Slashdot Mirror


Folding@Home Reports Success

msheppard writes "This Article describes how the folding@home distributed computing project is reporting that they used the data processed on client machines to "predict the folding rate and trajectory of the average molecule." Too bad Seti@Home hasn't had a hit yet."

241 of 325 comments (clear)

  1. Oh, *that* kind of folding. by Anonymous Coward · · Score: 4, Funny

    Did anyone else think this was yet another article about @Home going bankrupt?

  2. I fold at home by Anonymous Coward · · Score: 3, Funny

    I make all sorts of neat origami... Frogs, swans, flowers, all very lovely! I can also make some kick ass paper airplanes.

    1. Re:I fold at home by L.+VeGas · · Score: 4, Funny

      I tried to fold a molecule once, but I wasn't even able to fold a piece of paper eight times.

    2. Re:I fold at home by waferbuster · · Score: 1
      I folded once, when I was first learning. But the other guy had a crap hand... now I wait a little longer.

      Life is like a deck of cards...

      --
      I'm an individual! Just like everyone else!
    3. Re:I fold at home by Webmoth · · Score: 3, Interesting

      Go check out Yamaha Papercraft for some neat origami, including a few motorcycles.

      --
      Give me my freedom, and I'll take care of my own security, thank you.
  3. Folding @ Home page is by wherley · · Score: 4, Informative
  4. Links of course by DeadBugs · · Score: 5, Informative

    MSNBC Article.

    Folding@Home Home

    For the real info though check out the Forums

    Token link to how my team is doing.

    PRIME1

    --
    http://www.kubuntu.org/
    1. Re:Links of course by Anonymous Coward · · Score: 2, Informative

      Or, just go to Google News since that is where all of the story posts of late are coming from anyway.

    2. Re:Links of course by tuxedo-steve · · Score: 1

      Finally, link describing the manner of beast that is the parent comment's poster.

      --
      - SMJ - (It's not just a name: it's a bad aftertaste.)
    3. Re:Links of course by doru · · Score: 1
      Token link to how my team is doing.

      Uh huh, so you're the one at the bottom with a negative score ?

  5. Protein!!!! by The+Spelling+Nazi · · Score: 5, Funny
    "predict the folding rate and trajectory of the average molecule"

    That's average protein molecule, you insensitive clod!

    1. Re:Protein!!!! by Dutchmaan · · Score: 3, Funny

      No no no..

      Average molecules come in plain white bags with black stencil lettering "Molecules"

      They're located in the science section of your local grocery store.

    2. Re:Protein!!!! by Bob+McCown · · Score: 4, Funny

      Is that an unladen molecule?

    3. Re:Protein!!!! by Alranor · · Score: 4, Funny

      And is it African or European??

    4. Re:Protein!!!! by doomdog · · Score: 1

      Or possibly a binladen molecule?

  6. Its just a shame by dan+dan+the+dna+man · · Score: 4, Interesting

    that the sister project genome@home was so monumentally badly mismanaged that it effectively merged with folding@home a distinct project. I lost complete faith in the Pande group at that point along with a lot of other genome crunchers and switched all my CPU's back to SETI...

    --
    I don't read your sig, why do you read mine?
    1. Re:Its just a shame by mfos.org · · Score: 3, Insightful

      Try the Distributed folding project I like them because they have cooler client for linux

    2. Re:Its just a shame by Vijay+Pande · · Score: 4, Interesting

      sorry to hear you say that. Our emphasis has always been on the science (hence we have important results whereas the other "science" d.c. projects don't). What I would say to you is the results speak for themselves.

    3. Re:Its just a shame by skeedlelee · · Score: 1

      Note to most /.er's go ahead and ignore the below...

      Dr. Pande-

      Great study (see point number four of Good CS, Good Chemistry for what I particularily liked about it). I'm about to ask a bunch of scientific questions in the worst possible forum but what the hey...

      I really like intelligent application of physical chemistry here (specifically why you can do this with only a 20ns simulation). It seem obvious now (after reading the paper), but for some reason I'd never considered it, very clever. Three questions.

      1) Are you surprised that it worked at all? What with implicit solvent and the like I was surprised with the degree of success that you had. Specifically, it seems the usually important water entropy term would be next to impossible to account for. Not to read too far into the study, but do you thin this may mean that perhaps water entropy helps with stability (pretty hard to argue against these days) but has little effect on the forward rate in this case (ie. it affect mostly the unfolding here)? Or did I miss a subtle hydrophobic exposure penalty or something? I'm a bit out of date here, is 'generalized Born/surface area implicit solvent' how this is taken care of?

      2) You mentioned simulation of Abeta in another comment here. Did you catch the entertaining coincidences at last year's Biophysical Society? Specifically, two adjacent posters on Abeta. Someone from Ruth Nussinov's (I think it was DZ Gomara, but my memory may be lying to me) group got a structure of Abeta in the fiber by simulation which was surprisingly close to the structure that AT Petkova of Tycko's had by SSNMR. Both were rather preliminary but it was fun to see.

      3) Are you going to try and extract information from the trajectories themselves. It seems like you're just trying to cast everything in terms of an observable at this point (ie. paying particluar attention to only those trajectories that produce a structure close to your expected conformation). It seems that there should be some underlying information regarding the actual folding landscape (if you believe that stuff) in the trajectories them selves. I'm not sure how you would do it, ie. I can imagine how to make rules regarding local structure and then see what happens to the trajectories, but the reverse seems hard. Just wondering if you're after that sort of information, given that it seems like you might have a data set which actually permits it :) Okay, okay, back to work... S

    4. Re:Its just a shame by Vijay+Pande · · Score: 3, Interesting

      Implicit solvation is a good question and deserves a long discourse. The bottom line in my mind is that while it's a pretty harsh approximation, it's still not too bad. Actually, our work shows that. However, we are moving to explicit solvation anyway to compare for sure.

      I'm not sure how predictive the Nussinov work was considering the methodology.

      Finally, I agree that we need to mine the trajectories more. We're doing that, but perhaps more importantly, we will release the data for others to mine too!

      V

  7. Other uses for Distributed Computing by ksplatter · · Score: 5, Funny

    Maybe next we can use our screensavers to do something cool like search the web for potential stories to post on slashdot.

    1. Re:Other uses for Distributed Computing by Suppafly · · Score: 4, Interesting

      I'm surprised google hasn't come out with a spider at home client which goes out and searches the web caching sites as it goes. Sure distributed computing could help their venture and who doesn't love google?

    2. Re:Other uses for Distributed Computing by Atlantix · · Score: 5, Funny

      Who doesn't love google? Apparently some guy over at SearchKing!

      --A2K

    3. Re:Other uses for Distributed Computing by Duckz · · Score: 2

      This grub project is on the way to doing just that.

    4. Re:Other uses for Distributed Computing by labtec6 · · Score: 1

      Sure there are a couple that are doing it. Grub and OpenCola are two that do it.

    5. Re:Other uses for Distributed Computing by donutello · · Score: 2

      We need to come up with a good algorithm to determine which stories get posted multiple times.

      --
      Mmmm.. Donuts
    6. Re:Other uses for Distributed Computing by Reckless+Visionary · · Score: 2

      No, but my google toolbar did popup today and ask if it could use my spare cycles for its Google Compute feature. First beneficiary of my processor and google toolbar? That's right, folding@home.

      --
      I think I'll stop here.
    7. Re:Other uses for Distributed Computing by The_Guv'na · · Score: 1

      "...banned after a day of constant refreshing."

      They can give it but they can't take it! ;-)

      Ali

      (well, I have a little spare karma to smoke :-)

    8. Re:Other uses for Distributed Computing by Anonymous Coward · · Score: 1, Informative
      13. How come I have this Google Toolbar feature but my friend doesn't?

      Google is gradually releasing Google Compute to its users, so it is possible that your computer received the invitation but another computer you know of did not. This feature will eventually be released to all toolbar users. If you want to try it out beforehand please contact us at compute-support@google.com, and we will send you instructions on how to enable it on your machine.

      So does anyone have the instructions to enable this? I wasn't invited ...
    9. Re:Other uses for Distributed Computing by froseph · · Score: 1
      "I'm surprised google hasn't come out with a spider at home client which goes out and searches the web caching sites as it goes. Sure distributed computing could help their venture and who doesn't love google?"

      Perhaps you are thinking about grub?

    10. Re:Other uses for Distributed Computing by compwiz3688 · · Score: 1

      who doesn't love google?

      Initially China didn't. :)

  8. well... by gray+code · · Score: 5, Funny

    Too bad Seti@Home hasn't had a hit yet.

    Well, here's the thing: "we know molecules exist..."

    1. Re:well... by meteau · · Score: 5, Funny

      How do YOUUUU know? I can't see a molecule. It's just another one of those things like "germs" or "atoms" that the man keeps claiming are there. It's all about the health industry and their "oh you're sick with an 'infection' so here is some 'anti-biotics' to kill the big bad invisible 'germs'...whatever...

      --
      -- "You used your dictaphone to post, didn't you?"
    2. Re:well... by meteau · · Score: 1

      No doubt about this...

      If I were an alien (especially not from earth), I would not like all those big laser beams that seti uses pointed at me. I think I would swear.

      --
      -- "You used your dictaphone to post, didn't you?"
    3. Re:well... by T3kno · · Score: 2, Insightful

      With a universe the size of ours it is almost inconcievable that life doesn't exist elsewhere. On the other hand how special and unique does it make humanity if we are the ONLY life in the universe? God is truly wise, we are not.

      --
      (B) + (D) + (B) + (D) = (K) + (&)
    4. Re:well... by geigertube · · Score: 1

      There may be other intelligent life out there, but I'd wager that the odds of us finding a intelligent life form that just happens to develop technology in the same way we did, and then manageing to use a method of communicating that we would understand, is pretty small. Hell, we have a hard enough time trying to communicate with dolphins, and they are supposedly smarter than we are, at least according to the brain wrinkle benchmark. :/

    5. Re:well... by lacrymology.com · · Score: 1

      That sounds like an incredibly large program! The showDetails() funtion alone would be enormous:

      if( IsLookingInMicroscope )
      showMolecules();
      else if( IsLookingBehind )
      showStuffInBack();
      else if( IsLookingInMirror )
      if( IsNerd )
      showPastyWhiteChubbyPerson(); ...

      --

      #
      # Modus Ponens
      #
    6. Re:well... by Fascist+Christ · · Score: 1

      Scary... I understood your post better than the one you responded to.

      --
      TodayTM BillyJoelTM GoogleTMd for StitchTMes due to WindowsTM while RollerbladeTMing with an AppleTM and a PopsicleTM
    7. Re:well... by anthony_dipierro · · Score: 2

      With a universe the size of ours it is almost inconcievable that life doesn't exist elsewhere.

      Sure, but with a universe the size of ours it is almost inconcievable that we will actually find that life.

    8. Re:well... by Cujo · · Score: 1

      SETI @ Home has a couple of weaknesses. They are mindful of these, but you can only do so much:

      • They would probably only detect a signal from someone who was trying to communicate with us. If you believe that the speed of light is a true macroscopic speed limit for information, than thatlimits us to a sphere about 50 LY in radius, but which gets bigger every day.
      • They can't see the whole celestial sphere from Arecibo - only part of it, and only a small part of it at anyone time. Soon they'll be able to see more, but not all.
      --

      Helium balloons want to be free.

  9. dfold too! by nevershower · · Score: 5, Informative

    If you like F@H, check out Distributed Folding.

    --
    Look, ma! I'm a karma whore
    1. Re:dfold too! by hplasm · · Score: 4, Funny

      Never mind the folding, why is there no Ironing@Home to do it for me?

      --
      ...and he grinned, like a fox eating shit out of a wire brush.
  10. They could work on the screensaver version by jeblucas · · Score: 5, Insightful
    It's not exactly overwhelming. They have alpha-trace, ball and stick, wireframe, and most interesting (I guess) is space filled. This big blob rotates about once every second, and these two static images sit at the bottom "provided by COSM" and a bad "Folding@home" graphic. They look ugly. Plus I'm not too anxious to let the static images sit on my LCD screen overnight. (Please don't respond with a torrent of "u ID10T, u w0n7 hur7 ur scrn!!!!" --Call it voodoo.)

    SETI@home has much nicer graphics, albeit, a much dumber purpose. I'll stick with folding@home, but I wish they would pretty the damn thing up a little--at least on the Mac OS X platform.

    --
    blarg.
    1. Re:They could work on the screensaver version by Papineau · · Score: 2

      Plus I'm not too anxious to let the static images sit on my LCD screen overnight.

      Just turn off the damn screen if nobody will watch it for the night. No need to keep it powered on (even if it consumes less than a CRT). It'll probably live longer, and your monthly electricity bill will be a bit lower (~ $2).

      But that begs the question: is it possible to turn off the LCD of the new Macs? Or the CRT of the older iMacs? (not meant as flamebait, just asking because I don't have access to one)

    2. Re:They could work on the screensaver version by iainl · · Score: 1

      "(Please don't respond with a torrent of "u ID10T, u w0n7 hur7 ur scrn!!!!" --Call it voodoo.)"

      Actually, I was going to insult you for not just turning the screen off. Is that ok? ;-)

      --
      "I Know You Are But What Am I?"
    3. Re:They could work on the screensaver version by notanatheist · · Score: 1

      What's wrong with the commnad line? Then just run xmatrix -root and you're all set.

    4. Re:They could work on the screensaver version by Vijay+Pande · · Score: 3, Interesting

      in the latest clients, you can turn off the logos if you like. We've been pretty responsive to people's feature requests like that.

