Slashdot Mirror
Adobe Considers Withdrawing from Asian Markets
Max Groff writes "This brief ZDNet article (printer-friendly version) describes how Adobe is considering leaving its Asian markets due to the apparently high levels of piracy across the Pacific. This change would not only cut off the marketing of Adobe products to Asian markets, but also halt the development of much of the company's Asian-language software."
Take your ball home; might open some eyes. But I'm sure that somebody else would step in to produce the right software, and Asia can be a BIG market.
Vintage computer games and RPG books available. Email me if you're interested.
Oh, yeah. THAT'LL lower "piracy."
I mean, I guess that the pirates have screwed themselves over, insofar as they care about Adobe products. Although I would bet that they'll just start pirating the US versions...
"The weak are always anxious for justice and equality. The strong pay no heed to either." - Aristotle
How will this prevent people in Asia from getting copies of Adobe products and distributing them on their own? Common sense, people!
A professor at a local US University handed our help desk a CD labeled "Adobe & Macromedia's Greatest Hits, Vol. II"
She wanted us to install Photoshop and Dreamweaver off the disk. The help deskers explained how it was a pirated copy, and how her dept. could legally purchase the software for significant discount for educational purposes. She protested, saying it was legit because she'd paid 5 dollars for it on her travels in Malaysia.
cant we all just get a bong?
Yes, ok. So now I can't legally buy it, and I used to.
If I want it, I *HAVE* to pirate it!?
Sounds like a great idea adobe.....
i hate pansy republicans
Isn't that an emerging market-and-a-half?
FP...
oh boo hoo! They copy my precious software. I think I'll take my ball and leave.
Fuck you, Adobe. This one's for Dmitri.
Who gives a damn about those markets anyhow? If all they do is pirate software, screw 'em.
Oh wait, the slashdot crowd condones piracy as a "funadmental freedom" that all are entitled to, right?
I can't wait for you GNU robots to jump in and say "linux is free, why not everything else", right?
long live newsforge.com, to hell with slashdot, you people suck.
... of course that they will still have Adobe's products.
Photoshop 4.0 works just as good as 6.0.
Get your Unix fortune now!
It is my understanding that a lot of Asian country citizens are bi-lingual(sp?) They often take english as a second language so I'm not sure how this will stop piracy. If they speak english and you stop selling your software there, then they will just download and burn the english version. Right?
...this will have on the piracy of Adobe products?
I am under the impression that English-language versions will just be pirated instead of the localized Chinese/Korean/whatever versions.
Granted, there will be a fair amount of users who will have difficulty using the pirated English versions of the products, but I'm sure that a good percentage of technically trained people have sufficient English skills to use the latest version of Photoshop.
What do the rest of you think?
Christ, I don't have my MBA yet...otherwise I'm sure I'd be management material!
"It's not a war on drugs, it's a war on personal freedom. Keep that in mind at all times." Bill Hicks
Korean version was produced (or planned) provided that a korean company would help in creating version plus guarantee certain number of sold copies; apparently (south-)Korea has similar problems but situation is perhaps not quite as bad.
Yeah, that's a great idea. Take away the only legal way to use Photoshop / Premiere / Pagemaker, etc., and that'll really curb piracy. .pdf's? Now they're going to have to steal copies of the software, even if they wanted to pay for it!
What does Adobe expect - people will just stop editing images? People will stop publishing
*I realize that there are other programs to edit all kinds of documents, but, as Windows has shown, people have a tendency to want to stick with the software they've originally learned.
The English versions will just be pirated over IRC, etc. There are little windows tools to turn the English in programs into Chinese (or any other language). So withdrawing from the market will not really kill priacy. It is only worth withdrawing if your not making money (obviously).
If nothing else, even domestic users who need to work with Asian-language materials should assure that. Adobe's main products are high-end, and in the case of programs like InDesign, are sold into markets where international audiences are common. I can only imagine that removing Asian language support would hand back any marketshare they have managed to take from Quark, despite the convenience of a basically all-Adobe publishing workflow.
I get the feeling that Adobe is not just doing this for financial reasons, but also to punish the area by not providing Asian versions of it software. It's too bad that they're going to stop development of Asian language versions, but if punishment is their goal, somehow I think that it will have little effect, and may even backfire.
The thing is that while their programs set the standard here in the US and many companies now depend on their products, the same is not true in Asia, where Linux is actually being adopted quite rapidly, especially now with Windows XP having copy protection in place (although that hasn't stopped many hacked versions from being produced). This may in fact be a big boon to the Linux industry as more and more users may come to find more full fledged Linux graphics solutions (GIMP is getting there).
"The only normal people are the ones you don't know very well."
Isn't there something that you can do about posts like this??
"The weak are always anxious for justice and equality. The strong pay no heed to either." - Aristotle
I do not advoate software piracy. I've been weaning myself off of illigitimately copied programs for several years now, and encourage friends to also not use pirated materials.
That said, I believe that the equivalent dollar cost in pirated products is highly mis-leading. People who pirate software wouldn't buy the programs if they lost access to it. They would just do without.
Chizen said in the article that it can cost up to $750,000 to produce a Chinese-language version of a product, and extensive piracy makes it difficult for Adobe to recoup those costs.
That said, I can appreciate theirt reasons for leaving. If they spend $750k to produce the Asian version, and don't sell sufficient copies to recoup costs and profit, then they should leave. My understanding is that most companies require a 15% return-on-investment from a product, or they shut it down.
ShoutingMan.com
yea, scroll down and read something more interesting
-shpoffo
The point is that they will no longer be creating localized versions for the Asian market. In other words they won't bother translating into the various Asian languages.
Yes, it's justifiable to pay $600 for a flimsy cardboard box and a plastic CD.
If you make $600 with said flimsy cardboard box and plastic CD, I think the product has paid for itself.
Justification's from Adobe's view? If the $600 price funds the development of the next version of Photoshop and keeps employees and the company afloat, that's justification.
Can anybody possibly justify taking property that doesn't belong to you?
GPL Deconstructed
I've been waiting to see when M$ would launch an all-out assault on Adobe and Macromedia, with their own graphics and video editing software apps.
Maybe this will be the opportunity they've been waiting for...
Of course, M$ suffers from massive piracy in Asia too.
"Apparently" high piracy? You're talking about a market in which people do not generally realize that software exists in shrinkwrapped form. I have talked to people that literally were not aware of shrinkwrapped software before coming to America. Most software is purchased in the form of $5 CDs containing EVERY SINGLE PROGRAM EVER MADE by a particular company.
;-).
I should know; I have a copy of just such a CD full of Adobe software
ZFS: because love is never having to say fsck
Seriously, piracy is a big problem in Asia, and something must be done to stop it. Adobe spends tens of millions of dollars a year in product development costs to provide consumers with useful products. If someone is not willing to pay for the software, he should not be allowed to use the fruits of Adobe's labor. Of course, open-source and other freely available software is different; and those authors should be commended for their dedication and service. However, a company which spends so much money developing its products has a right to recoup its investment.
Sig (appended to the end of comments you post, 120 chars)
Nah...what's REALLY happening is that their Asian languages translator(s) quit, and they can't find a new one in time for their next release :)
It's so much easier to just forget about a substantial portion of the world, you know?
If you're not a professional, or at least a "power consumer", then Photoshop is overkill. Get Photoshop Elements or some other consumer-level application instead.
And the men who hold high places must be the ones who start
To mold a new reality... closer to the heart
Yes, my purchasing department can.
So can the bsa.
As far as lowering the prices, how can they hope to compete with people selling their entire library for $5(US)?
If you don't like the prices, don't use the software.
there's more than one way to do me.
Hopefully Adobe will withdraw from ALL markets, putting Apple out of its misery once and for all.
According to other reports on this, it's being done purely on cost grounds. They spend $750k doing localization, they can only expect about $500k back because so many users just pirate it, and that's not going to change any time soon.
Imagine a piece of pretty greenish paper being worth $100 ... or a canvas with some paint thrown on it being worth millions ...
Indeed, i am absolutly sure that Adobe will give up on half the world's population (Asia) containing the only big market that's still growing at 7.8% (5 times the european rate) a year (China).
Yes, i can just see how incredibly briliant that market strategy is!!!
I see a lot of posts here saying that this will not stop piracy of the Adobe's products, because it will eliminate the only legal way to obtain the software, so people will be forced to pirate it. Adobe knows that, but that's not the point. The point is that Adobe is actually spending money to support the Asian money, and that money is wasted.
And the men who hold high places must be the ones who start
To mold a new reality... closer to the heart
It doesn't hurt them at all to have English language versions pirated in Asia, in fact they probably prefer that to having their competitor's products pirated.
But if it costs $650,000 to produce an Asian languages version of their products (a number I can easily believe, having done localizations of much smaller products), and they don't recoup that cost, there's no point in doing it.
This is news?
I've been waiting to see when they'd do it. Adobe and Macromedia are some of the only major producers of desktop apps that M$ hasn't yet gone after.
This may be the moment Bill's been waiting for. Of course, he has his own piracy troubles in Asian markets...
However, I don't think this will hurt the pirates. Anyone willing to go to the lengths necessary to acquire the software and circumvent anti-piracy measures (serial numbers, dongles, etc.) is probably willing to put up with English menus. Photoshop and Illustrator aren't exactly language intensive applications -- they're intuitive graphics apps.
The people who will really suffer are the people who do pay for asian versions of Adobe's software (businesses, schools, etc.) and the employees who work on those versions at Adobe. If you're an internationalization guru who got laid off because international piracy is just too rampant, you're in trouble.
