Folding@Home Reports Success
msheppard writes "This Article describes how the folding@home distributed computing project is reporting that they used the data processed on client machines to "predict the folding rate and trajectory of the average molecule." Too bad Seti@Home hasn't had a hit yet."
Did anyone else think this was yet another article about @Home going bankrupt?
I make all sorts of neat origami... Frogs, swans, flowers, all very lovely! I can also make some kick ass paper airplanes.
Here.
MSNBC Article.
Folding@Home Home
For the real info though check out the Forums
Token link to how my team is doing.
PRIME1
http://www.kubuntu.org/
That's average protein molecule, you insensitive clod!
that the sister project genome@home was so monumentally badly mismanaged that it effectively merged with folding@home a distinct project. I lost complete faith in the Pande group at that point along with a lot of other genome crunchers and switched all my CPU's back to SETI...
I don't read your sig, why do you read mine?
Maybe next we can use our screensavers to do something cool like search the web for potential stories to post on slashdot.
Too bad Seti@Home hasn't had a hit yet.
Well, here's the thing: "we know molecules exist..."
If you like F@H, check out Distributed Folding.
Look, ma! I'm a karma whore
SETI@home has much nicer graphics, albeit, a much dumber purpose. I'll stick with folding@home, but I wish they would pretty the damn thing up a little--at least on the Mac OS X platform.
blarg.
I hadn't realized how many distributed (grid) computing programs were out there... Check out Google Directory's list of links to distributed computing pages/projects here... Distributed Chess sounds very interesting!
Sorry, brain no workie this morning.
go here instead
It would be cool if someone would develop an opensource API for this sort of thing. Then us lazy people out there could easily write programs to utilize this sort of processing power. I wouldn't mind harnessing the power of 200 computers to perform a Bubble Sort.
in saying that it's the first distributed computing success. Look at the success of the distributed.net project, they just recently cracked rc5-64, and have cracked several other ciphers before.
Okay, it's nice to see that distributed computing is finally becoming a useful tool. Nonetheless, I don't think there's anything particularly impressive about the biological results. The proteins they're folding are so small that most factors that affect the folding and conformation of the vast majority of proteins simply don't exist. When someone accurately predicts the structure of a normal globular protein at atomic resolution, I'll be impressed. When they can predict the structure of the F1F0 ATPase, then we can throw out crystallography- but it's not going to happen. (Ignoring for the moment that crystallography has it's own issues. . . at least it can show active sites and quaternary structure)
Don't get me wrong, the geek half of me thinks that what they're doing is very cool (and far more interesting/useful than Seti@Home). But I don't think it's very relevant to biology, and I doubt it'll ever replace traditional methods. Computers have almost unlimited potential as an aid to experimental structural biology, but in silico protein folding is still a pipe dream and a hand-waving exercise. The theory is really cool, the practical applications are nearly zero.
(Disclaimer: I don't have a PhD so I'm not very qualified in this field, but I do have a BS in biology and a fair amount of experience in programming and some knowledge of molecular simulation.)
Amen. If you are going to use your spare cpu cycles for something, apply them to a good cause. Besides if you study much on the SETI project, they look at a very limited range of data of the odds of finding anything interesting are exponentially worse than you'd even think. At least the various folding projects and the think project from intel and other medically related go towards good causes where every bit of data helps the cause.
It would be interesting to see a comparison between the numbers of users using seti@home versus these other systems. I find it just slightly depressing that a lot of people would rather look for possibly non-existent little green men than actively participate in the search for something that will benefit people in the very near future. I guess curing cancer isn't 1337 enough for some people.
SETI is a nice concept, and I don't wish for it to go away, but it is a waste of your spare CPU cycles.
And who, exactly, are you to say what other people should be doing with their own spare CPU cycles on their own machines? Who died and made you dictator? Do you have any idea how many people paid the ultimate sacrifice so that free people in a free society can choose to do whatever they want with their selves and their own private property, without any constraints or impositions from governmental authority?
Say NO to SETI and YES to Folding/Genome@Home.
Uh huh. Sieg bloody heil, laddie.
if you are intressted in distributed computing, good page to start with is http://www.aspenleaf.com/distributed/. there is info on every existing distributed computing project (both upcomming and existing), lots of articles on distributed computing and even links to books on distributed computing.
