Slashdot Mirror


Build Your Own Virus

Wire Tap writes "Scientists have assembled the first synthetic virus. The US researchers built the infectious agent from scratch using the genome sequence for polio. The most amusing part is this snippit: 'To construct the virus, the researchers say they followed a recipe they downloaded from the internet and used gene sequences from a mail-order supplier.' Heck, don't we all have our own mail-order suppliers for gene sequences?"

324 comments

  1. fp i get it by Pen1s+Goat+Guy · · Score: -1

    right

    --


    Krama: Bigdickinyoura
    1. Re:fp i get it by Anonymous Coward · · Score: -1, Offtopic

      Karma whores have no right to claim first post. AC iN dA HiZoUsE!

    2. Re:fp i get it by handybundler · · Score: -1
      --


      a/s/l here. Sorry, adding domain tags to your s
    3. Re:fp i get it by Mode0x13 · · Score: -1

      TrollTech version 2.0.14 (Crapola) running on i286-dosbox Entering postlevel: -1 TrollTech version 2.0.14 (Crapola) running on i286-dosbox Entering postlevel: -1 probing goatse.cx... OK BSD is dying... OK Mounting Natalie Portman... OK nportman: Covered in hot grits nportman: naked and petrified Slashdot losers: found slashdot: 10 stories on front page slashdot: 5 linux FUD articles slashdot: 2 feebleminded rants slashdot: 2 recycled articles slashdot: 1 junk science story slashdot: this is not news for nerds, stuff that matters. Registering troll personalitires... Wintroll 3.0 (c) 1998 Redmond Right Wing Troll: found. Loaded at 0x1950 Jon Katz (c) VA Linux Welcome to TrollTech. HTH. HAND. C:>TROLLTEK> CD SLASHDOT C:>TROLLTEK\SLASHDOT> DEL *.*

    4. Re:fp i get it by Mode0x13 · · Score: -1

      I do it wrong:

      TrollTech version 2.0.14 (Crapola) running on i286-dosbox

      Entering postlevel: -1
      TrollTech version 2.0.14 (Crapola) running on i286-dosbox

      Entering postlevel: -1
      probing goatse.cx... OK
      BSD is dying... OK
      Mounting Natalie Portman... OK
      nportman: Covered in hot grits
      nportman: naked and petrified

      Slashdot losers: found
      slashdot: 10 stories on front page
      slashdot: 5 linux FUD articles
      slashdot: 2 feebleminded rants
      slashdot: 2 recycled articles
      slashdot: 1 junk science story
      slashdot: this is not news for nerds, stuff that matters.

      Registering troll personalitires...
      Wintroll 3.0 (c) 1998 Redmond
      Right Wing Troll: found. Loaded at 0x1950
      Jon Katz (c) VA Linux

      Welcome to TrollTech. HTH. HAND.

      C:>TROLLTEK> CD SLASHDOT

      C:>TROLLTEK\SLASHDOT> DEL *.*
      <A HREF="dfgdfgdfg"></A>

    5. Re:fp i get it by Goatse+Pez+Dispenser · · Score: -1

      Hey, check THIS OUT!!!

  2. Smell my feet by Anonymous Coward · · Score: -1, Offtopic

    Give me something good to eat.

  3. fp by Anonymous Coward · · Score: -1, Troll

    I claim this for all trollkind!

    1. Re:fp by TrollBurger · · Score: -1

      You sir, are an embarrassment to trolls everywhere. Sorry.

  4. But will it infect Microsoft? by Anonymous Coward · · Score: -1, Troll

    If not, it's not a real virus anyway.

    1. Re:But will it infect Microsoft? by Anonymous Coward · · Score: -1, Flamebait

      LMFAO, tard.

  5. No more DeCSS for me by Henry+V+.009 · · Score: 1, Flamebait

    I've posted an aerosol AIDS virus recipe to my website. Go there and check it out.

    Sure it's a joke now, but just wait a few years...

    1. Re:No more DeCSS for me by Mode0x13 · · Score: 0, Funny

      TrollTech version 2.0.14 (Crapola) running on i286-dosbox

      Entering postlevel: -1
      probing goatse.cx... OK
      BSD is dying... OK
      Mounting Natalie Portman... OK
      nportman: Covered in hot grits
      nportman: naked and petrified

      Slashdot losers: found
      slashdot: 10 stories on front page
      slashdot: 5 linux FUD articles
      slashdot: 2 feebleminded rants
      slashdot: 2 recycled articles
      slashdot: 1 junk science story
      slashdot: this is not news for nerds, stuff that matters.

      Registering troll personalitires...
      Wintroll 3.0 (c) 1998 Redmond
      Right Wing Troll: found. Loaded at 0x1950
      Jon Katz (c) VA Linux

      Welcome to TrollTech. HTH. HAND.

      C:>TROLLTEK> CD SLASHDOT

      C:>TROLLTEK\SLASHDOT> DEL *.*

    2. Re:No more DeCSS for me by Anonymous Coward · · Score: -1, Troll
      last poster: has too much time to create stupid fake programs
    3. Re:No more DeCSS for me by Horny+Smurf · · Score: -1

      I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
      It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
      bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

      "Well? Have you?" Kara was waiting expectantly for my answer.

      "Well...I...no! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

      "Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

      I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

      Instead, I said, "No...I mean....kissing another girl after...."

      Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
      about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
      sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
      apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

      Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

      "Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

      "Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

      "YOU?" I exclaimed, shocked. "You'd never do something like that."

      "Dare me," Kara challenged.

      "OK....I dare you!" I giggled, playing along.

      Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

      "Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

      As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
      wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
      embarrassed! My face must have been bright red as Kara brought the two guys over.

      She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
      "friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
      objected to being classified as a walking sex object.

      Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
      guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

      "Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
      Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
      guy gently pulled me toward him. I opened wide and took him in...

      We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
      for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
      arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
      playing with them! My nipples immediately got rock hard.

      "Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
      them and having them fucked," she whispered.

      Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
      I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

      Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
      nice juicy tits together...tighter! Make him cum....!"

      Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
      guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

      Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
      his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
      Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
      Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

      Then she drew me in and our lips locked.....

      What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
      her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

    4. Re:No more DeCSS for me by Anonymous Coward · · Score: -1, Troll

      yuo=fagot

    5. Re:No more DeCSS for me by Anonymous Coward · · Score: -1, Offtopic

      Why did you create an aerosol AIDS virus? I'm not judging you or anything. I'm just wondering what was going through you head when you were thinking this up.

      Are you trying do develop simulations of possible mutations in order to save life much unneeded suffering?

      Or...

    6. Re:No more DeCSS for me by Henry+V+.009 · · Score: 2

      I didn't create an aerosol AIDS virus. I said that I was just kidding in the post itself. All I'm saying is that in a few years someone will create a virus and put it up on the internet, just like the polio virus was up on the internet.

      That seems like an important issue, why is it flamebait?

    7. Re:No more DeCSS for me by uncoveror · · Score: 1

      This lends credence to the theory that AIDS was created in a biological warfare lab, and did not exist in nature before that. This is terrifying. We could cause our own extinction tinkering with this stuff. We are, to use a cliche, playing god be creating viruses.

      --
      The Uncoveror: It's the real news.
    8. Re:No more DeCSS for me by Cyno01 · · Score: 1

      i thought we got AIDS from having sex with monkeys?

      --
      "Sic Semper Tyrannosaurus Rex."
    9. Re:No more DeCSS for me by Anonymous Coward · · Score: 0

      Because slashdot moderation is EVIL.

    10. Re:No more DeCSS for me by TWR · · Score: 2
      No, it doesn't. In fact, the earliest humans with AIDS were infected in the 1930s, well before any sort of genetic engineering was possible.

      http://news.bbc.co.uk/hi/english/health/newsid_783 000/783533.stm

      Please adjust your tin foil hat so that you can pick up a different conspiracy theory.

      -jon

      --

      Remember Amalek.

    11. Re:No more DeCSS for me by uncoveror · · Score: 2

      I Tried that link, but got a page not found error. Aids in the 1930s? This is the first time I've read that. The theory that AIDS came from an American biological weapons lab was put forth by the former Soviet Union during the cold war, or so it has been said. I'm not saying that I believe it, but a lab created virus is no longer just science-fiction. This fact will lead imaginations to run wild.

      --
      The Uncoveror: It's the real news.
    12. Re:No more DeCSS for me by TWR · · Score: 2
      There's a space in the URL as pasted (stupid Linux). Delete it.

      It's well-known that the Soviets created the "US made AIDS" rumor as disinformation during the Cold War.

      -jon

      --

      Remember Amalek.

    13. Re:No more DeCSS for me by neocon · · Score: 1

      For a source on the origins of the `America created AIDS' myth as a Soviet Active-Measures propaganda program, check out The Sword and the Shield: the Mitrokhin archive and the secret history of the KGB by Christopher Andrew and Vasily Mitrokhin, which is one of the best histories of the KGB written since declassified records have become available with the end of the cold war (including the Mitrokhin archive, which is a collection of copies of KGB archival material smuggled over the Finish border by a defecting KGB archivist as the USSR crumbled), and can be purchased here.

  6. Not surprising, unfortunately by h2oliu · · Score: 2, Interesting

    I remember my BioChem classes (10+ years ago), and it seemed even back then that to some degree the technology was already there. It does make you wonder if this is truly the first one, or just the first one to be formally announced.

    --
    Ok, I give up, why you?
    1. Re:Not surprising, unfortunately by Horny+Smurf · · Score: -1

      This should surprise you!

      I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
      It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
      bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

      "Well? Have you?" Kara was waiting expectantly for my answer.

      "Well...I...no! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

      "Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

      I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

      Instead, I said, "No...I mean....kissing another girl after...."

      Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
      about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
      sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
      apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

      Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

      "Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

      "Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

      "YOU?" I exclaimed, shocked. "You'd never do something like that."

      "Dare me," Kara challenged.

      "OK....I dare you!" I giggled, playing along.

      Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

      "Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

      As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
      wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
      embarrassed! My face must have been bright red as Kara brought the two guys over.

      She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
      "friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
      objected to being classified as a walking sex object.

      Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
      guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

      "Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
      Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
      guy gently pulled me toward him. I opened wide and took him in...

      We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
      for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
      arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
      playing with them! My nipples immediately got rock hard.

      "Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
      them and having them fucked," she whispered.

      Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
      I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

      Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
      nice juicy tits together...tighter! Make him cum....!"

      Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
      guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

      Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
      his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
      Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
      Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

      Then she drew me in and our lips locked.....

      What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
      her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

    2. Re:Not surprising, unfortunately by stuuf · · Score: 0

      So its true what my bio teacher said about being able to call up a biological supplier and say "I want a DNA molecule that goes ATTCGACAGATTGCTAGCTGAGTCCGAGTCGCCTATGACTCGA"

      --

      Everyone is born right-handed; only the greatest overcome it

    3. Re:Not surprising, unfortunately by drpentode · · Score: 1

      It's like Neuromancer. Mail order body parts.

    4. Re:Not surprising, unfortunately by fockewulf · · Score: 1

      it's been known for quite some time that if you put all the components of a virus in a solution they're capable of reassembling into a functional virus. i think they proved that first with the tobacco mosaic virus back in the 50's.
      it's a very useful concept, people use it for packaging genes into viral vectors and using them to transduce cells. one particular application is gene therapy.

    5. Re:Not surprising, unfortunately by PD · · Score: 2

      My BS detector is going off. Can I have a citation please? I can believe that bases can assemble into random DNA strands, but a functional virus would require a selection mechanism to assemble, either natural selection like all the other viruses, or artificial selection. Oh yeah, I almost forgot: this article also points out deliberate assembly as another mechanism. But I have a hard time believing random assembly.

    6. Re:Not surprising, unfortunately by Syre · · Score: 2

      What he means by components is... components. Not individual DNA bases.

      Here's your citation:

      1956 Heinz Fraenkel-Conrat took apart and reassembled the tobacco mosaic virus, demonstrating "self
      assembly."

      and here's an interesting URL including the citation:

      http://www.acq.osd.mil/cp/biotech96/annex_a.pdf

      Your "bullshit detector" needs some work, apparently!

    7. Re:Not surprising, unfortunately by fockewulf · · Score: 1

      sure, there are any number of references on this matter. here's one :
      http://noda.scripps.edu/recpapers/Papers/122.pd f
      if you coexpress the components in a bacterial cell, the assembly reaction is autocatalytic. any book on basic virology can tell you that.
      and yeah, there're lot's of things in nature that defy the obvious.

    8. Re:Not surprising, unfortunately by PD · · Score: 1

      Thanks for the reference.

    9. Re:Not surprising, unfortunately by Sgt+York · · Score: 1

      Yep...costs about $0.75 / base for a small prep. Theoretical limit is about 400-500 bases per artificial sequence, but you can take several of those & link them together pretty easily.

      --

      There is a reason for everything. Sometimes that reason just sucks.

  7. You'd Better Watch Out by DonkeyHote · · Score: 0

    With all the terrorist paranoia going on in the U.S., you might just get arrested for a stunt like this.

    1. Re:You'd Better Watch Out by Anonymous Coward · · Score: 0
      With all the terrorist paranoia going on in the U.S., you might just get arrested for a stunt like this.

      And rightfully so. Just imagine what Armani or Gilgamesh would do if they had access to one of these virus creation kits.

  8. Get an Amiga, and quit worrying about viruses! by Anonymous Coward · · Score: -1, Offtopic

    title

    1. Re:Get an Amiga, and quit worrying about viruses! by Anonymous Coward · · Score: -1, Offtopic

      Amiga FO'EVA, bee-yotches!

  9. I can see the popular media now... by Anonymous Coward · · Score: 0

    Al-Quda set to infect US via the Internet with a virus downloaded from mail order sources. CNN on Monday?

  10. Huge medicine possibility by tuxrules · · Score: 2, Interesting

    What if, say, a virus could be designed to destroy cancer cells? What if a virus could be designed to infect parasites? If the drug companies start doing this, it's only a matter of time before they can make viruses that can target disease cells extraordinarily effectively.

    1. Re:Huge medicine possibility by gerf · · Score: 2, Insightful

      True, just like there were a couple computer viruses that searched out and destroyed the bad ones.

      of course, this wouldn't work. viruses can't attack each other.

      perhaps we can make viruses to attack bacteria strains? but this is too questionable. what if you make a strain that kills off good bacteria that we need? no, too risky. kinda like the bacteria that eat petroleum, and could make it into some underground reservoir. just too dangerous

      so what good could these virii do for us? safely, not much. there's too many things that go wrong with simple chemicals we use in regular drugs, much less a biochemical virus, which is much more complicated than anything we can wholley, fully, and correctly predict

    2. Re:Huge medicine possibility by Henry+V+.009 · · Score: 2

      There have actually been studies on animals and even humans using genetically engineered viruses (not made from scratch) to do this kind of thing for years. They keep killing people though, so I don't know that they're having as much success as they'd like.

    3. Re:Huge medicine possibility by einhverfr · · Score: 3, Insightful

      What if, say, a virus could be designed to destroy cancer cells?

      Until they mutate and we have that same viruses destroying healthy tissue. Besides, what would the immune response be? Would that make you sick?

      --

      LedgerSMB: Open source Accounting/ERP
    4. Re:Huge medicine possibility by neuroticia · · Score: 2, Insightful

      Early blood transfusions would kill people, as well. Seems like most medical technologies kill people in the early stages. The researchers just need to get it right. (Early blood transfusions killed people due to cross-species transfusions, and lack of knowledge of blood types.)

      Of course, this will open up a whole can of worms, too, I'm sure. Renegade viruses that we can't stop, etc.

      Sometimes I just have to wonder which innovation of humanity will kill us all off. =]

      -Sara

    5. Re:Huge medicine possibility by Horny+Smurf · · Score: -1

      I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
      It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
      bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

      "Well? Have you?" Kara was waiting expectantly for my answer.

      "Well...I...no! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

      "Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

      I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

      Instead, I said, "No...I mean....kissing another girl after...."

      Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
      about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
      sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
      apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

      Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

      "Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

      "Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

      "YOU?" I exclaimed, shocked. "You'd never do something like that."

      "Dare me," Kara challenged.

      "OK....I dare you!" I giggled, playing along.

      Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

      "Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

      As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
      wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
      embarrassed! My face must have been bright red as Kara brought the two guys over.

      She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
      "friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
      objected to being classified as a walking sex object.

      Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
      guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

      "Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
      Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
      guy gently pulled me toward him. I opened wide and took him in...

      We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
      for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
      arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
      playing with them! My nipples immediately got rock hard.

      "Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
      them and having them fucked," she whispered.

      Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
      I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

      Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
      nice juicy tits together...tighter! Make him cum....!"

      Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
      guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

      Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
      his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
      Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
      Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

      Then she drew me in and our lips locked.....

      What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
      her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

    6. Re:Huge medicine possibility by gotak · · Score: 1

      Immune respond would be a legitimate question. But we do have immune supression drugs. Better to been slightly weak for a while then to die from cancer.

      Mutation would occure only if the engineered virus is allowed to reproduce. IF it's just a means to target certain cell it's a once off deal once used it's gone.

      Of course there are alot of questions. But this is the way to do it's just like surgery only at a very small scale.

    7. Re:Huge medicine possibility by krmt · · Score: 5, Interesting
      What if, say, a virus could be designed to destroy cancer cells?
      Heh. This is exactly what my lab is doing, as are many others. We're using a modified adenovirus to deliver a suicide gene to cancer cells, thereby killing them. Not a new idea anymore at all (people have been working on gene therapy for over a decade) but it's one that takes a lot of time to put in motion. Just do a search on "gene therapy" and "viral vector" at PubMed and you'll get more info than you ever wanted to know about what's going on.
      --

      "I may not have morals, but I have standards."

    8. Re:Huge medicine possibility by Subcarrier · · Score: 3, Funny

      *THUDDUD*

      Oooh, verdamnt, not once more! Back to ze dravink board es ist. Igor, clear out ze body and vasche ze beakerz! Schnell! Ich must vork on the formula some more! Hunh...

      --
      "I have opinions of my own, strong opinions, but I don't always agree with them." -- George H. W. Bush
    9. Re:Huge medicine possibility by Sheetrock · · Score: 3, Interesting

      Viruses have already been employed in gene therapy, and actually this technique was involved in the first gene-therapy death. So, already been done and already wreaked unforseen havoc on at least one occasion, but the idea is that the virus alters the genes in a person's cells in a beneficial manner rather than in a way that causes the cells to churn out more viruses.