Look, for 15 years US software houses have been charging nearly ten times as much money as they should for their applications. Our original AMX Pagemaker desktop publishing software launched in 1985 for the BBC Microcomputer sold for £40 (about $65), which was just within the budget of most people who needed it. Today your typical application or application suite is $300-$500. And then, you have to constanly pay to upgrade. And I'm a Mac user, so I now have to 'upgrade' all my apps from OS 9 to OS X which will cost thousands. What makes all this far more serious is the complete niavity of American business culture to the reality that the rest of the world (and I include the UK in this) have MUCH less money. To a Brit, spending £50 ($80 approximately) is equiv to a middle class American spending about £250 ($350). For those who do not believe me, if you're a Brit, go live in the US for a few years. If you're an American, come live here. So, in Asia, where the standard of living outside of wealthy communities is even lower than the rest of the Western world, the situation is even worse! Price it right, and people will PAY for it. People want their original user guide, colour CD insert etc. We did it! We created http://www.onumber.net at just £14.95 (about $23) a pop for 5 years, feature upgrades included. It's on the net, so why should we screw people for more? A little more global understanding and increase use of ASP business model, and mass software piracy will be a thing of the past.
O'WONDERWe're working on it.
That's like selling what, 10 copies of photoshop? ;)
-- Dan
I'm not interested in justifying it.
"Hey, you can't stop marketing your software here! I wanted to get a copy of it, but I haven't had time to find a someone to let me pirate it yet!"
Serves 'em right.
The company has every right to do as they wish with their product.
The problem unfortunately IS with the local culture (in regards to buying software) in many oriental countries. Even if the prices were lowered the problem wouldn't go away. The same happens in Eastern Europe as well, by the way; it seems to be related to the end of communist system.
A lot of people seem to be saying that this move won't cut down on piracy.. they will just pirate american copies..
I think that is a given! I think their whole problem is that the costs of maintaining an asian version for each product, a sales force and tech support team, etc is costing them more than they are getting from the asian market. If they want to pirate the software.. at least they can pirate the US version.
This is the best that a huge software company like Adobe can come up with?
I would think that Adobe could come up with some kind of solution that would prevent unauthorized copies of their software. (I refuse to use the word "piracy" to refer to unauthorized copying of software. It's ridiculous.) Hardware dongles or some other sort of anti-copying protection. IIRC QuarkXPress used to come with a required dongle when you'd purchase it for some environments. (The college I attended had hardware dongles for XPress.)
This is obviously a threat to the Asian governments "pass something like the DMCA and be willing to arrest teenagers for us, or we'll quit playing in your market."
Let's see who blinks first.
It's not that pirates wouldn't buy the software, it's that some pirates wouldn't buy the software, some pirates couldn't buy the software, and some pirates would have to buy the software.
The question is how to separate all of them enough to target the payers, and get them to pay.
People who do without aren't interesting to this equation or argument. It's the people who make money with the product, and people who need the product, that should be targetted.
In a very fair market way, if there isn't enough pirates who can pay, if they had to, to support the product, the product should go away. If there is enough pirates who can pay, then they can afford to sell, as long as they can convince the pirates to pay.
The question is how lack of an Asian version of the product will affect the market. Will Chinese users, for example, start to use English or Japanese versions? Older versions? Does this mean that Chinese OS X users will be, literally, up the creek?
GPL Deconstructed
...for Photoshop, or $100 for Acrobat, or other outrageous prices for desktop software, maybe people wouldn't pirate it as much. Most buyers of pirated software over in Asia are normal Joes, who just want to do some photo work on a picture of his cat.
Why spend $200 on something like that? It's ridiculous, especially when something like The GIMP is free. If a powerful program like the GIMP is free, shouldn't Photoshop be closer to it?
Remember: only poor people pirate software.
Zodiac Survey
I'm glad they're pulling out--they're cutting their own throat in the process by discounting all the people who actually do purchase their software.
I hope Adobe goes down the tubes. Fuck you, Adobe!
Despite the whining from the (lets not mince words here) pro-piracy segment of the slashdot readership, this sounds like a perfectly sound business decision.
Face facts people, corporations are not charities. If they can't get a Return On Investment, they need to invest money elsewhere. Nor will any other business simply step in, because they're not going to get any ROI either. This has already elminated entire markets. The Hong Kong movie business is basically dead because piracy is so culturally acceptable in China.
These companies are crying babies. Come on, ain't they the proponent of free market? Don't they understand the market supply and demand?
They priced their product out of reach of 99% of the population, and they now complain about people not buying it. People can get creative, if they don't have the means to buy it. One copy of their software costs more than the income of a whole family for more than 80% of the population in China. Imagine you are US consumer, and your whole family earns $60K/year, and a copy (a license for a single user!) of Photoshop costs $80K. And imagine you get a chance to buy it at $100 on the black market. Go figure.
Maybe Adobe should be more creative in pricing too, if they want to get into this kind of market? Otherwise, don't fucking complain, and stick to the US/EU markets.
Why is it I need to lower my threshold to zero before I can read any serious discussion?
simply don't make movies for them to rip, don't make music for them to copy, dont' print books for them to xerox. In fact, just stop the flow of information completely. there ya go...
It isn't a lie if you belive it.
Open Source, while it's a great thing, really isn't enough of an answer. There are no OS equals to programs like Photoshop, Media 100, Oracle. (Yes, Virginia, I know about GIMP and PostgreSQL.)
Copy protection isn't the answer, either. Fair use, monopolistic control, hell, you all know the arguments.
Lassiez-faire isn't the answer, either. Given the option to purchase something or steal it without risk of repercussion, far too many people will do the latter. Adobe deserves revenue for their efforts, and they're apparently suffering enough in Asia that they're considering dropping the whole thing. Say whatever you will about the quality of their work beyond version whichever-you-love-most, but is this the norm you want to see developing with -other- companies?
What do you see as the middle ground?
Obliteracy: Words with explosions
Net reduction in piracy: Marginal. Net hit to legitimate product sales in the fastest growing market in the world: huge.
Is it just me, or does this smack of a trial baloon dreamed up by marketing without a lot of forethought? Honestly, if I were an investor I'd unload the stock if it looked like they were actually going to do what they're talking about.
It sounds as if upper management has started drinking the BSA kool-aid and believe that every pirated copy represents a lost sale. Silly.
"It was a summer's tale: Just a boy, his Linux, and a head full of dreams..."
Maybe charging less than 600$ for their software could also help?
Your comparing two very different things. People don't need Photoshop to edit images, hell most people couldn't make use of most of the features even if the package was free. Photoshop and applications in its price range (and higher) are priced based on the work that went into them and the value of what comes out. If someone can use Photoshop to make an image for an advertising champain that they get payed thousands of dollars for then the 600$ price tag of Photoshop is well worth it. Having people bitch that they cant afford Photoshop to edit pictures of their grand kids is just dumb. There are lower end packages that cost less then 50$ which will serve their purposes just fine.
Bottom line, if you think the software costs too much then you don't really need it. Go use something else, be it Gimp or Adobe Image Effects. Dont bitch and moan about the cost of Photoshop and don't condone the piracy of the software.
"Have you ever thought about just turning off the TV, sitting down with your kids, and hitting them?"
Cool, if I'm ever pulled over by a cop and have a happen to have some marijuana or hashish on me, I'll just tell him I bought it in Amsterdam since it's legal there and I paid for it fair and square.
That should keep me out of jail.
Doing this would be, in the long run, a death sentence for Adobe. The only reason for existence that Adobe really has, right now, is that if you put documents in their format(s), everyone will be able to read them, because Adobe has gone to a lot of trouble to make acrobat reader ubiquitous; which in turn provides Adobe's other products with unthinkable amounts of free advertising. I don't want to reignite the religious argument about the merits of different formats - but suffice to say that .pdf isn't enough better, intrinsically, than the various free formats to be worth paying money for.
.ps files, half of my students can't even read them. The sooner adobe implodes (preferably, as in this case, from its own stupidity), the better.
.pdf pass away; however, they will lose the biggest (only?) edge they have.
If they cut off support for 50% of the human race, they will cease to be the defacto standard really quick.
This is a good thing. Having a proprietary standard for scanned document transmission over the web sucks 'til donkey jiz runs down its chin. How many universities do you know who spring to put Acrobat Writer on all of their workstations? If I hand out documents as
Yes, I am aware that they also make Photoshop, which is not proprietary format dependent (and even worth buying) so they will not actually implode and vanish with a little "pop" should
The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
Anyways, I doubt they'll discontinue the print drivers. Just a few non-profitable apps.
~~~
This is nothing but racial profiling. Adobe is trying to keep the Asian man down. This is no way to be showin' props to MLK on his B-day weekend.
they're such piracy minded folks anyways due to the easy, cultural differences and high prices that doing this could be good. open source replacements are meant to be copied.
either that, or they'll all start learning english and using the pirated US versions.
Because the really intelligent posters don't give a hoot about karma. Unfortunately, neither do the trolls.
A more complete version of this article was released four days ago by C|Net. The decision only seems to effect the Chinese language versions.
my blog
what's the worse they can do to us? Point their nukes at Texas? Supply weapons to Al Que'da? Pirate [more]software?
too late.
China's homepage wreaks of honeybucket stew.
Yeah, they have families to support and bills to pay. But since you're still living with your parents, you dont understand that, do you?
Perhaps commercial software just isn't the right model for the rest of the known universe.
:)
It'll take more than hardware DRM to shut down that distribution network, I promise you...
...so why not free software? Emergin' Market nation-states could finance GPLed code development/I18N as a means of pushing their economic interests forward.
They're already used to $5 software, dammit! This market is perfect for us!
- undoware.ca
What would you lower the price to? What price-point would maximize profitability? What does the supply/demand curve for Photoshop look like?
1. It's very difficult to find an authorized dealer that sells unpirated version. In many cases, there is no authorized dealer. :) BTW, each pirated CD costs about $1 in China.