    5. Re:They could work on the screensaver version by Anonymous Coward · · Score: 1, Funny

      Well, Seti@Home has a few static images, as well. A friend of mine has a line right across his monitor about 2/3 of the way up from Seti.

    6. Re:They could work on the screensaver version by jeblucas · · Score: 1
      you can turn off the logos if you like.
      Not on my version. I'm using the OS X Screensaver (OSX-SS-3.12.pkg.tgz). My preferences limit me to name and team number, proxy or no, and what kind of protein I want to see. There's a lot of real estate on that Settings tab--maybe it's in development?

      <sheepish>I will sleep my display though. OS X 10.2 added a lot of functionality here (like the battery vs. AC Adapter settings), I should have checked it out.</sheepish>

      --
      blarg.
    7. Re:They could work on the screensaver version by An+Onerous+Coward · · Score: 1

      I noticed that I did get some burn-in on an older monitor from the SETI screensaver. It wasn't too noticeable; I had to load a pure white background before it was obvious.

      Now I've switched over to the command line, and I'm doubleplus happy.

      --

      You want the truthiness? You can't handle the truthiness!

    8. Re:They could work on the screensaver version by Mike1024 · · Score: 2

      Hey,

      these two static images sit at the bottom "provided by COSM" and a bad "Folding@home" graphic. They look ugly

      On the Windows version you can switch them off. On the 'preferences' window, 'advanced' tab, under 'graphics' there's a checkbox labeled 'logos enabled'. Deselect it and have no logos.

      Personally, I don't use the screensaver, though. I power down my screen. But that's just me.

      Don't know if the no logo option is there on the mac version, but it can'r hurt to look.

      Cheers,

      Michael

      --
      "Goodness me, how unlike the FBI to abuse the trust of the American public." -- The Onion
  11. So many to choose from! by TheGreenGoogler · · Score: 4, Interesting

    I hadn't realized how many distributed (grid) computing programs were out there... Check out Google Directory's list of links to distributed computing pages/projects here... Distributed Chess sounds very interesting!

    1. Re:So many to choose from! by De+Lemming · · Score: 5, Interesting

      You can find even more projects here. And they're ordered in categories, including science, mathematics, puzzles and even art (I really like the Electric Sheep Project).

      Bottomquark has reviewed a number of projects.

      And here is a community site of people participating in such projects.

    2. Re:So many to choose from! by whereiswaldo · · Score: 3, Interesting

      I almost signed up for a distributed computing project until I read the terms very carefully.

      What bothered me is they weren't responsible for damage to your computer, your data, they wouldn't guarantee the non-existence of virii, and they wouldn't tell you what kinds of things were being computed on your computer (it was processing power as a service - you'd get paid a measly amount to let them use your computer).

      How was I to know they wouldn't be using MY computer to do things I'd consider unethical or illegal?

      Whatever service you join, be SURE to read the fine print carefully beforehand.

    3. Re:So many to choose from! by Anonymous Coward · · Score: 1, Informative

      Unfortuantely, that's a common trait in software licenses.....

    4. Re:So many to choose from! by das_cookie · · Score: 3, Interesting

      How about United Devices? They have a project that's helping find a cancer cure. Plus, they have a really cool screen saver of a model of the current protein you're working on floating around your screen.

      --

      You! Yes, YOU! Out of the gene pool!

    5. Re:So many to choose from! by mortis_aeturnus · · Score: 2, Interesting
      It appears that the original Electric Sheep site has been replaced with a technology site of similar name.

      Now this is the new official site, and the only place I can find that has a source download.

    6. Re:So many to choose from! by teh*fink · · Score: 1

      mod this up, it deserves to be seen. another case of despicable people doing despicable things. http://draves.org/electricsheep/

      --
      "I DARE you to make less sense!"
    7. Re:So many to choose from! by overunderunderdone · · Score: 3, Insightful

      ... and even art

      I'm really suprised that none of the special-effects CG companies are using this. This kind of grid computing is great for rendering. I could see Pixar doing a really slick screen-saver & maybe letting you see the frames you rendered as a "reward" (maybe not all of them - don't want to give away too much of the movie to a geek with a super powerful computer). It would get their rendering done for free and would be a great promo for the movie. Who wouldn't go to see a movie they helped produce? More than once - " Here comes the frame I rendered... There! Did you see it? Just when Nemo swims up to that shark?... I did that!"

    8. Re:So many to choose from! by spot · · Score: 1
      Yes please mod it up! I am the creator and original owner of electric sheep and the story of how it was robbed from me is pretty sad.

      Here is the old site at its new address: http://draves.org/electricsheep

      But first a question: tell me how to mod anything! I don't know why but I no longer have the menu used to moderate anything. I have positive karma... Instead of the funny/interesting/stupid menu, i have something where i can make friend/foe choice. forget that!

    9. Re:So many to choose from! by mixmasta · · Score: 1

      Not so insightful when you realize that you might need to download a gigabyte of proprietary content and software before even starting the render on one frame.

      Unlikely from either a practical or security standpoint.

      --
      #6495ED - cornflower blue
    10. Re:So many to choose from! by overunderunderdone · · Score: 2

      Not so insightful when you realize that you might need to download a gigabyte of proprietary content and software before even starting the render on one frame.

      The fact that it is proprietary is irrelevant if the person giving it to you is the proprietor. I doubt they would care if you saw one frame prior to the release of the movie - if anything seeing just one frame would be a great "teaser". They could also just offload rather unimportant scenes in this way, the set up to the visual joke rather than the punchline. If one frame is too big, even better for the security of Woody & Buzz's big scene. Just have your particular computer rendering a portion of a frame. Rendering is already done with this kind of distributed computing. I'm sure it's possible to create a subset of RenderMan as part of the distributed client that would allow Pixar to offload some of their heavy-lifting without compromising their proprietary software, models or scenes.

    11. Re:So many to choose from! by mixmasta · · Score: 1

      huh?

      Unlike seti or the other clients mentioned here, this type of problem requires huge amounts of data and gigabytes of RAM that dwarfs the computation itself.

      Do you really think Pixar is willing to give anyone on the internet full quality Woody models, textures, _and_ Renderman? The crown jewels, as it were. That's absurd.

      Even if they were willing, i.e. we lived in some kind of parallel universe, the bandwidth required would still make it impractical. Why would they want to wait a week for you to download the scene and render it when they can do it locally in 6 hours?

      Even chopping each frame into little pieces would make things extremely complicated on already too complicated renders. Just because you render only a portion of the frame doesn't mean you don't need most of the full models, materials, etc... in memory (radiosity?). A giant complex pipeline would have to be developed to figure out exactly what each tile of the render needed, truncate all the elements, package it for download, and wait, wait wait, for someone out there to return the result.

      whew... unlike seti, cgi rendering typically has an artist/tech at the other end waiting for the answer. They don't have time to sit and wait days/weeks because 10 distributed renders just got stopped because the Joes just got back from lunch, or maybe one landed on a 386. As soon as the render comes in, it is tweeked and another render is submitted. If they have the capacity for the daily renders, then they have it for the final.

      This idea *might* be interesting for low res free content rendering on clients with dedicated OC12's but it isn't practical for anything else really, sorry. I don't mean to rain on your parade or anything, but were talking fantasy here.

      bye,

      --
      #6495ED - cornflower blue
    12. Re:So many to choose from! by overunderunderdone · · Score: 2

      unlike seti, cgi rendering typically has an artist/tech at the other end waiting for the answer. They don't have time to sit and wait days/weeks b

      I'm not talking about the fairly low-res rendering as the artists & modellers are working on the project, I'm talking about the final high-res render which already takes not weeks but months. The original Toy Story took nearly a year on a render farm with 100 computers. Each frame took 6-8 hours for the farm to render, each second of film had 24-frames. The data obviously is already being divied up in a way that each computer is NOT working on an entire frame. I'm not sure exactly how the data and computation is divied up but I wouldn't doubt that it is already being divided in a way that the actual tasks each computer is working on is pretty well abstracted from the models, textures etc. which are the "crown jewels" of Pixar's intellectual property. The fact that we are already talking about very long-term jobs (no artist is sitting at his desk waiting for the render so he can work on the next thing) and that the job is already handled in a distributed manner makes it seem like an ideal candidate for a really wide distributed computing solution. Instead of using 100 Sun or SGI machines for many months use the spare cycles of 100,000 PC's for a few weeks.

      Even chopping each frame into little pieces would make things extremely complicated on already too complicated renders. Just because you render only a portion of the frame doesn't mean you don't need most of the full models, materials, etc... in memory (radiosity?).

      I don't know how RenderMan handles this on the existing render farm but I do know that some distributed renders work in exactly this way. A master handles the big picture and sends each slave on the farm just the data and tasks it needs to do it's bit. I would imagine this would only work over the net if, as I said before, you are dividing up the computational work at a lower level that is both abstracted from the models, textures etc. and is capable of being divided up with finer granularity, sending out smaller chunks of work down smaller pipes to smaller computers but a whole lot more of them to get the work done much faster.

  12. Try this instead by mfos.org · · Score: 4, Funny

    Sorry, brain no workie this morning.

    go here instead

  13. API???? by ksplatter · · Score: 2, Interesting

    It would be cool if someone would develop an opensource API for this sort of thing. Then us lazy people out there could easily write programs to utilize this sort of processing power. I wouldn't mind harnessing the power of 200 computers to perform a Bubble Sort.

    1. Re:API???? by Duncan3 · · Score: 1

      Well, there is the API that Folding@home used. That might work.

      --
      - Adam L. Beberg - The Cosm Project - http://www.mithral.com/
  14. Article is incorrect... by motardo · · Score: 5, Interesting

    in saying that it's the first distributed computing success. Look at the success of the distributed.net project, they just recently cracked rc5-64, and have cracked several other ciphers before.

    1. Re:Article is incorrect... by hexxx · · Score: 1

      So what does cracking rc5-64 prove then?

      That it's breakable when you have a lot of computer power?
      Well guess what? We knew that before they broke the damn cipher.

      Sorry. I just can't see the point in this. Even SETI@Home provides more knowledge. Atleast we know that ET isn't VERY easy to find.

      --
      IVAN Nethack is not the king anymore.
    2. Re:Article is incorrect... by unicron · · Score: 2

      Distributed.Net was NOT about encryption. It was about proving that distributed computing applications have merit, encryption was just the chosen application to prove that. Also, during the rc5-64 run, math and logic errors were found in the algorithm, so it wasn't all brute force. If you honestly think that the application is invalid because no one country could put that many computers together to pose a threat to our security, you're wrong.

      --
      Finally, math books without any of that base 6 crap in them.
    3. Re:Article is incorrect... by hexxx · · Score: 1

      It's true that distributed.net was an important techinological step in distributed computing, but it's also true that their results are useless. The way they where achieved might be somewhat useful.

      I have to admit that cracking the cipher was pretty cool and it might have increased awarness about PGP and other ciphers, but at least now it's time to move on to something more useful...

      --
      IVAN Nethack is not the king anymore.
    4. Re:Article is incorrect... by thmitch · · Score: 1

      I noticed that comment in the article also. I think they are refering to the fact this is the first distributed project to get an article published in a scientific journal.

    5. Re:Article is incorrect... by Duncan3 · · Score: 1

      Actually RC5 was about getting the export restrictions removed. But what would I know ;)

      --
      - Adam L. Beberg - The Cosm Project - http://www.mithral.com/
    6. Re:Article is incorrect... by unicron · · Score: 2

      In all seriousness, apparently very little. How does your sentence even make sense? What aspect of RC5? The distrubted.net application of finding the key through brute force? The encryption itself? If the latter, how does that even begin to make sense? Which RC5 encryption level? 64? We aren't even really discussing encryption to begin with, we're discusssing distributed computing applications. I can't even begin to fathom the logic behind your sentence.

      --
      Finally, math books without any of that base 6 crap in them.
  15. Good CS, bad chemistry by the+gnat · · Score: 5, Interesting

    Okay, it's nice to see that distributed computing is finally becoming a useful tool. Nonetheless, I don't think there's anything particularly impressive about the biological results. The proteins they're folding are so small that most factors that affect the folding and conformation of the vast majority of proteins simply don't exist. When someone accurately predicts the structure of a normal globular protein at atomic resolution, I'll be impressed. When they can predict the structure of the F1F0 ATPase, then we can throw out crystallography- but it's not going to happen. (Ignoring for the moment that crystallography has it's own issues. . . at least it can show active sites and quaternary structure)

    Don't get me wrong, the geek half of me thinks that what they're doing is very cool (and far more interesting/useful than Seti@Home). But I don't think it's very relevant to biology, and I doubt it'll ever replace traditional methods. Computers have almost unlimited potential as an aid to experimental structural biology, but in silico protein folding is still a pipe dream and a hand-waving exercise. The theory is really cool, the practical applications are nearly zero.

    (Disclaimer: I don't have a PhD so I'm not very qualified in this field, but I do have a BS in biology and a fair amount of experience in programming and some knowledge of molecular simulation.)

    1. Re:Good CS, bad chemistry by photonic · · Score: 1

      There IS something impressive about this research. Sure, they started with some very tiny protein fragments that are biologically hardly interesting. But as the nature article (subscription probably required) shows, these tiny fragments can be synthesised and can be investigated. Once agreement between simulation and experiment is proven (which they claim), it is time to move on to the more interesting stuff.

      In the beginning they will probably investigate small proteins that are interesting to biophysics people (the fundamentals behind folding). Later on, when enough people switch over from SETI, they might be able to simulate real big proteins that are interesting to biologists.