      --

      Try not. Do or do not, there is no try.
      -- Dr. Spock, stardate 2822-3.




    10. Re:Huge medicine possibility by Anonymous Coward · · Score: 0

      I do not know what studies to which you are referring. But there are promising and so far successful approaches:

      http://www.stanford.edu/dept/news/report/news/ap ri l10/cold.html

      http://www.nature.com/nsu/010830/010830-9.html

    11. Re:Huge medicine possibility by krmt · · Score: 5, Informative

      This is a possiblity, but pretty much anyone who's serious about this (ie, actually doing work in the field) is using a virus that can't replicate on its own. It just doesn't have the machinery to do so, because we've taken it out all together. Believe it or not, the space in a viral genome is very valuable, and you want to make as much use of it as you can, so you take out everything that's not necessary to your work.

      So if the virus mutates (which isn't likely, given that most mutations happen during genomic replication) it would just sit there, doing nothing. I suppose that potentially another, wild-type virus could coinfect the cell with the mutant (also relatively unlikely) and supplement the necessary machinery, but this is no more likely than if the wild type virus itself had mutated, in which case you have a new strain on your hands (although with the originally synthetic mutant, it would still need to be supplemented by the wild type each time it infected a cell in order to replicate).

      While you do raise a good point about mutation, it's not any different than what happens in nature. In fact, it's probably far more controllable.

      --

      "I may not have morals, but I have standards."

    12. Re:Huge medicine possibility by nick357 · · Score: 5, Funny

      "I may not have morals, but I have standards."

      When someone who is in the business of "using a modified adenovirus to deliver a suicide gene", is using a sig like this, it scares the bejeebers out of me...

    13. Re:Huge medicine possibility by Horny+Smurf · · Score: -1

      I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
      It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
      bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

      "Well? Have you?" Kara was waiting expectantly for my answer.

      "Well...I...no! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

      "Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

      I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

      Instead, I said, "No...I mean....kissing another girl after...."

      Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
      about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
      sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
      apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

      Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

      "Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

      "Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

      "YOU?" I exclaimed, shocked. "You'd never do something like that."

      "Dare me," Kara challenged.

      "OK....I dare you!" I giggled, playing along.

      Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

      "Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

      As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
      wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
      embarrassed! My face must have been bright red as Kara brought the two guys over.

      She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
      "friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
      objected to being classified as a walking sex object.

      Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
      guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

      "Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
      Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
      guy gently pulled me toward him. I opened wide and took him in...

      We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
      for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
      arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
      playing with them! My nipples immediately got rock hard.

      "Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
      them and having them fucked," she whispered.

      Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
      I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

      Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
      nice juicy tits together...tighter! Make him cum....!"

      Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
      guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

      Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
      his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
      Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
      Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

      Then she drew me in and our lips locked.....

      What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
      her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

    14. Re:Huge medicine possibility by Anonymous Coward · · Score: 1, Informative

      Actually there are a class of virii that infect only bacteria, and happen to be quite specific to particular bacterial strains.

      http://www.evergreen.edu/phage/phagetherapy/phag et herapy.htm

    15. Re:Huge medicine possibility by krmt · · Score: 2

      Do you have a reference for this? I've never heard of using these sorts of things on people and killing them.

      There was one case out (in Pennsylvania, I think) where the doctor administered way way way too much virus, and the kid was already immunocompromised, and he basically died of toxic shock. Since then, I don't think anyone's done any real viral gene therapy on humans.

      But if you have references for this (particularly abstracts from medical journals linked from PubMed) I'd really like to see them.

      Oh, and as for killing animals with engineered viruses, I have personally seen plenty of animals that were not affected by engineered viruses that are administered. We generally have a pretty good idea as to what we've made before we go putting it in a living creature.

      --

      "I may not have morals, but I have standards."

    16. Re:Huge medicine possibility by Anonymous Coward · · Score: 1, Funny

      At least he's not plugging his new book: "Apoptosis for Dummies"

    17. Re:Huge medicine possibility by sam_handelman · · Score: 2

      As other posters have pointed out, the virus to infect cancer cells is too risky; in order to work, such a virus would have to be engineered to sidestep the body's own defenses. At that rate, there is too much risk it might go "wild" and start attacking other cells.

      Virii that attack bacteria (which are more typically called Phage) exist extensively in nature. They are one of the classic tools of molecular biology, well studied and characterised. Some strains are also nearly 100% lethal as they exist in nature. We are unlikely to improve on the lethality of phage with direct meddling - that is to say, by rewriting individual nucleotides one at a time (why below). In any case, in order to get all of the bacteria in your body with phage, your body would have to be inundanted with the phage. The phage don't hurt you, but you're body doesn't know that! The phage would send you into a state called Septic Shock, as you're own immune system's panic response killed you. We might engineer phage that don't set off our alarms - this has other risks, and this custom virus technology doesn't really help do this (yet.)

      I'm trying to include a minimum of background, so here I go - genes/DNA (a code of 4 monomers) code for proteins (composed of 20 monomers, the code is somewhat degenerate.) The sequence of these monomers determine the shape of the protein - some of these monomers contain polar (vinegar-like) groups which want to be on the outside of the protein, touching water, some of them contain oily (like olive oil in salad dressing) groups which want to be on the inside, touching eachother. Other, more complex factors also come into play, making the relationship between sequence and three dimensional structure (which determines function) highly opaque. The ability to predict how a 13 monomer long protein is shaped, and thus what it will do, is beyond our present capability.

      You could make up a sequence up the top of your head, but you'd have no way of knowing what it would actually do!

      This means that when you genetically engineer an organism you don't even want (generally) to type genetic changes into a keyboard. You want to import large, complicated pieces of DNA from another organism, and clone (move) the DNA into the organism you're tinkering with.

      There are situations where DNA you want is not available - for example, if I wanted DNA from the Ebola virus, I could not get it. There are other situations where you want to make single point changes in DNA, in order to see what happens (if, for example, you want to know if the single peptide you changed is important in the function of the protein.) However, this technology won't (if I understand it correctly) let you do that - their duplication of the virus genome was EXACTLY precise enough to get live virus; any errors in their DNA sequence that didn't render the virus nonviable wouldn't be caught.

      The upshot? This isn't a tremendous advance in our ability to customise organisms. With refinements, it might be, but right now all you would use it for is to get DNA that you don't have physical access too.

      --
      The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
    18. Re:Huge medicine possibility by Henry+V+.009 · · Score: 2

      I read a New York Times story about a year ago. Apparently two studies were canceled because of two separate incidents of patients dying.

    19. Re:Huge medicine possibility by SamBeckett · · Score: 1

      I tried the same strategy with my dog; I had him neutered.. But the bastard keeps trying to hump my leg.

    20. Re:Huge medicine possibility by Anonymous Coward · · Score: 0

      Amen.

    21. Re:Huge medicine possibility by orthogonal · · Score: 1
      Sometimes I just have to wonder which innovation of humanity will kill us all off. =]

      Ever wonder if some archaic chimp, something like Sahelanthropus tchadensis looked over at one of his particularly bright brothers, and thought, "A whole bunch like him, making those high-tech hand axes, and we might all be toast"?

      (Not that there's any real liklihood Sahelanthropus tchadensis made any stone tools, much less engaged in abstract thought.)

    22. Re:Huge medicine possibility by gerardrj · · Score: 2
      using a virus that can't replicate on its own. It just doesn't have the machinery to do so
      Uh huh. And just how many times has something that "can't happen" happend in research?

      You are putting a virus with no capability to reproduce in to a cancer cell with an over-ability to reproduce. Are you telling me there is abosoutly no way that a cancer cell will mutate, accept the introdouced virus and create a new hybrid cell/virus that carries the deadly portion and the reproduction capability? I don't ask if it's unlikely, but guaranteed impossible.

      I'd think this is especially bothersom with a virus that is as higly mutative as HIV is.

      --
      Article X: The powers not delegated... by the Constitution...are reserved...to the people
    23. Re:Huge medicine possibility by Saxerman · · Score: 1
      ...a virus that can't replicate on its own. It just doesn't have the machinery to do so, because we've taken it out all together.

      Hey, wait a minute. Didn't they only engineer females in Jurassic Park? And how did that work out, excactly? Sounds like this theory isn't that safe after all!

      --

      A steaming cup of soykaf would be real wiz right now.

    24. Re:Huge medicine possibility by Anonymous Coward · · Score: 0


      * Yeah.. what's the chance of killing the good ol' ones?
      I mean, how many good cells must die to kill a cancerous one?

      * Where's the "off" button?

      im just curious..

    25. Re:Huge medicine possibility by Anonymous Coward · · Score: -1, Troll

      There is no such word as "virii". Please stop using it if you want people to take you seriously.

    26. Re:Huge medicine possibility by Anonymous Coward · · Score: 0

      There is no such word as "virii".

    27. Re:Huge medicine possibility by jso888 · · Score: 1

      One of the more prominent deaths from virally-mediate gene therapy was Jesse Gelsinger. You are probably thinking of him. That page is pretty comprehensive in terms of describing why he died, and the metabolic defect that they were trying to correct.

      The clinical trial that he was taking part in was immediately halted, and there was some soul-searching in the scientific community for a while. But a quick search on gene therapy indicates that it's still quite an active area of research (look here, sort by date).

      A while ago, gene therapy was discussed on Slashdot. I found a couple of good articles on the future and hazards of using viruses to deliver corrective DNA to diseased tissue. Follow the link to them from my Web site, unless you're the copyright police! Hope they are helpful.

    28. Re:Huge medicine possibility by Robert1 · · Score: 1

      Gene therapy works even better at curing incurable genetic diseases. My lab for example is pretty much focused on injecting specimens with an adenovirus that attempts to reintroduce a deleted gene. The problem around killing cancer cells with virii is that, adenovirus especially, creates only localized effects. And the actual creation of such virus, at least in large quantities is nowhere near easy without the right equipment.

    29. Re:Huge medicine possibility by bofkentucky · · Score: 1

      Reminds of a fellow undergrad at UK. He moved to KY from one of the Baltic republics (Latvia or Estonia, can't remember) like when he was 13, so he has this wild slavic accent, but uses american slang. I used to think of Pitr from User friendly whenever he would give a talk in our research methods class.

      --
      09f911029d74e35bd84156c5635688c0
    30. Re:Huge medicine possibility by bofkentucky · · Score: 1

      ...In other news today the MPAA and RIAA, along with Cactus Data Shield corp are invesigating a new DRM technique involving viruses which will not reproduce after a point mutation. RIAA Chairperson Hillary Roasen has this to say "Die you fucking pirates", and now in sports....

      --
      09f911029d74e35bd84156c5635688c0
    31. Re:Huge medicine possibility by BurningRome · · Score: 2, Informative

      I make recombinant lentiviruses every week in the lab. Probably made around 20 different ones so far.
      Gene search ones, ones with GFP, ones with the tet transactivator, etc etc.
      They work great, infect all types of human and mouse cells with great efficiency. They are all what is called SIN vectors : "Self INactivating". Their LTRs (control centers) lack promoters and enhancers, they lack Psi packaging signals for the viral RNA to be packaged, and (once integrated into the cell's genome) lack all lentiviral/retroviral structural genes (gag, pol, env, rev, tat, etcetera) which make a virus a virus. Safety with regard to virus gene therapy has been extensively studied in the past 10 yrs - just check out PubMed.
      If in the event that this vector infects a cell already infected by a real pathogenic lentivirus (ie HIV-1)where the structural genes already are (in trans) it STILL wouldn't generate further vector virions because the viral vector provirus lacks LTRs to transcribe the viral RNA, and even if it somehow was transcribed it couldn't be packed into the protein particle as it lacks the RNA secondary structure element known as the psi signal. So no "new hybrid cell/virus that carries the deadly portion and the reproduction capability". No way of that happening that I can think of.
      Onyx Pharmaceuticals (I think) has had inital success with this approach- using a virus (Adeno?) which specifically infects cells lacking p53 (many tumor cells) and had promising results with head and neck tumors (here's a ref:http://www.ncbi.nlm.nih.gov/entrez/query.fcgi? cmd=Retrieve&db=PubMed&list_uids=11892945&dopt=Abs tract)

      Finally a subject on /. that I know something about!

    32. Re:Huge medicine possibility by fferreres · · Score: 2

      Well, it should not. That's probably why he was hired in the first place, as everyone else in the sector :)

      --
      unfinished: (adj.)
    33. Re:Huge medicine possibility by Tablizer · · Score: 2

      (* We're using a modified adenovirus to deliver a suicide gene to cancer cells, thereby killing them. *)

      How does it tell the difference between good cells and bad cells? I read that cancer cells may differ by one or two genes from good ones. That is rarely enuf for a virus to lock onto, isn't it?

      Or, does it target a *kind* of cell, like a liver cell? In that case, couldn't you kiss the real liver goodbye?

    34. Re:Huge medicine possibility by Anonymous Coward · · Score: 0

      http://www.evergreen.edu/phage/phagetherapy/phaget herapy.htm
      Am i the only one who thinks its funny how that came out?

    35. Re:Huge medicine possibility by krmt · · Score: 1

      Thank you very much! I was actually just asking my boss this afternoon for more info on the subject, and she couldn't find the papers she had stashed somewhere on it. These will be very helpful, thank you very much. I think you just killed at least a little bit of my free time this weekend, damn you! :-) Thanks again.

      --

      "I may not have morals, but I have standards."

    36. Re:Huge medicine possibility by FiendBeast · · Score: 1

      Sorry, but I can't really see this happening. Imagine if such a virus was created, if it were to spread (and even if it was designed to be non-contagious, how could they be sure it would not mutate), where would the drugs companies get their profits from?

      If all a person has to do is get the virus from the person down the street, without having to pay the company anything, they would all go broke.

      However, if they make their 'miracle cure virus' have unpleasant side-effects if some other drug was not regularly taken, they would hit the jackpot because all of the people suffering from what the virus cured would have to hand over money regularly and so would other people who happened to get the virus.

    37. Re:Huge medicine possibility by ckaminski · · Score: 1

      Presuming for even a SPLIT second that the science in Jurassic Park was possible, you will remember that the DNA for the dinosaurs was filled in with DNA from frogs, some of which are capable of [asexual reproduction].

    38. Re:Huge medicine possibility by Anonymous Coward · · Score: 0

      I do not know what studies to which you are referring

      I'm sorry, but this sentence right here shows how the whole "do not end a sentence in a preposition" rule is false and outdated. That is probably the most awkward sentence in a long time. In the late 18th century, some British guy wrote an authoritative guide to English grammar. Apparently that was one of the rules in there. Well, guess what? Language changes.

      Look at the following sentence: "I do not know what studies you are referring to." It's not like that sentence doesn't have an object of the preposition "to". It's just that, as per the rules of inversion when asking a question, the object of the preposition comes before the preposition, instead of the way it usually comes after it.

    39. Re:Huge medicine possibility by NorthDude · · Score: 1

      I guess it's very "controlable". If it is "designed" to kill only cancer cell based on certain criteria, it will never mistake a normal cell from a cancer cell...

      You just have to wish that the algorithm is good enough hehe

      But on another note, why are you all so scared at things like that? I mean, normal vaccins do not scares you? And hey, they inject you the real virus! Science is ghoing forward, but I think that peoples will never change. We are afraid of the things we don't know, and we will be afraid of those things as long as it will not have been "mainstream" for a while...

      --


      I'd rather be sailing...
    40. Re:Huge medicine possibility by topham · · Score: 2

      Just a slight reminder... Jurassic Park is -FICTION-. They could have had the Dinosaurs build nuclear weapons if it helped the plot a long..

    41. Re:Huge medicine possibility by SilverLuz · · Score: 1
      How does it tell the difference between good cells and bad cells? I read that cancer cells may differ by one or two genes from good ones. That is rarely enuf for a virus to lock onto, isn't it?
      Although cancer can be triggered by changes in only one or two genes, it doesn't stop there. Fundamentally, cancers accumulate mutations. That's what makes them cancerous: building up enough mutations that they no longer behave like ordinary cells. In reality, by the time a tumour has become malignant, it has lots and lots of mutations. Frequently, the genome will be hugely rearranged, with missing or duplicated chromosomes, and pieces repeatedly broken and then stuck back together in different places. Many of the mutations aren't important, and don't affect the cell's cancer-causing nature one way or the other. But a handful of mutations are important for causing cancer, and cells that happen to get those mutations are the ones that become cancerous. And we see many of the same mutations over and over again in many different types of cancers. (Look up 'p53' on PubMed if you don't believe me.) Some of these 'characteristic' mutations are ones that affect which molecules are present on the outside surface of the cell. If, for example, you know that a certain type of tumour expresses something on its surface that it normally wouldn't, that makes a great target for selection with a virus. Alternatively, have a virus that enters all cells, but only becomes active in those that contain a certain product that is indicative of cancer. All this is pretty theoretical, since it's not my area of research, and there are huge technical and logistical difficulties in getting a system that works well and reliably. But that it is a huge field of research, and is showing promise.
    42. Re:Huge medicine possibility by noproblema · · Score: 1

      A virus that can't replicate on its own is NOTHING. A virus needs replication for infect a system. If the viruses in the article referenced are capable to kill mice they have replicated inside the host. The cycle of a virus is infect a cell, make N copies of himself in the cell, kill the cell and infect N more cells.

    43. Re:Huge medicine possibility by bonoboy · · Score: 2

      "Senescence: Can't spell it, don't need it. A dummy's guide to handling nuclear waste."

      My God, if anybody gets that, I'll be amazed. Too much coffee today.

      --
      toeslikefingers.com - because
    44. Re:Huge medicine possibility by bonoboy · · Score: 2

      Typically they inject you with fragments of a dead virus, known to be incapable of reproducing itself. It's no live virus.

      Adenoviruses are a class of viruses we hope ain't that bad. They're normally blamed for the common cold, for instance. I guess one of the reasons they have 'localised effects' as somone noted above is that your body is so used to destroying them, it does so quite quickly. A nice side effect.

      One problem: it was an adenovirus that killed a human participating in a GE experiment (don't take this as a rule and don't flame me). in other interesting news, a couple of adenovirii have been blamed for rampant obesity in chickens and humans.

      --
      toeslikefingers.com - because
    45. Re:Huge medicine possibility by Tablizer · · Score: 2

      (* Some of these 'characteristic' mutations are ones that affect which molecules are present on the outside surface of the cell. *)

      Okay, but this suggests that such a technique may not be "general purpose" because many cancers may not have any "easy markers" on the outside, right?