2. It's very very easy to find pirated version of anything. In many cases, authorized dealer also sell pirated version on the side.
3. Anyone making $600 a month is considered doing very well. So no one can really afford the authorized versions.
4. Chinese version of Adobe software is simply the English version + additional step to install a localization executable.
5. For many people, they'd rather get English version. I know of many people who specifically asks for English version.
For Photoshop Elements.
What do you say to that?
Adobe has every right to charge whatever they want.
Consumers have every right to *not* buy something more expensive.
Consumers don't have the right to pirate, just as Adobe doesn't have the right to take the bits from your bank account.
GPL Deconstructed
Kenja, I certainly don't condone piracy. We lost a good 75% of our sales to piracy in the 1980s. I will confess, we didn't care that much simply because the complexity of the software meant a user guide was essential, and we figured the people who did copy it for their own use were too poor, and the extra users did no harm to the reputation of the product, and ironically, they sometimes ended up buying the (lower cost) utilities we produced, such as extra fonts, clipart etc. (Give away the razor etc!) I do agree that buying a complex application for a basic job is overkill, but it is actually hard to find affordable applications that offer the quality of Adobe's products. That said, this will all change. I am not sure if plugging one's own products on Slashdot is kosher, but we will be adding some nifty 'applications' powered by oNumber.net in the future. IE, online shared ('chalkboard') drawing for kids etc. All that could evolve into fully fledged online image editing. (We have been planning this since the early 1980s, way before Microsoft's recent .NET initiative.) I ramble on. Time for Zzzzz. It's late. The real software revolution has yet to happen. The future's looking good...
O'WONDERWe're working on it.
Sure-- you are not paying for the plastic CD and the card-board box. You are paying for the man-hours of development time that the product required. You are paying the developers saleries.
In the proprietary software industry, the only way you can lower your prices and still maintain profitability is to make up for it in volume sales, and this is not one thing that a high-end photo-editor can do, so you are stuck charging $600 for the right to run the software.
THe answer to this problem is not piracy, but rather open source. Don't use Photoshop, use the GIMP instead. Open Source software also benefits from economy-of-scale, and this is a great way to help make the software more competitive. The reason is that if you base your process on the use of pirated software, you are dependent on that software, and that places you at the mercy of the manufacturer that does not care about your reaction because you are not bringing them money.
So Adobe really does not have much of a choice-- this is an area that they simply cannot compete without throwing lots of money away without any real effect. (Note: Most people pirate the most common products in their categories-- when was the last time you heard of someone selling pirated copies of Solaris for the x86?) However, this is still a problem for Adobe because other products could move in on their market-share by exploiting piracy as an advertizing method esp. if Adobe were to require product activation ala Microsoft. (Piracy blocks competition.)
LedgerSMB: Open source Accounting/ERP
I am a programmer. I do it for a living. I make a living because people can't just take what I make and sell it without my knowledge, without paying me. These people make a mockery out of my livelyhood.
.sg, .my or .cn ISPs.
We care about companies breaching GPL-licenses, and we should care about these people breaching the commercial software world's licences.
Asia will never get a software industry of their own if they continue this way, and will be doomed to producing cut-throat priced commodity hardware for the rest of the world.
I hope Adobe makes it real hard to use their programs on computers where the clock is set to Bangkok, Kuala Lumpur or Beijing time, or the internet connection reveals they are connected to
If they can't pay for commercial saftware, they'll just have to settle for GPL'ed alternatives!!!
To a Brit, spending £50 ($80 approximately) is equiv to a middle class American spending about £250 ($350). For those who do not believe me, if you're a Brit, go live in the US for a few years.
I am, I do, and you are absolutely right.
By pulling Chinese support, aren't they doing exactly that? Sticking to the US/EU markets?
Photoshop's price point isn't targetted to consumers, at $600. Photoshop elements, at $89, is targetted towards consumers.
They do understand supply and demand. They supply Photoshop at $600, and the demand doesn't exist for the product. Therefore they exit the market, since it can't support them.
GPL Deconstructed
If Adobe were to pull out, some Asian competitor (or, gasp, free software) would fill their market niche, at a lower cost and probably higher quality. And those Asian competitors would have a much easier time delivering English-language versions than the other way around.
Adobe won't pull out. They are just saber rattling. Pulling out would be foolish. They'd rather give their software away than let some other company take over their market niche.
By posting under that with your +1 mod point you're making others browse at +1 or above see such nonsence. Why would you reply anyway? Why reply as yourself? Are you replying to your own little post (I figured this much from /. psychology). Anyway, next time, feed the trolls using non point posts (anonymous). OK.
BTW MODS. You can mod the parent, this post, and anything else down in here. Good job.
Come on, Slashdot. You can do better than THAT. ZDNet has bills to pay, too.
Elitist assholes.
But Adobe MAKES consumer level products. Are you saying that Photoshop Elements or Photo Delus are not of the same quality as other Adobe products? These products are within the price range needed and do just about everything an average user would want to use Photoshop for.
But I degress. Go to sleep all ready.
"Have you ever thought about just turning off the TV, sitting down with your kids, and hitting them?"
Only $89! Over 9x cheaper than Photoshop :P
GPL Deconstructed
Then how are we supposed to be able to buy or download cheap pirated versions of adobe software in the US??
Yes, I can justify taking property that isn't mine -- I like it, I want it, it's free, therefore, I'll take as much as I please!
I have known Chinese (in China) who own little more than 2 white shirts, a pair of pants, and a bicycle.
However, they may use a computer at work to do personal jobs. They may run software on a computer at work that costs, in the U.S., more than their entire net worth.
This is not lost profit for companies like Adobe. It is free advertising and free trademark promotion.
No amount of law-making or law enforcement will make these people pay hundreds of U.S. dollars for Adobe Photoshop. However, advertise that you need someone who knows how to use Photoshop, and hundreds will apply. Is this a bad thing?
People in the U.S. get little accurate news of other countries. They often unconsciously make the assumption that other people are as rich as they are.
U.S. Senator Biden, who is an intelligent and educated man, and who is the Chairman of the U.S. Senate Foreign Relations Committee, doesn't even pronounce the words correctly, yet he talks of changing (my article, see the Biden interview) the Saudi government and controlling the development of the government of Afghanistan. If Senator Biden is like this, make a guess about the knowledge of other countries of the average Adobe executive.
Adobe executives should not consider that every pirated copy is a personal attack on Adobe profitability. There are many social situations that require more social sophistication than that.
Bush's education improvements were
Yes, it's justifiable to pay $600 for a flimsy cardboard box and a plastic CD.
If you make $600 with said flimsy cardboard box and plastic CD, I think the product has paid for itself.
Justification's from Adobe's view? If the $600 price funds the development of the next version of Photoshop and keeps employees and the company afloat, that's justification.
Can anybody possibly justify taking property that doesn't belong to you?
Doh, ment to reply to Wonderkid, not myself. Arguments with myself never end well for anyone involved,
"Have you ever thought about just turning off the TV, sitting down with your kids, and hitting them?"
That's the problem, isn't it?
If everyone, or even enough people, believed in 'taking' what they wanted, rather than through peaceful exchange, you get a much more brutal and hostile world.
GPL Deconstructed
Almost any piece of software with a business market will COMPLETELY IGNORE the broke average Joe. You tell me one person who is willing to pay $600 for a copy of Photoshop, who is not doing it for business work. They will pirate a copy of it EVERY TIME.
Now, I'll admit that GIMP is not quite as good as Photoshop, but it's good enough. Having a $600 gap between The GIMP and Photoshop for a little bit of difference is not right at all.
True that piracy is illegal and they don't "have the right" to pirate software, but piracy is a form of protest. People protest high software prices through illegal piracy, just like blacks protest segregation by illegally sitting on the front of the bus. Most people may do it for more practical reasons than political (like "should I pay rent with $600 or buy a fucking piece of software?"), but it still acheives the same effect.
If only the software companies wouldn't be so blind to why they are doing this...
Zodiac Survey
I can understand the rationale behind the decision, but abandoning a market that big is dangerous and foolish. Consider what happened to Word Perfect. The only market they abandoned to M$ was Macintosh users. Partly because of that, Word was able to fully develop in a space where it had no competition, and expand in to other markets. There were other factors, of course, but it makes my point: give the competition a space to grow in, and it will grow. Perhaps the Gimp will, with the addition of thousands of Asian hackers, finally mature past Photoshop. Even worse for Adobe would be if a company (like Macromedia) took advantage of this and kicked their butt.
BlackGriffen
Chizen said in the article that it can cost up to $750,000 to produce a Chinese-language version of a product, and extensive piracy makes it difficult for Adobe to recoup those costs.
Duh, the way Adobe charges for their product that's only, what, 1,000 boxes?
yeah, if I only had some mod points..then again i couldnt post to this discussion
Well, things have been changing, most companies
in HK are forced to buy numerous copies of
software from BSA member due to the new
IP law. The situation here is better than most US
company that buy one copy of Photoshop and install in every machine, right?
You know, I could say the same thing about... your blood, or your life, or your shoes.
GPL Deconstructed
As I said in an earlier message (which is playing hard to find), I knew someone from India living in the United States. He made minimum wage to make his way though college. His father was one of the top engineers in an Indian company. Guess who had the higher salary? My friend, not his father.
A $15,000 yearly salary in other countries is enough to make one live like a king. In India (I've been told; perhaps someone can comment), a $15,000 U.S.-equivalent salary is enough to have a personal cook prepare your lunch, and a personal servant bring it to your workplace.
$15,000 may seem like a lot to many students, but there are countries out there where people make $1.50 an hour or less. Companies make items abroad where it is cheaper yet attempt to sell said items abroad in the same countries at U.S. pricing.