      --
      karma police: arrest this man, he talks in maths; he buzzes like a fridge, he's like a detuned radio. [radiohead]
    2. Re:Good CS, bad chemistry by the+gnat · · Score: 3, Interesting

      They also have some prior knowledge of the tertiary structure of the protein they're simulating, by the way. So, all they've proved is that they can simulate the folding of a small protein and get results close to what experiment shows. This is a long way off from "we can predict the structure of proteins."

      Besides, it tells you nothing about enzymatic activity, interaction with other proteins, interaction with small molecules and ions. . . these are not easily simulated, and certainly aren't covered by their current method. The software they're actually using is fairly standard (I don't mean this in a bad way), and isn't really the type of thing that would be useful for, say, docking experiments.

      Frankly, I find David Baker's work at the U of Wasington to be far more impressive from the perspective of biology. (But still not good enough to replace Xray and NMR methods anytime before I retire.) He's not doing distributed computing though, so I guess it doesn't rise to Slashdot levels of sexiness.

    3. Re:Good CS, bad chemistry by k98sven · · Score: 4, Informative

      When they can predict the structure of the F1F0 ATPase, then we can throw out crystallography- but it's not going to happen.
      (Ignoring for the moment that crystallography has it's own issues. . . at least it can show active sites and quaternary structure)


      Well, for the first, we can't throw out crystallography even then. When you're doing a computer calculation, you are in the realm of theory. (even if you have arbitrary accuracy).

      You will still need to do experimental verifications now and then.

      At the moment, about 2/3 of known protein structures have been mapped through X-ray crystallography. At best the resolutions are about 1.8 Å, which is pretty good. So you can see quite a bit more than quaternary structure!

      The other third is done with NMR spectroscopy,
      usually with some powerful computing help to figure it out.

      And then there are a pitiful few,
      done with computers and experimental data.
      These structures also have the poorest accuracy.

      Note that computers will never, ever be able to figure out a protein structre ab initio. (i.e. without any info except the sequence)
      Do the math, say you have 100 amino acids, and you
      test say, 4 conformations for each, that's 4^100
      combinations to test.. and you test 10 million a second, it'll take you 5E45 years.
      Much older than the current universe.

      (Disclaimer: I do not -yet- have my PhD in computational biochemistry.. but I'm working on it..)

    4. Re:Good CS, bad chemistry by Vijay+Pande · · Score: 3, Insightful

      I think you're missing the point. This is not about structure prediction, it's about understanding HOW proteins fold -- info which will never come from Xray or NMR. In terms of practical applications, we're now running simulations of Alzheimer AB peptides to understand their misfolding properties.

    5. Re:Good CS, bad chemistry by the+gnat · · Score: 2

      Okay, that's fair. And I probably sounded way too harsh- I do think understanding HOW proteins fold is a great idea. Certainly some interesting work has been/is being done with prions as well, along similar lines. What I object to is the notion some uninformed people seem to hold that in a few years we'll routinely be guessing the structures of proteins correctly with computers. (I guess I read Slashdot too much, otherwise this might not bother me.) So my beef isn't (or shouldn't be) with this research, but with people who are participating in it for the wrong reasons.

      Sorry if I sound like a loose cannon. No offense intended- I liked the paper, really.

    6. Re:Good CS, bad chemistry by EvilSuggestions · · Score: 1

      Note that computers will never, ever be able to figure out a protein structre ab initio. (i.e. without any info except the sequence)

      Example of non-sequence info: The accuracy with which you can model the resultant structure of temperature-shocked chicken egg albumen proteins depends greatly on whether or not you choose to also model the frying pan.

      --
      "There is a thin line between ignorance and arrogance, and only I have managed to erase that line." - Dr. Science
    7. Re:Good CS, bad chemistry by skeedlelee · · Score: 3, Informative

      Given that you've almost stated the Levinthal paradox I'll assume you're familiar with it, but missed the point. Basically, it states that even in the simplest description of protein conformation (say 3 possible states each for 100 amino acids) can't be searched in a reasonable period of time, the shortest feasible time that a protein could sample a state in about 10^-13s. This works out to be ~10^27 years to check all the 3^100th states (borrowing Styer's description of this). This is clearly wrong, proteins fold in milliseconds (okay ns-100s of but you get my point). The clear conclusion is that proteins don't sample every conformation availible, or even any singificant fraction of them. There must be some fashion by which frequent short range and random long range contacts guide the protein into a 'pathway' of folding.

      The nifty thing with the folding@home study is that there were able to basically show that invoking a simple physical force field system was enough to get pathways, though they don't make too big a deal about this, maybe someone else has already done this, but I'd be surprised if they managed to do as many trajectories as were done here. I imagine it'll be a while before they process the trajectories to try and find actual pathways (very compute intensive), but the fact that they found a comparable rate (we're not talking global conformation here, these are kinetics) suggests that they may be sitting on top of an actual description of the folding pathway for this teeny protein. Spiffy!

    8. Re:Good CS, bad chemistry by slave · · Score: 1

      Crystallography produces a static 3D stucture of a molecule. These simulations produce the motion of the atoms within the molecule. These techinques are complimentary, not in competition. Even as the speed of computers and the level of theory increase, similiar advances may occur in the crystallographic field.

      I agree, however, the results in this paper are not earth shattering, but this is foundation for future work.

      As a computational chemist and given the nature of this forum, I must say it: "where is the source code?" Applications of this phase space sampling technique (IMHO, one of the best) extend to every molecule, not just proteins. I'd love to play with it and compare with any given MD simulation.

    9. Re:Good CS, bad chemistry by RandomCoil · · Score: 2
      Note that computers will never, ever be able to figure out a protein structre ab initio. (i.e. without any info except the sequence)

      If you're working on your Ph.D., you might want to abandon the use of the word "never" when it comes to what may be accomplished in the future. A 20-residue protein has already been folded from sequence information alone
    10. Re:Good CS, bad chemistry by exp(pi*sqrt(163)) · · Score: 1

      The catch is the complexity of the problem grows exponentially. I don't believe that predicting the folding of a tiny protein shows that we are any closer to predicting the folding of the kinds of proteins that would be useful to be able to predict. I think the time is better spent on SETI@home myself.

      --
      Doesn't it make you feel good to know that our freedoms are protected by politicans, lawyers and journalists.
    11. Re:Good CS, bad chemistry by k98sven · · Score: 1

      you might want to abandon the use of the word "never" when it comes to what may be accomplished in the future. A 20-residue protein has already been folded from sequence information alone.

      Well, it doesn't really invalidate my point, as I wrote, it scales exponentially, and 20 residues is very few.
      (barely qualifies as a protein, more a peptide :) )

      I suppose I'll rephrase that to "never, with current technology", it'll take something quite different from what we have today.

    12. Re:Good CS, bad chemistry by k98sven · · Score: 1

      True, proteins do not sample every conformation, they follow the nice path of lowest energy.

      Our problem is, that this potential surface depends on the position of the molecule, and the position of the molecule on the potential surface.
      (i.e. it's a big differential equation)

      And as with many differential equations, the end result is dependent on your starting value (or structure, in this case)

      So you still need experimental data. The MM (molecular mechanics) model used also needs experimental data, and my point wasn't that you can't calculate protein folding, only that experimental results are neccessary to do so.

    13. Re:Good CS, bad chemistry by RandomCoil · · Score: 2
      barely qualifies as a protein, more a peptide :)

      As long as you keep the word "barely" in that sentence, I won't have to call you out for a duel :)
  16. Re:And so what if SETI did get a hit? by Suppafly · · Score: 4, Insightful

    Amen. If you are going to use your spare cpu cycles for something, apply them to a good cause. Besides if you study much on the SETI project, they look at a very limited range of data of the odds of finding anything interesting are exponentially worse than you'd even think. At least the various folding projects and the think project from intel and other medically related go towards good causes where every bit of data helps the cause.

  17. Worthwhile... by guidemaker · · Score: 1

    It would be interesting to see a comparison between the numbers of users using seti@home versus these other systems. I find it just slightly depressing that a lot of people would rather look for possibly non-existent little green men than actively participate in the search for something that will benefit people in the very near future. I guess curing cancer isn't 1337 enough for some people.

  18. Re:And so what if SETI did get a hit? by Anonymous Coward · · Score: 1, Insightful

    SETI is a nice concept, and I don't wish for it to go away, but it is a waste of your spare CPU cycles.

    And who, exactly, are you to say what other people should be doing with their own spare CPU cycles on their own machines? Who died and made you dictator? Do you have any idea how many people paid the ultimate sacrifice so that free people in a free society can choose to do whatever they want with their selves and their own private property, without any constraints or impositions from governmental authority?

    Say NO to SETI and YES to Folding/Genome@Home.

    Uh huh. Sieg bloody heil, laddie.

  19. good place to start by emir · · Score: 3, Informative

    if you are intressted in distributed computing, good page to start with is http://www.aspenleaf.com/distributed/. there is info on every existing distributed computing project (both upcomming and existing), lots of articles on distributed computing and even links to books on distributed computing.

    --
    -- http://electronicintifada.net --
    1. Re:good place to start by permaculture · · Score: 1
      Has no-one mentioned United Devices yet?

      www.ud.com

      Another distributed computing project, looking for a cure for cancer by chatacterising therapeutic targets and assessing drug candidates.

      I've already clocked up more than 8 1/2 years CPU time on that one :-)

      --
      Environmentalism is the new Victorianism. Everyone ties on a green corset and pretends we're virtuous.
    2. Re:good place to start by emir · · Score: 2

      heh, if you cared to go to that page that i sent link to you would see that ud project is listed :)

      --
      -- http://electronicintifada.net --
  20. Re:And so what if SETI did get a hit? by smd4985 · · Score: 3, Insightful

    if we only focused our minds and money on problems that are immediate to us, we would be making a grave mistake. if we DID find evidence of another civilization, the philosophical ramifications would be enormous.

    --
    smd4985
  21. Why do people download these blah@home clients? by zaqattack911 · · Score: 3, Interesting

    If SETI can get 100s of thousands of people do lend cpu cycles, and folding@home (which is MUCH more obscure than SETI) can get 30k people.

    Then this phenomina should really be looked at by marketing people. It's amazing they can start a project, and just assume people will want to download their little client to use up cpu power ala screen saver.

    What drives you people to use these clients? Why bother? And don't tell me it's cuz you want to do your part to find aliens :)

    --Me

    1. Re:Why do people download these blah@home clients? by tgibbs · · Score: 2

      Why not contribute to scientific progress? I can't perceive any effect on the performance of my computer by having Folding@Home running in the background. No, I don't believe that it is particularly cure Alzheimer's Disease or cancer, but it is an important problem, nevertheless. And while the likelihood of actually finding extraterrestrial life may not be high (although nobody knows for sure), a success would be extremely important.

    2. Re:Why do people download these blah@home clients? by Reckless+Visionary · · Score: 2

      Well, its pretty easy (and you don't have to download a client) when it's built into your Google toolbar.

      --
      I think I'll stop here.
  22. Seti? by den_erpel · · Score: 3, Interesting

    Hm,

    In the "Space" documentary series (hosted by Sam Neill), one researcher mentioned something about "except that one time".

    Apparently they had some signal, but it was gone before they could reallign the dishes to get a confirmation.
    I guess they ruled out possible "domestic" signals...

    If anyone could guide me to a more elaborate source except that remark of one of the researchers, I would like to read it :)

    --
    Genius doesn't work on an assembly line basis. You can't simply say, "Today I will be brilliant."
    1. Re:Seti? by misterhaan · · Score: 1

      interesting page, but the background sucks! man i hate it when people use a background that makes the text hard to read . . .

      --

      track7.org has all kinds of interesting stuff!

    2. Re:Seti? by FuzzyBad-Mofo · · Score: 1

      Sounds like you could use a bookmarklet!

    3. Re:Seti? by misterhaan · · Score: 1

      hey i'll have to try that out!

      --

      track7.org has all kinds of interesting stuff!

    4. Re:Seti? by pclminion · · Score: 3, Funny
      From that page:

      Assuming the Wow! signal is a typical SETI-like transmission, then we can expect valid SETI hits to be very strong, high intermittent signals which appear once (as the transit beam sweeps past Earth), and never repeat again.

      So, in other words, they admit that they can never fulfill their own requirements (namely, the repeatability requirement).

      Rather daunting, isn't it...

  23. NP-Completeness by mortis_aeturnus · · Score: 5, Informative
    This is an abstract for On the Complexity of Protein Folding, which deals with the NP-Completeness of protein folding in two dimensions.

    This(postscript) is the the original paper on the hardness of String Folding problems.

  24. Re:Also on Folding@Home by meteau · · Score: 1

    I'm sorry but this was funny...somebody mod this guy up...of course I thought it was 7 times. And what if it is very very thin paper?

    --
    -- "You used your dictaphone to post, didn't you?"
  25. Re:And so what if SETI did get a hit? by Palos · · Score: 1

    Personally I like United Devices although there is a bit of controversy surrounding them. Check out their faq.

  26. Re:And so what if SETI did get a hit? by msheppard · · Score: 5, Interesting

    If we get one Seti hit and we may be able to replace ALL of our current problems with new ones.

    Earth: How do we cure cancer/every disease we know of?
    ET: Use *this*, but now that you're living forever, you have to worry about massive overpopulation.
    Earth: How do we get off this planet?
    ET: Use *this*, but now you have to worry about war between your planets.
    Earth: How do we achieve peace?
    ET: Use *this*, but now you're bored outta your minds.