      It is a technique that targets a *subset* of cancers that do. (That subset may be large or small, but still a subset.)

    46. Re:Huge medicine possibility by Ozmel · · Score: 1

      Of course! This and other uses for viruses are in the future. What about packaged therapeutic genes in a viral particle to transport to correct genetic disorders? Or a virus specifically targeted to a certain type of bacteria that'll wipe out a plaque. Researching viruses to do what we want them to do is so important. They are our own worst enemies but what about manipulating them to be our best friends? Transposons (viral genes that can jump from one genome to another) have been to known to be evolutionarily important to our species. Once we figure these nasties out it's just a matter of data analysis and experimentation to find out how we can use them. They may be more of a problem because of control (they're not cellular) and contamination but who knows?

    47. Re:Huge medicine possibility by Anonymous Coward · · Score: 0

      Right. Correct someone's spelling, get modded down as "troll".

      There sure are a lot of ignorant moderators on this board.

      Allow me to repeat myself. There is NO SUCH WORD AS VIRII. That is just wrong. In classical Latin there's no plural at all for virus, since it is what's called a "mass noun".

      Since there is no Latin plural, we need to use English rules, and make it "viruses".

      If there WERE a Latin plural, it sure as fuck wouldn't be "virii". That would only be correct if the singular were "virius", not "virus".

      If you use "virii" you're a fucking idiot. That is all.

      Go ahead, moderate me down as "troll" again, I don't care. I'll still be lauging at your retarded asses every time you try to look "intellectual" by using fake Latin plurals.

      "Virii". HAHAHHAHAHAH!

    48. Re:Huge medicine possibility by porges · · Score: 1

      Previous Poster (whose first language may not be English for all we know) would have done better to try

      I do not know to which studies you are referring. ...his first try wasn't any kind of English I know.

    49. Re:Huge medicine possibility by agentelmo · · Score: 1

      i disagree. Most viruses have a specifit host. Most host cells have specific protein receptors. All one would have to do is code the viral receptors to a specific surface protein on a specific cell. Kind of like a lock and key mechanism. The possibilities are endless.

    50. Re:Huge medicine possibility by Anonymous Coward · · Score: 0
      "Gene search ones, ones with GFP, ones with the tet transactivator, etc etc."

      Could you please provide a reference for these vectors, as I searched PubMed for "recombinant retrovirus tet GFP SIN" and found nothing (I also tried using "tat" instead of "tet" with the same result :). I really am curious about this.

      "Their LTRs (control centers) lack promoters and enhancers, they lack Psi packaging signals for the viral RNA to be packaged, and (once integrated into the cell's genome) lack all lentiviral/retroviral structural genes (gag, pol, env, rev, tat, etcetera) which make a virus a virus."

      You indicate that the recombinant is integrated into the cellular genome, and lacks the necessary structural/regulatory coding sequences "once integrated into the cell's genome." From that statement, I take it that the viral vector contains at least the gag, pol, and env coding sequences along with the GFP marker transgene. Or are the retroviral proteins provided in trans in producing the infectious vector? Also, if the vectors "lack promoters and enhancers", how is the GFP (or any other transgene) expressed? Perhaps you meant that the vectors lack the promoters/enhancers associated with the wild-type virus?

      "If in the event that this vector infects a cell already infected by a real pathogenic lentivirus (ie HIV-1)where the structural genes already are (in trans) it STILL wouldn't generate further vector virions because the viral vector provirus lacks LTRs to transcribe the viral RNA, and even if it somehow was transcribed it couldn't be packed into the protein particle as it lacks the RNA secondary structure element known as the psi signal. So no "new hybrid cell/virus that carries the deadly portion and the reproduction capability". No way of that happening that I can think of."

      Though I don't know the details of the vector(s) you are using, I don't see how something lacking at least some LTR sequences is still a lentiviral/retroviral vector. How does a construct become described as a retroviral vector let alone become a provirus, in the accepted meaning of those terms, without LTR sequences? In short, it doesn't. So there must be some LTR sequences present.

      As to "No way of that happening ..." in the event of a wild-type provirus (of the same type) already present in the cell providing biological functionality in trans, such that a "new hybrid cell/virus that carries the deadly portion and the reproduction capability" would be formed, I can certainly envision the mechanism for how that can happen, even without the psi signal being present in the incorporated vector.

      Hint: Think of the retroviral replication mechanism, the fact that retroviruses are double-stranded RNA viruses, the fidelity of the replication and reverse transcription process, and the availability of all necessary processing and packaging functionalities available in trans from the wild-type provirus.

      Please, if you would, provide one or more PubMed references as to this/these vectors (not the older stuff that I already know about :-)

    51. Re:Huge medicine possibility by Squalish · · Score: 1

      Cancer cells are merely normal human cells with a few extraordinarily improbably mutations that allow them to break free of whatever it is that self-organises cells in a multicellular organism and reproduce without control.

      Ones that have the same telomere-shortening vulerabilities as human cells(and from what I can tell, almost all sexual organisms) eventually stop reproducing, and we call them moles, or cysts. Strains that have somehow bypassed this aging process are called Cancer.

      Cancerous cells are merely malignant(meaning they won't stop growing) moles/cysts/whatever you call them in X part of your body. They are still 99.99percent human cells.

      Any virus that is designed to destroy cancer cells will destroy human cells just as easily(It seems that the body does not specifically code for angiogenesis[dynamic formation of blood vessels] so it adapts to the tumor's demands for blood the same way it would as for any other growing body part, by forming new blood vessels. Without angiogenesis(and there are angiogenesis-inhibitors that are looking promising) a tumor without blood running through it dies the same way a body part without circulation would. All this means that any antibodies formed in the person's blood against virii work for the cancerous cells too.) Since antiviral medications are so volatile(usually they are carcinogens at even moderate doses) there is no way we could treat people wholesale with this kind of thing.

      The only thing that might work are virii that only code a specific, small segment of cancerous cells that tells them to either suicide(would be very dangerous since the virus would likely affect the host too) or to reprogram whatever section of their genetic code that has been modified to make them cancerous. This would be extremely hard as most cancers are genetically unique, as are the people infected with them.

      There are also, on the horizon, growth-inhibitors that look very promising as a cure for any type of cancer, but could bring on premature aging or stop growth in non-mature patients. I recall a study somewhere in popular science a couple years back about a group of hormones that are released from south pacific sea slugs in trace amounts that stopped tumor growth in 100% of mice and reduced the size of tumors in 80%, but which could only be made at incredible expense from dozens of sea slugs that live at 2 miles deep and were impossible(so far) to manufacture. Things like this are why we need to have wider-ranging studies(not 100$ million put into the healing affects of soy) on unique substances' anti-cancer properties.

      Any way you slice it, it is very hard to negatively affect a cancer without negatively affecting the body, other than some type of surgery, which doesn't protect from metastasizing.

      ---------
      I disagree with your right to exist, but I will defend to the death your parent's right to grant it to you.

      --
      People in Soviet Russia, however, appear to be afflicted with amusing juxtapositions of the aforementioned situation
    52. Re:Huge medicine possibility by Sgt+York · · Score: 1

      It's being done already. for example, there's a group at MD Anderson that is using an adenovirus that specifically takes out cells with a mutation in a certain oncogene (p53). Cells that lack that protein are killed by the virus, those that have the protein survive. In theory, it works great. In mice, it cures cancer. In humans, it works sometimes. Viral delivery is one of the methods behind gene therapy. A lot of people are doing it

      --

      There is a reason for everything. Sometimes that reason just sucks.

  11. Finally! by Joe+Tie. · · Score: 5, Funny

    From the article: injected it into mice to demonstrate that it was active. The animals were paralysed and then died.

    After decades of research, advances in biotechnology finally creates the long fabled "better mousetrap".

    --
    Everything will be taken away from you.
    1. Re:Finally! by Anonymous Coward · · Score: 0

      Yeap, scientics running after mice, and injecting 'em.
      I'll stick with my cat ta.

    2. Re:Finally! by Horny+Smurf · · Score: -1
      I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
      It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
      bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

      "Well? Have you?" Kara was waiting expectantly for my answer.

      "Well...I...no! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

      "Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

      I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

      Instead, I said, "No...I mean....kissing another girl after...."

      Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
      about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
      sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
      apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

      Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

      "Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

      "Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

      "YOU?" I exclaimed, shocked. "You'd never do something like that."

      "Dare me," Kara challenged.

      "OK....I dare you!" I giggled, playing along.

      Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

      "Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

      As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
      wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
      embarrassed! My face must have been bright red as Kara brought the two guys over.

      She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
      "friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
      objected to being classified as a walking sex object.

      Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
      guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

      "Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
      Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
      guy gently pulled me toward him. I opened wide and took him in...

      We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
      for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
      arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
      playing with them! My nipples immediately got rock hard.

      "Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
      them and having them fucked," she whispered.

      Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
      I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

      Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
      nice juicy tits together...tighter! Make him cum....!"

      Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
      guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

      Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
      his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
      Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
      Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

      Then she drew me in and our lips locked.....

      What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
      her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

    3. Re:Finally! by Kredal · · Score: 3, Funny

      Polio didn't kill the mice... the scientists were just careless and injected the saline solution into the mice's spinal cords, causing paralysation, and then death.

      False alarm, nothing to see here...

      --
      Whoever stated that signature sizes should be limited to one hundred and twenty characters can just go ahead and kiss my
    4. Re:Finally! by Anonymous Coward · · Score: 1, Funny

      Oh. Well, what a relief.

    5. Re:Finally! by Bisqwit · · Score: 1
      From the article: injected it into mice to demonstrate that it was active. The animals were paralysed and then died

      I think injecting just about anything to mice can kill them the same way. This isn't quite a proof...

    6. Re:Finally! by FiendBeast · · Score: 1

      Of course, this could never happen once they moved on to human trials.

    7. Re:Finally! by bonoboy · · Score: 2

      He's right, inject enough anything into a mouse, and it'll still explode.
      **rushes to patent office to register new biological weapon*

      --
      toeslikefingers.com - because
  12. Worrisome? by maynard-lag · · Score: 5, Insightful

    Ok, wtf, from the article we have these snippets:

    Responding to criticisms that such research could lead to bioterrorists engineering new lethal viruses, the scientists behind the experiment said that only a few people had the knowledge to make it happen.

    and then the rest of the article is filled with stuff like this?!

    To construct the virus, the researchers say they followed a recipe they downloaded from the internet and used gene sequences from a mail-order supplier.

    According to researcher Jeronimo Cello, the polio virus assembled in the laboratory is one of the simplest known viruses. "It was very easy to do," he said.

    "We've known this could be done. We've known it was just a matter of time before it was done," he said.

    Why shouldn't we be worried?

    --
    Have you hugged your Karma Whore today?
    1. Re:Worrisome? by billstr78 · · Score: 2, Insightful

      I also hope that this sort of synthesized virus does not become another "Africanized Bee".

    2. Re:Worrisome? by Troodon · · Score: 3, Insightful

      The reporting of this advance seems to be spun in two different directions by those reporting it:

      The dangers of the net, open reseach genetic databases: a modern terrorist's cookbook.

      A scientific advance, potential medical breakthrough with the posibility for radical vaccine developement etc.

      Perhaps its from different viewpoints within the institution/research group responsible. Id suggest going to the horses mouth should you have realplayer and listen to an interview by one of the researchers by the BBC radio4 program Leading Edge (Real Audio unfortunately)

      --
      troodon.net
    3. Re:Worrisome? by nucal · · Score: 3, Informative
      According to Science it took the group two years to synthesize the virus and the synthetic virus is 1000 - 10,000 times weaker than "natural" Polio virus.

      Still, by biotech standards, this is the equivalent of doing science in the garage. At least the smallpox genome is ~25x bigger than polio.

    4. Re:Worrisome? by Rutulian · · Score: 3, Insightful

      Still, by biotech standards, this is the equivalent of doing science in the garage. At least the smallpox genome is ~25x bigger than polio.

      Except that it still costs tens of thousands of dollars to run a lab capable of doing this. This isn't mix-and-match with chemicals from the local drugstore. It costs a lot of money to buy vectors, kits, reagents, perform sequencing, etc....

      It is kind of funny to find comments like this on a site like slashdot. People will post a comment jumping all over congress for creating the DMCA (i.e: "Just because software CAN be used for illegal activities doesn't mean it should be illegal itself because it has a legitimate use."), and then they will say things like: "This is dangerous research because it can be used by terrorists to make biogents!" Sheesh.

    5. Re:Worrisome? by fermion · · Score: 1
      Almost any advance scientific research can, with relatively trivial changes, be made into a weapon. As a matter of fact creating weapon of mass destruction can often be a bit simpler than creating a useful tool, as a tool must be relatively easy to control, while a weapon can be allowed to run rampant.

      As a side issue, one must also consider if using this 'high tech' weapon will be strategically more destructive than a lower tech existing technology. Even though the U.S. is obsessed with 'high tech' glamorous weapons, partly in an effort to reduce risk to U.S. soldiers, we have seen that simpler 'high concept' devices can be very effective. With relatively little thought, one can imagine any number of simpler, though higher risk, methods to introduce contagions into an environment.

      That said, if a random person followed a recipe they downloaded from the Internet and used gene sequences from a mail-order supplier they would not necessarily be able to generate a virus. For example, having a cookbook and a stove does not mean that you can create a Cheese Souffle or a fresh Baguette. There is a certain skill level needed to succeed. I can, in fact, make a reasonable facsimile of these things, but only after quite a bit of practice.

      This isn't to say we should not be worried. But Washington has used the 'download from the Internet' scare card so often, that is very furstrating to see people accept it so readily.

      As another example, I have helped researcher create a number of solid state devices. That does not mean that I can recreate those devices, either because the tools needed are too expensive, or the skill needed is beyond my abilities. Even with the tools and adequate materials, the average person would have little hope of figuring out which button to push.

      --
      "She's a scientist and a lesbian. She's not going to let it slide." Orphan Black
    6. Re:Worrisome? by HD+Webdev · · Score: 1

      True, but then again, in the latter case, the person's life could be effected. In the former, it's pretty much Someone Elses Problem.

      People don't usually take a serious stand against something unless either a) it will directly effect them, or b) they find out someone else is having a lot of fun.

      --
      This is not a dream, not a dream...we are transmitting from the year 1-9-9-9.
    7. Re:Worrisome? by Ctrl-Z · · Score: 1


      Are you saying that potential terrorists don't have access to tens of thousands of dollars?

      If that's all that is needed to construct a virus then there is potential for a lot of harm in technology like this.

      --
      www.timcoleman.com is a total waste of your time. Never go there.
    8. Re:Worrisome? by dachshund · · Score: 1
      Except that it still costs tens of thousands of dollars to run a lab capable of doing this. This isn't mix-and-match with chemicals from the local drugstore. It costs a lot of money to buy vectors, kits, reagents, perform sequencing, etc....

      If you think in the very short-term, you may be right. If your vision extends a decade or two into the future, you might have cause to be a little worried. The cost of the equipment and knowledge necessary to carry this sort of thing out is inevitably going to plummet.

      It's sort of like somebody in 1968 saying nobody could ever build a computer virus in their house because computers are too big and expensive...

    9. Re:Worrisome? by cybrpnk2 · · Score: 2
      We should be worried. we should be worried about a lot more than the creation of synthetic viruses. Take the Ebola virus - 90% fatal, compared to the smallpox fatality rate of 30%. We know a lot about the genetic structure of Ebola and the details of its genome are at a universtiy library near you; see Sanchez, A., et al. (1993), "Sequence analysis of the Ebola virus genome: organization, genetic elements and comparison with the enome of Marburg virus", Virus Research 29, 215-240(1993).

      But nobody is going to go to the trouble of synthesyzing an Ebola virus because it's too much trouble and there's a better way to turn it into a Weapon of Mass Destruction (WMD). Ebola has just seven genes and only one of these produces the substance that causes the 90% fatality rate - Ebola glycoprotein. The gene for this protein has already been isolated and put in a common cold virus!!!

      "...Nabel's team worked with intact blood vessels taken from people and animals. The researchers infected those cells with a cold virus they had engineered to carry the Ebola glycoprotein gene. Within 48 hours, massive numbers of endothelial cells began to die and the blood vessels became leaky. Such effects could lead to the internal and external bleeding caused by Ebola...."

      Kinda makes you wonder where ol' Nabel's virus is now, huh? Hope it's safely in the bottom of his lab freezer. But inserting the Ebola glycoprotein in a bacterium (as opposed to a virus) is basically a science fair project these days, so ANYBODY can get in on the fun. Who knows, the next Jack in the Box E Coli scare may very well be a version with an Ebola gene in it. The basic data you need for such a project is onlione at the SWISS-PROT database in Switzerland; just enter ebola in their search engine and see for yourself. The specific data for Ebola glycoprotein is here, and in case that gets slashdotted, the relevant sequence data info is as follows:

      MGVTGILQLP RDRFKRTSFF LWVIILFQRT FSIPLGVIHN STLQVSDVDK LVCRDKLSST NQLRSVGLNL EGNGVATDVP SATKRWGFRS GVPPKVVNYE AGEWAENCYN LEIKKPDGSE CLPAAPDGIR GFPRCRYVHK VSGTGPCAGD FAFHKEGAFF LYDRLASTVI YRGTTFAEGV VAFLILPQAK KDFFSSHPLR EPVNATEDPS SGYYSTTIRY QATGFGTNET EYLFEVDNLT YVQLESRFTP QFLLQLNETI YTSGKRSNTT GKLIWKVNPE IDTTIGEWAF WETKKTSLEK FAVKSCLSQL YQTEPKTSVV RVRRELLPTQ GPTQQLKTTK SMASENSSAM VQVHSQGREA AVSHLTTLAT ISTSPQSLTT KPGPDNSTHN TPVYKLDISE ATQVEQHHRR TDNDSTASDT PSATTAAGPP KAENTNTSKS TDFLDPATTT SPQNHSETAG NNNTHHQDTG EESASSGKLG LITNTIAGVA GLITGGRRTR REAIVNAQPK CNPNLHYWTT QDEGAAIGLA WIPYFGPAAE GIYIEGLMHN QDGLICGLRQ LANETTQALQ LFLRATTELR TFSILNRKAI DFLLQRWGGT CHILGPDCCI EPHDWTKNIT DKIDQIIHDF VDKTLPDQGD NDNWWTGWRQ WIPAGIGVTG VIIAVIALFC ICKFVF

      Any genetic engineer worth her salt should be able to take this data and create a Ebola / E Coli hybrid plasmid with the help of this data and a friendly mail order supplier of synthetic DNA...