-- http://electronicintifada.net --
if we only focused our minds and money on problems that are immediate to us, we would be making a grave mistake. if we DID find evidence of another civilization, the philosophical ramifications would be enormous.
smd4985
If SETI can get 100s of thousands of people do lend cpu cycles, and folding@home (which is MUCH more obscure than SETI) can get 30k people.
:)
Then this phenomina should really be looked at by marketing people. It's amazing they can start a project, and just assume people will want to download their little client to use up cpu power ala screen saver.
What drives you people to use these clients? Why bother? And don't tell me it's cuz you want to do your part to find aliens
--Me
Hm,
:)
In the "Space" documentary series (hosted by Sam Neill), one researcher mentioned something about "except that one time".
Apparently they had some signal, but it was gone before they could reallign the dishes to get a confirmation.
I guess they ruled out possible "domestic" signals...
If anyone could guide me to a more elaborate source except that remark of one of the researchers, I would like to read it
Genius doesn't work on an assembly line basis. You can't simply say, "Today I will be brilliant."
This(postscript) is the the original paper on the hardness of String Folding problems.
I'm sorry but this was funny...somebody mod this guy up...of course I thought it was 7 times. And what if it is very very thin paper?
-- "You used your dictaphone to post, didn't you?"
Personally I like United Devices although there is a bit of controversy surrounding them. Check out their faq.
If we get one Seti hit and we may be able to replace ALL of our current problems with new ones.
Earth: How do we cure cancer/every disease we know of?
ET: Use *this*, but now that you're living forever, you have to worry about massive overpopulation.
Earth: How do we get off this planet?
ET: Use *this*, but now you have to worry about war between your planets.
Earth: How do we achieve peace?
ET: Use *this*, but now you're bored outta your minds.
M@
Krispy Cream is people
Comment removed based on user account deletion
Slashdot reports "Folding@Home Reports Success"... you can too! That is right, with Folding@Home and Stuff@Home, you too can become $$$RICH$$$ with Envelopes@Home!! Send your $1 in and a SASE to us today!!
This article was presented to you because you subscribe to the opt-in Slashdot site. If you no longer want to subscribe, please write "unsubscribe" on a $5 bill and send to Envelopes@Home. All removal requests honored.
This article can not be considered spam because we provide an opt-out method per Bill S. 1618 TITLE III passed by the 105th U.S. Congress.
This message is NOT intended for residents of WA, CA, or VA.
It might well be seven. And I agree it was pretty funny - some people have no sense of humour :).
Hehe. Because of your comment, I'm going to take two of my machines that are currently running GIMPS clients (Great Internet Mersenne Prime Search) and run SETI@Home instead. I've got a desktop machine running Folding@Home, but if I see many more comments like this, I'm going to kill that one as well. (Hint: People can use their own spare CPU cycles on whatever they like.)
I think what drives people to use these clients is simple. I have heard several "technically adept" (read: geek) friends state that they simply hate to see their computer sit idle.
They have paid for the hardware, paid for the bandwidth, paid for the electricity. It should be doing SOMETHING. Even if it is just displaying flying toasters.
(I presume that this is what they were referring to).
The article Said: "Specifically, the computers predicted that one experimental protein would fold in 6 microseconds, while laboratory observations revealed an actual folding time of 7.5 microseconds. " That sounds quite a bit off to me, I guess I really don't understand any of this. I do however think it is very nifty to use extra cpu cycles for something other than 'HLT'.
Later, when folding@home has folded, the distributed power of the toolbar may be used to make a 'Super-Google' of sorts. (is that a pun?)
no doubt. I mean was it really that big of a stretch going from protein folding to paper folding? I mean it's not like he made a joke about folding laundry or anything...
-- "You used your dictaphone to post, didn't you?"
By the time Folding@Home or Genome@Home actually produce data useful enough to lead to medical cures, your wristwatch will be powerful enough to fold proteins in seconds. Don't confuse a nifty theoretical exercise with experimental science. Neither the technology nor the methods are sophisticated enough for this to be of any help to people with cancer etc. I wish someone would come up with a project that actually produced useful biological data with distributed computing. BLAST@Home, maybe. Doesn't sound nearly as sexy as protein folding, I guess.
(You're still right about SETI, though. What a freakin' waste.)