Personally, I'm predicting a severe devaluation in the U.S. dollar to come sometime within the next century or so; one cannot price an item at price A in country X and price B in Y without a third party Z coming along and moving the item from A to B at a lower cost. Given that most other currencies are worth less than the United States', the dollar likely will be devalued as we start kicking and screaming and wondering why.
How dare they not pay for software like Photoshop, especially when it's at the eminently reasonable price of $600! The nerve!
---If you can't trust a nerd, who can you trust?
I don't think many U.S. companies do that anymore. maybe in the early/mid 90's they did.
Please help! I'm stuck inside my virtual reality headset!
Well, I disagree with your sanctimonious premise. I feel I have the RIGHT to pirate whatever I want, especially since the greedy software companies continue to overcharge for their products. So, my response -- a means of protest -- is to pirate the software, and get it for free. I'll take as much as I please!
... you should ban free software, too.
In market economy nobody deserves anything, you just sell stuff if you can. If you can't, switch products or die away.
Marko
Its one thing if you want to give your software away to the world. it's a noble pursuit. But lots of people don't. Adobe's products are *huge* software endevours, consuming years of peoples lives to develop. They have every right to sell it to whom they please.
Adobe should be applauded. I wouldn't sell my software in a market just to have it stolen and illegally reproduced. Who wants to work hard just to see the work stolen? This is a much more elegant solution that suing people or pressing criminal charges against millions of citizens that pirate software.
Reason, free market capitalism, and individualism
What, they're not profitable?
You mean they're not enjoying having a huge marketshare and no competition because software piracy gives them all the benefits of "dumping" without any fingers of blame to point at the company?
They're just a bunch of whiners trying to justify a clampdown on our rights to their paid lackeys in the government.
These are my friends, See how they glisten. See this one shine, how he smiles in the light.
On Pirating software:
.nib files then all that is needed is to change some strings since OS X supports nearly all language formats.
I myself pirate some software titles. Yet even I can see that this article is not about Adobe trying to stop piracy. Adobe's products are aimed towards businesses and professionals, not home users. I personally dont think they expect a home user to pay the $600 for the software. In fact they probably dont mind piracy by the home user because it would extends their user base. However I do think they expect someone who makes money from the software to pay it. The artists are the people who Adobe makes photoshop for. If you are an artist who has the cash it is probably in your best interest to pay for the software. Adobes continued existance would be a good thing for them.
On the discontinuation of asian localization:
Adobe is losing money when they localize the software. If they continued to localize while losing money it would go against all business logic. does 2+2=5? Also Asians can localize the software themselves. If some korean was using OS X and an adobe app used
how does Adobe afford the production costs
Release the non-trade-secret parts of the application as free software. That'll help a bit. Splitting the most proprietary parts into modules priced at $49.95 a piece might help further.
and the support costs
"No support except to registered users." That's one of the proposed models for making money off open source.
and the bandwidth costs
If they can get their install down to 10 megabytes (perhaps by not including all that d*rn clip-art), bandwidth becomes relatively cheap.
if they don't make any money on top of the distribution costs?
For downloadable software, bandwidth costs == distribution costs.
Will I retire or break 10K?
now my future hardware purchases will come with the manual in HTML instead of goddamn PDF format.
or better still, TXT
It'll make them learn to speaky engrish. That way next time I go buy a new NIC at the local discount computer store I can actually cary on a conversation with the guy running the shop that just came over in the same cargo container from Taiwan that the NIC I'm buying came in.
This isn't what they want. They want authorities to enforce, with whatever means necessary, these ridiculous laws concerning pirating with threat of great economic damage to the country. HAH!
I say let them drop out, something will replace Adobe's program or better yet, there is rarely a reason to upgrade so they can just keep using the ones they already have.
REALLY, would life stop because Adobe disappeared?
I get the feeling that Adobe is not just doing this for financial reasons, but also to punish the area by not providing Asian versions of it software. It's too bad that they're going to stop development of Asian language versions, but if punishment is their goal, somehow I think that it will have little effect, and may even backfire.
I interpret this as a threat to get the governments in the area to cut down on piracy. If they don't then Adobe would make good on the threat (or not, as it chooses).
The funny thing is is that Bill does not care, Balmer even said that they don't really mind it becouse they are using MS software, now in 3 or 5 years when Asia has a better market going on eveyone will know how to use MS software and the big corps don't want to be bothered so they will fork over the money.
hmm... for fun I enjoy launching DDoS attacks against 127.87.42.5
if they don't make the software, there is no way to pirate it. plus, they could still buy legal copies from the u.s.
Maybe...just Maybe
http://www.freebsd.org
The reason adobe has stopped seeling asian products is not to prevent pircacy. It is because of piracy.
The asian market is simply not proftable anymore, because of piracy.
The Asian countries that don't have access to Adobe products any more will just start pirating it from other countries, and eventually Adobe will have a fit and pull out of all markets entirely.
The Acrobat format is not proprietary. I have the entire spec in a binder right here. I downloaded it from Adobe and printed it freely, then used it to create code that writes PDF files.
.ps files. But I can't see spending much time decoding a paragraph that contains the phrase donkey jiz in it.
I have written web based programs that generate PDF without using any Adobe code. (When you need to be in control of the exact layout and 75dpi is not good enough, it is a great choice.)
TeX is happy to make PDF files. My Mac is happy to write anything I wish out as a PDF file instead of printing. In linux I have a little program to convert postscript to pdf. No Adobe software required on those systems.
I do tend to use Acrobat Reader for reading them, but I also use xpdf (launches much faster under linux) and, under OS X, Preview to read them.
I don't even understand that part about scanned documents and
It is possible that there is another format that provides precise display at high resolution in an easily navigable, on demand downloadable format, but I haven't heard of it. Long live PDF.
Why should I price software that I create at anything other than the price that I want. If you can't afford it, then tough, don't use it. Photoshop, Pagemaker, Framemaker, etc are not needed to sustain human life. People don't die because they don't have them. Newspapers can still use other means to create their publications.
There are plenty of other free or cheaper products out there that will remove red eye from your pictures of the kids. If you need more than those programs will provide, then BUY it! Nobody has a god given right to software. We've already given the rest of the world blue jeans and knight rider episodes, why should we be expected to give you photoshop as well?
I mean, come on, pirates can't get on a plane?
sulli
RTFJ.
Anyone have any idea how much these products are in China? I mean, China has a per capital GDP of $3600 (see here), vs. $36,200 in the USA (see here), so if Photoshop costs $600 there, that would cost 2 months of salary, equivalent to at least $6000 here, in addition to the fact that they still need to spend money for life's necessities (i.e. food, clothing, shelter).
"I have not failed. I've simply found 10,000 ways that won't work." --Thomas Edison
Can anybody possibly justify taking property that doesn't belong to you?
Yes, in many cases. Some legal, some illegal. Anyone who can't think of a single case where taking property from someone else is justified must be a moron.
Everyone thinks they are the biggest market in the world, but here are some facts about china's "market".
Out of 3 billion people, 900 million of them are rural peasants who don't have a pot to pee in. These are people that are so poor that they go for months without even seeing currency, let alone using it.
100 million of them are rural farm workers who may sometimes receive a "paycheck", but who are not employed for long periods of time. These people make a fraction of what a McDonalds grill cook makes in the US.
Of the remaining 2 billion, you have a tiny elite of maybe 120-80 million people who make money in a range that is remotely similar to the west. Of all the people who receive somewhere in a living wage range, maybe 500 million of them, save 40% of their income and use 60% to live. They do this because their economy is fragile and they are subject to losing their incomes rather easily. Compare that to Americans where 4% of people's income (on average) is saved.
The Chinese do not have descretionary income to spend on software. This is what Adobe is really coming to grips with. If it were made to be incapable of stealing the software, they would just go without!
Companies that make money in China are like Coke-a-Cola, Pepsi, Marlboro. These are companies that make 80-90% of their money outside the US anyway. The rest of the companies (like Adobe) tread water for years and never turn the corner. This is the reality of the Chinese market: they are an export economy with a weak domestic economy. A place where slavery was "abolished" in 1929. A place where children participate in forced labor programs to pay for their educations. Where you recieve the death penalty for selling a fossil you dug up in your own backyard to a non-Chinese buyer.
(I have no idea why we have a normalized trade relationship with this country and yet Cuba is still under an embargo)
Adobe execs: think about this. Is that really a world you want to live in?
What do the "poor" need with a moderately-high-end photo editing suite?
python -c "x='python -c %sx=%s; print x%%(chr(34),repr(x),chr(34))%s'; print x%(chr(34),repr(x),chr(34))"
(I honestly don't know if this has been posted yet, but...)
It seems maybe Adobe is just simply noticing things that are already out there. No piracy, just smart minds coupled with fast fingers. Adobe is trying to make a buck. Others do it because they need to (or just want to, whatever. Sortof the same thing IMHO).
Just a thought.
I'm not a prophet or a stone-age man,
I'm just a mortal with potential of a super man.
Because the pirated Adobe software I get from Asia is always in Taiwanese?
The same thing college students need it for - doing some decent photo editing.
---If you can't trust a nerd, who can you trust?
In using software from a Pirated CD, you're going to have to copy it to the computers. In the case of the teacher there, she's be copying it on to dozens of machines that probably would be running licensed software.
autopr0n is like, down and stuff.
That's not really true, Copyright laws help out big corporations, whereas most drug laws help absolutely no one.
autopr0n is like, down and stuff.
I'd hope that most large companies in Asia actually buy licenses for Adobe products. Those would be easier to check than individuals. If you could audit those you could still make enough cash for it to be worth staying in the market.
Has anyone actually tried using localized Adobe products with the localized menus?! They're completely impossible to understand, and anyone who has worked with any of these programs since the older versions are more likely to continue to use the English language versions than the localized versions with the garbage translations.