    M@

    --
    Krispy Cream is people
  27. Comment removed by account_deleted · · Score: 5, Interesting

    Comment removed based on user account deletion

  28. Make money with folding@home! by Anonymous Coward · · Score: 4, Funny

    Slashdot reports "Folding@Home Reports Success"... you can too! That is right, with Folding@Home and Stuff@Home, you too can become $$$RICH$$$ with Envelopes@Home!! Send your $1 in and a SASE to us today!!

    This article was presented to you because you subscribe to the opt-in Slashdot site. If you no longer want to subscribe, please write "unsubscribe" on a $5 bill and send to Envelopes@Home. All removal requests honored.

    This article can not be considered spam because we provide an opt-out method per Bill S. 1618 TITLE III passed by the 105th U.S. Congress.

    This message is NOT intended for residents of WA, CA, or VA.

  29. Re:Also on Folding@Home by yatest5 · · Score: 1

    It might well be seven. And I agree it was pretty funny - some people have no sense of humour :).

    --
    • Mod parent up! [a] by Anonymous Coward (Score:5) Thurs, June 31, @13:37
  30. Re:And so what if SETI did get a hit? by Anonymous Coward · · Score: 2, Insightful

    Hehe. Because of your comment, I'm going to take two of my machines that are currently running GIMPS clients (Great Internet Mersenne Prime Search) and run SETI@Home instead. I've got a desktop machine running Folding@Home, but if I see many more comments like this, I'm going to kill that one as well. (Hint: People can use their own spare CPU cycles on whatever they like.)

  31. People hate to see computers sit idle by jason99si · · Score: 5, Insightful

    I think what drives people to use these clients is simple. I have heard several "technically adept" (read: geek) friends state that they simply hate to see their computer sit idle.

    They have paid for the hardware, paid for the bandwidth, paid for the electricity. It should be doing SOMETHING. Even if it is just displaying flying toasters.

    1. Re:People hate to see computers sit idle by the_real_tigga · · Score: 2, Interesting

      Exactly.

      Plus, again very interesting for the geeky, even with a (lets be frank) stupid project like SETI, there is still the WHAT-IF factor.

      It may be an infinitesimal chance, but just imagine YOU were "the one". Rather alluring.

      --
      my .sig is better than yours.
    2. Re:People hate to see computers sit idle by zaren · · Score: 2

      That's a very good reason - why let the cpu sit idle (providing you're the type that never shuts your computer down), when it could be doing some good for somebody's science project?

      Of course, as far as rc5 was concerned, I was strictly in it for the cash :D

      --
      Come to the University of Mars! Classes starting soon!
  32. Wow! (was Re:Seti?) by BabyDave · · Score: 2
    Try a Google search for the Wow Signal

    (I presume that this is what they were referring to).

  33. Margin of error... by WestieDog · · Score: 2, Interesting

    The article Said: "Specifically, the computers predicted that one experimental protein would fold in 6 microseconds, while laboratory observations revealed an actual folding time of 7.5 microseconds. " That sounds quite a bit off to me, I guess I really don't understand any of this. I do however think it is very nifty to use extra cpu cycles for something other than 'HLT'.

    1. Re:Margin of error... by notanatheist · · Score: 2, Funny

      That's what happens when you fold with P4's and not Durons.

    2. Re:Margin of error... by Vijay+Pande · · Score: 4, Informative

      Actually, we're in the experimental error. Keep in mind that folding time distributions are exponentially distributed (not Gaussian). This means that the std devs will be big just by their nature. 7.5 vs 6 are indistinguishable statistically.

  34. Google Toolbar is now distributed. by teamhasnoi · · Score: 3, Informative
    Here is the link to the FAQ on Google's Toolbar which works on the folding@home problem. I guess this is old news, but I woke up the other day to find a new button on the toolbar. Clicking on that let me turn it on or leave it alone. Apparently, it is not on everyone's pc (my puter upstairs did not get the 'new!' button)

    Later, when folding@home has folded, the distributed power of the toolbar may be used to make a 'Super-Google' of sorts. (is that a pun?)

    1. Re:Google Toolbar is now distributed. by RadioheadKid · · Score: 2

      There's an article about the Google toolbar and Folding@Home on k5 too...

      --
      "Karma can only be portioned out by the cosmos." -Homer Simpson
  35. Re:Also on Folding@Home by meteau · · Score: 1

    no doubt. I mean was it really that big of a stretch going from protein folding to paper folding? I mean it's not like he made a joke about folding laundry or anything...

    --
    -- "You used your dictaphone to post, didn't you?"
  36. Re:And so what if SETI did get a hit? by the+gnat · · Score: 5, Insightful

    By the time Folding@Home or Genome@Home actually produce data useful enough to lead to medical cures, your wristwatch will be powerful enough to fold proteins in seconds. Don't confuse a nifty theoretical exercise with experimental science. Neither the technology nor the methods are sophisticated enough for this to be of any help to people with cancer etc. I wish someone would come up with a project that actually produced useful biological data with distributed computing. BLAST@Home, maybe. Doesn't sound nearly as sexy as protein folding, I guess.

    (You're still right about SETI, though. What a freakin' waste.)

  37. Google supporting Folding@Home by truesaer · · Score: 5, Informative

    I submitted this as a story, but it was rejected. Google has incorporated distributed computing into its toolbar as an option. The first supported project is Folding@Home, but they will add more projects in the future. Its optional, and currently has only been released to a few toolbar users. It will gradually be released to all users. Check it out at toolbar.google.com/dc/. Google is currently seventh in the team statistics...

    1. Re:Google supporting Folding@Home by Mr.+Fusion · · Score: 1

      Yesterday I plugged my note-taking laptop into the network during class for, uh, 'research' and found out about Folding@Home from Google. It was working pretty well until my computer's turbo-charged fan turned on midway through a lecture. After some rocket launch comments comments from the professor, now he thinks I'm playing some cpu-intensive games and not paying attention. At least before I had the benefit of a doubt.

      -Mr. Fusion

    2. Re:Google supporting Folding@Home by nmrs · · Score: 2, Informative

      If you want to enable the distributed computing feature on the toolbar, but haven't got the new button, go here.

    3. Re:Google supporting Folding@Home by boa13 · · Score: 1

      Do you have a link to the stories in which it was reported? I had sent a story, which was rejected too, because I hadn't found anything about that on Slashdot (searched for folding, folding@home, and Google -- the latter matching every single story on Slashdot, it seems).

  38. Re:And so what if SETI did get a hit? by Atzanteol · · Score: 5, Funny

    *IF* SETI gets a hit, it will be more like:
    Earth: Wow, a spike that may have possibly been generated by an intelligent life form millions of years ago...
    ET: ???

    --
    "Ignorance more frequently begets confidence than does knowledge"

    - Charles Darwin
  39. Good results by ShooterNeo · · Score: 5, Interesting

    Well, on a related topic has anyone thought of this explanation for why SETI has found no results :

    Most current radios, based on decades old tech, broadcast a very orderly signal. It is confined to a narrow band range, only one transmitter is allowed per channel, the data being transmitted is uncompressed and so has many repeating orderly patterns.

    To increase capacity future radios will do the opposite.. They will broadcast compressed data that seems completely random, they will use a large swath of spectrum, they will repeat parts of the same signal across a large portion of the spectrum using a "chipping" algorithm. Even farther in the future, so many radios at once may be talking on the same spectrum that to identify a particular sender in order to communicate you'll have to use multiple antennaes and know his location (you'll share spectrum based on location).

    What is the end result of advanced communication gear that intelligent minds develop? What is the optimal result? To an outside observer the signal will seem like pure, almost totally random noise. Only to the electronics of a particular receiver that has the correct encryption and chipping key will it seem like anything else.

    THAT's why we can't hear anything. Trillions of sentient beings could communicate using this method and we wouldn't hear a thing.

    1. Re:Good results by Ektanoor · · Score: 2

      Only to the electronics of a particular receiver that has the correct encryption and chipping key will it seem like anything else.

      Interesting idea... And it could be quite truthful if a general path of progress forced civilizations to choose methods of communication with signals nearing background noises or pure white noise...

      Maybe it is would be a good idea to change the project into "Hack@SETI". However this could be dangerous. Imagine an orange being carrying two antennas, glasses, dressed on a Yuppie-like fashion and crying: I'm Bell Gadzes from Migrozoft Conglomeration, Red Moon, Vaxinton System, United Empires!.. You violated our DTCA (Digital Trillion Copyright Act)!! You will be assimilated!!!

    2. Re:Good results by hplasm · · Score: 1

      So our govts can't monitor what they are up to.

      --
      ...and he grinned, like a fox eating shit out of a wire brush.
    3. Re:Good results by jhines · · Score: 2

      There was an article a couple of weeks ago, on how SETI was going to use a new antenna, with much broader range to gather the raw data.

      To date, only a small fraction of the sky has been searched, this development was going to increase that tremendously.

    4. Re:Good results by schwatoo · · Score: 1

      I'd guess it depends on what the average "lifespan" is of a technology using civilisation within our galaxy and at what point during that lifespan radio is developed.

      --
      I have trouble with passwords among other things.
    5. Re:Good results by Insightfill · · Score: 1
      Right now, on this planet, millions of non-sentient beings are jabbering on their digital cell-phones (using exactly those broadcast techniques) and don't hear a thing.

      Still looking for intelligent life on Earth.

    6. Re:Good results by schwatoo · · Score: 1

      Or alternatively let's take mankind as the galactic average. Then statistically any alien race has a 50/50 chance of having more advanced technology than us. ;-)

      --
      I have trouble with passwords among other things.
    7. Re:Good results by De+Lemming · · Score: 3, Insightful

      Other civilizations will also go through evolution. So the earliest signals emitted will be the simple ones, and those will reach us first. If aliens detect signals from us at this moment, it will probably be radio or television emisions from decades ago. Marconi transmitted the first radio signal in 1901, but signals from those days are probably too weak to detect, even with technologies more advanced than ours. But earth's strongest transmitters like military radars are sending out signals since about 30 years.

      Also see this item in the Seti@Home FAQ.

    8. Re:Good results by SB5 · · Score: 1

      that's easy, to fool the FCC and so that the government can't triangulate their position...

      --
      If what you are reading sounds funny, or sarcastic, lame, or stupid
      it is because it is supposed to be. just laugh
    9. Re:Good results by ShooterNeo · · Score: 3, Insightful

      Who says we will be listening at this intersection of time and space? Current theory is that civilizations/intelligent life advance stupendously fast. Remember all the current progress has been made in 100 years...out of BILLIONS. It seems almost inevitable that in another hundred years this era will end (the era of humans) and simple radio signals unless used in a deliberate communication attempt are unlikely. So the odds that we would be able to pick up extremely weak signals from a developing civilization at a given time period of listening are so small to be negligable. The SETI project is being done for religious reasons. (not organized religion...just a general feeling that if we discovered intelligent life we would feel we had a purpose)

    10. Re:Good results by ediron2 · · Score: 2, Informative

      Your concern that we won't recognize complex wave methodologies (spread spectrum is one I can wrap my brain around, so I'll stop there) may be right.

      However, in addition to large elaborate schemes, we have several broadcast schemes that aren't likely to change and that are simple enough to detect: Telemetry (intentionally made repetetive since spectrum's cheap when you're talking to something a zillion miles away ( V'Ger) and its antenna is an ever-shrinking dot), and WWV (The US's atomic clock broadcast). Heck, our way of talking to already-gone objects like voyager *cannot* change.

      Similarly, a never-obsolete set of radar pings, carrier waves for TV and radio and *whatever* use, etc. are all just as vaguely possible. For example, WE MAY *NEVER* MANAGE TO KILL OFF FM OR SHORTWAVE BROADCASTS. And if, in this far-off civilization, two planets are settled, the first communication methodology geared to span interplanetary distances is going to be as simple as possible.

      Occams razor: Noise cancellation's first and easiest technique is redundant signal (carrier waves with frequency-modulation being close enough to fit this category). No matter what, there'll always be easy opportunities for this easy way out. Anything more complex without a good reason would be illogical (I wanted to say anything less would be uncivilized, but nobody'd remember the old ad campaign).

      I like your concern, though. It brings to mind a good question I'll be sending to SETI in a moment: Has SETI projected what we'll sound like in 50 or 100 years and seen how they'd score at considering us civilized if we're entirely spread-spectrum or worse by then?!

    11. Re:Good results by bstadil · · Score: 1
      The SETI project is being done for religious reasons. (not organized religion...just a general feeling that if we discovered intelligent life we would feel we had a purpose)

      Why wouldn't the "knowledge" that we are unique in the universe give you the same sense of "purpose"?

      As an atheist I think the search is very worthwhile in its own right, it fuels the thinking about other sentient beings and by implication to ourselves.

      Who know maybe the SETI and the Folding project might compliment each other one day. The more we know about life in this part of the universe the better we will be able to strategize about life elsewhere.

      --
      Help fight continental drift.
    12. Re:Good results by Torgo's+Pizza · · Score: 3, Insightful
      You make the false assumption that if there are aliens out there, they would be using some high technology to communicate with us. However, if some alien civilization is out there wanting to communicate with us, doesn't it make sense that they would try to do so in a common and basic manner? For example, look at what we Earthlings are doing to communicate with others.