I submitted this as a story, but it was rejected. Google has incorporated distributed computing into its toolbar as an option. The first supported project is Folding@Home, but they will add more projects in the future. Its optional, and currently has only been released to a few toolbar users. It will gradually be released to all users. Check it out at toolbar.google.com/dc/. Google is currently seventh in the team statistics...
*IF* SETI gets a hit, it will be more like:
Earth: Wow, a spike that may have possibly been generated by an intelligent life form millions of years ago...
ET: ???
"Ignorance more frequently begets confidence than does knowledge"
- Charles Darwin
Well, on a related topic has anyone thought of this explanation for why SETI has found no results :
Most current radios, based on decades old tech, broadcast a very orderly signal. It is confined to a narrow band range, only one transmitter is allowed per channel, the data being transmitted is uncompressed and so has many repeating orderly patterns.
To increase capacity future radios will do the opposite.. They will broadcast compressed data that seems completely random, they will use a large swath of spectrum, they will repeat parts of the same signal across a large portion of the spectrum using a "chipping" algorithm. Even farther in the future, so many radios at once may be talking on the same spectrum that to identify a particular sender in order to communicate you'll have to use multiple antennaes and know his location (you'll share spectrum based on location).
What is the end result of advanced communication gear that intelligent minds develop? What is the optimal result? To an outside observer the signal will seem like pure, almost totally random noise. Only to the electronics of a particular receiver that has the correct encryption and chipping key will it seem like anything else.
THAT's why we can't hear anything. Trillions of sentient beings could communicate using this method and we wouldn't hear a thing.
2. use their spare cycles to do my computing
3. ?
4. profit!
sorry, couldn't resist :)
track7.org has all kinds of interesting stuff!
Switch to kuro5hin - it has a wayyy bettre moderation system. although less stories (ducks)
You see... folding at home is going for a tangible goal... seti is... searching for ALIENS! ;)
I still prefer Seti@home, it looks cooler
--JonnyBlog
And what about all the tens or hundreds of millions that aren't running anything?
Hint: People can use their own spare CPU cycles on whatever they like
Sure they can. That's not in question. But the theory behind the distributed clients is to avoid wasting CPU cycles and to do something useful.
The point of the OP was that SETI@Home (and, frankly, RC5 crack searches) are osteniably no better than having the CPU cycles spinning anyway. Projects like Folding@Home, Genome@Home, and UD Cancer Research can provide a real, proveable benefit in both the short and long term. Mathematical projects like GIMPS and prime number searches do so as well, although my personal opinion is that they're not as valuable.
Use your CPU cycles however you like. Hell, don't run a distributed project at all if you don't want to. All that's being asked is to consider how to actually use the spare cycles effectively if you're going to join a distributed project.
That's right! Will somebody please think about the children?!??!
From the article:
"Specifically, the computers predicted that one experimental protein would fold in 6 microseconds, while laboratory observations revealed an actual folding time of 7.5 microseconds."
They missed the prediction by 1.5 microseconds. While that may not sound like much, that's 20 percent of the actual result.
Are these considered good results? I'm no protein folding expert...but 20 percent seems like alot.
-ted
I ran folding for a couple months a year ago. I tried again in the spring for a couple weeks.
Each time I quit and removed it from my system.
Buggy installs, buggy software, buggy server statistics, unoptimized code, and a direct quote from Vijay that said "I don't care" about those issues because he already had enough people running the client for his purposes. Or at least that's my opinion of and the feeling that I was left with.
...I even snickered thinking that someone else besides me found @Home's troubles a "success". ...Although, knowing them, I bet they'd even fail failing.
ZERO
What I can't figure out is whether or not these are the same projects now!
Of course since glibc 2.3.1 killed the folding@home client....
X(7): A program for managing terminal windows. See also screen(1).
No, I think they call it "Fording at Homu."
Yes it does. Be sure to set chmod +x $FILENAME.exe also.
Where does the school board find them and why do they keep sending them to ME?
Easy.
TANSTAAFI: There Ain't No Such Thing As A Free iPod.
if you don't like the .exe just rename it! Either way it's chmod a+x FAH3Console.exe then ./FAH3Console.exe. Tean number 668 when it asks. Just kidding.
Last I heard, this was an opinion oriented discussion board. Your stupid fucking troll post could easily be applied to anything anyone says about anything. Fuck yourself.