Microsoft's localized programs still have the same keyboard shortcuts as the English version, so if you can't figure out the menu item for something, you can just use the keyboard shortcut if you remember that. Adobe programs force you to use the menus. (No keyboard shortcuts at all.)
I wish I could find a pirated copy of psp4. 6.0b loads like a pig.
autopr0n is like, down and stuff.
yeah but they made a deal with the biggest OEM in China to bundle Windows with all systems sold. I'm wondering how many profit this will bring them.
The article says that Adobe is considering withdrawing from the *CHINESE* market, not all *ASIAN* markets. Japan is currently Adobe's largest overseas customer, in large part b/c Adobe has better Japanese language support than any competitor. Adobe is not about to abandon that market.
Hi, I'm Adobe, and watch me shoot myself in the foot!
By eliminating their products from Asian markets, they will be increasing demand for such a product in that region and removing themselves from the list of competitors!
Now some entrepreneurial code wizards from Asia have the perfect opportunity to introduce new software to that region. Don't forget the Asia is one of the fastest growing technology markets in the world and an up-and-coming tech powerhouse. Maybe it won't be long before they turn around and sell their software to the US?
I am not a zealot for Open Source Software. I use it when it makes sense, I purchase software when it makes sense. I do admit that I also use software that is not free or Open and do not pay for it.
I think piracy will only end when the software is opened up, and that might be the only reason that Open Sourced Software like Linux will not only survive, but take large strides in the market. As MS and Adobe and others find ways to cut off the rest of the world from their software, those that cannot afford it (which is the majority of computer users, let's face it) will turn to the free alternatives.
They stuck me in an institution, said it was the only solution, to...protect me from the enemy, myself
screw you adobe, you suck, and yeah i have premier, photoshop, after effects, and all that crap, and they all came in ONE CD, and cost me $2!!! (greenhills in .ph is the place to shop for cheap software) i ain't using it coz it sucks, but it's available for all my friends, take THAT!
Resources put into software development are what economists refer to as "sunk costs". They shouldn't affect decisions regarding the price of a final consumer product after the fact. Only the market value should determine that. If a product requires more resources to produce than the market value for that product, it will simply not be produced.
Logically, it follows that piracy shouldn't have *any* effect on Adobe's decision to continue producing for Asian markets. The only question they should ask is "Is it profitable to sell in Asia?"
Adobe can't reasonably take into account the "cost" of piracy when making a such a decision.
-- "The reward of suffering is experience." - Aeschylus
In most cases, a handshake means more than a contract. Contracts in china are worth S_ _T. The government isn't going to enforce a law the entire country percieves as stupid. The chinese culture believes in practicality and utility. Take the phrase "Kung-fu". It isn't just martial arts. The phrase is applied to anyone who has refined/exceptional skill and strong work ethic. A businessman can be said to have "kung-fu" in the art of negotiation. A teacher can have "kung-fu" in inspiring students.
Adobe needs to first learn about the culture and understand it before they try to dictate how chinese people should behave. Chinese are very proud of the culture, history and tradition. No self respecting chinese is going to roll over just because adobe says so.
the key point as others have pointed out is LOCALIZED versions.
There is more to a localized application than just being able to bang in non-english text. Localized versions take into account numbering systems, date schemes, etc.
I worked in the Japanese market for 10 years, you couldn't effectively use English Excel since it didn't know which year was Heisei and which year was Showa. Absolutely required for local reports.
out of the 300 people, 100 were dirty and poor, 150 had crappy slave jobs to pay for education, 40 were idiots, and didn't have to work, and 10 were elite. NO ONE paid for software.
adobe should stop marketing software to college kids.
MARIJUANA, SHROOMS, X: ONLINE?! - E
Alliance estimates that more than half of the software in use in Asia is illegally copied, resulting in annual losses of more than $4 billion for the software industry.
Of course, like every other piracy report, they are assuming that every person who has a copy of their software would have purchased it if they couldn't get their hands on it. Which of course isn't true at all, the people would have just moved on to another piece of software.
I'm surprised at a move like this. After all, it was piracy that largely resulted in Adobe getting the market share they have now.
Not really.
But there are a large number of ev1l h4x0rZ over there who *can* - and they'll simply *translate* the software.
Not possible? Not bloody likely - US citizens already translate Asian products (Anime, games, software, etc.). To think that they won't translate from English to random language X is just.. Funny.
Oh well, good for Adobe. Remember Dmitry, motherfucks.
That sucks.
All those chinks are the same.
Can China Pull An India?
I particularly found this posting and the followup humorous given the context of this.
This will encourage the 'asian market' to learn English. Then they can start pirating American movies too. Er.. wait, they already do.
Attention all employees:
We will now cut off our nose to spite our face.
That is all,
The Management
Asia Pacific is pretty much the biggest mostly-untapped customer base on the planet. If I were an Adobe shareholder, I'd be very much concerned by these statements. Compare "losses" from piracy, which won't show up on your balance sheets, versus profits from the folks who WILL deal. Not to mention the vast sums you could potentially bring in from services and hardware, which can't be pirated...
I'm trying to teach myself to set people on fire with my mind... Is it hot in here?
Then try buying the low priced high quality photoediting software called Photoshop Elements ($99) or some of the cheaper but pretty good ones for $50! Or use GIMP for free! Geez, anything to justify stealing...
Contrary to popular belief, coding is not all free blow-jobs and beer. Those things cost MONEY!
If you are a chinese and don't understand English, the only legal way to create pdf files on Windows now vanishes. The only way to create pdf files using localized software is to install an alternative OS and use ps2pdf.
Right on the money (pun intended). Only in conditions where supply and demand are out of whack does a black market develop. Software is HIGHLY overpriced and that is the reason for rampant piracy. No other explanation is valid. As every other market has proven, if you price it right, people will buy it.
English or European language software cannot cope with the double-byte characters for Japanese, Korean, and Chinese.
You mean "Poorly written English or European language software cannot cope with the double-byte characters for Japanese, Korean, and Chinese." For example, the Mozilla browser I'm typing this comment into supports Chinese, Japanese, Korean, Arabic, Hebrew, and several other languages that have their own scripts. Windows 2000 and Windows XP include full support for Unicode text processing, input methods for the double-byte languages are just a Windows Update away, and it's trivial to hack localized resource strings into an application.
Will I retire or break 10K?
The Adobe China/Asia region president did an interview with a Chinese newspaper, and clarified the issue. There was no quitting in the market for the company whatsoever.
But how can you look at ZDnet for journalism anyway?
The question is how lack of an Asian version of the product will affect the market. Will Chinese users, for example, start to use English or Japanese versions?
What's the Chinese word for "gimp"? Seriously, many people who have learned both GIMP and Photoshop Elements have commented that GIMP has a shorter learning curve than Photoshop Elements unless you already know Photoshop Elements. (Photoshop Elements is Photoshop 6 minus prepress.)
Does this mean that Chinese OS X users will be, literally, up the creek?
No.
Will I retire or break 10K?
After reading all these posts, there is one thing that I find rather humorous. When people come on here and say that the Asian countries don't respect IP laws of the US so they should not be allowed to have access to US software that Americans worked so hard to produce...but then these same people turn around and download MP3s illegally breaking the same IP laws that they claim the Asian nations don't respect. It is the exact definition of being hypocritical.
/. posting from last week, they want to become what India has become in terms of a service industry. By stepping out of this market and allowing another company to fill the gap, it will be even harder for them to reclaim their position later on. This is especially true later on when China totally turns around and becomes a service industry producing softwares and we become a consumer of their products.
Adobe has the right and power to produce whatever product that will get the most return on investments. If they have made this decision to not localize Adobe products than [hopefully] they have put in much research into this showing that their ROI is not worth it. However, Asia, especially China, is starting to become a even bigger hotbed for technology, in terms of production and consumption. In the
_______________________________
"I'm not Conceited...I'm just a realist..."
When it comes to products like Photoshop I really belive that Adobe and others should adopt personal use licenses. They already have education licenses which is a great idea but I think they need to also have a discounted price for those who will not be making money off of their use of the program.
It just does not seem fair that I have to pay the same amount of money for Photoshop as a company that will be making 10's if not 100's of thousands of dollars off of their purchase.
Many developers have adopted this type of license. I know it can't be fully enforced, no license can, but if someone just wants to play with Photoshop or make their own personal artwork that they will never profit from, they should be able to pay a significantly discounted price compared to a business.
If Adobe goes through with this, you can be assured that other companies will follow. Know what that means? Asian pirates will just start swapping and selling English-language versions, unless Asian companies can create and poularize comparable software. In the long run, this will lead to an asian technical elite that uses english more and more, as well as a great boost for english among asian college students. This will help solidfy English as the common language for international business, and put Americans in an even better position.
Shweeet.
The numbers aren't even right for one. Anybody that is paying attention to China knows that their entry into the WTO opens up a huge market. I see an emotional argument that appears to be racist. I'm not saying I support the Chinese Government or it's policies but I'm not going to condemn a nation and it's people for it's leadership or I'd have to completely condemn mine own for some past and present polcies. How many other countries had abolished slavery before the US did? Do you know the dates for that? How many US states wanted to keep it and went to war over "states rights". What was Davy Crocket fighting for at the Alamo? I'll give you a hint, Mexico had abolished slavery.
Since you can't make any money off selling individual copies of software because of piracy concerns. Bundle your software with OEM's and have them pay you a cut.
Do you actually think gillette makes money from selling you a razor? No it's the blades... .
I'm not going to pretend the GIMP is as powerful as Photoshop. (It isn't.)
What does Photoshop Elements do that GIMP doesn't? Photoshop Elements is Photoshop without high-end prepress and without the expensive PANTONE royalties that prepress brings, but retaining all the ability to photoshop "ALL YOUR BASE ARE BELONG TO US" onto a road sign.