      Worried yet? I am. PS to any Fed reading this: don't worry, I'm no terrorist, I'm posting this in the spirit of Paul Revere, not Osama. The public has got to be EDUCATED about the implications of transgenic research and just how easy it is to do some really scary things that may well lead to the next 9/11...
    10. Re:Worrisome? by IsoRashi · · Score: 1

      That caught my eye too, but then I thought they could be pointing out that it's not easy to engineer *new* viruses, whereas it was simpler to create polio since they already knew how it was structured bla bla bla.

      --
      This is not the greatest sig in the world, no. This is just a tribute.
    11. Re:Worrisome? by bonoboy · · Score: 2

      The point is surely that terrorists have cash. That's not the problem, it was always the know-how. I'm all for freeing knowledge, and using the Internet to brighten the corners of ignorance without forcing people to pay large amounts of money to go to Universities, but I like ice creams and walks on the beach. I don't like bleeding to death through my eyeballs so much.

      I have a degree in genetics, and personally wouldn't withhold knowledge from anybody. This is the kind of shit people like Monsanto and Celera would jump on in order to privatise data that should be publicly available, so we should proceed with care. but don't underestimate what's capable with biological weaponry, ever, ever, ever.

      *Washes hands after typing the words 'monsanto' and 'celera' twice in the same coment.*

      --
      toeslikefingers.com - because
    12. Re:Worrisome? by bonoboy · · Score: 2

      Ebola's a really scary one, too. not because it's a particularly smart virus, quite the opposite. In evolutionary terms, something which destroys its environment so quickly is totally sucky. HIV is obviously much smarter, with a huge gestation period and good infectivity. Ebola has the potential to spread very quickly and visibly. Thus, a city gets quarantined, but not before everybody is infected. HIV ain't so good, cause it might take ten years to blow up in your face. Ebola is ore easily controllable once contained. It's like a clean nuke. Handle it right and it's a serious piece of evil fucking hardware.

      I'm afrad of the big bad wolf

      --
      toeslikefingers.com - because
    13. Re:Worrisome? by bonoboy · · Score: 2
      Almost any advance scientific research can, with relatively trivial changes, be made into a weapon.

      This is true. Not many people realise just how many cats Schrodinger killed before he published.

      --
      toeslikefingers.com - because
    14. Re:Worrisome? by maelstrom · · Score: 2

      At least with such quickly killing viruses the potential for spread is limited as the person doesn't have time to travel widely as a carrier...

      --
      The more you know, the less you understand.
    15. Re:Worrisome? by Anonymous Coward · · Score: 0
      According to Science [sciencemag.org] it took the group two years to synthesize the virus and the synthetic virus is 1000 - 10,000 times weaker than "natural" Polio virus.

      It's weaker only because the researchers purposely made about 27 changes to mark the virus in order to distinguish it from other polio virus already in their lab. These optional changes had the side effect of making the virus weaker and are not a necessary part of the manufacturing process.

    16. Re:Worrisome? by ShavenYak · · Score: 2

      I don't like bleeding to death through my eyeballs so much.

      Aw, come on - you've never tried it! How do you know you don't like it?

      --

      Hey kids, there's only 5 days left 'til Yak Shaving Day!
  13. A new virus?! by Schmelter · · Score: 5, Funny

    Great, another computer-engineered virus.

    No wonder my roomate has been screaming "I send you this file in order to have your advice. See you later. Thanks. " while throwing porn at me and defacing my website. Fortunately, I was able to powercycle him with a car-battery.

    1. Re:A new virus?! by Horny+Smurf · · Score: -1

      I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
      It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
      bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

      "Well? Have you?" Kara was waiting expectantly for my answer.

      "Well...I...no! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

      "Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

      I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

      Instead, I said, "No...I mean....kissing another girl after...."

      Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
      about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
      sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
      apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

      Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

      "Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

      "Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

      "YOU?" I exclaimed, shocked. "You'd never do something like that."

      "Dare me," Kara challenged.

      "OK....I dare you!" I giggled, playing along.

      Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

      "Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

      As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
      wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
      embarrassed! My face must have been bright red as Kara brought the two guys over.

      She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
      "friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
      objected to being classified as a walking sex object.

      Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
      guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

      "Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
      Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
      guy gently pulled me toward him. I opened wide and took him in...

      We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
      for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
      arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
      playing with them! My nipples immediately got rock hard.

      "Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
      them and having them fucked," she whispered.

      Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
      I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

      Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
      nice juicy tits together...tighter! Make him cum....!"

      Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
      guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

      Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
      his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
      Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
      Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

      Then she drew me in and our lips locked.....

      What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
      her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

  14. Why FreeBSD is dying by poopbot by Anonymous Coward · · Score: -1, Offtopic
    The End of FreeBSD

    [ed. note: in the following text, former FreeBSD developer Mike Smith gives his reasons for abandoning FreeBSD]

    When I stood for election to the FreeBSD core team nearly two years ago, many of you will recall that it was after a long series of debates during which I maintained that too much organisation, too many rules and too much formality would be a bad thing for the project.

    Today, as I read the latest discussions on the future of the FreeBSD project, I see the same problem; a few new faces and many of the old going over the same tired arguments and suggesting variations on the same worthless schemes. Frankly I'm sick of it.

    FreeBSD used to be fun. It used to be about doing things the right way. It used to be something that you could sink your teeth into when the mundane chores of programming for a living got you down. It was something cool and exciting; a way to spend your spare time on an endeavour you loved that was at the same time wholesome and worthwhile.

    It's not anymore. It's about bylaws and committees and reports and milestones, telling others what to do and doing what you're told. It's about who can rant the longest or shout the loudest or mislead the most people into a bloc in order to legitimise doing what they think is best. Individuals notwithstanding, the project as a whole has lost track of where it's going, and has instead become obsessed with process and mechanics.

    So I'm leaving core. I don't want to feel like I should be "doing something" about a project that has lost interest in having something done for it. I don't have the energy to fight what has clearly become a losing battle; I have a life to live and a job to keep, and I won't achieve any of the goals I personally consider worthwhile if I remain obligated to care for the project.

    Discussion

    I'm sure that I've offended some people already; I'm sure that by the time I'm done here, I'll have offended more. If you feel a need to play to the crowd in your replies rather than make a sincere effort to address the problems I'm discussing here, please do us the courtesy of playing your politics openly.

    From a technical perspective, the project faces a set of challenges that significantly outstrips our ability to deliver. Some of the resources that we need to address these challenges are tied up in the fruitless metadiscussions that have raged since we made the mistake of electing officers. Others have left in disgust, or been driven out by the culture of abuse and distraction that has grown up since then. More may well remain available to recruitment, but while the project is busy infighting our chances for successful outreach are sorely diminished.

    There's no simple solution to this. For the project to move forward, one or the other of the warring philosophies must win out; either the project returns to its laid-back roots and gets on with the work, or it transforms into a super-organised engineering project and executes a brilliant plan to deliver what, ultimately, we all know we want.

    Whatever path is chosen, whatever balance is struck, the choosing and the striking are the important parts. The current indecision and endless conflict are incompatible with any sort of progress.

    Trying to dissect the above is far beyond the scope of any parting shot, no matter how distended. All I can really ask of you all is to let go of the minutiae for a moment and take a look at the big picture. What is the ultimate goal here? How can we get there with as little overhead as possible? How would you like to be treated by your fellow travellers?

    Shouts

    To the Slashdot "BSD is dying" crowd - big deal. Death is part of the cycle; take a look at your soft, pallid bodies and consider that right this very moment, parts of you are dying. See? It's not so bad.

    To the bulk of the FreeBSD committerbase and the developer community at large - keep your eyes on the real goals. It's when you get distracted by the politickers that they sideline you. The tireless work that you perform keeping the system clean and building is what provides the platform for the obsessives and the prima donnas to have their moments in the sun. In the end, we need you all; in order to go forwards we must first avoid going backwards.

    To the paranoid conspiracy theorists - yes, I work for Apple too. No, my resignation wasn't on Steve's direct orders, or in any way related to work I'm doing, may do, may not do, or indeed what was in the tea I had at lunchtime today. It's about real problems that the project faces, real problems that the project has brought upon itself. You can't escape them by inventing excuses about outside influence, the problem stems from within.

    To the politically obsessed - give it a break, if you can. No, the project isn't a lemonade stand anymore, but it's not a world-spanning corporate juggernaut either and some of the more grandiose visions going around are in need of a solid dose of reality. Keep it simple, stupid.

    To the grandstanders, the prima donnas, and anyone that thinks that they can hold the project to ransom for their own agenda - give it a break, if you can. When the current core were elected, we took a conscious stand against vigorous sanctions, and some of you have exploited that. A new core is going to have to decide whether to repeat this mistake or get tough. I hope they learn from our errors.

    Future

    I started work on FreeBSD because it was fun. If I'm going to continue, it has to be fun again. There are things I still feel obligated to do, and with any luck I'll find the time to meet those obligations.

    However I don't feel an obligation to get involved in the political mess the project is in right now. I tried, I burnt out. I don't feel that my efforts were worthwhile. So I won't be standing for election, I won't be shouting from the sidelines, and I probably won't vote in the next round of ballots.

    You could say I'm packing up my toys. I'm not going home just yet, but I'm not going to play unless you can work out how to make the project somewhere fun to be again.

    = Mike

    --

    To announce that there must be no criticism of the president, or that we are to stand by the president, right or wrong, is not only unpatriotic and servile, but is morally treasonable to the American public. -- Theodore Roosevelt



    - poopbot: crapflooding since 7/8/02
  15. heh by Anonymous Coward · · Score: -1, Flamebait

    slashdot crew

    unable to recognize idiocy
    unable to recognize sarcasm

    nothing new here

  16. Oh great... by Anonymous Coward · · Score: 4, Funny
    Damn script kiddies designing their own viruses, how long until they get their own downloadable virus construction toolkit?

    What's it called?

    9o7i0

    kewl! I just made 5m4L7p0x

    Release it dude!

    1. Re:Oh great... by shepd · · Score: 2

      Too late. :)

      Now, where's the one made by China Labs I remember from the early 90's?

      --
      If you could be told what you can see or read, then it follows that you could be told what to say or think - BoC
  17. Reminds me of a Frank Herbert book ... by Introspective · · Score: 1

    called The White Plague, if you haven't read it, the story goes a bit like this :

    A biochemist witnesses his wife and children getting killed in a car bomb explosion in Dublin, Ireland. After suffering a deep depression, he goes into hiding in the US and after a couple of years he develops a new contagious virus which infects and kills women only. He releases it in Ireland and, IIRC, Algeria and some other terrorist states by posting infected dollar bills to people in those countries. Of course, the virus sooon spreads to other countries and Frank Herbert doesn't hold back in graphically describing the pain, suffering, and insanity.

    It makes a very powerful story in light of recent events, and is well worth reading of you can find a copy.

    If Anthrax-in-the-post worried you, this story would scare the shit out of you.

    1. Re:Reminds me of a Frank Herbert book ... by TastySiliconWafers · · Score: 1
      Read this book!

      Seriously, this is IMO one of Herbert's best novels. Written in 1982 and more relevant than ever now. Ask yourself the question, "What if Theodore Kaczynski had been a molecular biologist?" and you realize just how plausible the hellish world Herbert describes really is. If Huxley's "Brave New World", Orwell's "1984", and Kafka's "The Trial" gave you nightmares, better leave the night light on and keep a can of Lysol and a gas mask by the bed while you're reading this book.

    2. Re:Reminds me of a Frank Herbert book ... by seosamh · · Score: 1

      It's scarier than that. In an interview after it was published, Herbert explained that all of the equipment and materials that John (the protaganist microbiologist) used were freely available via mail order. In 1982.

      What might be possible today, when we learn that no one knows exactly who received anthrax stock over the years?

      And it is a great book, up there with his original Dune. I've read and re-read it many times since the first excerpt appeared in Omni. Good fiction entertains; great works inform.

  18. PLEASE PAY ATTENTION by Anonymous Coward · · Score: -1, Troll

    I have a DICK that's FULL OF LOVE for you.

    Thank you.

  19. Ask Slashdot by cDarwin · · Score: 3, Interesting
    Question for molecular biologists in slashdot land:

    How hard would it be to reduce this to a stepwise procedure that any reasonably intelligent, resourceful, dedicated person could carry out?

    Making LSD from scratch required a lot of skill. But with detailed how-tos now widely available, practically anyone can make acid.

    --

    --
    Socrates was asked where he was from. He replied not "Athens," but "The world."

    1. Re:Ask Slashdot by Anonymous Coward · · Score: 0

      In order to make virus like this your need a few things:
      1. MS or better Ph.D. in virology or molecular biology,
      2. Equipment (not really fancy, just everyday stuff found in practically every lab)
      3. ~100,000$
      4. determination

      And the good part: you can just order any gene to be made from scratch, for polio it will cost around 70,000$ and take ~6 mo.
      BTW, they did not 'create' or made it from scratch: they used nucleotide sequence determined for natural virus. And when you have a DNA copy, it is almost trivial to convert it into virus. People have been doing this for years. I think that this paper does not bring much new knowledge, but it is great for public relations (not that E. Wimmer needs it, he is well known in the field).
      Some general comments:
      People, please write viruses, not virii!! No virologist will ever say virii!
      Polio is one of the easier viruses to re-create, but other RNA viruses, and some DNA ones are almost as easy to make. People have been developing viruses to make vaccines for quite some time. And it is not terrible as some posts say. For example, vaccinia virus was used for ~200 years and helped to eradicate smallpox. It is now engineered as a vaccine for HIV. Number of other viruses also have been modified and are now in testing for vaccine and cancer applications. Please, give some credit to molecular biologists - they are not stupid, even though most cannot write a perl script!

    2. Re:Ask Slashdot by Anonymous Coward · · Score: 0

      People, please write viruses, not virii!! No virologist will ever say virii!

      Be careful. I made this same point and got modded down as "troll" multiple times.

      If virus DID have a plural in Latin (which it doesn't), it sure as fuck wouldn't be "virii". "Virii" would only be plausible if the singular were "vir*I*us". There is no example of a Latin word not ending in "*I*us" that has an "ii" plural ending.

      "Virii" is laughably incorrect.

      Since THERE IS NO Latin plural, we are forced to use the English rules and make it "viruses".

  20. Build your own troll by Mode0x13 · · Score: -1

    TrollTech version 2.0.14 (Crapola) running on i286-dosbox

    Entering postlevel: -1
    probing goatse.cx... OK
    BSD is dying... OK
    Mounting Natalie Portman... OK
    nportman: Covered in hot grits
    nportman: naked and petrified

    Slashdot losers: found
    slashdot: 10 stories on front page
    slashdot: 5 linux FUD articles
    slashdot: 2 feebleminded rants
    slashdot: 2 recycled articles
    slashdot: 1 junk science story
    slashdot: this is not news for nerds, stuff that matters.

    Registering troll personalitires...
    Wintroll 3.0 (c) 1998 Redmond
    Right Wing Troll: found. Loaded at 0x1950
    Jon Katz (c) VA Linux

    Welcome to TrollTech. HTH. HAND.

    C:>TROLLTEK> CD SLASHDOT

    C:>TROLLTEK\SLASHDOT> DEL *.*
    e

  21. Spit Kiddies! by tchdab1 · · Score: 2, Funny

    Now we'll get hassled by spit kiddies - anyone that can follow a sequencing recepie will be generating these things.

  22. Very troubling this is! by Anonymous Coward · · Score: 0

    Isn't anyone else out there disturbed by this? We just might end up whipping out man kind!

  23. I want to change my name by confucio-licious · · Score: -1

    I am changing my name to Fuckforce Lambroghini.

    --

    "someone should make a hot air balloon that is shaped like a giant vagina". --Bill Clinton
  24. Catalog? by thelinuxking · · Score: 1

    'To construct the virus, the researchers say they followed a recipe they downloaded from the internet and used gene sequences from a mail-order supplier.' This sounds like its nothing revolutionary...first, the recipe apparently was already on the internet in public access...and they used parts from a mail order catalog! How come whenever I read those science magazines, it never has advertisements for the "Make your own Virus...In Your Home!" kit? Seems to me that if its so impressive and potentually harmful, it wouldn't have already been posted on the internet!

  25. Smells like by Anonymous Coward · · Score: 0

    The White Plague by Frank Herbert. Woopie!

  26. Animals Were Hurt! by Anonymous Coward · · Score: 0
    Having constructed the virus, which appears to be identical to its natural counterpart, the researchers, from the University of New York at Stony Brook, injected it into mice to demonstrate that it was active. The animals were paralysed and then died.
    They can't claim animals weren't hurt can they? I am sending in the PETA team as I type.
  27. I'm feeling sick... by I_am_Rambi · · Score: 1

    *Cough, Cough*

    Don't worry, I just caught a synthetic virus. I'll be well in a few days...

  28. It's not an accident DNA is digital. by Kjellander · · Score: 1

    I'd better go and backup my genome to CD-ROM, so I can be restored later, in case of an accident...

  29. Not the first virus by Anonymous Coward · · Score: -1, Troll

    This is really not the first synthetic virus. AIDS is synthetic. They "tested" it among African villages ravaged by smallpox. All those villages that recieved
    vaccines become infected.

    /me Welcomes the flames!

  30. Biological Genie by Anonymous Coward · · Score: 0


    This is the most disturbing thing I've read in a long time. Scientists could not keep the nuclear genie in the bottle, and they won't be able to keep the biological genie in the bottle, either. And it will be worse if it becomes easy to design biological viruses. Next thing you know and we'll be needing vaccines more frequently than Microsoft security updates. I'm afraid that ultimately, the knowledge which we use to destroy disease will be the the knowledge that we use to destroy ourselves.

  31. Right by fizban · · Score: 1

    Just like Slashdot to take a deadly serious issue and turn it into light-hearted fun!

    --

    +1 Insightful, -1 Troll. What can I say, I'm an Insightful Troll.

  32. AV companies have gone too far.... by mike3411 · · Score: 1

    Wow, I pretty pissed when McAfee started publishing fake virii like the JPEG thing, but this time they've clearly gone too far....

    Of course, if you aren't using MS DNA, you should be fine. Just another example of the benefits of Homo *NIX.