      A lot of focus is made on SETI and listening for signals. We have in fact in the past sent signals to outer space with a specific message. In 1974, Frank Drake used the radio telescope at Arecibo, Puerto Rico to beam an elaborate coded message in the direction of globular star cluster M13. The message, coded in the binary notation of ones and zeros, contained 1679 bits of information. 1679 is the product of two prime numbers 23 and 73, which should suggest to an alien to break the message up into some combination of those two numbers. When the message is arranged in 23 columns of 73 bits each, and the zeros and ones are replaced by white squares and black squares. Coded into this pattern are from top to bottom: binary representations of the numbers 1- 10, atomic numbers of the five elements essential to terrestrial life, the chemical formula of the DNA molecule, numbers for the average human height and the world's human population, images of the human form, the solar system (with Earth displaced to indicate it is the planet from which the signal originated), and the transmitting radio telescope, with its diameter indicated.

      If, (and that's a strong if) there are aliens out there, chances are that we'd receive a simple radio signal rather than intercept B'lorg's phone call to Vk'lar.

    13. Re:Good results by ShooterNeo · · Score: 2

      *Ahem* All but the atomic clock signal would be transmitted more effectively if the beam is focused on the target. To communicate with a space probe, you would focus the signal at the dot not all over the sky (that's what we do now). To communicate with a distant planet you'd do the same thing. Carrier signal? That's a relic from analog transmission...those WILL go away. Remember, a T.V. station to work in analog has to gobble an ENORMOUS chunk of spectrum...enough for dozens of equivalent bandwidth digital channels or an almost infinite number with more advanced techniques. For the same reason, we would quit wasting spectrum with AM and shortwave...I'm sure you can cram thousands of times of much information in with better techniques. Redundant signal? Yes, that's still done with more advanced systems BUT the redundancy uses a "key" so the same symbol might get mapped to 50 different modulations split between the channels. Giving the same noise as before. Radar? I won't try to speculate on the future of radar but it would not surprise me at all if broadspectrum radars worked better and were harder to jam.

    14. Re:Good results by ShooterNeo · · Score: 2

      LOL to be honest, its more likely that the aliens would never figure out the message. How would they know the bits mapped to numbers? How would they know that 5 random seeming numbers referred to atomic elements? Or how would they understand a chemical formula? Human height/population is meaningless without a scale, images might work if it weren't almost infindesmally unlikely for them to understand that we meant pixels. No matter how smart the aliens were, a random seeming series of bits could mean anything.

    15. Re:Good results by MQBS · · Score: 1

      Sort of true, but one doesn't just send encrypted data, does one? Unless every civilization out there is communicating with one-time pads (read: very difficult, especially at galactic distances; you have to send your key in plaintext or else have someone physically bring it- no small task in space!), then there is handshaking. There is key distribution. There are (probably) large prime numbers at work. I belive one of the things that SETI@Home checks for is prime numbers, no?

      --
      The dream reveals the reality which conception lags behind. That is the horror of life- the terror of art. -Franz Kafka
    16. Re:Good results by ediron2 · · Score: 1

      I was just digging into a lengthy screed about the BS you're peddling above, but it'd be a waste of my time and not convince you of beans.

      Short version:

      Stuff never goes away. AM is not at risk for FCC reallocation, last time I checked. Why? Because it is cheap and easy. It works. And as you'll unfortunately likely see over the next twenty years (my bet), killing TV will never happen like the FCC wants it to. Millions of voters will scream bloody murder at the cost of throwing out a perfectly-good TV they bought in 2005.

      Stuff gets replaced only when something truly better comes along. I saw a discarded mimeograph the other day and thought immediately through the sequence and agreed that it was a good thing to go.

      Aimed focussed beams are labor-intensive and labor costs are the limiting factor in anything I do, so I doubt this is truly the whole future.

      Broadcast, on the other hand, is a consumer oriented medium. And efficiencies of scale without having to teach consumers how to do something more complex than programming a vcr... that's the future, kid. Aimed beams are a narrow niche until we ALL pass trig (i.e., never!)

      You're also blowing smoke up the wrong skirt on your claims of infinite compression into 6mhz of television bandwidth, the odds of any design opting for more complexity in the face of excessive jamming or noise, etc. Just saying it doesn't make it so, joe.

      And just for the record: space looks like a gray ambience of noise, with entropy spreading all the RF and matter out to a nice, cool, 3 or 7 kelvin, I forget which (that physics class was in '90). There are trademark hotspots around pulsars, quasars, and with predictable spectrums for stars, etc. But my bet is any anomaly to this is picked up, no matter how random-seeming the signal inside it. I think it'd be funny if we ended up being detected from deep space audiophiles annoyed by the 60 hz hum of our hundreds of millions of fluorescent light ballasts. (Oh, and please, everyone, I do know how unlikely that is, given inverse-r-cubed ratio on signal strength vs. distance for such small signals)

      End of story. Now leave me alone while I go kick myself for returning to slashdot. I'm back to Alterslash.org and lurker mode, until someone comes up with an intelligent geek news paradigm. Clue to the slashdot editors: moderation by intelligent non-experts is NOT as good as intelligent moderation by experts. Matter of fact, it's almost indistinguishable from tabloid journalism and that shrieking talk-radio hag that calls herself Dr. Laura.

    17. Re:Good results by ShooterNeo · · Score: 2

      Why am I not convinced of this argument? You shouldn't be, either. Your standards for comparison : human politics, "design complexity" (compared to what? Today's electronics, certainly), stupid consumers (they CAN use a VCR that sets its own clock), using obsolete designs because they still work; don't mean much. Do you really believe in a few centuries that any of these issues will still exist in there present form? Such a belief would be like thinking that problems with horse manure in city streets would be an ever present issue. You can't predict the future, and neither can I, but I CAN prove to you that the best possible radio scheme appears as completely random noise to outside observers. A point which you haven't disputed. I can also prove to you that there is an overall long term tendency for humans, and life in general, to use more effective solutions to a given problem. Obviously better radios are a more effective solution, and obviously shutting down radios that waste spectrum is also a good idea. 3 Kelvin is the correct answer. Thanks for the link to alterslash, I do agree that I would rather the moderation were done by people who knew something.

    18. Re:Good results by ediron2 · · Score: 1

      Your argument focusses on a single definition of better:

      Better bandwidth.

      My disagreement looks on the variety of reasons for using a technology:

      easier
      cheaper
      faster
      hassle of change outweighs improvement
      better handling of narrow circumstance
      narrow physics/chemistry constraints for chosen technology (low-freq for talking to subs, certain other freq's because of atmospheric bounces)

      I do dispute your definition of 'best possible radio scheme'. It's too narrow a definition. Shutting down wasteful use of RF isn't likely, either, since, as you said, there are a zillion ways to better utilize some areas while leaving others alone. The use of RF will remain a hodgepodge, likely forever. I don't dispute that lots will shift to spread-spectrum or the likes. But it'll never be all of it. Human nature doesn't work that way, physics doesn't work that way, and economics don't work that way. You're suggesting that a hammer is all the tool anyone needs, so to speak.

    19. Re:Good results by ShooterNeo · · Score: 2

      And my point was that none of these reasons are relevant. A few centuries, absolutely nothing compared to billions of years that have already passed, and none of these constraints will mean much. "easier" compared to what? Current radios are thousands of times more advanced than smoke signals. "cheaper" Umm cell phones already do some of this, they are semi-wideband devices. The fancy encoding can easily be done by a $10 chip with todays technology. "faster" A more advanced communication protocol transmit information faster "hassle of change". 10,000 times or better efficiency improvement is worth the hassle. Besides, even if the improvement were small over a period of centuries we'd do it anyway physics constraints : physics means it is possible to have every radio on earth sharing the same band. To sort out which transmission you want to listen to you have to know where the sender is located. You then electronically focus your antennae on that spot, blocking all the other senders.

    20. Re:Good results by ediron2 · · Score: 1

      In reverse order:

      The examples I had in mind for physics were:

      ultralow frequency is all that passes more than a few meters into water. I defy you to communicate electromagnetically with anything in deep water at >60hz. (Again, I'm not going to grab the physics book to remind myself just how thick skin depth is for water at 60 hz, but memory says a few meters). If you're only able to spread spectrum over 60 hz, I think it'll be noticeable by E.T.

      Certain frequencies bounce atmospherically. Others can't penetrate trees and walls. Spread spectrum mechanisms will have to work around the latter, and will never achieve non-line-of-sight without remaining in a narrow band for the former.

      Chemically, similar tricks/issues abound. I don't have an example in mind, but can imagine issues like: auto-immune rejection of an implanted device restricting it's composition, and the RF equivalent of bic shavers (throwaway communicators?).

      Strict Physics/Chemistry dependencies aren't going away, even in a few billion years, unless you expect all subaquatics to use a non-RF method (or a damn-long extension cord/leash) and for the skies to have a cloud of redirect/forward sat's to COMPLETELY obviate the advantages of atmospheric bounce under every circumstance (including experimental and hobbyist use).

      Transmissions and pointing: I'll assume you plan this to all happen in hardware/software. I'll similarly assume protocols that allow sharing lists of 'public broadcasts available' and other mechanisms to allow the economies of one-to-many to remain, or that you're just planning bandwidth to exceed demand and become as free as air. Both are plausible. Otherwise, initiating a conversation is impossible (if both parties don't know who to look for to see if 'they' want to talk to 'me'). This 'hailing frequencies' concept never seems to die, but I can at least work around it with protocols akin to the 'net or cell phones.

      Dunno where '10k better' comes from. Source of the number? Data compression gets Video down 10x in demanded bandwidth. God himself won't get that to 100x improvement. Advanced methods of signal compression can get you another 20x. You popped off about almost infinite compression into an existing 6mhz band of television last time, and I wasn't buying it. Still not. Certainly not *better* than 10000x. An exception would be by shrinking the geographical footprint of each transmitter. And that'd make things harder to notice. But you're still not getting my base point here, either. How does this improve prospects for one-many that we have using current methods?!

      A $10 chip? Compared to a three-cent radio? That's how simple RF is. No matter how fast you rush downward on the former's price, the latter will always be a helluva lot cheaper and more ubiquitous.

      All of my above-mentioned constraints stand. Your way is nice, but not compellingly cheaper, easier, better or physics-advantageous compared to existing solutions. The wheel didn't go away. Fire comes out of devices that are hugely different than its origins, and light/heat is available in variations that would stagger the mind of someone born in the 1860's. But it's pretty much still a safe bet that we'll always have a *FIRE* source (perhaps completely unlike a bic lighter) around.

      Likewise, you're arguing against a concept that won't go away: it is convenient and easy to oscillate, then perturb that oscillation to generate a means of communication. No matter how we shift and advance the details on complex engines to exploit this, the basics will always pop up and get used.

      What you're saying isn't akin to something like saying books will go away. That issue is strictly technology-oriented, and while slow to happen, is likely to largely (I won't say completely) happen over millenia. You're saying that a concept, RF oscillators, will cease to have a use.

      Do you really think so?

      Smoke signals: funny you should mention them. People still use 'em. Because of simplicity, they have their use: rescue fires, signal flares, and (in some ways similarly) plumes of dye released by people stranded at sea. Technology provides better solutions to all these problems, but complexity tends to rob us of the complex solutions. The more parts there are, the more there are to break. This flows nicely along my argument that things don't tend to get more complex to overcome jamming, which I notice you didn't respond to.

      Oh, and thanks to the slashdot interface, I can't easily trace back to verify, but weren't you talking about RF going away in a few hundred years initially? If not, that's really all that matters, since we're stuck with that part where signal strength fades at 1/r^3.

      Billions of years? Agreed. Total unknown. Rocks and spears or gravitationally-powered pulse cannons. It's a crapshoot. But who cares. I wanna live forever and even THAT is too far ahead for me to plan...

    21. Re:Good results by ShooterNeo · · Score: 2

      The 10,000 times comes from the concept that thousands of users can share the exact same frequency (yes, even at 60 hz or lower though there wouldn't be much point) if the tuning hardware listens only to the signal coming from a particular point.

      That is, with thousands of people using the same frequency it appears to be totally random noise unless your receiver is focused on a spot perhaps a few hundred meters in diameter. To any outside observers this communication method would seem like noise. And yes, bandwidth is pretty much infinite using this method (between two parties it isn't but for the entire system it basically is), and no, regulation by government is not needed with this transmission method because its impossible to jam. Granted, you would require some sort of "hailing frequency" that would have to be policed, but once a communication session is started outside interference would be meaningless.

      I said a $10 chip with todays technology....in 20 years it very well might be a 3 cent part.

      Billions of years? Think again. There is a tremendous amount of evidence that technological progress is accelerating exponentially (and its been doing so even before humans existed on earth). Soon enough life from earth will hit the vertical part of the curve...advancing to the limits allowed by physics (if there are any.).

      Note I said life from earth, obviously I mean later improved versions of intelligent life, not humans.

  40. note to self by misterhaan · · Score: 2, Funny
    1. get lots of people to download screensaver
    2. use their spare cycles to do my computing
    3. ?
    4. profit!

    sorry, couldn't resist :)

    --

    track7.org has all kinds of interesting stuff!

  41. Re:Also on Folding@Home by yatest5 · · Score: 1

    Switch to kuro5hin - it has a wayyy bettre moderation system. although less stories (ducks)

    --
    • Mod parent up! [a] by Anonymous Coward (Score:5) Thurs, June 31, @13:37
  42. the reason folding@home has more success by Jonny+Balls · · Score: 2, Insightful

    You see... folding at home is going for a tangible goal... seti is... searching for ALIENS!
    I still prefer Seti@home, it looks cooler ;)

    --
    --JonnyBlog
  43. Re:And so what if SETI did get a hit? by Anonymous Coward · · Score: 2, Insightful
    Don't force your personal opinion on other people. Folding/Genome/SETI are different projects for different kinds of people. No offense, but you are in no position to tell people what to use their spare cycles for.