But lots of people buy (or copy) Photoshop who don't need all that, and the GIMP would suit their needs.
You're right. GIMP for Windows doesn't compete with $600 Photoshop. It competes with $100 Photoshop Elements (successor to Photoshop LE and PhotoDeluxe) and with $100 Paint Shop Pro. Why people who would be happy with $100 Photoshop Elements or with GIMP go and pirate $600 Photoshop Professional beats me.
Will I retire or break 10K?
First post!
Except that I don't have to brutalize anybody to get the latest Photoshop ISO. Such weak metaphors make you appear alot less insightful than you imagine yourself to be.
You're right - MS pathologically cannot allow another company have a thriving software business. It's amazing they've allowed it for this long.
Adobe wins because, as mentioned before, they save on development costs and don't lose much in sales anyway.
China wins because if they do want to use Adobe products (pirated or otherwise) they have to use the English version, and anything that reinforces the de facto standard of English in the IT world is a good thing. You'll understand if you ever have to deal with a mixed-language environment of Simplified Chinese (PRC), Traditional Chinese (Taiwan/HK) and English versions of software, none of which really "play nice" with each other.
Plus, it's especially hard to port technical documents to Chinese, which isn't an alphabet- or syllable-based language. So, to translate something technical, they have to either use homophones (Chinese characters that sound like their English equivalents, but mean something completely different), or string together two or more characters to create a very loose, easily misinterpreted translation.
Hey, working in China, I hope more companies follow Adobe's example... =)
Let the producers prosper, and no man should consume more than he can produce.
I love those principles. But they have nothing to do with this, I believe. Nor mp3, nor DeCss.
Yes, at first it appears to be 'stealing'. At first it seems like people are taking that which they have not earned. But ownership is far more intrinsic than mere national divides or even governmental laws. What really separates us from Asia? Or you from your patriot nation? With liberal discourse via electronic communications, the national divide (and national law) is meaningless. At least in terms of exchange of data.
Governments play a small role in defining boundaries, with their little 'currencies' and 'intellectual property' guarantees. But in the face of a fully (or majorly) interconnected world, these are meaningless. Adobe's claims to ownership are only valid if backed by big guns. Otherwise, the materials they produce become like oxygen. Freely available to all, and fair game. Not because someone perceives them to be, but because they are. A simple minded search bot could retrieve the material for its master, given the right keywords.
Contemporary electronic ownership is based on the ability to encrypt, and nothing else. If you cannot produce a sufficient algorithm, kiss your widespread ownership rights goodbye. Yeah, you could claim rights based on your sovereign nation, but how far will it go? Cutt off Asia, but there are millions of human agents in between who will facilitate the transfer. Even within, millions of schoolkids will take your hard-earned music and send it to their buddies.
And of course, nothing is unbreakable. "I swear --by my life and by my love of it -- that I will never live for the sake of another man, nor ask another man to live for mine." But does the sake of other men lie with national laws, or the law of nature? If nature, then electronic data is widely available, like grass or cows used to be. This realm is still carnivoreous, grabbing any raw flesh it can find.
Whether this ceases to be in the future is another matter. America could surely block off all internet communications with the rest of the world, to protect the integrity of its copyright laws. In fact, any blockage is possible. I block you from my real email address. But once you hack in, and find me, it's my slip, and I have just given up my right to that information.
Oh wait I have no morals or religion. Wow, it's nice being free... lol
Why should I price software that I create at anything other than the price that I want.
Because you want to sell it?
If you can't afford it, then tough, don't use it.
People use a different approach. They use it. But since they can't afford it, you haven't lost any money.
Nobody has a god given right to software.
Not that i have talked to God, but you are probably right. But then nobody has a god given right to get money either, that's a convention invented by some people, and some people don't agree.
Though the vast masses who copy programs don't generaly steal anything else, they just reason, that since they can't afford the program nothing will be lost if they do make a program.
Me? The only adobe program on my machines is their free pdf reader, i can't stand their products, their interfaces are too damn small.
If Google really cared they would fix Android Chrome to reflow text, instead of discriminating
Except that US$99 and US$50 is still more than some people make in a week or a month. You can't sell softare in forign contries and still expect to charge US prices.
How dare they not work more for a living. Lazy, pirating bastards!
Anything to justify over-priced software.
property? Sometimes.
Like.. if I kno wit's going to sit on a shelf in a warehouse for 50 years, then get thrown in the garbage, I'll take it. I'm not 'depriving'anyone of anything.
Software.... if I can't afford said software, then I'm not really hurting them by not paying for it, becaues I CANNOT buy it in the first place.
I think it's NEWS to those who are curious (like myself) and those who have an interest in the products in question. Some might think that it doesn't make a good DEBATE, although I've seen some interesting points of view here.
Your comparing two very different things. People don't need Photoshop to edit images, hell most people couldn't make use of most of the features even if the package was free. Photoshop and applications in its price range (and higher) are priced based on the work that went into them and the value of what comes out.
You just said that most people couldn't figure out how to use the program, so the value of what comes out its closed to zero - hence the price should be close to zero??
The first postulate, that the price is based on the work that goes into them may be believed by some, but a lot of people don't believe that at all. They feel it is an outright lie, and that the producers are mostly selling to companies whome they believe can pay through the nose, and so they MAKE them. Ie, the price is WAY overrated. - Right or wrong, this is very much a motivating factor.
Bottom line, if you think the software costs too much then you don't really need it.
Nonsense, and you should know.
Dont bitch and moan about the cost of Photoshop and don't condone the piracy of the software.
People have a right to complain about anything they feel it is right to complain about, and a duty to oppose that which they think is amoral.
If Google really cared they would fix Android Chrome to reflow text, instead of discriminating
Who said anything about brutalize?
GPL Deconstructed
Look, for 15 years US software houses have been charging nearly ten times as much money as they should for their applications.
I know this is hard to grasp for some of the socialists on Slashdot, but: It isn't one man's business to tell another what he should charge for a product. (note, I don't mean to imply that you are a socialist, but a lot of people on Slashdot are and just won't admit it).
The only legitimate exception to that is when the product is a government granted monopoly. Notice, just because you are selling IP does *not* mean that you have a government monopoly. The market is still competitive because comparable products can still enter the market.
Now if I were Adobe I would try lowering the price to something comensurate with the salary of the average Chinese citizen to see if I could make profit on larger volume. That's just my opinion though. There is absolutely no moral imperitive for anybody to lower the price on software.
Too many people on Slashdot look at high-priced software as a problem. By gosh! It's not a problem at all: IT'S AN OPPORTUNITY. Let that sink in. Whenever there is an overpriced product in any market, IT'S AN OPPORTUNITY FOR COMPETITORS TO ENTER.
This is exactly what Be Inc. tried to do, and as much as people would like to think it was killed by MSFT, it wasn't: It was killed by Free Software. Free Software makes enterring the market look like a really bad idea. If you want to kill competition, just give the product away for nothing--Internet Explorer.
So, if you think that any product (not just Chinese PhotoShop) is over-priced, here is what you do: Attempt to enter the market at a lower price. Either you will discover that it can't be done (which means that the product was fairly priced) or you will do it (which means that you are good at business).
Now, Slashdot is supposed to be a site for nerds. What are nerds? Well, they are *supposed* to be the people who produce this stuff. So, instead of complaining, why don't you have a go and enter the market?
For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
Good troll, jerk. Read an economics book.
...because their taxes are so low compared to the rest of the world. Of course they still bitch and moan about it because they don't know much about other countries.
If Google really cared they would fix Android Chrome to reflow text, instead of discriminating
I didn't bother pulling Photoshop into a resource editor, but I wouldn't doubt that it uses string resources to implement the internationalization, so the pirates will most likely just need to edit the resources on the US version to make their own version.
Actually they tend not too, for example they lack the ability to mask out part of an image to run a unsharp mask on (many even lack the full unsharp mask). Many also lack multiple levels of undo (which is far more useful to the untrained dabbler). Many also have no layer support either.
The GIMP is a notable exception, it comes quite close to PhotoShop in most areas. It doesn't look to have the same color space handling, and last I tried it the trace tool was nowhere near as good. However it is amazingly cheaper then PhotoShop :-)
That part is true, something being overpriced seldom gives one the right to steal it (food might be an exception - it is at least an understandable).
There is no amount of ridiculous crap that you can spin me to tell me that that market is stealing.
You think that Adobe got into this market to be a goodwill ambassador? No they got in it because they like to make programs and be rewarded handsomely for it. After all this is software, and you people talk about them like they are arms dealers. They are not hurting humanity by selling software, stop screaming at them.
Adobe did a pretty legitimate job (which of course nobody here bothers to notice) in estimating software losses. They took the development costs for porting to Asian languages and subtracted how much revenue it generated. It came out negative, hence, they are actually losing money.
This is putting a spin on it. Its more truthfull to say: They are spending more money than they earn. That could be due to other factors.
If Google really cared they would fix Android Chrome to reflow text, instead of discriminating
Just as well you aren't in charge of anything important. It doesn't matter how many people there are in a country, it matters how many people have computers and how many of those can afford to pay the required price for the software (and are prepared to do so). Hmmm, easy to see how 'brilliant' you are...
Phillip.
Property for sale in Nice, France
I know this is hard to grasp for some of the socialists on Slashdot, but: It isn't one man's business to tell another what he should charge for a product. (note, I don't mean to imply that you are a socialist, but a lot of people on Slashdot are and just won't admit it).
The only legitimate exception to that is when the product is a government granted monopoly.
Or, if I may paraphrase, "It isn't one man's business to tell another what he should charge, unless the product is distributed in a socialist manner." Brilliant!
If JASC (and I have no idea who JASC is,
http://www.jasc.com/ the producers of Paint Shop Pro (among a few other things) its very nice, and one i use (legit) - their support people are idiots, but then that seems the way support is these days, money or not.