    --
    Mod me down, and I will become more powerful than you can possibly imagine!
    1. Re:AV companies have gone too far.... by Anonymous Coward · · Score: -1, Troll

      There is no such word as "virii". Using it makes you look like a pretentious idiot. Please stop.

    2. Re:AV companies have gone too far.... by mike3411 · · Score: 1

      Fuck you, I don't _look_ pretentious, it's the real deal.

      --
      Mod me down, and I will become more powerful than you can possibly imagine!
    3. Re:AV companies have gone too far.... by Anonymous Coward · · Score: 0

      The idiot part is the real deal too, apparently.

      "Virii".... HAHAHAHAHAHA!

    4. Re:AV companies have gone too far.... by mike3411 · · Score: 1

      fuck off, i guess i should have known better than to respond, in any way, to an anonymous coward, it's latin-based word, and that's how it might be pluralized in latin.
      and "viruses" sounds almost as stupid as you do....

      --
      Mod me down, and I will become more powerful than you can possibly imagine!
    5. Re:AV companies have gone too far.... by Anonymous Coward · · Score: 0

      it's latin-based word

      Yes, it is.

      and that's how it might be pluralized in latin.

      No, it isn't. The only Latin words that use "ii" to form a plural are words that end in -*I*us. Virus does not end in -ius. "Virii" is moronic. As are you.

      Virus doesn't even HAVE a plural in Latin. It is a mass noun.

      Why don't you make the great intellectual effort of consulting a fucking dictionary before posting here again?

  33. NOT the first one by Anonymous Coward · · Score: 0

    http://www.apfn.org/apfn/aids.htm
    "The transcript that follows is taken from the June 9, 1969 Senate
    testimony of Dr. Donald MacArthur, a high-level Defense Department
    biological research administrator. For those who hold the theory that
    AIDS is the result of a U.S. biological weapons program--discussed in
    chapter 40 of 60 Greatest Conspiracies of All Time--this testimony is a
    smoking gun, or smoking petri dish as the case may be. We present it
    without further comment. Judge for yourself."

    Funding was approved in 1970 - $10 million to the DOD.

  34. Disturbing by theolein · · Score: 2

    This frightens me badly. Judging from the success that the FBI have had at tracing certain people involved in last year's Anthrax spree (at least one of the suspects was involved in biowarfare trials against blacks in South Africa in the '80s), I shudder to think what one pissed off reseacher could do and how the inept security agencies would not be able to do anything about it.

    1. Re:Disturbing by pryan · · Score: 4, Interesting

      Think "12 Monkeys".

    2. Re:Disturbing by Anonymous Coward · · Score: 0

      I'm trying to, but I fell asleep after two hours.

    3. Re:Disturbing by rendler · · Score: 1

      No thanks, I'd rather get ideas from getting intentionally infected from a deadly virus than to try and conjure up any memories of that movie.

      --

      *shrug*
  35. ebola ain't no joking matter by knitting+fool · · Score: 1
    it was possible that viruses like Ebola could be assembled in laboratories, but there were only a few people in the world with that skill.

    i would like to think anyone who has read The Hot Zone by crighton is being plagued by the same tingles of fear running up and down their spines. all it takes is one of the few... the hot zone is about an ebola outbreak, and the descriptions of liquidized organs seeping out every opening is enough to give ghengis kahn nightmares.

    --
    -- Give us your technology and we'll give you all the cow lips you want.
    1. Re:ebola ain't no joking matter by krmt · · Score: 5, Informative

      Ebola is scary scary stuff.

      But it's also limited. Why is it that we haven't had a major outbreak all over the world, killing billions? Ebola is an RNA virus, which makes it very unstable (RNA is far less stable than DNA, and more prone to mutations). Because of this, Ebola was able to evolve in the first place in to something so deadly, due to its high mutation rate.

      But Ebola never lasts too long, it comes in outbreaks, then it goes. That's because of two reasons. One is that the same instability which made it deadly also causes it to become ineffective at a quick pace. Mutations can work against these organisms too. The other reason is that it kills too quickly. It can't spread because people die before it gets a chance to move effectively. It's just too damn lethal.

      Ebola is terrifying, but it's not all powerful. Any kind of pathogen has to balance infectivity with lethality, and Ebola is too far on the lethal side to be massively infective right now, thankfully.

      --

      "I may not have morals, but I have standards."

    2. Re:ebola ain't no joking matter by Anonymous Coward · · Score: 0

      Crighton [sic] did not write The Hot Zone. Richard Preston did.

    3. Re:ebola ain't no joking matter by irc(addict) · · Score: 1

      You've read Executive Orders havent you? ;-)

    4. Re:ebola ain't no joking matter by krmt · · Score: 1

      Nope, but I took a class on bioterrorism and talked about it pretty extensively with a paranoid friend of mine in the same major. We all sat around and discussed, among other fun topics, ebola for weeks. Great class :-)

      --

      "I may not have morals, but I have standards."

    5. Re:ebola ain't no joking matter by Anonymous Coward · · Score: 0

      Mutations can work against these organisms too
      Dont say that you will disapoint a whole genaration of slashdoters still sitting behing an array of crt`s every day instead of switching to lcd`s just to develop an extra arm and super powers! When they realize that they are more likely to develop tumors at random locations, and large spots dead tissue they might switch to lcd`s which are expensive cousing them to move to better paying jobs then the normal oss stuff, like the less ethical sofware development stuff, would you damn biologist thing of the harm to the "software ecosystem" before making the stupid and completly unfounded claims.

    6. Re:ebola ain't no joking matter by dachshund · · Score: 1
      Ebola is terrifying, but it's not all powerful. Any kind of pathogen has to balance infectivity with lethality, and Ebola is too far on the lethal side to be massively infective right now, thankfully.

      Every virus expert whose work I've read takes the prospect of a global Ebola outbreak pretty seriously. So far the thing has been limited to a relatively small number of people and places by sheer luck and geography. If it did get begin spreading via the air transit system, it could kill millions of people. Yes, it probably wouldn't wipe out more than a few percent of the world's population... But that's not comforting.

    7. Re:ebola ain't no joking matter by Anonymous Coward · · Score: 0

      On the other hand though,
      what if the terrorists of september 11th had just stuck a bag containing ebola samples in the middle of an airport somewhere,

      There'd be pockets of it all over North America.

      It is ineffective in some ways because of the limited distribution due to the extrodonaraly low time-to-death from infection, but if a mass distribution system (ie flights all over the place) were used I think that we'd be in a lot of trouble.

      Of course though, engeneering virii does have the positive aspect as well. Its just a question of whether the positive outweight the negative, and even if the negative outweighs the positive are we willing to leave it alone knowing that someone else will probably work on this anyway without our help?

    8. Re:ebola ain't no joking matter by Anonymous Coward · · Score: 0

      Its too old to find an article, but actually there was an ebola outbreak/scare near DC maybe 15 years ago (not sure exactly when). Apparently a monkey brought in for experiments to a lab was infected with ebola and a researcher caught it. The building was sealed off and all the people were hospitalized. They pumped the building full of poison to try to kill it all and it didn't spread.

    9. Re:ebola ain't no joking matter by JohnnyCannuk · · Score: 2

      It happened in Reston Virginia and it is what the book The Hot Zone by Richard Preston was about.

      This strain was very closely reloated to Ebola Zaire, the most deadly strain of Ebola. It killsw about 95% of those who catch it. Ebola Reston, however, does not affect humans, only monkeys (where it is 100% fatal, at least in Reston). Lucky for us (the human race) because Ebola Reston is transmitted by air! All other strains of Ebola (and it's cousin Marburg) are transmitted through "exchange" of body fluids such as blood. And, of course, in this context "exchange" means some blood spashes in your eye, gets on a cut in your hand or a patient vomits his liquified inards on you.

      The monkey handlers at the facility did become "infected" with Ebola Reston as their blood shows anti-bodies to it. But no human became sick because of exposure to the Reston strain.

      That's the good news.

      Bad news: nobody knows where Ebola/Marburg lives in the wild. It must have a host that it does not kill but no-one knows what it is. It could be insects, rodents, plants...who knows. Also, as it is highly mutable, perhaps the next mutation will be like Reston, but worse - an airbourne strain of Ebola as deadly as the Zaire strain spread throughout the world by a 757 flying out of Kinshasa to Heathrow and from Heathrow to...well EVERYWHERE. Ebola takes about 5 days to kill. In the bush this means it can usually burn out before it can get established in a big human population. In a major city it could spread fast enough to kill a large percentage of the human population. In Kikwit, the outbreak killed 235 people in a very secluded part of the African rainforest. I shudder to think what would happen if the same virus broke out in New York or Tokyo.

      Given all that, the idea that someone has made polio in a lab is frightening. After all, Ebola is very closely related to the virus that caused measles.....

      --
      Never by hatred has hatred been appeased, only by kindness - the Buddha
  36. The virus and the secret life of apples. by Anonymous Coward · · Score: 0


    I don't care about either. I have yet to solve the mystery of why deer are immune to lime disease from deer ticks and other animals aren't.

    1. Re:The virus and the secret life of apples. by spiro_killglance · · Score: 1

      Lime disease is an autoimmune disease trigged
      by the very weak virus transmitted by the
      deer ticks. Presummibly Deer have been exposed
      to the virus for so long that they evolved a
      slightly modified immunue system or antigens to
      avoid the autoimmune problems.

  37. live virus by Veteran · · Score: 1, Troll

    The definition of stupidity is doing something just because you can, and for no other reason.

    Evidently these people don't understand the difference between 'could' and 'should'.

    Since these ethical idiots have now demonstrated that building an artificial virus is possible it is only a matter of time before someone (since the gnome is available) rebuilds a small pox virus and lets that loose on the world.

    1. Re:live virus by Anonymous Coward · · Score: 0

      The definition of stupidity is doing something just because you can, and for no other reason.

      E.g. your annoying habit of breathing.

  38. In other related news... by Anonymous Coward · · Score: 0


    As i clean out my grain silo, I crush the heads of every mouse I see and mail them to PETA's PO Box in San Francisco, California.

  39. mail order genome by Anonymous Coward · · Score: 0

    This is nothing new. I graduated from college 3 years ago. While obtaining a BS in Chemistry, I took a DNA sequencing class where we learned EXACTLY how to construct DNA chains with proper shielding of the substituatnts (anything other than the N-C-CO chain). This was an undergrad course, people.

    Of COURSE there are going to be mail order catalogues to get these bases. Why go to the extra effort to create your own when you can get pure ones? And this isn't some stupid "science magazine" as has been suggested. These are catalogues that biologists and others can order from to create their own strands from isolated ones(like DNA duplication anyone?) and see the effects of certain genes rather than taking a large sample of blood and sorting out the specific gene they want for instance.

  40. It's Hard by krmt · · Score: 5, Interesting

    This would be a major, major, major pain in the ass to reproduce.

    Doing this kind of work takes a lot of time and skill and equipment. It's not particularly hard to get the stuff, but you do need stuff, and the knowledge to go about doing it, and you're not just going to get that knowledge from nowhere.

    This team worked for 2 years on this, and they are dedicated scientists with plenty of experience in this sort of work. How long would it take one person working in a home lab to start from scratch? Well over two years. If they don't know anything about Molecular Biology besides what they got out of high school (like your LSD-making example) probably at least triple that.

    Everyone is very paranoid about the synthetic virus thing. This is hard work. No, what's more scary is the technology that's been around for three decades or so now, which is the ability to modify existing viruses. Why would someone really go to the trouble to make a new superbug from scratch when they can just use what nature's already done?

    Or do you think that you can do a much better job than evolution has over millions of years?

    Not that there aren't problems with creating superbugs (even Ebola and HIV have major weaknesses) and it wouldn't be easy, but it'd be far easier to modify something that already exists than it would to build something from scratch.

    --

    "I may not have morals, but I have standards."

    1. Re:It's Hard by Anonymous Coward · · Score: 0

      I agree with krmt that it would take education, equipment, and time.

      The "sequence downloaded from the internet" and "mail order supplies" are just silly inflammatory comments. Of course biologists post sequences to databases, many of them public. What do you think we do, have one person read from the paper while another types ATGGTGCCT....?

      And of course we order nucleotides from various suppliers, although they usually ship FedEx rather than the mail. They're not exactly controlled substances. I used to buy shampoo that claimed to contain nucleotides.

      The hard part is that there's more to most viruses than just making the RNA or DNA with the correct sequence. Packaging them correctly so that they can infect a real critter is much more complicated. That's why the authors of this paper infected some mice to prove they had done it.

    2. Re:It's Hard by Anonymous Coward · · Score: 0

      This team worked for 2 years on this

      Of which maybe 101 weeks on failed attempts and 1 week on the final version.
      Now all it takes is leaking out the exact howto for that last attempt.

    3. Re:It's Hard by Anonymous Coward · · Score: 0
      Well over two years. If they don't know anything about Molecular Biology besides what they got out of high school (like your LSD-making example) probably at least triple that.

      You can't possibly be seriously suggesting that a complete novice could synthesize polio out of a Fisher catalog in just six years. Heck it took OBL a decade to plan the September attack.

  41. That would make a gread science project! by Anonymous Coward · · Score: 0


    To make an application that constructs actual living virii to be injected into a Microsoft Windows system using an infected floppy disc, CDROM, or internet connection. Uhm, doesn't such a tool already exist? It's called MS Macro Assembler...Ahh, now i remember...

    1. Re:That would make a gread science project! by Anonymous Coward · · Score: 0

      Get back with the rest of your herd.

  42. Gee, at least the method is really secure.. by zytheran · · Score: 1

    "Responding to criticisms that such research could lead to bioterrorists engineering new lethal viruses, the scientists behind the experiment said that only a few people had the knowledge to make it happen."
    Well this makes me feel safer because we all know so well how security through obscurity works. Just as well only a few chemists know how to make ecstasy too, otherwise all sorts of undesirables would be making illegal drugs, and we know that doesn't happen either. It's not as if anyone can get the recipe for that of the internet either. And of course, middle class people fighting for a cause would never bother getting degrees in biochemistry. (or learn to fly jets) Is there any sort of weird maths that allows for individuals to have really high IQ, and all IQ's to be positive, and yet overall the mean appears to be negative??

  43. Things to think about... by Anonymous Coward · · Score: 0

    Has the smallpox virus been sequenced? If so,
    eradicating it in the wild doesn't really elimanate
    the threat, since someone could simply download
    the code and fire up the old dna sequencer. Yikes.

  44. They *think* they made an exact copy... by pstav · · Score: 4, Interesting
    But a slight change in the molecular make up of the man made Polio renders this new virus unrecognizable to the antibodies devoloped by the Salk vaccine.

    Be very afraid...

    1. Re:They *think* they made an exact copy... by Anonymous Coward · · Score: 0

      Yes, 27 bits were changed as markers. This made the virus much LESS virulent; but the antibodies are the same.

  45. Wasn't AIDS the first? by lems1 · · Score: 1

    For those who believed that AIDS was engineered in a lab, now have prove that this can be done. And who knows, maybe they were right!!
    Now I'm really scare; I'm putting a condom to my monitor right now!

    --
    This sig can be distributed under the LGPL license
    1. Re:Wasn't AIDS the first? by Anonymous Coward · · Score: 1, Informative

      You really think anyone on this planet has the skills to build something as complex and shape-shifting as HIV? You've got MUCH more faith in human bioengineering abilities than I do.

    2. Re:Wasn't AIDS the first? by Anonymous Coward · · Score: 2, Insightful


      This proves AIDS could've been engineered?
      And, the existence of fighter jets today proves that Napolean had them too, I guess.

      Technology has come a long way. And you may be interested to know that there is speculation that AIDS killed someone as early as 1955. 1955 was also the year that DNA was discovered. Do the math.

    3. Re:Wasn't AIDS the first? by orthogonal · · Score: 1

      Er. Watson & Crick proposed their model of DNA in 1953, not 1955.

    4. Re:Wasn't AIDS the first? by user32.ExitWindowsEx · · Score: 1

      They want you to think that DNA was discovered then.............

      --
      "Evil will always triumph because good is dumb." -- Dark Helmet
  46. Information wants to be free... by sterno · · Score: 1

    Well folks we are pretty much screwed if this becomes possible for the average person to do. The fact of the matter is that no matter what, this information will get out and eventually somebody will use it.

    --
    This sig has been temporarily disconnected or is no longer in service
  47. Methods not suprising by rockrat · · Score: 5, Insightful

    That these scientists downloaded their instructions off the net and used ordered the sequence mail order is not at all the shock that this story portrays it as. Virtually every common technique in molecular biology can be accomplished with a pre-made "kit" from one of several major vendors (e.g. Sigma, BioRad, Qiagen). These kits contain all the necessary reagents and instructions for completing the procedure. Most of the companies that produce these kits also post the instructions on their websites in case you loose the printed copy. Any trained molecular biologist would have a pretty easy time recreating the "kit" from the directions and the ingredient list.

    As for getting DNA by mail, that's standard practice at most research labs I've been involved with. It's more expensive than producing it yourself, but a hell of a lot more convenient. Many universities even have their own, "in house", sequence generation facilities that labs interact with by, you guessed it, inter-departmental mail.

    I'd say the poster of this story was taken by the shock value of these statements (and perhaps they are more shocking in our terrorist-paranoid times), but in reality, there's nothing to be suprised by.

    1. Re:Methods not suprising by genesplicer · · Score: 4, Informative

      Getting DNA by mail certainly is standard practice these days ... Some of the suppliers I've dealt with in the past include IDT [http://www.idtdna.com], Oligos Etc. [http://www.oligosetc.com/], and Operon (a subsidiary of Qiagen) [http://www.operon.com/] ... Orders are accepted by phone, fax, or email - have your credit card ready (I'm being totally serious) ... Plus there's usually even locally owned and operated "Mom-and-Pop" style oligo shops around where there's a market ...

      In fact, it's now gotten to the point that it's way more economical for small and medium sized labs to order out, rather than doing their own synthesis ...

      --
      Me? Debunk an American myth? And take my life in my hands?
    2. Re:Methods not suprising by gargle · · Score: 2

      That these scientists downloaded their instructions off the net and used ordered the sequence mail order is not at all the shock that this story portrays it as. ...
      Any trained molecular biologist would have a pretty easy time recreating the "kit" from the directions and the ingredient list.


      Well, that's the whole point - it's not difficult to do, and someone has finally done it. Terrorist groups can assemble their own viruses - no need to gain access to actual viruses which may be tightly controlled.