    And what about all the tens or hundreds of millions that aren't running anything?

  44. Re:And so what if SETI did get a hit? by Zathrus · · Score: 4, Insightful

    Hint: People can use their own spare CPU cycles on whatever they like

    Sure they can. That's not in question. But the theory behind the distributed clients is to avoid wasting CPU cycles and to do something useful.

    The point of the OP was that SETI@Home (and, frankly, RC5 crack searches) are osteniably no better than having the CPU cycles spinning anyway. Projects like Folding@Home, Genome@Home, and UD Cancer Research can provide a real, proveable benefit in both the short and long term. Mathematical projects like GIMPS and prime number searches do so as well, although my personal opinion is that they're not as valuable.

    Use your CPU cycles however you like. Hell, don't run a distributed project at all if you don't want to. All that's being asked is to consider how to actually use the spare cycles effectively if you're going to join a distributed project.

  45. Re:And so what if SETI did get a hit? by Anonymous Coward · · Score: 1, Funny

    That's right! Will somebody please think about the children?!??!

  46. The results were off by 20 percent! by zerofoo · · Score: 3, Insightful

    From the article:

    "Specifically, the computers predicted that one experimental protein would fold in 6 microseconds, while laboratory observations revealed an actual folding time of 7.5 microseconds."

    They missed the prediction by 1.5 microseconds. While that may not sound like much, that's 20 percent of the actual result.

    Are these considered good results? I'm no protein folding expert...but 20 percent seems like alot.

    -ted

    1. Re:The results were off by 20 percent! by skeedlelee · · Score: 3, Interesting

      That's pretty good. Lab to lab variation when repeating measurements like this is usually this bad or worse. Factor of two would have been reasonable. When comparing in silico work to experimental its usually considered good when you're within a factor of ten. More commonly a series of related proteins is ranked in order (by some property) and then compared to experimental measurements of said rankings.

      Also, keep in mind that this is a microsecond folding rate. Rates in the ms regime of folding are routinely measured with high accuracy, the microsecond regime is really hard as it usually takes longer than that to do what ever you're going to do to trigger folding in the first place. The number in the paper is 7.5us +/- 3.5us, so they got as close as could be expected.

    2. Re:The results were off by 20 percent! by tgibbs · · Score: 2

      In a purely theoretical prediction like this, I'm impressed if they even manage to come within a factor of two. It's easy to be off by orders of magnitude.

  47. Re:And so what if SETI did get a hit? by ckedge · · Score: 2, Interesting

    I ran folding for a couple months a year ago. I tried again in the spring for a couple weeks.

    Each time I quit and removed it from my system.

    Buggy installs, buggy software, buggy server statistics, unoptimized code, and a direct quote from Vijay that said "I don't care" about those issues because he already had enough people running the client for his purposes. Or at least that's my opinion of and the feeling that I was left with.

  48. I was on that wavelength.... and... by gik · · Score: 1, Funny

    ...I even snickered thinking that someone else besides me found @Home's troubles a "success". ...Although, knowing them, I bet they'd even fail failing.

    --
    ZERO
  49. folding@home and genome@home by jon787 · · Score: 2, Informative

    What I can't figure out is whether or not these are the same projects now!

    Of course since glibc 2.3.1 killed the folding@home client....

    --
    X(7): A program for managing terminal windows. See also screen(1).
    1. Re:folding@home and genome@home by Duncan3 · · Score: 1

      glibc 2.3.1 killed a ALOT of things.

      And we're working on post-2.3.1 clients already.

      --
      - Adam L. Beberg - The Cosm Project - http://www.mithral.com/
  50. Re:You call it "Folding @ Home".... by ThinkingGuy · · Score: 1

    No, I think they call it "Fording at Homu."

  51. Re:.exe? by dr_dank · · Score: 2, Informative

    Yes it does. Be sure to set chmod +x $FILENAME.exe also.

    --
    Where does the school board find them and why do they keep sending them to ME?
  52. Display sleep on Macintosh by andfarm · · Score: 1
    Sure is. There's an "Energy Saver" control panel with an option to set display sleep time. When the given amount of time passes with no use (keyboard or mouse activity), the display turns off. Works on both the older CRT machines and newer LCD ones.

    Easy.

    --

    TANSTAAFI: There Ain't No Such Thing As A Free iPod.

  53. Re:.exe? by notanatheist · · Score: 1

    if you don't like the .exe just rename it! Either way it's chmod a+x FAH3Console.exe then ./FAH3Console.exe. Tean number 668 when it asks. Just kidding.

  54. Re:And so what if SETI did get a hit? by joshamania · · Score: 1, Flamebait

    Last I heard, this was an opinion oriented discussion board. Your stupid fucking troll post could easily be applied to anything anyone says about anything. Fuck yourself.

  55. Re:And so what if SETI did get a hit? by maddskillz · · Score: 1

    Actually, even if you are using your spare cycles for something like RC5 challenge, at least you are advancing distributed computing.
    I had my computer in the RC5 challenge, not because I could care less about he secret phrase, but because I hope it advances research in distributed computing. I guess right now, I am way more interested in the medium, then the message

  56. You've got a point.......... by Ride-My-Rocket · · Score: 1

    The theory is really cool, the practical applications are nearly zero.

    Much like the SETI@Home search, methinks.......... this isn't a troll, this is my honest opinion, but feel free to mod it as you wish.

    1. Re:You've got a point.......... by the+gnat · · Score: 2

      Well, to be fair, I don't think Folding@Home is useless (like SETI), just not particularly useful. I'm mainly just disappointed that people haven't put a lot of effort into distributed computing projects that actually have immediate scientific applications, and instead go wild over these stunts. I'm also more than a little peeved that people with little or no knowledge of structural biology, physics, chemistry, or scientific computing keep talking about how great protein folding simulation is.

      And, to give Pande some credit, I read the Nature paper and I thought it was interesting and a good proof-of-concept. I stand by my intial assessment of the long-term prospects of this kind of research, however.

  57. Sigh... IP? Anyone? by sjbe · · Score: 5, Insightful

    I've read the Folding@Home FAQ looking for information about what they plan to do (from an IP standpoint) with the information they get. The "answers" they provide are pretty vague on the details.

    Unlike other distributed computing projects, Folding@home is run by an academic institution (specifically the Pande Group, at Stanford University's Chemistry Department), which is a non-profit institution dedicated to science research and education. We will not sell the data or make any money off of it.

    Ok, they won't make any money off it, but who might? Who owns any patents? What actually is done with the data? And the non-profit bit tells me nothing. The Vanguard Group is a non-profit too, but that doesn't mean they aren't interested in money. (Vanguard is owned by the investors, hence non-profit, but not really) Just because it is a non-profit institution doesn't tell me much. Universities are non-profit but they make a ton of money off of IP. They can do whatever they want but before I commit my processor cycles to helping I'd like to know specifically what I'm helping.

    The FAQ goes on to say:
    Moreover, we will make the data available for others to use. In particular, the results from Folding@home will be made available on several levels. Most importantly, analysis of the simulations will be submitted to scientific journals for publication, and these journal articles will be posted on the web page after publication. Next, after publication of these scientific articles which analyze the data, the raw data of the folding runs will be available for everyone, including other researchers, here on this web site.

    So the data is going to be available. How? What "levels"? To whom? For how much? Just saying it will be published in journals tells me little. What else will be done with it? Who stands to benefit from the data? (aside from the obvious)

    Basically I want to know and am not impressed with their answers. I'd like some candor when it comes to something this important. With SETI@home, who really cares? That won't affect my life. Folding@home might.

  58. Good CS, good chemistry by skeedlelee · · Score: 5, Informative

    Well, I kinda agree and I kinda disagree.

    First, you can't expect to go from no success to complete success overnight. People have been trying to fold proteins for some time now and have basically failed because it is freakin' hard. The theory is in principle in place, a least to a first approximation, but the calculations are so intensive that they have basically beaten every comer. As an undergraduate I remember how everyone in the field thought getting bigger and better grants and buying bigger and bigger computers was the answer. Oh to be SGI in those days. They sum up the problem pretty well in the Nature paper, essentially a modern (desktop) computer would require a few decades to crunch through a single useful length simulation. Then you need to do it many times to get a useful answer (say 100-1000). Even supercomputers are going to balk at that kind of calculation. Moore's law what it is, we should then be able to get through an in silico simulation in a week on a single computer (when its this fast crystallography really will be dead) by, oh say 2040 at best. (somebody want to calculate that exactly, 10000yrs -> 0.02yrs is how many doubles). So yes, this hasn't gotten rid of x-ray crystallography just yet.

    But this is still really cool. Complaints about interface and maintenance aside, this was a great system. It relied on four pretty bright insights.

    First, that distributed computing is essentially the poor man's (cough, the academic's) super computer. Also, it automatically adapts itself to technological improvements. People will buy new computers from time to time and, hopefully, reload your software.

    Second, that there was no reason other than no one had sufficiently brute forced the process that the existing methods shouldn't work. They use a bunch of 'cheating' techniques to make this managable during the screen saver timescale, such as a united atom model (I think that means they ignore aliphatic hydrogens) and implicit solvent (don't treat it as individual solvent molecules, just a uniform field). It was an open question as to whether this approach would work at all or if you had to go over to much more explicit methods to get it to work at all. It appears that this has kinda worked with the cheater methods in place.

    Third, choice of a test case. Yes they chose something that was small. This isn't surprising. They wanted to be done sometime this decade, remember there is a graduate student as the primary author here. Small was necessary. However they also chose a FAST-FOLDING protein. That was clever. Basically, even with distributed computing, it is still hard to simulate a full microsecond of time. Thus they chose something that had some chance of completing its folding one the time scale that they could look at.

    Fourth, they remembered their P-Chem. It is really hard to run these things to completion... so they didn't. You don't have to run the simulation until 99% of the molecules have completely folded, just until an appreciable number have folded and you can extrapolate the behavior from that. They ran a 20ns simulation (at the longest). The thing takes 7us for ~60% to fold. As a result only once in a great ong while did one of the simulations actually produce a folded protein. But by doing it ~10000 times they could figure out how that translated into the rate constant. That's clever.

    That said, yes there is a long way to go on this, but its still a really clever paper. No we haven't cured cure cancer yet, but its still progress. And forget an in silico structure of the ATPase, that's largely understood already (check the RSCB/PDB there's a bunch). The real challenge will be getting a structure that size that hasn't been solved by other methods and convincing anyone else that you're right! Disclosure- I don't have PhD in this area yet, but I'm close.

    1. Re:Good CS, good chemistry by the+gnat · · Score: 2

      That said, yes there is a long way to go on this, but its still a really clever paper. No we haven't cured cure cancer yet, but its still progress. And forget an in silico structure of the ATPase, that's largely understood already (check the RSCB/PDB [rcsb.org] there's a bunch). The real challenge will be getting a structure that size that hasn't been solved by other methods and convincing anyone else that you're right! Disclosure- I don't have PhD in this area yet, but I'm close.

      Um, you sort of made my point for me. Crystallography is solving these structures now, and even if it isn't perfect it can do a hell of a lot more than the current computational techniques ever will. The range of structures that can be solved by this method keeps growing- less than a decade ago I doubt anyone thought structures for the potassium or chloride channels could be determined.

      I'm sure computing power will make it easy to simulate giant structures, but I still think the science behind this isn't good enough. How do you deal with chaperonins, transmembrane helix formation, association of subunits, functional conformational changes. . . sorry, but by the time the computational chemists figure out how to deal with these there may not be much of a point. And there's a huge difference between fold and atomic structure.

    2. Re:Good CS, good chemistry by tbuskey · · Score: 2, Insightful

      ... no one had sufficiently brute forced the process that the existing methods shouldn't work. They use a bunch of 'cheating' techniques to make this managable during the screen saver timescale....


      The essence of engineering when the math can't be done to completion. When I went to college (84-88, Mechanical Engineering) we had VAXen (11/785) and PCs. The 8MHz AT was just coming out. The 386 wasn't widespread until later.

      Here's the scene: You need to design an airplane wing. You have an equation to solve for harmonic vibration. You bring it to the math guys. They tell you it's an unsolveable differential equation. It's in this group of unsolveable ODEs. So, you can solve this. Meanwhile, you still have to design the wing and you have to make sure it doesn't vibrate off the plane from harmonic vibration like the Galloping Gurtie bridge did.

      So, you cheat. You might make the wing heavier and stiffer then it needs to be. In the 80's you reduced the calculus to those boxes to figure out the area under the curve. You make the boxes smaller & smaller until the answer is "close enough".

      Engineering doesn't solve everything to all decimal places. You round off. The moon shot only used 4 decimal places; much of it was done with slide rules.

      The trick with engineering is know when you "cheat" and aproximate and when you can't

    3. Re:Good CS, good chemistry by tbuskey · · Score: 1

      Err, you can't solve it. Damn typos...

  59. Folding Lag Time by Anonymous Coward · · Score: 1, Insightful
    --Specifically, the computers predicted that one experimental protein would fold in 6 microseconds, while laboratory observations revealed an actual folding time of 7.5 microseconds.--

    Perhaps the kinetic "experimental" 1.5 usec lag time is what is referred to in this PNAS article by Alan Fersht.

  60. Can I join someone's team? by Isldeur · · Score: 3, Funny

    Hi, I'm the administrator for the big ASCI Purple cluster and, do to a lot of budget cutbacks, we have a lot of spare CPUs (like 30,000).