Actually, even if you are using your spare cycles for something like RC5 challenge, at least you are advancing distributed computing.
I had my computer in the RC5 challenge, not because I could care less about he secret phrase, but because I hope it advances research in distributed computing. I guess right now, I am way more interested in the medium, then the message
The theory is really cool, the practical applications are nearly zero.
Much like the SETI@Home search, methinks.......... this isn't a troll, this is my honest opinion, but feel free to mod it as you wish.
I've read the Folding@Home FAQ looking for information about what they plan to do (from an IP standpoint) with the information they get. The "answers" they provide are pretty vague on the details.
Unlike other distributed computing projects, Folding@home is run by an academic institution (specifically the Pande Group, at Stanford University's Chemistry Department), which is a non-profit institution dedicated to science research and education. We will not sell the data or make any money off of it.
Ok, they won't make any money off it, but who might? Who owns any patents? What actually is done with the data? And the non-profit bit tells me nothing. The Vanguard Group is a non-profit too, but that doesn't mean they aren't interested in money. (Vanguard is owned by the investors, hence non-profit, but not really) Just because it is a non-profit institution doesn't tell me much. Universities are non-profit but they make a ton of money off of IP. They can do whatever they want but before I commit my processor cycles to helping I'd like to know specifically what I'm helping.
The FAQ goes on to say:
Moreover, we will make the data available for others to use. In particular, the results from Folding@home will be made available on several levels. Most importantly, analysis of the simulations will be submitted to scientific journals for publication, and these journal articles will be posted on the web page after publication. Next, after publication of these scientific articles which analyze the data, the raw data of the folding runs will be available for everyone, including other researchers, here on this web site.
So the data is going to be available. How? What "levels"? To whom? For how much? Just saying it will be published in journals tells me little. What else will be done with it? Who stands to benefit from the data? (aside from the obvious)
Basically I want to know and am not impressed with their answers. I'd like some candor when it comes to something this important. With SETI@home, who really cares? That won't affect my life. Folding@home might.
Well, I kinda agree and I kinda disagree.
First, you can't expect to go from no success to complete success overnight. People have been trying to fold proteins for some time now and have basically failed because it is freakin' hard. The theory is in principle in place, a least to a first approximation, but the calculations are so intensive that they have basically beaten every comer. As an undergraduate I remember how everyone in the field thought getting bigger and better grants and buying bigger and bigger computers was the answer. Oh to be SGI in those days. They sum up the problem pretty well in the Nature paper, essentially a modern (desktop) computer would require a few decades to crunch through a single useful length simulation. Then you need to do it many times to get a useful answer (say 100-1000). Even supercomputers are going to balk at that kind of calculation. Moore's law what it is, we should then be able to get through an in silico simulation in a week on a single computer (when its this fast crystallography really will be dead) by, oh say 2040 at best. (somebody want to calculate that exactly, 10000yrs -> 0.02yrs is how many doubles). So yes, this hasn't gotten rid of x-ray crystallography just yet.
But this is still really cool. Complaints about interface and maintenance aside, this was a great system. It relied on four pretty bright insights.
First, that distributed computing is essentially the poor man's (cough, the academic's) super computer. Also, it automatically adapts itself to technological improvements. People will buy new computers from time to time and, hopefully, reload your software.
Second, that there was no reason other than no one had sufficiently brute forced the process that the existing methods shouldn't work. They use a bunch of 'cheating' techniques to make this managable during the screen saver timescale, such as a united atom model (I think that means they ignore aliphatic hydrogens) and implicit solvent (don't treat it as individual solvent molecules, just a uniform field). It was an open question as to whether this approach would work at all or if you had to go over to much more explicit methods to get it to work at all. It appears that this has kinda worked with the cheater methods in place.
Third, choice of a test case. Yes they chose something that was small. This isn't surprising. They wanted to be done sometime this decade, remember there is a graduate student as the primary author here. Small was necessary. However they also chose a FAST-FOLDING protein. That was clever. Basically, even with distributed computing, it is still hard to simulate a full microsecond of time. Thus they chose something that had some chance of completing its folding one the time scale that they could look at.
Fourth, they remembered their P-Chem. It is really hard to run these things to completion... so they didn't. You don't have to run the simulation until 99% of the molecules have completely folded, just until an appreciable number have folded and you can extrapolate the behavior from that. They ran a 20ns simulation (at the longest). The thing takes 7us for ~60% to fold. As a result only once in a great ong while did one of the simulations actually produce a folded protein. But by doing it ~10000 times they could figure out how that translated into the rate constant. That's clever.