    3. Re:Methods not suprising by Zurk · · Score: 1

      yeah but the combination process to actually build the virus from raw DNA is hellishly complex.
      See their paper in which they point out 2 YEARS and $300,000 from a DARPA grant was used to build it. not something someone can do overnight in a basement using a $10K budget.

      Cello, J., Paul, A.V. & Wimmer, E. Chemical synthesis of poliovirus cDNA: Generation of infectious virus in the absence of natural template. Science published online, doi:10.1126/science.1072266 (2002).

    4. Re:Methods not suprising by Wah · · Score: 2

      See their paper in which they point out 2 YEARS and $300,000 from a DARPA grant was used to build it. not something someone can do overnight in a basement using a $10K budget.

      In the future, only the 5 richest kings of Europe will be able to affort computers.

      --
      +&x
  48. A typo, surely? by Simon+Garlick · · Score: 1

    I'm guessing that the text is meant to read

    "...used gene sequencers from a mail-order supplier..."

    1. Re:A typo, surely? by Morf · · Score: 2, Informative

      No, they mean sequences.

      You send off to a mail order place asking for a DNA sequence AGTTGTTGTTACGTT (or whatever), and they send you back 2uL of it in solution.

      This has been pretty standard ever since I did my genetics honours work (1993).

      --
      -- Why should I question authority?!
    2. Re:A typo, surely? by Simon+Garlick · · Score: 1

      Wow. Oh well, consider me better-informed now. Thanks for clearing that up :)

    3. Re:A typo, surely? by pagel · · Score: 1

      Not - not a typo, just poorly phrased: What they actually ordered was DNA. You send the company the sequence ant they synthesize a strand of DNA for you.

      --
      Signature under construction
  49. Seriously... by Jim+Norton · · Score: -1, Flamebait

    What a bunch of assholes ...

    I can just see some dickhead scientist now:

    "Huh huh huh. Let's make the AIDs virus and distribute it to Africa. Huh huh huh. That would rule ... huh huh.."

    --
    -- Jim
  50. More details at Science and Nature by mallorean · · Score: 4, Informative
    Science (subscription required)and Nature have more details. The citation of the paper is

    Cello, J., Paul, A.V. & Wimmer, E. Chemical synthesis of poliovirus cDNA: Generation of infectious virus in the absence of natural template. Science published online, doi:10.1126/science.1072266 (2002).

  51. Aback into thy portal of darkness yonder poop deck by SlashdotTroll · · Score: -1, Offtopic


    # smbmount \\TROLLTECK\\16BITLOSER -U JiminyH4x0r ${HOME}/mnt/mranderson

    # cd ${HOME}/mnt/mranderson
    # rm -Rf --overly-pedantic-booming-godly-voice * &
    # cd /opt/coffeepot
    # ./insert -columbian; ./grind; ./saturate; brew
    # xbill

    --

    I am the nightmare of nightmares.

  52. Is it really from scratch? by leighklotz · · Score: 3, Insightful

    I can understand that the virus was created from scratch in the sense they it didn't come from mammalian cell infected by another polio virus, but my guess is that it is not from scratch in the sense of making a biological thing out of stuff from a chemistry set, because the "reagents" used in the process almost certainly had biological origin in their manufacturing.

    Can someone familiar with the process comment on the source of the reagents?

    1. Re:Is it really from scratch? by Anonymous Coward · · Score: 0


      All they needed was the four base molecules of DNA: A,C,G,T. These are found in most every life form on the planet, and can be ordered from any biological supply company.
      (If you really want to debate the term "from scratch", perhaps you should start with those cooks who use flour from the store - rather than growing and grinding it themselves - oh wait - but they didn't even make the plant.)

    2. Re:Is it really from scratch? by leighklotz · · Score: 2

      How did they assemble the bases? Not with tiny tweezers. They use chemicals called "reagents" that are complex, and to my understanding biologically derived.

    3. Re:Is it really from scratch? by h3 · · Score: 1

      Well, I think polynucleotide synthesis is purely chemistry in that no biological 'reagents' are need. In other words, you can make RNA completely "from scratch".

      However, as hinted in the Nature summary linked elsewhere, the raw RNA was first thrown into an in vitro translation mixture, which is a biological extract containing all the components of the translation machinery. This machinery translated the viral RNA,creating the viral proteins which then further replicate the RNA and then assemble into particles.

      These particles are harvested and that was what was used for the infection study.

      So, you can't get infectious materials in this case without a biological "reagents". It will be a long long time (if ever) that we're able to synthesize an entire virus particle- the polypeptide synthesis issue is a lot more complex than for polynucleotides due to folding.

      What I don't get is how they got a 7500 base RNA molecule. That seems awfully long to be able to just order from a oligo shop. Has efficiency and yield gone up that much in the past 5 years? Anything over 100 bases was unrealistic back in my day.

      -h3

    4. Re:Is it really from scratch? by pagel · · Score: 1

      Of cause some biological tools like the reverse trancriptase used to generate virus RNA from the DNA template are involved in the process.
      But that is not the point. The virus was assembled in vitro (or from scratch) but it was not designed from scratch - actually not at all: They used the known sequence of the virus, had a DNA template synthesized, made RNA from it and in vitro translated the RNA into virus proteins. All that is pretty easy to do and doesn't require much more than the "mail order kits" that have stirred people up so much here.
      After having generated all those virus components you have to assemble an actual virus from the parts - the simpler the virus the better the chances that it assembles more or less spontaneously at this point.

      --
      Signature under construction
    5. Re:Is it really from scratch? by Anonymous Coward · · Score: 0

      Ummm .... time to go back and study your Mol. Biol. 101 book. Reverse transcriptase transcribes RNA into DNA, not the other way around. What is used is an RNA polymerase, which transcribes the synthetic DNA into RNA, which is then translated to produce the viral proteins.

    6. Re:Is it really from scratch? by h3 · · Score: 1


      Nevermind the last paragraph - I miss understood the process. I thought the article was novel technically, but it appears that they just created a DNA clone, ripped RNA off it, and use that to generate virus. While not novel technically, it is novel conceptually.

      -h3

  53. I'm a Prophesor for a large Fortune 1,000 company by Anonymous Coward · · Score: 0

    and i say you should prepare to eat crow because nobody with a BS could construct a dna chain without the use of tinker toys.

  54. why is this suddenly so scary? by heby · · Score: 2, Insightful

    biologists have been able to insert additional genes and knock out genes in organisms for quite a while. while this is the first time they've completely synthesized a virus, as real geeks of course you know that reinventing the wheel might be a good exercise but is hardly ever the most efficient way of reaching a goal - a bioterrorist / military would therefore never build a virus from scratch to use it as a biological weapon but use a perfectly working virus from the wild that already has the ability to infect human cells and maybe alter it to reach the "desired" effect. the techniques needed for that have been the microbiologists' bread and butter for years.

  55. Shades of Jake Brundlefly by gelfling · · Score: 3, Funny

    Do it yerself gene sequencing...ooops

  56. Poor Dr. Wimmer... by Anonymous Coward · · Score: 0

    Somebody should engineer him some eyebrows so that the journalists don't have to paint them onto his head after the fact.

  57. poor mice. by jasontheking · · Score: 1

    What's the biggest killer of labratory mice?
    .
    .
    .
    .
    .
    .
    spoilers below
    .
    .
    .
    .
    answer: scientists!

    1. Re:poor mice. by Anonymous Coward · · Score: 0

      Actually, scientists are in danger of becoming the second biggest killer of mice. The technicians that cHange racks and Leave Several mice in a rack to die of starvation or get cooked in a cagewashing machine are responsible for 30% of deaths at a particular research lab. Cover-ups are done at a lower level (sub-director), as firing is the least of their worries in some cases.

  58. Cool by Anonymous Coward · · Score: 0

    Karma: "Excellent"?

    ROFL. So much for gaming the Kap.

    1. Re:Cool by Anonymous Coward · · Score: 0

      Mine's excellent too!

  59. Now all we need... by DarkHelmet · · Score: 1, Troll
    ...is a "virus" that straightens teeth, removes the drawl from people's voices, and causes family trees to start having forks. Either that, or kills off people with those qualities.

    Gawd, I hate talking about suicide.

    --
    /^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
    1. Re:Now all we need... by Anonymous Coward · · Score: 0

      ...is a "virus" that straightens teeth, removes the drawl from people's voices, and causes family trees to start having forks. Either that, or kills off people with those qualities.

      Better yet: let's just replace all the world's cities with glowing craters, or just put big domes around them so the only people who get to eat are those who still know how to produce food.

    2. Re:Now all we need... by Anonymous Coward · · Score: 0

      I think we need one that kills off elitist snobs who'd have no food to eat without the people whose accent they sneer at.

  60. Yeah, right by Anonymous Coward · · Score: 0

    What Pharmaceutical company is going to develop a self replicating cure for something? These people don't want to develop cures, they want to develop treatments. Expensive, patent protected treatments that you have to pay for over and over again...

    1. Re:Yeah, right by Ozmel · · Score: 1

      There are PLENTY of other diseases and disorders going on in the medical community that a beneficial virus would not cause any concern about profits. Consider the number of rhinoviruses known currently, approximately 350-how much money would that make if we were able to design an "anti-virus" to each one, not to mention the number of mutants that would evolve (let's not even consider the possibly hundreds/thousands of HIV variants). I'd love to have a slice of THOSE profits...give me a break on the cause of side-effects. The FDA doesn't even allow horrific side-effect drugs on the market, if bad only for a short time until a better one becomes available. Do you think there's a hidden conspiracy here among scientists (these are usually broader-minded people) to develop drugs that give you more disease so they make more profit? You've been reading too much fiction. Too much funky issues happen naturally, for humans to better that portion of experimentation with drugs.

  61. Genetic Recombination Lab in highschool by bsDaemon · · Score: 2, Funny

    in my AP Biology class we made a strain of e.coli that was resistant to the antibiotic ampicilin. That was pretty fun. We also got them to turn green when they broke down lactose (or glactose...which ever is bigger...i forget).
    I guess this is more impressive though. I want to be a bio major in college, so i hopefully will get to do some neat stuff like this.

  62. The reasoning: by Slur · · Score: 2

    Viruses are going to be extremely useful as vectors for genetic and cellular therapies in the future, to deliver therapeutic genetic material directly to the cells that need it.

    While it is certainly possible that a designer virus might escape the laboratory, unless the virus was designed specifically as a deadly agent and endowed with the kind of viability inherent in naturally-evolved viruses there is no reason to believe that such viruses can or will be worse than those already existing "in the wild" which have had complete freedom to evolve for millennia.

    In the future this technology can and likely will become a weapon in the hands of power-hungry individuals. Whether that future is near or far seems to me rather irrelevant. Humanity's lessons come in their due time, no sooner and no later. There might be some comfort in the fact that these technologies are being pursued, at least initially, in consideration of their benefits, by individuals in relatively free and rational non-hostile nations.

    The cliche holds true: With great power (and knowledge) comes great responsibility! Those of use who do not control these technologies must learn to exercise faith. Not faith in mankind to act infallibly (or even responsibly) but faith that whatever comes is ultimately for our benefit in this continuum.

    --
    -- thinkyhead software and media
  63. Sounds like.... by nochops · · Score: 2

    Sounds like the script kiddies of the microbiology world.

    They just took ready-made, off the shelf parts & put them together

    --
    "A terrorist is someone who has a bomb but doesn't have an air force." -William Blum
  64. Security through obscurity? by BlowCat · · Score: 2

    I have a depressing feeling that my body is less secure than old Outlook Express, yet I cannot upgrade it. Until we have a patch, the vulnerability should not be disclosed :-)

    1. Re:Security through obscurity? by mikeee · · Score: 2

      Not at all, you have multiple security monitors/tripwires/firewalls/virus scanners running. The human immune system is fiendishly complex and quite ferocious.

      Now, you can't upgrade the OS without trashing your filesystems, which is kinda sad, and there's no viable backup mechanism...

  65. Homo *nix? by Anonymous Coward · · Score: 0

    Homo *NIX.

    hahahahahahah!
    You said it, not me...

  66. Did these guys create "life"? by VValdo · · Score: 3, Interesting

    There is an ongoing question of whether or not viruses are "alive". Clearly the fragments of DNA used to reconstruct the polio virus aren't, right?

    If the "frankensteined" (a good word here) polio virus replicates and acts in other ways like a regular virus...

    Did these guys create life from lifelessness?

    W

    --
    -------------------
    This is my SIG. There are many like it, but this one is mine.
    1. Re:Did these guys create "life"? by bruthasj · · Score: 1

      I'm not even a geneticist and I can create life from lifelessness... You just have to trace the composition back far enough. Hey, we're all made from dirt.

    2. Re:Did these guys create "life"? by LS · · Score: 2

      The reason this question has not been settled unanimously is because it is a flawed question. "Life", just like any other definition, such as "America" or "body" or "good" is just a definition. There there a true "essence" that defines "life" to make it absolute. Some consider the entire earth to be a living organism (Gaia). Some consider the entire universe to be an organism (God). Some consider nothing to be alive, but just atomic processes exhibiting emergent phenomena, and the definition of life is an arbitrary boundry.

      There is not an absolute definition of life... We are asking to define life by deciding whether a virus is alive or not.

      LS

      --
      There is a fine line between being a cultivated citizen and being someone else's crop. - A. J. Patrick Liszkie
  67. Immortality by b0bd0bbs · · Score: 1

    This + This = Immortality. All you'd have to worry about from there would be disease/walking in front of a MAC truck.

  68. Pure BS - here's why by Anonymous Coward · · Score: 2, Interesting


    1) "While rare, sporadic case reports of AIDS and sero-archaeological studies have documented human infections with HIV prior to 1970"
    http://www.avert.org/his81_86.htm

    Why wasn't it identified earlier? It's extremely easy to imagine a situation where hundreds or thousands of Africans were dying of AIDS for decades, though no one knew what they were dying from. It wouldn't have caused a great deal of alarm because deaths would be sporatic (occuring years apart) and deep inside the least medically advanced continent on the planet.

    There is even some speculation about deaths as early as 1955 from AIDS, though no one is entirely sure if the "mystery disease" that killed back in 1955 was actually AIDS.

    2) AIDS exists in chimpanzee populations, too. It is a different from the strain found in humans.

  69. Mail Order Gene Sequences by CaptainCarrot · · Score: 4, Funny

    They should be very, very careful. You never know what might happen with mail-order gene sequences, or genetic material from eBay or such places.

    --
    And the brethren went away edified.
  70. Just a quote from my biology teacher... by Jugalator · · Score: 1

    He once said something similar to "The more details you get to know about the HIV virus, such as its defensive mechanisms and "polymorphic" behavior, etc, the more it seems like it was created by humans. In a sense, it looks like it's too complex to have been made by nature's randomness."

    I can do nothing else than agree with him, but who knows...

    --
    Beware: In C++, your friends can see your privates!
    1. Re:Just a quote from my biology teacher... by Anonymous Coward · · Score: 0

      A gift (via time travel) from a dystopic future where the planet is overpopulated perhaps? According to stats, the AIDS plague isn't slated to hit its peak until 2060. A lot of bodies are gonna go in the ground between now and then.

    2. Re:Just a quote from my biology teacher... by orthogonal · · Score: 2, Insightful

      I believe (English biologist and popularizer of science) Richard Dawkins refers to this logical fallacy as "the argument from personal incredulity". It's often used by creationists, as for instance, "I can't believe an organ as perfectly suited to its function as the eye was created without intelligent design", or "since each particular species of fig is fertilized by a particular species of fig-wasp that can itself only reproduce in its species of fig, I can't conceive of how new species of either fig or fig-wasp can evolve."

      With all due respect to your biology teacher, it seems that Hamlet was right:
      There are more things in heaven and earth, Jugulator,
      Than are dreamt of in your teacher's philosophy.

      Furthermore, a biology teacher ought to understand that evolution is NOT "nature's randomness". While a mutation may be randomly produced, evolution works AGAINST randomness -- and works precisly because it defeats randomness by conserving what is useful, and discarding what isn't.

      If the AIDS virus is too complex for your teacher to believe it to be natural, what must he think of human origins?

      I myself "can't conceive" how a mix of carbon, hydrogen, oxygen, and nitrogen networked via electrical pulses, can possibly become self-aware. Yet I see examples everyday, and even occasionally on slashdot. And I don't go looking for an intelligent designer.

    3. Re:Just a quote from my biology teacher... by pagel · · Score: 1

      It is sad to hear nonsense like that from a biology teacher! If he can't believe that a simple thing like HIV was "made" by evolution how does he explain human beeings - creation? You don't live in Kansas, do you?

      --
      Signature under construction
  71. Who's afraid of a Nuclear Genie besides the media? by Kaz+Riprock · · Score: 2, Insightful
    Scientists could not keep the nuclear genie in the bottle

    So what? Name one other country besides the US that has used a nuclear weapon on its enemy.

    Bzzt, time's up.

    The science to design a biological virus from scratch has been out there for over two years. Of course, nobody's gone about doing it other than these guys. There are enough loose ends in your typical high-level biohazard lab to give any wacko with a postage stamp the ability to mail you hepatitis, anthrax, or influenza. They don't need to mail order the parts and put it together at home.

    --
    Mordor...a magical, mythical land where women are more rare than dragons--but where every man would rather find a dragon
  72. Basically, we are fucked... by Anonymous Coward · · Score: 0

    What this means is that new viruses which

    A.) There is no natural human immunity
    B.) No research base
    C.) Rapidly mutate and infect easily

    can be synthesized. Viruses like ebola and HIV could be made more contagious, virulent and prone to mutation. I think what's worse is that new virii can be synthesized (worse than anything we have now). It's only a matter of time before such a virus takes out a huge chunk of the world's population. I wonder what Charles Darwin would think of this news.

    1. Re:Basically, we are fucked... by Anonymous Coward · · Score: 0

      There is no such word as "virii".

  73. "just-like-sea-monkeys" department? by Anonymous Coward · · Score: 0

    BANJOOOOOOOO!!!!!!

    1. Re:"just-like-sea-monkeys" department? by Tablizer · · Score: 2

      Those Sea Monkeys are the greatest marketing gimmick ever.

      Almost nobody would buy them if the box said, "Mini-Shrimp Farm. Grow your own ugly pale little shrimp!"

