. I found it would not run under heavy load (like big graphic renders) without going past the BIOS temp limit, whereupon it would slow the clock down. (This is on a home-assembled system with the Asus A7A266 mobo. A coworker tells me his son has no such problem with the same chip in his Compaq, but I have to wonder if the OEM systems aren't simply implementing software overtemp protection without announcing it.) I was able to get the temp to stay in limits by installing a high-quality copper heatsink and a very potent fan, but the noise level was a show stopper: loud and VERY offensive, so I went to a water cooling setup. It's a bit of a hassle, but works very well. The only purpose-built component is a copper heat exchanger block that bolts onto the CPU; the rest consists of an aquarium pump, a plastic water tank and a transmission cooler. Overclockers don't consider this an unusual setup at all. They start with water, and then typically add a Peltier-effect thermoelectric cooler which is essentially a heat pump between the CPU and the water block. Others are experimenting with various types of true phase-change refrigeration. rj

  117. didn't i see these... by Anonymous Coward · · Score: 0

    in audio amplifiers from the 60's and 70's?

  118. I -have- a watercooled work PC by xtal · · Score: 2

    Sorry, no pictures online yet, other people have plenty however. I got my kit from cool-computers.com, but there's lots of other ones out there. You don't use alcohol in a liquid cooled system because not only is it flammable, the vapours are extremely explosive. If you had a minor vapour leak, the slightest spark inside your computer - like, oh, say, a motor, a bad capacitor, your power supply, whatever - would cause an explosion. Alcohol at near purity running at ~40C is also extremely flammable. That's INSANE.

    Please, nobody attempt to use alcohol to liquid cool a PC. It's dangerous. If you want to experiment with other liquids with higher specific heats, try an oil instead, but understand the risks. No, I'm not responsible if you blow up your machine. Distilled water is a wonderful insulator, too. No worries there. $1 buck for 4 liters at the local Walmart. Hardly exotic.

    I'm running a athlon 1.2G mildly overclocked (1.3g) with the entire apparatus inside a mid tower case. I got sick of my work machine locking up because of overheating (the lab I work in has poor ventilation and gets extremely hot). Liquid cooling works extremely well, but it's far from plug and play and definately not something for beginners. :)

    --
    ..don't panic
  119. AMSTRAD?? by Anonymous Coward · · Score: 0

    Reminded me of the following I read up in FUD DEF :

    "AMSTRAD, a UK consumer electronics manufacturer, had a reputation of selling reasonably OK electronics goods at rock-bottom prices. Much of their success was due to rationalized design, giving customers what they most desired whilst keeping the construction simple. One day they decided to launch a range of PC's aimed at the home consumer. Due to the optimization of the design, AMSTRAD decided that a 35W PSU would be sufficient, even if a hard disk and tape-streamer were added (at that time many low end PC's just had twin floppy drives). As the computer was supplied complete with a monitor (and monitors have complicated PSU requirements), they also decided that instead of putting the standard PSU in the corner of the box (as most manufacturers still do today), they would supply the computer from the monitors PSU, which was accordingly upgraded.

    This actually spawned another advantage. Monitors dissipate a lot of heat, and so the large case is peppered with holes to allow effective convention cooling. Computers by contrast tend to be closed boxes, and so it was (and still is) normal to have a fan incorporated in the PSU. As the AMSTRAD had no PSU in the case, and the contents dissipated typically 20W, they ran quite happily with no fan (they had incorporated convection cooling in the case), and so were also quieter.

    The AMSTRAD computers were a great success. Too great. Not only did they sell in AMSTRAD's traditional consumer market, but they were finding a place in office environments, where equivalent 'traditional' models cost typically 50-100% more, and of course the AMSTRAD'S were quiet. FUD campaign gets rolling. "The AMSTRAD has no cooling fan", shock horror. "Stick a hard disk in an AMSTRAD and it melts", aghhh.., "If your program crashes it is because your AMSTRAD has no cooling fan".

    The FUD was easily refuted. AMSTRADS actually worked quite well, and you could use them all day, then feel the box and find it to be cool. Nonetheless, many new customers where being scared away from the AMSTRAD because it had no fan when everybody else did. So in the end AMSTRAD fitted fans, right in the back corner where the PSU normally goes. Of course the AMSTRAD had no PSU there, and because the case was designed for natural air-flow, a simple test with a cigarette would soon reveal that the air was just going round in circles"