If Google really cared they would fix Android Chrome to reflow text, instead of discriminating
...and "funny" too.
These posts are why Slashdot is worthwhile. Not the "news".
I think that Adobe is obviously doing the right thing, after all, they are not trying to stop the piracy (and IT IS PIRACY, enough said) they are removing the incentive to pirate. They are not doing anything aggressive, they are just walking away from the cheaters (in this case, it appears to be the whole frickin' society). This is an honorable approach in a dishonorable situation.
Many posts here have seemed to bring up these dishonorable practices as though they are the exception. Unfortunately in this case, they are the rule of 90% of the software users there. Entire multinational corporations are cheating because they can. Stealing. Like the idea of paying for goods and services is somehow alien to these corporations.
Yes, I have paid for my software. I plunked down my coin for Wolfenstein. I have payed up. You should too. It is pathetic to hear these cheap justifications.
Evil Asians pirate programs from Adobe.
Adobe says "We'll stop selling them to you if you keep pirateing them!"
Hm... no wait...
Adobe stops selling Asian versions of their program since their translater wants millions in salery.
Evil Asians priate programs from Adobe in a langauge they don't understand.
Evil Asians learn english.
Evil Asians keep pirating programs from Adobe.
Adobe starts marketing Photoshop on Mars
If Google really cared they would fix Android Chrome to reflow text, instead of discriminating
Smart move!!!
You can see book distributors doing this, when the booksellers have gotten smart. Textbooks cost a lot in the US, but are cheap in Asia. Why? Becuase distributors lower the price significantly to let the poorer nations pay for what they want, at a reasonable price. Often the binding is cheaper and more "mass produced". Sure they make less profit, but at least everyone is happy.
Remember boy, you can't ride a wave a when the surf is down, but you can at least keep aflost!
When are going to withdraw from the US market?
I believe Adobe is run by a bunch of scum! They used to be a really cool company, but nowadays, they're just getting people arrested and withdrawing from the Asian market because they're racist! Why are they racist, you ask?! Well, simply because they're saying that Asians are thieves, that Asians pirate more software than, say, Whites or Latinos or Indians or something. That's why! I think the community should get together and bring back the "BoycottAdobe" website!
On the other hand, perhaps it would be benificial to all parties involved if some representatives from these "Asian" countries got together with Adobe management and knocked some sense into them through their thick skulls, because making, say, 50% profit because of piracy is better than making no profit at all because you're not even SELLING in the region, you IDIOTS!!!!
On the other hand, when Adobe walks away from a market just like that, without seeking further solutions, that is not a crime. Just pure plain lack of vision and stupidity.
In my dealings with Asian languages, I have found PDF to be particularly helpful. PDF is a godsend after all of your formatting gets killed when you move from EUC to Shift-JIS. In addition I have seen some amazing computer produced art out of Asia. By pulling out of this market, lots of talented artists will be left in backwater (lets face it, no matter how good Gimp is, Photoshop is still the gold standard for the industry). Oh well...
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
Always keep the asian language versions several behind the latest release.
I know this is hard to grasp for some of the socialists on Slashdot, but: It isn't one man's business to tell another what he should charge for a product. (note, I don't mean to imply that you are a socialist, but a lot of people on Slashdot are and just won't admit it).
As a consumer, it IS my right to tell someone his price is too high. It's called capitalism.
I wonder if someone in Redmond just said in slow motion... Ohhhhhh shhiiiiiiiiitttt.
Since Adobe is being pirated out of a profit anyway they have nothing to lose. I wonder what percentage of illegit copies of Photoshop are running on legit copies of Windows? Oh wait, they can still fire up paint.exe. :)
You know just like the newly emotional commander Data when the enterprise crashed to the ground.... "ooooooohhhhh shhhhiiitttt".
I enjoyed that way to much, perhaps I'm mental or somthing.
Novel theory: Modern Man evolved from psychopath
You did. Twice in this thread have you compared software piracy with assaulting and robbing others physically, making the world a shittier place blah blah blah. Which has sweet fuck all to do with software piracy.
Adobe might very well stop internationalizing some of their products (like Photoshop), but I am sure they have an agenda for the Asian market.
Under capitalism man exploits man. Under communism it's the other way around.
Consumers don't tell businesses what the price should be. They either buy or don't buy. In response to that the producers either reduce the price or stop selling the product. That's capitalism. If consumers had the right to tell producers what the price should be, they would be dictating the price, and historicly they tend to dictate as low as they can. In the extreme case they dictate as low as possible and you end up with a broken Soviet style system.
In my previous post, I was criticizing the moralization from the Left, not the action of the market. Adam Smith called the market the "invisible hand" not the "obnoxious baby who keeps crying 'gimme, gimme, gimme'".
I think we probably agree on all this. It's just that you either misunderstood the semantics of my previous post, which is forgiveable; or perhaps you are just being difficult which sucks, but online forums are full of people who like to be difficult.
For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
Why not? It's not as if the businessman must actually follow the advice right? Doesn't (potential) consumer feedback factor in somewhere?
I once had to buy MS Office that way because of some problems with my notebook whilst travelling in Central Asia. I needed to reinstall but the real licensed s/w CDs were in Germany. So I bought a local copy and it was fine. I kept my keyt rather than using the one enclosed, so I guess it was ok.
Only one difference, the pirates actually include the service packs on the distribution CD to make it easier to bring stuff up to date.
See my journal, I write things there
Come back with another argument for the blatant price gouging of the software industry.
For years Photoshop had neither layers or multiple undo, and it still sold for $600. The value is almost entirely on the press side, not the doohickies.
The fact is that there's no incentive to produce a $50 paint program because your target market is too busy pirating Photoshop. For simlar reasons, there's no real incentive for anyone to get the gimp working properly (natively) on Windows/Mac.
Adobe's software is way too expensive for the many that pirate their software. Imagine if in the States you had to pay upwards of 10 grand per user license for Photoshop or whatever. That's the situation we face in Asia.
This goes for all other software including DVDs, videos etc. People here want to use it or view it but to pay US dollar prices for it is simply out of the reach of most people here.
The marginal cost of producing a single piece of software is pretty tiny. Software companies do not have to charge exorbitant amounts. In the long run, you stop the piracy by pricing it on levels everyone can afford.
Until Asian people get a clue about copyright and start honoring intellectual property and respecting same, they deserve to have EVERYONE pull the fuck out, and let them starve for software. Until they learn to play by the rules, fuck'em.
Over a decade ago, Autodesk faced the same problem. The English version of AutoCAD was #1 in the USSR, but the copies were mostly pirated. So Autodesk cut a deal with the USSR for a bulk buy of a custom Cyrillic version. That brought in a revenue stream, and the USSR got a version that their non-English speakers could use.
If they think developing Asian versions is costly and is not making money, of course they can leave that market as they want. And piracy would be a perfect excuse.
In a very significant way, the ability to sell copies of software on a profit-per-copy basis is very much a product of government fiat.
It's only through the artifical imposition of copyright that software producers can charge per copy. It's artificial, because having sold it to one party, that party would otherwise be able to give an identical product to a third party without depriving themselves of it.
Copyright is a comprimise, used to encourage the creation of intellectual property - it's perfectly legitimate to question where this comprimise ought to be taken, or whether or not it is in fact of net benefit to society.
Not that I claim that these are necessarily viable, but there do exist alternatives to the artificial imposition of copyright.
One is support through taxation in order to add to the capabilities and richness of society. I don't really expect this one to be popular on Slashdot :) But it does correspond to arts grants and the like. In fact, it is siginificantly better than a grant to support a performance or art installation: software's easy and nearly-free duplication ensure that it can benefit a very large number of people very easily.
This form of funding already exists for many people involved in the creative arts, and in a slightly different form, for those involved in research at public Universities and the like.
The second major alternative is to treat software creation like a service (which it is.) If a company or consortium feel they could benefit from the creation of software package, they could (and in fact can right now of course) go out and commision that package. So the software may be copied by third parties? I imagine in many circumstances this won't take away from the original benefit acrued by the commisioners of the software, and that in the remainder of cases it is could be protected in the same way that trade secrets already are.
Given that these two forms of IP creation are already extant in industry, it doesn't seem unreasonable that they could work for software as well.
This is only addressing one of your points, and then tangentially - but I feel it's important to keep in mind that copyright is very much an artificial construction, and as such, needs to be carefully weighed in terms of the benefits and hindrances it bestows upon society at large.
why is this -1? it's true what he says. oooh yeah i forgot, slashdot is american :) go fuck yourself.
... kinda bad...
but i'm torn on the issue. it's a good or bad thing..
If it wern't for piracy, most of us here in Malaysia would never have had our hands on such great software as photoshop, where each copy would otherwise cost more then our median monthly income.
but then again, having adobe out of asia would mean that tech support for adobe in asia will get much worse and it might hurt sales considering that most publishing houses that use adobe aoftware will have less incentive to buy orginal, considering the problems with support and such...
Sometimes I wish I was a plumber, then I'd know how to deal with other people's shit.
if adobe thinks that could stop piracy. they should come to my country ; Indonesia.
over here you could go to big legitimate shopping malls and found store/shops that sells all kind of CD (macromedia,microsoft,adobe,playstation,sega or whatever) only for Rp10.000 (US $1.00)
it gets even worse on the street, where you could buy it with a bargain price $5 for 6 CDs.
no local language version? no problem. most of us speak english too anyway (if we dont, then we wouldnt be able to use a computer know do we?)