      The marketing deparment might be a-holes, but only an expert a-hole could BS people like that.

      Microsoft should hire them to do something interesting with BSOD's. Make them *want* BSODs.

  74. According to RZA of the Wu-Tang Clan by Anonymous Coward · · Score: 0

    AIDS was the first synthesized virus :

    Yes, the Wu-Tang's RZA broke this news some years ago ::

    Wu-Tang Clan

    America Is Dying Slowly

    ...

    [RZA]
    My nigga Chuck, he loved to fuck
    Everything, exotic bitches down to ugly ducks
    Like Nancy, who liked the fancy tickles
    So he put popsicles on her nipples
    To make her sex passion triple quadriple, until she bust
    Overcome with passion, big ass want lust upon him
    But nigga he forsake to grab the condom
    Fuck it, he said AIDS was government made to keep niggaz afraid
    So they won't get laid no babies be made
    And the black population will decrease within a decade
    German warfare product against the dark shade

    [Raekwon]
    AIDS kills, word up respect this, yo
    Comin from my crew, it's real
    AIDS kills, word up respect this, yo
    Comin from the Wu, it's real, yeah

    1. Re:According to RZA of the Wu-Tang Clan by mabinogi · · Score: 1

      Except that those lyrics are saying that the government created only the fear of AIDS, to scare blacks into not having sex, not that they created the virus itself.

      the Raekwon section is then debunking the idea, saying that AIDS is real.

      Nowhere do they imply that the government actually created the virus.

      --
      Advanced users are users too!
  75. Wow...something from the US... by Anonymous Coward · · Score: 0

    I'm in the biotech field, and I must say, this is an amazing feat. It's not just some run of the mill thing. From scratch is the real hard part - designing a virus from the ground up. In theory it's easy - in practice hard.

    Unfortunately, because of the current way things are going in the US, this is really the only direction people can go I guess. Stem cell research has been all but eliminated in the US, while countries like Saudi Arabia and China push on (surpasing us as we speak)...kind of sad.

  76. Can't stop science by nukeade · · Score: 2, Insightful

    As scary as this is, and for all the negative implications it has, I have to say that the research must continue, the reason being that it may lead to something positive in the future, such as a universal cure for virii. Remember what happened to Britain before WWII? They banned civilian explosives research and so when the time came Germany was massively far ahead. In the same way, the civilized world must continue their research so that hopefully the good guys have the answer before the bad guys have the problem.

    I just hope I have the good guys and the bad guys straight. Deus Ex was a great game, but I sure don't want it to be real.

    ~Ben

    1. Re:Can't stop science by Anonymous Coward · · Score: 0
      And when it is easy to defend against any virus, it will also be easy to create new ones.

      In 2050, we'll be asking each other if we downloaded the latest pattern files to combat the new AIDS 5 virus that came out last Tuesday.

    2. Re:Can't stop science by Anonymous Coward · · Score: -1, Troll

      There is no such word as "virii". Please stop using it if you want people to take you seriously.

    3. Re:Can't stop science by Anonymous Coward · · Score: 1, Insightful

      Yes, positive stuff in future, and scare bjzus out of us now. That's a good thing. If it isn't sci-fi it should be done under controlled conditions so that everyone knows that it is not sci-fi. Some people think theory means 'made up story with low truth value', so is not enough to say that something could be done 'in theory'. It is sad for the mice, but good we know. Now we know I hope they destroy it. Point made.

    4. Re:Can't stop science by Anonymous Coward · · Score: 0

      To the idiot moderator who rated this as "troll":

      I don't suppose it ever occurred to you to open a fucking dictionary and check before clicking the button?

      Of course it didn't. This is Slashdot, after all.

  77. Well, I've not seen this mentioned yet... by oPless · · Score: 2, Offtopic

    Corewars

    and

    More Core Wars


    and

    Even More Core Wars


    Okay, not virii - but still programs that kill each other are kinda cool :-)

    Whats more is people are evolving these little programs to be better.

    Oh they have a newsgroup too.( google alt.rec.corewar )


    /op

  78. Statistics, Nature, and Suicide Genes by krmt · · Score: 5, Informative
    Are you telling me there is abosoutly no way that a cancer cell will mutate, accept the introdouced virus and create a new hybrid cell/virus that carries the deadly portion and the reproduction capability?
    Nothing is guaranteed in life, especially the science of life. And yes, it is a possibility, but it's far far far less likely than creating a hybrid from a normal, wild type virus. The wild type virus already has the machinery to replicate, and thus is more likely to take the necessary cellular machinery with it.

    And you know what? This has already happened. That's how viruses can replicate inside us now. They have some of the same genes, stolen from host cells long long ago.

    So, you have to ask yourself this: How is what I'm doing any different than what nature itself is doing? It's not really, and in fact, it's far more controllable and less likely to happen than in nature itself. In nature, the virus has less hurdles to go through to create this sort of doomsday scenario you're thinking of. With us, it's got to go through a lot more trouble. It's not impossible, but it's really really unlikely.

    You also have to realize what I mean by "suicide gene". It's not something that will randomly kill whatever cell it's expressed in. We, and many many others, are using a standard gene taken from herpes called Thymidine Kinase (Tk). Humans have a version of this gene too, but it's far more picky than the herpes one. Basically, if you use the herpes gene, you can treat with a prodrug like gancyclovir, which normal human Tk will ignore, but herpes Tk will incorporate in to DNA. This will cause the DNA to be unable to replicate, and the cell will die. Note that this can't happen without administering the drug. The provides yet another major hurdle for the virus to overcome in order to attain its "deadly capability".

    Stop being so scared of what humans are creating. Nature is doing a far better job of finding ways to kill you and the rest of humanity than I or any other molecular biologist could ever hope to devise.
    --

    "I may not have morals, but I have standards."

    1. Re:Statistics, Nature, and Suicide Genes by dnoyeb · · Score: 1

      Actually its nature also that makes us adept at living through Natures nasties.

      As for reproduction being unlikely, exactly how unlikely? 1 in a billion? 1 in a trillion? not good enough.

      All it takes is 1 in x.

    2. Re:Statistics, Nature, and Suicide Genes by krmt · · Score: 3, Insightful

      The problem is that you're thinking of it like a normal, natural virus. It's not. It's really just a hunk of DNA surrounded by a protein capsule. That's what a virus is too, but the difference is that a virus can use you as a host to replicate. This DNA in a capsule can't. It simply isn't able to. It could potentially gain that ability and become Just Another Virus, but then it's just that: another virus, not really any different than the ones that are out there already. No more lethal, no more dangerous, just with a different heritage.

      The scenario that you're envisioning is no different than another piece of DNA gaining the ability to reproduce. Remember, this stuff gets integrated in to your genome when it's used, so it's really about as likely to gain reproductive ability as any other random part of your genome. And in case you've never dealt with the human genome, I'll tell you this: you've got a lot of it, but I don't see you worrying that a mutant p53 gene in someone's cancer will gain reproductive ability and go around infecting people and giving them tumors all over their bodies before spreading to the next victim. This is just as likely, and even more scary.

      --

      "I may not have morals, but I have standards."

    3. Re:Statistics, Nature, and Suicide Genes by bgarcia · · Score: 2
      "I may not have morals, but I have standards."
      I always thought your sig was cool, until I learned that you are A MOLECULAR BIOLOGIST WHO GRAFTS SUICIDE GENES INTO VIRUSES TO PLACE INTO HUMAN BODIES!!!!!
      --
      I'm a leaf on the wind. Watch how I soar.
    4. Re:Statistics, Nature, and Suicide Genes by NorthDude · · Score: 1

      Stop bitching like that, what they are doing could save you from cancer some day. Imagine being able to kill only selected cancer cells?

      I'm not a biologist, but I'm sure that if he is working on the next mass-weapon, he would not post the details on slashdot, don't you think?

      --


      I'd rather be sailing...
    5. Re:Statistics, Nature, and Suicide Genes by bgarcia · · Score: 2
      Dude, I was shooting for "funny".

      Guess I should have put a smiley face on the end, eh?

      --
      I'm a leaf on the wind. Watch how I soar.
    6. Re:Statistics, Nature, and Suicide Genes by NorthDude · · Score: 1

      Well, it's hard here sometimes to discern between jokes and real comments you know.

      Maybe everyone should enclose their comment in XML tags to describe the nature of the content ;-)

      --


      I'd rather be sailing...
    7. Re:Statistics, Nature, and Suicide Genes by naasking · · Score: 2

      As for reproduction being unlikely, exactly how unlikely? 1 in a billion? 1 in a trillion? not good enough.

      And the 100% likelihood of an ordinary virus replicating is better?

  79. two words by liloconf · · Score: 0

    Resident Evil

  80. test by Anonymous Coward · · Score: -1, Troll
    this .is .a .test .of .the .emergency .broadcast .system .dont .you .like .your .pages .wide .enough .I .certainly .do .thats .why .pages .should .be .wide .because .slashcode .has .a .regression .bug .in .it .it .sucks .the .big .monkey .nuts
  81. There's A Reason Why Genes Are Conserved by krmt · · Score: 3, Informative

    Why do you say that?

    My understanding of the poliovirus is that it's protein capsule is very highly conserved. The gene for its pieces is actually one polyprotein which is cleaved after the pieces interact. The pieces of the each subunit have to fit together perfectly, and altering the genetic structure of the gene can destroy those interactions, making it impossible for the virus to assemble correctly.

    So the antibodies will probably be just fine. Besides, the Salk vaccine is heat-killed virus anyways, so you could probably apply the same treatment to your mutated virus, and have an effective vaccine. Or, since you know the makeup of your synthesized original, you could mess around with its genetic structure and create a live attenuated vaccine (another type which exists for polio, and can be more effective).

    --

    "I may not have morals, but I have standards."

    1. Re:There's A Reason Why Genes Are Conserved by Anonymous Coward · · Score: 0

      Whoa now, you didn't expect a slashdot poster to understand the field he was commenting on did you? ;)

  82. Uhhh... by Goatse+Pez+Dispenser · · Score: -1

    Hey, check THIS OUT!!!

  83. As huge as the the problem by purduephotog · · Score: 2

    What happens if you cross a chicken virus with a human virus?
    You get the next plague.
    Those that understand my comments will remember the China scare from 2 years ago. Those that don't will think this is offtopic.
    Just because the virus doesn't reproduce doesn't mean it can't transfer it's genetic payload to something that does.

    1. Re:As huge as the the problem by krmt · · Score: 3, Insightful

      This is very true (you're thinking of influenza by the way) but the thing about the chicken strain is that it was able to reproduce in areas other than the upper respiratory tract, where the human influenza virus is stuck in. Mixing the human genes with the chicken ones allowed the new strain to reproduce in any human cell, which would have killed scores of people.

      This is a very real danger, but how does this change anything related to the technology? With the old technology, you could have easily done this by hand, rather than synthesizing from scratch, you could shuffle a bunch of coinfected influenza viruses around until you got what you wanted, essentially speeding up the natural process. You could also modify the existing virus to do this.

      Just like nature did in creating the Influenza strain you're talking about.

      --

      "I may not have morals, but I have standards."

  84. Re:I'm a Prophesor for a large Fortune 1,000 compa by Anonymous Coward · · Score: 0

    Fortune 1,000 companies don't hire "Prophesors". They sometimes hire scientists, but that's an entirely different thing.

    What you are is an idiotic troll. And it's past your bedtime.

  85. Nothing to fear, everything to fear by evilpenguin · · Score: 2

    I'm no virologist (or biologist for that matter), but it seems to me that there is nothing to fear here. Why would a bioterrorist "do it the hard way" when there are plenty of naturally ocurring and lethal pathogens out there? In fact, this kind of biotechnology is our best hope of a real defense against such weapons.

    Biological warefare was practiced in ancient times. Even though they had no real disease theory, they know that hurling diseased corpses into walled fortifications would spread disease. They new that fouling water upstream of a city would spread disease. They did all this with no scientific knowledge of biology or pathology whatever.

    Bombs are easier than bugs. Planes are easier than missiles. Radiation and disease are only probable attacks because of the primal fear they create. Biotechnology offers the best hope of defense against the latter (and maybe even a cure for the effects of the former). We need to know much more, sooner, not later.

    1. Re:Nothing to fear, everything to fear by cosmicrecursion · · Score: 1

      I couldnt agree more. The problem is of course, that as we are studying defences/solutions, etc.. we are also creating attacks and problems. In our studies and explorations, we are showing them how to build the bomb. The question is.. in knowing such a thing... do you still move forward?

  86. Re:Aback into thy portal of darkness yonder poop d by Mode0x13 · · Score: -1
    I have trolled the trolls. Beautiful.

  87. You don't need a virus to paralyze and kill mice by Valen+Faerlwynd · · Score: 0, Flamebait

    How do they know they didn't just create some sort of neuro-toxin? All they did was assemble the same basic "components" which made up the original virus. You could do the same thing with human body (admittdly with much more effort), and all you're essentially getting is a stack of carbon-based junk.

    The distinguishing factors between a stack of carbon-based junk and a human being still elude me.

    Love and Peace,
    Valen

    --
    "The best compliment a girl ever gave me was 'Your hair smells nice.' I hate being the platonic friend." -Valen
  88. Smallpox Virus by xSterbenx · · Score: 3, Interesting

    The funny thing, the sequence for smallpox has been available for quite some time at NCBI (National Center for Biotechnology Information, as are the sequences for at least 2000 viruses and phages (per my last count).

    I'm all for public knowledge of such sequences if they lead to productive research in the areas of disease control. However, with the current technology of being able to construct viruses from sequence data, it might be prudent to restrict such data to only respectable research centers.

  89. ALERT! Manhattan gets infected! by grunby · · Score: 2

    I see it happening every weekend in NYC, but I'm sure it happens elsewhere. Let me explain my findings.
    I've found that people between the ages of 19 to 30 are most likely to be infected by this virus. It usually always happens after drinking at bars or clubs. I even have been infected by this dastardly virus. After having quite a few beers and vodka cranberries, I've been know to get infected by virus that I've been calling the ILOVEYOU virus...It's usually only communicable to people of the opposite sex, unless you travel to the village. The more you drink, the more apparent this virus becomes. Good thing is that it usually lasts only about eight hours before it's effects wear off.

    I'll get to the bottom of this. Will report back with more information on Sunday.

    - grunby

  90. Re:You don't need a virus to paralyze and kill mic by Anonymous Coward · · Score: 0

    How do they know they didn't just create some sort of neuro-toxin?

    Because they're trained scientists and you're not.

  91. Notes from an Ex-molecular biologist by dexter+riley · · Score: 2, Informative

    IWAMB (I was a molecular biologist, until I discovered programming paid better, at least before the last round of layoffs...)

    This news should not be surprising. The technology to synthesize multiple large genes has been around for years; and it has been known that the pieces could be combined in a host cell to yield whole, infectious virions. The novel thing here is that somebody has combined the two technologies, creating the polio genes synthetically before putting them into a host.

    Two older articles describing the combination of cloned viral genes in vivo to make infectious virus are:
    This article showed that the bovine herpesvirus genome could be cloned into a bacterial vector, maintained indefinitely, then reintroduced into cow cells to produce active virions.
    This article showed that infectious rabies virus could be produced by putting cloned rabies genes into a suitable host.

    Nowdays, if you have a gene sequence, you can synthesize it in pieces and assemble it (with modifications, if you choose) with PCR quite easily. You don't need any source material from the original organism. I synthesized a small gene from scratch myself, once, back when I was an underpaid M.S. in a biotech company.

    Of course, I never tried this with a whole FREAKIN' POLIO VIRUS!!!!! WTF!!!! Didn't these guys ever read "The Stand"?!

    -dexter ("Don't Fear the Reaper", my ass) riley

  92. Re: high level by fferreres · · Score: 3, Insightful

    Now it all looks like low level "programming". How long until there's enough research so that scientists can start using high level languages for this?

    It may sound stupid, but that's also what some hackers though about C or anything 20 years ago. Or even now (compiled vs. interpreted).

    --
    unfinished: (adj.)
  93. Tools Still Need Knowledge by krmt · · Score: 2

    The way these scientists did this was actually fairly "high level". They ordered premade genes (read: libraries or objects) from the mail and pieced them together correctly. Obviously there's a lot more to it than that, but that's the gist of it. The problem is that it still takes a lot of skill and knowhow, as well as time and energy to do this.

    No matter what, you're still going to be cutting up DNA and splicing it together using enzymes.

    No matter what, you've got to make sure you have enough DNA, which means either amplification by PCR or growing it up in cells and isolating it.

    No matter what, you need to confirm what you've got, which takes more enzymes, gel equipment, and a good working knowledge of the sequence.

    No matter what, you'd have to package it in to a virus, something that's not easy even with today's kits.

    All of this can be done using "high level" stuff, kits for PCR, cloning, amplification, and isolation exist. You still need to understand what's happening, unless someone sends you a ready-to-make polio kit, you still have to know how to use the stuff. Having all of these tools lying around won't make the virus the same way having a copy of the gcc won't make you a programmer. You have to know how to use the tools.

    --

    "I may not have morals, but I have standards."

    1. Re:Tools Still Need Knowledge by fferreres · · Score: 2

      I really meant "high level". As an example (imposibly simple and uneducated, but to ilustrate the point):

      <?php
      // As high level as it gets

      include "ebola.db";
      include "hapinnes.db";

      $replication = grow(stablilize(splice(ebola.dna, 5, 7, soup(5,7,12))));
      if($hash = confirm($replication)) {
      simplify($replication, MatterLaw_Method5(4,$hash));
      } else {
      echo dump_analisis($replication);
      }
      $done = complement(replication => $replication, * => $hapinness);
      package($done);
      print($done, "DNA_Printer1", 50);
      ?>

      Or nothing at all can be abstracted?

      --
      unfinished: (adj.)
    2. Re:Tools Still Need Knowledge by krmt · · Score: 3, Interesting

      You're very right, biology can be more abstracted, up to a point. If someone decided to place a bunch of virulent genes on a single plasmid, or just took one from one of the bacteria that already have them, and simply put a multiple cloning site (a piece of DNA that can be cut in multiple different ways easily) in to it and sold it, there's a real big problem for everyone. Then the person using it isn't much better than a script kiddie, but yes it could certainly be abstracted in that way so that the person wouldn't have to know jack.