    Would anyone mind if I joined their team?

    1. Re:Can I join someone's team? by skeedlelee · · Score: 1

      Well, it's not a team as such right now, but I've got an idea that could make use of that sort of idle time. Biologically relevant (though not all atom), tedious for a single run and only interesting after about a thousand or so cycles. Ie. readily parallelized. Could probably have it ready to test out in early spring. Does that mean you've got 30k CPUs running with nothing on them or are they all powered down? If you're interested reply to this and then we can hopefully come up with a way of getting in touch without having to broadcast our email addresses to the world.

      Alternatively, who ever is following up on folding@home (I guarantee this is just the beginning) would be thrilled with access to that kind of power.

  61. SETI: let's hope aliens don't have lawyers by cant_get_a_good_nick · · Score: 5, Funny

    We can only hope that the aliens can actually legally send signals and aren't emcumbered by "Patent 1,345,821,098,836: sending signals encoded in high frequency waves to unknown lifeforms over the aether", and that they think the unknown lifeform receivers have a shot of decoding the signal without getting hit by "IGADCA - Inter-Galactic Age Digital Copyright Act: violations of decrypting the radio encoding".

    Hmm, maybe they have 8 arms and tentacles, and they'll just bite the lawyer's head off when they disagree with them.

    1. Re:SETI: let's hope aliens don't have lawyers by Rader · · Score: 2

      Or maybe they have 2 tentacles and 8 heads... all of them shouting "POint of Order!"

  62. This makes no sense, by treat · · Score: 2
    "One reason that protein folding is so difficult to simulate is that it occurs amazingly fast," Pande explained. "Small proteins have been shown to fold in a timescale of microseconds [millionths of a second], but it takes the average computer one day just to do a one-nanosecond [billionth-of-a-second] folding simulation."

    Who is this guy, and why does he make such an obviously false statement? Should this make me willing to trust these people and contribute to this process?

    If it takes one CPU-day to do 1ns of folding simulation, then protein folding is difficult to simulate because it occurs over a (relatively) long, not short time. This should be obvious, and therefore either the statement is either a deliberate lie or a misquote.

    1. Re:This makes no sense, by cant_get_a_good_nick · · Score: 3, Informative

      Wired had a good explanation on the problems inherent in predicting folding. IBM is building a big grid supercomputer to do this.

    2. Re:This makes no sense, by treat · · Score: 2
      What am I to make of the following statement from that Wired article, besides a profound ignorance of math and computing on the behalf of the author?

      , or 12 trillion floating-point operations (those that keep track of decimal places)

    3. Re:This makes no sense, by treat · · Score: 2
      Or this?

      then you have to multiply 3 by itself 100 times to get the number of possible shapes the chain might fold into. This is a big number - roughly speaking, the current age of the universe, squared. One hundred amino acids is a short protein.

      No units of time for the "age of the universe"? This number, by my math, is the age of the universe in microseconds. Surely this is a significant detail.
    4. Re:This makes no sense, by treat · · Score: 2
      Or this?

      cuts down the communications requirement by something like the square root of the number of atoms involved,

      Surely he means "to" and not "by", as they have opposite meanings.

    5. Re:This makes no sense, by cant_get_a_good_nick · · Score: 2

      Surely he means "to" and not "by"
      I'm pretty sure he means "by a factor of".

      To be honest, posting your editorial of the article here probably doesn't help much. You may want to write to the original authors if there are thigns you still need to clear up.

    6. Re:This makes no sense, by perrin5 · · Score: 2

      Umm,

      NO.

      Modeling is not the real world. If it were, we wouldn't need models, because we could just look at the source code, and see what was going on. The reason that it takes a cpu day to run a given simulation is because the computer is attempting to figure out what will happen next.

      This is not a real time simulation. This is a prediction program, there is some hefty math involved, and that math must be done for each time slice. The principle here is they gather information about the shape of and forces acting on the protein each time slice to predict what the protein will look like in the next time slice and then run the calculations for that one, ad infinitum until the protein is stable. So if this folding procedure takes 7 ns to run, and we model it by femtoseconds, that's 7 million time slices that the computer is modeling. so now, lets take a time frame for each slice. Let's pretend, for the sake of fun that it takes 2 seconds for each slice (optimistic in my view, but maybe it's a small protein).

      that's 7000000*2 seconds = 233,333 min = 3888 hours ~= 162 days.

      --
      hmmmm?
    7. Re:This makes no sense, by treat · · Score: 2

      What you say with does not contradict my point in any way. In fact, it stands in agreement with it. "7 million time slices" in your example because in relation to the resolution, it is a long (and not short) period of time.

    8. Re:This makes no sense, by Lord+Crc · · Score: 1

      If it takes one CPU-day to do 1ns of folding simulation, then protein folding is difficult to simulate because it occurs over a (relatively) long, not short time.

      From what I've gathered reading the papers at their site, the folding process happens in "steps". The changes between states occur quickly, and then the molecules stay in those states for a relativly long time.
      Thats why it's a problem, because you need very small timesteps to register the state changes properly.

    9. Re:This makes no sense, by treat · · Score: 2
      Thats why it's a problem, because you need very small timesteps to register the state changes properly.

      I know this, you know this. The point is that the author of the article I was referring to did not know this. He completely confused the issue. And if he lacks the basic understanding of what is being done, what else is he wrong about?

    10. Re:This makes no sense, by nitsuj · · Score: 1

      First, Dr. Vijay Pande is a professor at Stanford. His group is responsible for folding@home. He almost certainly knows more about this topic than anyone else posting in or reading this thread. There are few people who could be considered his peer, and I'm pretty sure the ones I know are not slashdot readers.

      Second, while I understand your confusion, what he means is this: proteins fold much faster in reality than we can simulate them. If we could simulate the folding of a protein in a week, for example, and it took actual proteins a week to fold, it wouldn't be considered a hard problem. But since proteins fold in microseconds, and it takes simulations a long, long time to fold proteins, it is a hard problem.

    11. Re:This makes no sense, by nitsuj · · Score: 1

      No units of time for the "age of the universe"? This number, by my math, is the age of the universe in microseconds. Surely this is a significant detail.

      Admittedly, this was poorly written, but this is what they meant: the number of possible conformations of a 100 amino acid protein is a very, very large number. If you explored conformations randomly, switching between them at a very high rate -- a diffusion limited rate (ie. as fast as the protein could move around in water) -- then the amount of time it would take to find the native state is something around the current age of the universe squared. If you want more information, look up Levinthal's Paradox.

    12. Re:This makes no sense, by Tinlash · · Score: 1

      Give it up. Just admit it when you're wrong.

  63. New bumper sticker... by KFury · · Score: 3, Funny

    "I'm a Protein Folder and I VOTE!"

  64. Bah by ucblockhead · · Score: 2

    You mean, a success at running through a known mathematical algorithm that, unsurprisingly, got the expected result?

    This is a success in that it is actually advancing the state of human knowledge.

    --
    The cake is a pie
  65. No don't change everyone to folding@home by Anonymous Coward · · Score: 1, Informative

    I've been folding for 2 years and I'll tell you they have deadlines on their work units; nec. to proceed to the next time step of the simulation.

    Only people who can meet the deadlines should fold- every else should do something else.

    To meet the deadlines you should:
    1. have a fast machine ( > 300 Mhz)
    2. leave your machine on 24/7
    3. have a persistant connection or
    dial in every 6 hours or
    set up your computer to autodial.

    1. Re:No don't change everyone to folding@home by Anonymous Coward · · Score: 1, Informative

      I didn't switch to Folding@Home until I upgraded my k6-2 550+ to an Athlon 1.4. Even at 24 hours a day, the k6 was hard pressed to finish most units on time. My Athlon usually does them within 8-24 hours, which allows me to shut the damn noisy thing off at night while I sleep. I think the limit is something like three days, and they've said as much as that they would change it as necessary to ensure cycles don't go to waste.

  66. He's not forcing SETI on you........ by Ride-My-Rocket · · Score: 1

    ...... he's merely stating his opinion. A key difference between an opinion and a dictator: an opinion is an idea, to be used or discarded at one's discretion; a dictator force-feeds their opinion(s) down your throat.

    Don't get so militant. Relax. Breathe. See you next week.

  67. Re:To all you IDIOTS out there. by aurelian · · Score: 1

    I agree with you. I don't understand what these idiots are on about. Nobody's forcing anything on anyone.

  68. Do They Get to Patent the Discovery? by FFFish · · Score: 2

    The public is helping with this research. Hell, the global public is helping.

    Who gets to hold any patents that arise?

    --

    --
    Don't like it? Respond with words, not karma.
  69. Re:To all you IDIOTS out there. by joshamania · · Score: 2

    Hear hear! We are agreed!

  70. Re:I fold at home AND MAKE $$$ by mraymer · · Score: 2, Funny
    Yes, my friend, you to can easily add THOUSANDS of $$$ per month to your income by folding@home. Just fold papers and stuff them into envelopes-- so easy I couldn't belive it! Before you think this is too good to be true...

    -end lame spam joke- ;)

    Seriously, this is cool. Perhaps having success in one area will lead the folding@home team to explore totally new areas, and have a breakthrough on something they never even planned to look at. With the recent end of RC5-64, I've switched to F@H, mainly because I feel that, in some small way, it helps to improve the human race.

    --

    "To confine our attention to terrestrial matters would be to limit the human spirit." -Stephen Hawking

  71. Now if we could only have it fold our laundry! by croftj · · Score: 1

    That would be something to write about.

    --
    -- Many men would appreciate a woman's mind more if they could fondle it
  72. Comprehensive list of distributed projects by essdodson · · Score: 3, Informative

    A comprehensive list of distributed projects can be found here http://www.aspenleaf.com/distributed/

    --
    scott
    1. Re:Comprehensive list of distributed projects by RedWolves2 · · Score: 1

      I was just going to ask if there was a list of distributed projects. Thanks for posting.

  73. Re:Sigh... IP? Anyone? by whovian · · Score: 2

    This is why I never picked up on F@H. In contrast, the distributed.net projects state they will include your name in any meaningful results if you are the discoverer (and pay you an award).

    --
    To-do List: Receive telemarketing call during a tornado warning. Check.
  74. Current theory by Ted_Green · · Score: 2


    Frankly I'm not sure what I believe, or what "theories" have greater validity or not. Though I am inclined to agree with your conclusions (that it is unlikely to find a signal from a developing civilization)

    I do think however is that we (as people) tend to over generalize theories and often treat ideas (much as you said) as religions. We feel a great encompassing grand unified theory is somehow more appeasing than chaos. So we seek purpose in the universe, even should that purpose merely be an ordered cause and effect.

    Unfortunately I'm inclined to believe this kind of thinking leads to many slippery slopes. In this particular instance, explaining the whole arising of human civilization as a natural product of evolutionary terms. I'm not so certian this is the case (though I'd like to see theories [with supporting evidence of course] on it) certainly evolution could be said to have gotten the ball rolling and given us an opportunity to create a species able to developed a civilization, but what, I wonder are the probabilities of that happening?

    Until we have another sampling, a different evolutionary chain to compare to, saying that a "civilization" is a natural (that is to say a probable) product of evolution is as faulty as rolling an infinitely sided dice and saying the number it lands on it is always likely to land on.

    Only if we can show that evolution does not have an infinite possibility for creations and traits, can we really say there is likely another civilization somewhere. And sampling of one, just ain't going to cut it.

    I'm just blathering. =]

  75. Re:Molecules.. by meteau · · Score: 1

    Why can't we have some stories on concrete subjects like the furry Sasquatch or the ever playful Nessie?

    --
    -- "You used your dictaphone to post, didn't you?"
  76. I say this every time.... by Wiwi+Jumbo · · Score: 2, Interesting

    ...something about Distributed Computing pops up but since I don't have the skills myself I feel it's important to pollenate the minds of as many people as I can. I might just get lucky. ;)

    But anyways:

    What is needed isn't multiple clints for each project, but one client which can take plugin's for any project that's out there.

    Say you can't decide between Seti and Folding @Home projects, why not divide up the work units? For every 1 Folding unit you could to 3 smaller Seti units. That way you can help every group that you want. And if one group has problems you don't wait for days to get a new unit, you can just start on another group.

    I'm just not sure how pretty screensavers would turn out with a plug-in method. :)

    O.k... I'm done, you can go and ignore me now. ;)

    --
    Wiwi
    "I trust in my abilities,
    but I want more then they offer"
  77. Re:And so what if SETI did get a hit? by Anonymous Coward · · Score: 1, Informative

    I agree with you 100% about the bugginess of the Folding@Home client. However, I also agree with Vijay that it is a minor issue. (I still wish they would make it more like UD.) UD may have a nice stable client, but they're a bunch of pricks, and brute force drug searches don't advance pure science as much as the fundamental discoveries made by projects like Folding@Home. Vijay means well, so please forgive him for his lack of social refinement regarding his project. 263 units and counting; I feel good about the use of my spare cycles.

  78. Re:Sigh... IP? Anyone? by Bamafan77 · · Score: 1

    I think if you're this anal about donating a couple of spare cycles of your CPU while it's not processing porn, they'd just as soon as you not bother helping out anyway. :)

  79. Re:And so what if SETI did get a hit? by gklyber · · Score: 1

    I was just in it for the cash prize....

  80. 10000yrs - 0.02yrs by oliverthered · · Score: 2

    10000/0.02 = 5000000
    log2 = just less than 19
    Applying moors law to the earth simulator in japan might be a better Idea than applying it to a desktop PC.
    I've never seen desktop x-ray crystallography.