Its not that i support piracy, but its kinda ridiculous to go to a legit microsoft dealer and purchase windowsXP for $200 (notice that i dont even know the real price?) when i can get them for a friggin dollar.
if they still interest on asian market, then they probably should realize that we dont have the kind of money you americans have. i and most of other students here couldnt afford to throw $200 for say...a windowzeXP. that kind of money are my parent`s month salary.
and the indonesian programmers,hackers,reverse enginers dont get to much salary either. so they make extra money by cracking and distributing american/european pirated softwares.
over here PC and internet is still a luxury, 200million people here, but only 40% know how to use a PC, and only half of the 40% have access to internet.
its like showing us an ice cream, tellin us it taste good, but not allowed us to eat it because we cant aford it
its sad, but what can we do when our government to busy being a corrupt SOB while our country drowned in debt and slaved by the IMF.
REVOLUTION NOW!!!
I know how poor most of the third world is...
I visited the Philippines some 20 years ago, where I saw that a whole family might travel (5 or more) on a 100cc motorcycle!
Its strange that the locals wholeheartedly take up activities that are declining in the west; things like smoking, etc, when THESE THINGS waste so much of their scarce money!!!!
--Of course, Western (mostly US & UK) Business actively PUSHES these products on them!
Examples like Powered Milk and Formulas where clean water is not universal, and the product is heavilly watered-down because of cost!
That really helps babies!!
..Not to mention TEL in petrol (phased out in the West), which dumps 53 tons of Lead in the air of Mexico City every day!!! Look up the archive at http://www.thenation.com
"prodded by Western lead manufacturers, some countries have even allowed the lead content in their gasoline to be increased."
.
(David Bowman, EVA near HUGE Monolithic Win-PC in orbit around Jupiter) "My God - its full of Malware!"
Really? Because there is a pretty good Windows port of the GIMP, a fair number of people working on the OSX version (it works under X11), and a lot of bad under $100 Windows Photo Paint programs (don't know about under $50). I assume the photo paint programs mostly survive because digital camera componies want to bundle something, and PhotoShop LE is too costly for some of them.
P.S. I think PhotoShop Elements is also about $100, I forget exactly what it leaves out, but lack of Actions makes it worthless to me.
Of couuse this got modded down. The post had inconvenient facts about a Democrat.
The same asswipes who own /. own newsforge.
First, even Adobe recognized that this was a case of their CEO having little social sophistication. From the article:
On Monday, Adobe confirmed Chizen's comments but downplayed the potential of abandoning Asian markets."
"Adobe remains committed to the Chinese market and to developing Chinese-version products,
This was not an issue of Adobe not making money on a Chinese version of its products, the company is making money. There are Chinese buyers who don't live in China, for example. This was an issue of a CEO with little social ability.
(Remember the Skylarov incident, and how that was handled in such a way as to give Adobe millions of dollars worth of bad publicity? What Skylarov did is legal in his country. He was only here for a technical conference. Also remember how Adobe treated the author of the program initially called Killustrator. It was handled with the same self-destructive crudeness.)
As Caudipteryx indicated, you would be amazed at how many of the products you use every day and find in the stores are made in China for U.S. companies.
The article said, "China's piracy rate is more than 90 percent." However, China's poverty rate may be (I'm guessing.) about 80 percent. Not all of the piracy represents lost sales. Although there is very rapid growth, most of the population are peasants.
Certainly, piracy is bad. However, there are many, many worse things going on in the world. It is backward to expect that the world be perfect just for one's own concerns, while ignoring that 20% of the people in the world don't have enough to eat, for example. It is a very imperfect world. Socially capable people find creative ways of dealing with this.
Slashdot readers who live in the U.S. should know that arrogance and insensitivity may cost them real money. Taking too much out of China, and putting too little in, may start a war between China and the U.S., ostensibly about Taiwan. The cost of this would come out of your pocket.
Bush's education improvements were
Adobe may be leaving Asian makets but their products won't be... Adobe is just leaving the risk behind. For example, a recent press release said that they chose Lionbridge, which will localize the company's recently released Illustrator 10 graphics software into Japanese, Traditional Chinese and Korean, "based on its ability to provide the Adobe team with improved quality and a more manageable localization process" (see press release) but I think it's simply an operation in risk management: Lionbridge invests the US$750,000 it would cost to produce the Asian versions of Illustrator 10 and then it also pays royalties. If the piracy rate is as high as the Business Software Association thinks it is -- 94 percent -- then Lionbridge takes all the risk while Adobe can only benefit. This meshes with Adobe's official position: "the company remains committed to developing Chinese-language versions of its products, despite comments reportedly made by its chief executive officer last week that Adobe could abandon the market because of software piracy in the region." (see IT World)
-Duke
Additional coverage: Mass High Tech, IT News (Australia)
Because nothing comes close to Photoshop, of course. Gimp doesn't support color management because of - guess who - Adobe's and other's patents on the matters. Not to mention a number of other features.
---If you can't trust a nerd, who can you trust?
Asshole theif.
Why do you think you have to upgrade? If OS9 and whatever apps you have for it do the job, why upgrade? No one is forcing you to get new software or hardware.
People commonly fall into that trap of "it's better so I have to upgrade" that sucks up so many IT dollars. No matter what my boss says, reading email does NOT warrant a 21" flat panel and a 1.8 GHz machine.
The idea that IP is not a natural right is currently one of the most popular ways to deconstruct it.
It may have been easy to ignore (or difficult to discern) the value of IP in Jefferson's time. In those days, IP constituted only a small part of the effort in most endevours. Patenting a new type of bridge design makes little sense when it takes 2 man-months to come up with the design, and 1000 man-years to actually build the bridge.
As technology has prorgressed, the proportion of intellectual labor to physical labor has shifted for some products. Wherever this occurs, ordinary people immediatly recognize the value of IP. Only a certain class of fashionable intellectuals seem to be interested in rationalizing things differently (the other class of people who tend to be AIP are warezers, but their arguments are hardly worth addressing).
It took the printing press to shift the labor balance from the hands to the head. Before then, copyright was a non-issue and the types of funding you describe were best because they were the only practical means.
Copyright does indeed protect a natural right--the right to benefit from one's own labor in the way one sees fit. Anything else is slavery.
This does not preclude the limitation of copyright. Copyright may be limited for the same reason wages may be taxed, but not for any other reason. This *does* preclude the elimination of copyright.
I shudder to think what kind of software we would get if it were all government funded, and for most people, choosing among 20 different shareware applications for $50/each is infinitely preferable to comissioning a custom app for $50,000.
For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
Why not write and maintain some patches that fix that to the official distribution and upload them to a server in a country that doesn't, shall we say, vigorously cooperate with patent infringement investigations? Maybe even put a nice disclaimer saying "Download from the USA or other countries signatory to the Berne convention is prohibited." (Makes it easier to find it with search engines.)
CEE5210S The signal SIGHUP was received.
Ooops! my numbers are screwy. The 900 mil is right though and the 80-120 mil is also right. A rather small market with weak buying power overall.
As far as manufacturing is concerned, yes, absolutely. The Chinese are fanatical nationalists, more so than even the Americans. They will kill themselves for the idea of China, do or die, right or wrong, making America's "manifest destiny" look like a mere prelude.
The problem is nothing to do with owning the media - what you do not have, and need, is a license from the copyright holder to *use* the copyrighted material by loading the code onto a computer and executing it. I don't know US law to this level of detail, but in many countries mere posession of the media is a minor offence or none at all, likely to be ignored.
:-).
:-)
Unlike with printed matter, software licensing is totally divorced from copies of media - it's perfectly possible and legal to write a software license that says you can only use the program on Wendesdays, or that you have to pay by the number of CPU-hours the code runs for (I have actually licensed CAE software under the latter).
A more down to earth example is DVD's - you may buy one for $19.95 in Best Buy, while Blockbuster has paid $50-$80 a pop for discs with the same sequence of bits in a slightly different wrapper; theirs came with a license to rent them out, yours didn't.
It's not uncommon for enterprise software media to be freely available - with the advent of CD-ROM, Digital (DEC) used to do this with VAX/VMS; anyone with any number of machines on software support got a full media set, including install kits for *all* VMS software, whether or not they had it licensed. Oracle install "media" is freely available - you can download their full product set from the technet web site.
Software is the ultimate in mass production goods - the cost is all R&D, and the unit manufacturing cost is effectively zero.
Licensing terms are all about price discrimination - they allow the licensor to systematically charge different licensees different amounts, based upon the value delivered, or more cynically, ability to pay, and thus maximise their revenue.
It's not even uncommon for enterprise *hardware* to work this way - Sun will ship you an E12000 with 32 CPU's installed, and only charge you for and activate 24 of them - and you can pay to activate more on request. When you consider that most of Sun's cost for these $2k-4k CPU chips is R&D, it makes perfect sense as an upsell opportunity.
Microsoft does the similar things with server-side software - the primary differences between basic MS-Exchange and the "enterprise" version is that the former (a) is at a much higher price point, and (b) is not crippled by having an arbitrary limit on the total amount of stored email (the former does, 18Gb I think - we of course use sendmail at work
For a wide range of software, up until now, per-desktop has been a pretty good metric as the sole axis of price discrimination; as internet-based services become more nebulous, expect to see a who range of more sophisticated enterprise pricing models you've never heard of make it down to the consumer, as well as completely new ones.
Combined with micropayment technologies, you may one day literally end up paying $0.003 every time you press a key in MS-Word-2008-.NET running in your Mozilla 3.0 browser on FreeBSD
I live in Denmark, and Linux is the only Danish language server operating system in the World. It's a real problem that you cannot get a Windows Terminal Server in a comprehensible language.
And so it is on a desktop, too. If there is no localized software for creating PDF-files on a Windows desktop, you have to hire somebody with knowledge of foreign languages, or get some other desktop that provides PDF functionality.
Try to imagine yourself operating a program made in finnish.
With Open Source, once somebody creates a localized piece of software, it will stay around for new users to use.
Agreed... Veeeery true.