      But no matter what they'd have to have some basics down, like how to run a gel or transfect bacteria. Not hard stuff, but they'd have to know how to do it. The more and more stuff people build up, like the antibiotic resistance example, the more abstract it can be, just like today you don't have to write to the hardware, you can use something like Perl. They'd still have to learn the equivalent of Perl to do it, which is no small task in itself, but even today there's no need to go around isolating your own restriction enzymes and such.

      It is very much an engineering question, just like in software. The more complex your library is, the less you have to worry about. There's a lot of premade stuff out there that can be pieced together already. We're not really at scripting language level, but we're well beyond assembly. Things can be absracted, but only to a point. Like if you want to write your own OS, you can't really do it in Perl (or perhaps bash is a better example there, perl is an organism unto itself ;-), and no matter what you're going to have to get down to some assembly at some time or another. Same thing with this. You can do some very basic things now, like make bacteria turn blue, which many high school biology classes do each year (the technology is over 25 years old!) but to do something as complex as synthesizing polio from scratch requires really knowing nuts and bolts. It's all a question of how much you want to do. Something simple? Doesn't take much knowledge. Something really tough? You'd better really know what you're doing.

      --

      "I may not have morals, but I have standards."

  94. Eckard by Anonymous Coward · · Score: 0

    Biotech... virus... Eckard... do these guys work for the GSA?!

  95. Next -- by Jace+of+Fuse! · · Score: 1

    It's MAIL ORDER MONSTERS!

    (do a google search)

    --

    "Everything you know is wrong. (And stupid.)"

    Moderation Totals: Wrong=2, Stupid=3, Total=5.
  96. Killing the host is usually subdued in nature by Tablizer · · Score: 2

    (* Stop being so scared of what humans are creating. Nature is doing a far better job of finding ways to kill you and the rest of humanity than I or any other molecular biologist could ever hope to devise. *)

    My understanding is that most viruses have evolved not to kill their host, otherwise they would shorten the time they can spread themselves around.

    HIV is one of the rarer viruses that *does kill* its host fairly easily.

    If the killer side is mixed in with the easy-to-spread features of say the common cold, then a killer cold could be put on the loose by some Osama-like madman (or madwomen. EOI=Equal Opportunity Insanity).

    1. Re:Killing the host is usually subdued in nature by Anonymous Coward · · Score: 0

      In general, I agree with you in that viruses in nature are disadvantaged by killing their host too quickly, and thus have evolved not to do that. I disagree, however, that HIV is one of the rarer viruses that kills its' host fairly easily. HIV takes years to kill its' host, giving it plenty of time to spread itself from one host to another.

    2. Re:Killing the host is usually subdued in nature by Tablizer · · Score: 2

      (* In general, I agree with you in that viruses in nature are disadvantaged by killing their host too quickly, and thus have evolved not to do that. I disagree, however, that HIV is one of the rarer viruses that kills its' host fairly easily. HIV takes years to kill its' host, giving it plenty of time to spread itself from one host to another. *)

      Well, are "fast killers" possible? If they are, even if rare, could offer sinister ideas for terrorists to combine the killing aspect of those viruses with the easy-to-spread aspects of say cold viruses.

      Are they mutually exclusive, or are there natural structural tradeoffs that prevent that?

      For example, some viruses may have feature A, others feature B. But in nature A and B rarely occure together in the same virus. Are the same laws of structure or nature that prevent AB strains also faced by a human virus designers?

      IOW, nature tends to have different "motives" from terrorists. The terrorists' goal is to kill many humans quickly, and not to ensure/increase the survivle of a virus strain.

      Thus, a human mind may be able to devise something deadlier than nature normally[1] does because it operates under different goals.

      [1] Perhaps every million years or so nature accidently does this.

    3. Re:Killing the host is usually subdued in nature by ShavenYak · · Score: 2

      Well, are "fast killers" possible? If they are, even if rare, could offer sinister ideas for terrorists to combine the killing aspect of those viruses with the easy-to-spread aspects of say cold viruses.

      How about Ebola? Ebola takes a week or two to kill a human, and does it in a quite gruesome fashion. If it could be spread airborne like a cold or flu, it could be the bio-terrorist's Holy Grail.

      Interesting note: The Ebola virus's exreme lethality in primates is probably somewhat of an accident - as was being discussed, killing your host too quickly is an evolutionary disadvantage. Thus, it is assumed that the virus has evolved to inhabit a different host, although this true host is unknown currenrly. There is some speculation that it may be a bat.

      --

      Hey kids, there's only 5 days left 'til Yak Shaving Day!
  97. Alarm by Anonymous Coward · · Score: 0

    I find it really hypocrital that the US is against all the bioterror and whatnot, and now some US researchers have developed a synthetic virus without anyone batting an eye.

  98. bigger than the moon landing ! by freddled · · Score: 1

    Does no one else see how big this is ? Life from nothing, without the chain of other life back to the primordial soup. This is a monumental achievement.

    1. Re:bigger than the moon landing ! by Apogee · · Score: 1

      Hmmm ...
      I know the point is somewhat controversial, but (speaking for myself and my point of view here) viruses are NOT alive.

      They are just a set of instructions (on how to make more viruses) packaged in a protein coat, sort-of like a shrink-wrapped piece of software.

      Viruses absolutely rely on the cellular machinery of the host cell in order to procreate. If there is no host, the virus just lies there, doing nothing.

      Therefore, a virus does not fulfil the definition of life form for me. The best, workable definition of what life is, to me is that metabolism is required. Thus, viruses != alive, and no life was created "from scratch".

      Also, on another note, "without the chain of other life back to the primordial soup" is not quite true, either. The scientists did not create a new species or a completely new virus, all they did was to re-create an exact copy of a polio virus, which very much has that chain attached.

    2. Re:bigger than the moon landing ! by straight-up_bio-geek · · Score: 1

      You are right about this being important, but it is just one of thousands of advancments being made in biotech!
      And do realize that this is far from "life from nothing". Even if they engineered a completely novel organism (here they just did some cut and pasting) it wouldn't be life from nothing. We have the advantage of a code that has been refined over the last few billion years.

    3. Re:bigger than the moon landing ! by Anonymous Coward · · Score: 0

      Sounds like you are describing humans there. Your logic is weird though. Without the sun plants would sit there and do nothing, without food animals would do the same. So aren't they not alive as well? By your logic also, a human clone is not alive, its merely a copy of the original. Dolly and her other sheep friends are not alive? For most people the only way they can tell they are dreaming is after they wake up. Life is like dreaming.

  99. Phew. For a second there, I thought we were toast by torpor · · Score: 2

    It'd really suck if the /. crowd worked out how to make their own Virus...

    (http://www.access-music.de/)

    --
    ; -- the corruption of government starts with its secrets. a truly free people keep no secrets. --
  100. how long before... by Anonymous Coward · · Score: 0

    ... medical companies create and release viruses which they just happen to have a treatment for?

  101. Why does this desperately by GauteL · · Score: 2

    .. make me want to paint monkeys on the walls, pluck out my teeth and travel to and from the past?

  102. 1, 2 , 3 by Anonymous Coward · · Score: 0
    1. Synthetic virus
    2. ...
    3. Profit!
    You Know What You Doing ??
  103. I would say "yes" by mirnav · · Score: 1
    OK so some guys put together some ordinary, inert chemicals together and assembled a *thing* that has a life cycle, moves, AND follows a strategy for its own survival.

    I don't need a complex definition for what life is, in order to call this *thing* alive.

    The difference between this creation and earth, for example, seems to be that the earth does not really have a strategy for survival, no conscious effort for its own good aside from some complex mechanisms that seek balance through adjustments. Really, the people who believe in the Gaia theory would probably believe that the stock markets, even the economy as a whole, is also "a living organism".

    1. Re:I would say "yes" by renoX · · Score: 2

      Hmm, saying that "a virus follows a strategy for its own survival" is a bit too anthropomorfic(sp?) for me.

      I agree with LS here the definition of life is too fuzzy to judge if a virus is alive or not.

  104. Great by Lord+Bitman · · Score: 1

    so how long before we create Super-AIDS to wipe out Regular-AIDS and replace our immune systems with unstoppable terrors which fight off any disease with 100% effeciency?

    --
    -- 'The' Lord and Master Bitman On High, Master Of All
    1. Re:Great by Anonymous Coward · · Score: 0

      The US has to take shit from a guy named Klaus? Fuck off NAZI.

  105. First? Nonsense by Anonymous Coward · · Score: 0

    First? Nonsense.

    AIDS is a biological weapon gone astray, and so is Ebola. I just can't prove it, but I can't prove that God exists (or not) either.

  106. Where to find a sequencer by MADCOWbeserk · · Score: 1

    gene sequences from a mail-order supplier. I wonder if I can find one on Ebay

  107. NO MORE MONKEY BUSINESS by Anonymous Coward · · Score: 0

    NO MORE MONKEY BUSINESS

  108. Why... by neilb78 · · Score: 0

    Why didn't they just write one in VBScript like all the other newbies?

    --
    © 2004 The SCO Group, Inc. All Rights Reserved.
    1. Re:Why... by d2002xx · · Score: 0

      Because it's not funny enough.

  109. What a frickin' waste of flesh by Anonymous Coward · · Score: 0

    I mean... If this guy's trying to impress the world with his ability's, why not work towards a cure for cancer, or aids? Whatever...

    Anything is better than this guy building the polio virus "as proof that we can do it".

    Give me a break... When scientists are getting grants to create potential deadly diseases, and existing deadly threats are going unchecked, something's definately wrong!

    Perhaps this mysterious rash of scientist death's really isn't such a bad thing afterall?

    I could possibly get behind such an effort if it meant that these morons weren't here to breed death for future generations just to prove that they can.

    Idiots... F*cking idiots!

  110. WTF?!?! Why not benign virus? by Sean+Clifford · · Score: 2
    Okay, why the f*ck did they use polio? Isn't there something more benign they could have messed with? Crap.

    [2 scientists smoking crack]
    Scientist 0: What should we make?
    Scientist 1: How about Ebola?
    Scientist 0: Too 'Tom Clancy.'
    Scientist 1: Hmm. Smallpox?
    Scientist 0: Nah. E-Coli?
    Scientist 1: Not cool enough. Anthrax?
    Scientist 0: Been there, done that.
    Scientist 1 & 0: [at once] Polio!

    You have to wonder what the crap goes through these guys minds. I mean, how is this a good idea? I'm all for scientific research and stuff, and yeah I know some of it is dangerous. But this seems to be tempting fate to me. What's the matter with making something *benign*?

  111. Great by KlausBreuer · · Score: 1

    Thanks, gold old US of A! The first fully artificial virus comes from your labs, too!

    I'm sure you'll only use this for humanitarian reasons, and your very safe bioweapon labs will make sure that none of its ilk will ever escape.

    Right? Right.

    Man, every day I'm glad that I don't live there anymore...

    Ciao,
    Klaus

    --
    Free PC version of ChipWits at http://www.breueronline.de/klaus/chipwits/
  112. AIDS was the first syntetic virus by maitas · · Score: 1

    Been there, done that, at least USA army can said that...

  113. I've been saying for a while now: by cosmicrecursion · · Score: 1

    Fear the Bio-Hackers! Call me a paranoid-glass-half-empty kind of a guy, but Id have to drop this into the old "always wondering if they can, never if they should" department ;P.

  114. Re: high level by topham · · Score: 2

    It doesn't sound stupid. I watched the local University channel one day out of boredom and they were discussion how gene's are processed. I understood the PROCESS immediatly, the terminallogy, etc was new to me, and I must admit quickly forgotten. But the process itself made perfect sense. Meanwhile, the professor asks the class a question and they stared back blankly like the whole thing was beyond them. It probably was. They can memorize all the molecules, etc they want. But I doubt most of them can understand a process in the same manner as most programmers do. I think a mix of molecular biologist & computer programmer will be the scariest thing in the next 20 years...

  115. Your Very Own Mail Order Gene Supplier by bigfatlamer · · Score: 1

    Heck, don't we all have our own mail-order suppliers for gene sequences?

    If you've got a credit card and a mailing address, you certainly do have your own mail order supplier for DNA sequences. In fact, you've got quite a few to choose from.

    --
    There's one thing computing teaches you, and that's that there's no point to remembering everything.
    --Doug Copland
  116. In a few years... by ab762 · · Score: 1

    A few years from now, the same scientists have advanced to creating higher life forms. One of them gets carried away and claims he can perform the Genesis process - creating a human from dust.

    "Poof" God appears in the lab.

    "No so fast, sonny - that's my dust. You make your own dust first."

    --
    Henry Troup, htroup@bigfoot.com

  117. Slightly Offtopic idea.. by A55M0NKEY · · Score: 1
    Consider Syphilus ( sp? ).

    This disease ( a virus I think but it doesn't matter ) was very deadly when it first came out but quickly evolved to kill much more slowly. What happened to the old killer version? That is, why did the less lethal mutant cause the lethal version to become extinct?

    I bet it's probably because enough of the population was infected with the less lethal version that the number of suceptible ( to the killer version ) people decreased. The people infected with the mild version were in effect vaccinated against the more virulent form.

    I wonder if you could create a version of a dangerous disease that did nothing ( or not much, maybe just the sniffles ) but would spread quickly, vaccinating the public against the virulent form.

    Syphilus hasn't mutated back to it's virulent form, wouldn't a less virulent form always have the evolutionary advantage over a nasty one? ( i am not sure.. )

    On the other hand syphilus still kills unless treated, and diseases like leporcy and smallpox ( which would still be around if we hadn't killed it off completely ) have always been around.

    If we could be *sure* that a less nasty version would outcompete a nasty one, then releasing an artificial mild form might make sense, but then humans have never been able to predict how an introduced species would affect an ecosystem, so I doubt we could do this.

    --

    Eat at Joe's.

  118. Rodney Books article - compiling into a DNA by rtstyk · · Score: 1

    Director of MIT AI lab Rodney Brooks gave a nice interview in which he mentions using a compiler to produce DNA that is then inserted in E. coli. Check this quote and read the article:

    "At the wackier, far-out end, Tom Knight now has a compiler in which you give a simple program to the system, and it compiles the program into a DNA strip. He then inserts that DNA string into the genome of E. coli, and it grows into a whole bunch of E. coli. When the RNA transcription mechanism encounters that piece of DNA it does a digital computation inside the living cell, connecting them to sensors and actuators. The sensors that he's used so far are sensing various lactone molecules."

    Article

    --
    I hate the fact that you people don't salute me
  119. The White Plague... by Anonymous Coward · · Score: 0

    How ironic for this to come out just days after I finished reading Frank Herbert's The White Plague. The novel deals primarily with engineering of viruses, how accesible some of the tech may be, and of course, outcomes. Fiction or not, it does leave me quite disturbed by this news, especially the whole mail-order part, was that a joke?
    Regardless though, I agree that this was inevitable. Also, a virus is the simplest most primitive form of life (I take the stance that viruses are alive) thus it was the logical first choice for this attempt. What really bugs me though, is these scientists claiming that lack of knowlege is some sort of defense. They repeatedly state that only a few people in the world could do this. But all that means to me is that there are only a few people in the world that could untangle any screwup these goofs come up with...

  120. The abstract by dotc · · Score: 1

    The abstract, and some comments.

  121. Yes, actually I do by Supa+Mentat · · Score: 2

    I do have my own gene sequencing mail order company. I work for Northwestern University in the Chicago campus in a molecular bio lab and let me tell ya, I still remember the first time I designed 20 sequences, sent off a long list of a's c's t's and g's online and got tubes of them back in five days. I felt like a god.

    --
    "A witty saying proves nothing." - Voltaire
  122. I had read this and it is quite interesting.... by Gabreal · · Score: 0

    The only problem I have with this whole desusion is the fact that I had heard that it was linked to Terrorism. Ummmmmmmm everything has been linked to Terrorism............my Grandma yelling out the door screeming in a psycotic manner about how her garden died was b/c of terrorism, "Those damn terrorist used chemicals to kill my garden!!" Get over it!

  123. If the Reston strain creates antibodies... by cyberwench · · Score: 1

    Is it possible that it might allow for some kind of a vaccine to be made against Ebola/Marburg? Or does the high mutation level counteract any vaccine?

    --
    ~ Leilah
  124. The end... by nomel · · Score: 1

    I think this is crazy...
    Something like this is going to be the end of us all!

    Flashbacks from "Last Stand"

  125. So.... by Ilgaz · · Score: 1

    Those evil biological stuff can be created so easily and so... Saddam moron even created it without a doubt...

    So he should be attacked,etc etc...

  126. As always by magi · · Score: 2

    "Ooooooh" and "aaaaaah", that's how it always starts. But then later comes the running and screaming. I mean, life will find a way.

    -- Ian Malcolm

  127. First Nanomachine? by Anonymous Coward · · Score: 0

    Maybe this is the beginning to nanomachines.

    Just a thought.

  128. Harder than you think by Anonymous Coward · · Score: 0

    This people didn't build a 7500 piece virus one piece at a time; they ordered premade sequences and then tried to get them to bind together (sounds pretty random to me.) Anyway, don't you think if you tried to order, say, all the subsequences of a smallpox virus, that would raise a few red flags somewhere? Wanna try it and see how long before the FBI comes knocking at you door? Thats why the the experiment was a good thing -- if the feds weren't monitoring the gene splicing marketplace before, they sure as hell are going to be keeping an eye on it now!!!

  129. Wrong assumptions by nusuth · · Score: 1
    The modified virus need not express its deadly gene as frequently as ebola. Infact, for terrorist use it doesn't have to express it ever. Killing people is not the goal of terrorism, it is a tool to scare people. With potentially expressible ebole proteins circulating in my veins, I would be scared more than enough.

    Then again, I don't live in or near the States. Local terrorist still prefer bombs and AK47s.

    --

    Gentlemen, you can't fight in here, this is the War Room!

  130. First synthetic life form by wtoconnor · · Score: 1

    Everyone seens to be missing the big picture here. This is the first artifically created life form. A bunch of chemicals were ordered, put into a container. The result being something that replicates itself.

    They didn't suck the nucleus from an already viable life and transfer it to another container like cloning.

    BTW: It doesn't take $300K of DARPA grants and 2 yrs to make DNA. I do it all the time.

  131. Re:You don't need a virus to paralyze and kill mic by Valen+Faerlwynd · · Score: 1

    That's a cop-out.
    Thats like answering "Uh, the Force" to that whole lightsaber termination point issue.

    --
    "The best compliment a girl ever gave me was 'Your hair smells nice.' I hate being the platonic friend." -Valen