    --
    thank God the internet isn't a human right.
    1. Re:10000yrs - 0.02yrs by kwijebo · · Score: 1

      >10000/0.02 = 5000000
      >log2 = just less than 19

      So if your going to use Moore's "Law" to predict when a desktop computer will be able to run this sort of job on its own, you have to multiply by 1.5, 18 months per doubling, or slightly under 28 years.

      I'm pretty dubious about using Moore's Trend that far in the future, though...

  81. Re:And so what if SETI did get a hit? by Dread_ed · · Score: 1

    Or maybe like this...

    ET: Nice to meet you...by the way, the entrance requirement for our ultra-powerful interglalactic league of creatures is the ability to properly model the folding characteristics of protein molecules...have you done this?
    Earth: Well...um...uh...see, we were looking for you, and well...we kinda put that aside for a...
    ET: Oh I see, well then we will just have to destroy you. Fire the "laser beam"!
    Earth: SPLAT!

    Yet another illustration that it is not a good idea to put the cart in front of the horse, nor to rely on others to solve your problems.

    It is completely impossible to say anything intelligent or enlightening in a space this size, excep

    --
    When the only tool you have is a claw hammer every problem starts to look like the back of someone's skull.
  82. Quite a claim... by skintigh2 · · Score: 1

    "Now, for the first time, a distributed computing experiment has produced significant results that have been published in a scientific journal."

    Does that mean all the giant primes that were published never happened?

  83. Re:And so what if SETI did get a hit? by jafiwam · · Score: 2, Insightful

    No.

    Here's why:
    • Greedy pharmaceutical companies benefit from them, they'll get my cycles when that "patent natural genes" crap stops, until then, they can buy their own damn computers.
    • SETI has been around longer, and I simply enjoy watching the numbers get bigger. Other projects would make me start over.
    • Want to do something effective to save lives? Tell the morons around you to wear seatbelts, or stop driving drunk, or maybe tell them fearing vaccinating their children is stupid.
    • Signals from ET would make a huge metaphysical impact on our society, and I for one want to see the fun of the Christians/Hindus/Muslems/etc. struggle with a demonstration of how retarded they really are.

    If all the "yahoos" stopped crunching SETI, it WOULD go away. So you DO wish for it to go away. Let the MAC freaks do the annoying evangelizing, they are better at it.

  84. Re:Sigh... IP? Anyone? by Duncan3 · · Score: 1

    Unlike other projects, everyone who works on a given protein works on it since it's a continuous process not a "you may be a winner" one.

    --
    - Adam L. Beberg - The Cosm Project - http://www.mithral.com/
  85. It's really very simple. by Dthoma · · Score: 2

    SETI@home was around first. That's why it has more users. It's the old faithful that most people know about. (Compare distributed.net to SETI and see how much the public knows about either.)

    --

    Note to M1-ers: a curt but otherwise insightful message is not "Flamebait" or "Troll".

  86. Chaperone Proteins by primenerd · · Score: 1

    I am still an undergrad in this field, so I may be wrong here, but wouldn't another reason to start small be the avoidance of the need to simulate chaperone proteins? Considering the complex and poorly understood nature of chaperones (i.e. heat shock proteins), it would seem prudent to choose proteins that fold without them. Until we have a good model of the various chaperones and how they work (perhaps a future folding@home project) I do not see a way we could simulate them in silico.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    1. Re:Chaperone Proteins by skeedlelee · · Score: 1

      Well, there's small and then there's small. This is pretty much a peptide that has a structure. There are plenty of ~80aa protein domains and full proteins that would still be called small but are globular and can fold all by themselves. These would still be big on the in silico folding scale. Then, there are also really big proteins that are able to fold without help by charperones. Chaperones are a whole other level of complexity. yes it would be really cool to try to simulate their action as well but there's a long time to go before that happens, and a lot of interesting work to do before they need to be included (ie. the above discussed globular proteins, eg. HEW lysozyme, which has vast amounts of kinetic folding data on it, most without chaperones, but this sort of simulation with many, many trajectories still hasn't been done on it.

      On the other hand, chaperones are actually really interesting to think about in this context. Some folks in the chaperone community might argue that the current method of in silico folding is actually a great way of modeling chaperone function. One model of chaperone function is that because they isolate a single folding protein into their internal cavity, they allow folding at infinite dilution (no other folding proteins nearby). Given that in silico folding studies pretty much always are done with only one protein molecule in the system, this is actually a reasonable approximation. Arguably, this is a great simulation of protein folding with chaperones, not in the cytosol (without them). But this is getting silly.

  87. We're not alone, just unpopular. [IMHO] by The_Guv'na · · Score: 1

    Take a look at the world, and our countless radio-based broadcasts since the invention of tuned transmition. Would you drop in to say hi?

    Didn't think so. ;)

    Ali

  88. But you dont know if..... by Albinoman · · Score: 1

    Something is curable. People dont seem to accept the possibility that something is not curable in some way. Besides that, theyre folding a protein that doesnt do anything. According to the article, the protein is useless.

  89. What has been done by WillWare · · Score: 2
    Reading the MSNBC article would lead you to think that the only thing accomplished by folding@home has been a feasibility test with a toy (non-biological) protein. The results page (see Google cache) shows dozens of simulation runs, including some of clinical significance.

    The big win with the toy protein is that it allows for experimental verification of the validity of data produced by FAH clients. That's a good thing, because biochemists are very suspicious of simulations and tend to ignore them until there's compelling correlation with results from a real lab.

    Hopefully this will substantiate a large number of already-done simulations, or at least put them in a position where they suggest some very small amount of lab work to verify an interesting result.

    To the folks complaining that only the big pharmas will benefit: This stuff is being done in academia. Would you prefer the big pharmas did it internally and there was NO CHANCE AT ALL for the results to make it into the public knowledge base? Be realistic - you KNOW the big pharmas will be the big winners on anything like this - that's the business they're in. For the rest of us, the best hope is to hasten the day when cheap generics of the resulting drugs are available for low-income patients.

    I question the thinking that much would be gained by fighting the big pharmas (quite aside from the complete ineffectiveness of a typical /.er in doing so). They are bearing the research costs for the drugs, as well as the expense of pushing them thru the FDA pipeline. Open-source bazaar-style development will not work for new drugs, no matter how much we wish it would.

    --
    WWJD for a Klondike Bar?
  90. I would run it, but... by inkfox · · Score: 2

    I'd run the folding project, but the source is closed. I've got a lot of machines with spare cycles, but I sure don't want to grab some bit of code and run it 24/7 if I'm not free to peek under the hood in exchange.

    --
    Says the RIAA: When you EQ, you're stealing bass!
  91. Re:And so what if SETI did get a hit? by Zathrus · · Score: 2

    The only reason I can think of is for cryptography purposes.

    My personal opinion (again) is that it's a fairly bunk reason to spend CPU cycles on - it doesn't really enhance cryptography much, and modern crypto is either secure enough for a long, long time or it's doomed to insecurity no matter what (which viewpoint you take depends on how successful you believe quantum computing will be).

    Of course, I'm not a mathmatician either, so I may be missing out on other practical uses for large primes.

  92. chroot anyone? by runswithd6s · · Score: 2
    You (the reader) may not agree in the general distrust I have for binary applications from third parties, but I would rarely run one of these applications outside of a chroot environment. There is an implicit trust that the software provider is only working under your best interests, but can you truly trust someone you don't know personally or someone who won't guarantee that their program won't destroy your OS installation?

    My general attitude about such software is to give it a shot, but only in a chroot jail. This particular software, the Folding@home binary, has been unsuccessful in running under such an environment. It will start running, but it won't retrieve data sets from the servers.

    Whose loss is this? Not mine. If I can't get something running in a satisfactory environment after spending a reasonable amount of my valuable time on it, I don't run it.

    Has anyone had success in running the Linux binary in a chroot?

    --
    assert(expired(knowledge)); /* core dump */
  93. Best ways to run client by mike3411 · · Score: 1
    For those of you that are interested in participating, but don't like having to deal with the limitations of their client (the console version is cool, but still no where near as nice, imho, as the distributed.net client) you can find some good info on setting them up as services, and running two clients (for all my dual-CPU peeps out there)here. Yeah, it's kind of a pain to set up, but the client is very stable and once you've got this configured, you'll never have to touch it again.

    Shameless plug for 2cpu team, ranked 25th & rising!

    --
    Mod me down, and I will become more powerful than you can possibly imagine!
  94. Not to troll, but... by jpt.d · · Score: 2

    If we all donate our computer time for this and then we help figure out how {whatever the target is} works - what will stop the medical companies from patenting and sucking our wallets for treatments later on?

    --
    What we see depends on mainly what we look for. -- John Lubbock Now search for that bug slave!
  95. Pls mod up parent.... by anonymous+cupboard · · Score: 2

    This is a good point. Full simulation is very difficult, but where are the manual tweaks on a protein molecule? Do we know the problem envelope well enough? There is a lot of 'domain knowledge' on airframe engineering, but are we there for protein molecule folding?

  96. Re:And so what if SETI did get a hit? by ckedge · · Score: 2

    > Vijay means well

    True, and he probably doesn't need 500,000 clients, so no big deal. Better that his efforts go to analyzing the output than trying to make something so perfectly stable and run that it attracts more CPUs than his group can handle...

    I think I used the word buggy too many times, I was never driven to anger. It just wasn't worth it to keep running it, as far as I was concerned. No hard feelings and no harm done, well not too much. My time is in fact relatively cheap ;)

  97. You have to wonder.... by theskov · · Score: 1
    From the Distributed Chess webpage....:

    The project does have quite a number of steady contributors and regular visitors. But when I look at the overall stats, I notice that we could use some fresh publicity, since the number of new visitors is decreasing steadily. Therefore it will be much appreciated, if you - the steady participants - go ahead and promote the project on the web, e.g. write about it in news groups and so on. To get it mentioned on Slashdot or some similarly popular news site would be optimal, of course.
  98. Still detectable.... by Goonie · · Score: 2
    Even if we discard all our simple radio gear and go with all this funky stuff that emits "random noise", surely that doesn't make us undetectable to a long-term observer. If you were observing the sun with a radio telescope, you'd notice this unusual amount of radio noise that varies according to a 24-hour (approximately) cycle, again for no apparent reason. Wouldn't you?

    Sure, that's a lot harder than pointing a telescope at the Sun and having "HELLO WORLDS" coming at you in Morse Code on a single frequency, but it's still possible.

    --

    Any sufficiently advanced technology is indistinguishable from a rigged demo
    --Andy Finkel (J. Klass?)
  99. Re:Microsoft also has a client by RAMGarden · · Score: 1

    Funniest post, EVER!

    --
    --- Nothing is secure.
  100. Team Slashdot by Tinlash · · Score: 1

    Hey, Is there a Team Slashdot for the FAH project? I bet it'd be able to destroy a bunch of other teams.

    1. Re:Team Slashdot by Tinlash · · Score: 1

      One more thing. Visit: http://forum.folding-community.org/ for the official FAH Forum. Ask questions there.

  101. Re:Sigh... IP? Anyone? by whovian · · Score: 2

    Yes, of course, you are right. Gosh, my phrasing was horrible. My motivation was not rooted in egotism. Really.

    My main concern with F@H and S@H is that their central question is not based on a falsifiable hypothesis. These projects are basically open-ended or exploratory searches. It could very well be true that there exist(ed) alien civilizations, while at the same time it can also be true that we may never detect them. Resource after resource can be put into something whose progress you really cannot evaluate. Still, neither project is entirely in vain because it can produce some results, information, or guides for how to proceed. With such projects, obtaining any single positive result is remarkable.

    --
    To-do List: Receive telemarketing call during a tornado warning. Check.
  102. Re:And so what if SETI did get a hit? by psychalgia · · Score: 1

    you've neglected the prime directive...

    --

    ________________________________________________

  103. first and second of all.. by NiTRiX · · Score: 1

    First of all; better uses for spare cycles:

    Microsoft@HOME:
    While on the surface the client application would collect information on software vulnerabilities and then simulate different instances of a MS installation and try to exploit the system, but the client would also have a built in backdoor that would continuously send microsoft information about how badly you want to find these vulnerabilities, all on accident of course.

    recode@HOME:
    The client would access google's web database, access pages that used certain kidns of code, specified by the user of course, and then analyse that code and try to produce a faster less bloated replica. Thus providing webmasters much more efficient versions of their own pages allowing the internet to be much easier to navigate.

    ada@HOME:
    This client software would also use Google's cache, however it would simply analyze a website for ADA compatability. If a violation is found, a lawsuit is immediately set against the offending website and the money goes to.. um.. me.

    Second of all, for the record, I would have to say 90% of the geeks in the world that do distributed anything do it for stats. Hell, I didn't spend two weeks compromising the computer lab at DeVRY in order to setup RC5 as a system service just so I could 'help out', hell no, it was all about the stats baby. 120 kkey/s was well worth the trouble. And I'm on SETI right now because I want to catch up to some of my friends, and I have some available horse power to do it.
    It's all about the stats.

    --


    on the sixth day God created man.
    on the seventh day, man returned the favor.
  104. Who are these guys? by miltieIV2 · · Score: 1


    Ok, so we know who these guys are: http://folding.stanford.edu, but who are these guys: http://www.foldingathome.org

  105. Last Post! by alpg · · Score: 1

    The hieroglyphics are all unreadable except for a notation on the back,
    which reads "Genuine authentic Egyptian papyrus. Guaranteed to be at
    least 5000 years old."

    - this post brought to you by the Automated Last Post Generator...