That said, yes there is a long way to go on this, but its still a really clever paper. No we haven't cured cure cancer yet, but its still progress. And forget an in silico structure of the ATPase, that's largely understood already (check the RSCB/PDB there's a bunch). The real challenge will be getting a structure that size that hasn't been solved by other methods and convincing anyone else that you're right! Disclosure- I don't have PhD in this area yet, but I'm close.
Perhaps the kinetic "experimental" 1.5 usec lag time is what is referred to in this PNAS article by Alan Fersht.
Hi, I'm the administrator for the big ASCI Purple cluster and, do to a lot of budget cutbacks, we have a lot of spare CPUs (like 30,000).
Would anyone mind if I joined their team?
We can only hope that the aliens can actually legally send signals and aren't emcumbered by "Patent 1,345,821,098,836: sending signals encoded in high frequency waves to unknown lifeforms over the aether", and that they think the unknown lifeform receivers have a shot of decoding the signal without getting hit by "IGADCA - Inter-Galactic Age Digital Copyright Act: violations of decrypting the radio encoding".
Hmm, maybe they have 8 arms and tentacles, and they'll just bite the lawyer's head off when they disagree with them.
Who is this guy, and why does he make such an obviously false statement? Should this make me willing to trust these people and contribute to this process?
If it takes one CPU-day to do 1ns of folding simulation, then protein folding is difficult to simulate because it occurs over a (relatively) long, not short time. This should be obvious, and therefore either the statement is either a deliberate lie or a misquote.
"I'm a Protein Folder and I VOTE!"
Kevin Fox
You mean, a success at running through a known mathematical algorithm that, unsurprisingly, got the expected result?
This is a success in that it is actually advancing the state of human knowledge.
The cake is a pie
I've been folding for 2 years and I'll tell you they have deadlines on their work units; nec. to proceed to the next time step of the simulation.
Only people who can meet the deadlines should fold- every else should do something else.
To meet the deadlines you should:
1. have a fast machine ( > 300 Mhz)
2. leave your machine on 24/7
3. have a persistant connection or
dial in every 6 hours or
set up your computer to autodial.
...... he's merely stating his opinion. A key difference between an opinion and a dictator: an opinion is an idea, to be used or discarded at one's discretion; a dictator force-feeds their opinion(s) down your throat.
Don't get so militant. Relax. Breathe. See you next week.
I agree with you. I don't understand what these idiots are on about. Nobody's forcing anything on anyone.
The public is helping with this research. Hell, the global public is helping.
Who gets to hold any patents that arise?
--
Don't like it? Respond with words, not karma.
Hear hear! We are agreed!
-end lame spam joke- ;)
Seriously, this is cool. Perhaps having success in one area will lead the folding@home team to explore totally new areas, and have a breakthrough on something they never even planned to look at. With the recent end of RC5-64, I've switched to F@H, mainly because I feel that, in some small way, it helps to improve the human race.
"To confine our attention to terrestrial matters would be to limit the human spirit." -Stephen Hawking
That would be something to write about.
-- Many men would appreciate a woman's mind more if they could fondle it
A comprehensive list of distributed projects can be found here http://www.aspenleaf.com/distributed/
scott
This is why I never picked up on F@H. In contrast, the distributed.net projects state they will include your name in any meaningful results if you are the discoverer (and pay you an award).
To-do List: Receive telemarketing call during a tornado warning. Check.
Frankly I'm not sure what I believe, or what "theories" have greater validity or not. Though I am inclined to agree with your conclusions (that it is unlikely to find a signal from a developing civilization)
I do think however is that we (as people) tend to over generalize theories and often treat ideas (much as you said) as religions. We feel a great encompassing grand unified theory is somehow more appeasing than chaos. So we seek purpose in the universe, even should that purpose merely be an ordered cause and effect.
Unfortunately I'm inclined to believe this kind of thinking leads to many slippery slopes. In this particular instance, explaining the whole arising of human civilization as a natural product of evolutionary terms. I'm not so certian this is the case (though I'd like to see theories [with supporting evidence of course] on it) certainly evolution could be said to have gotten the ball rolling and given us an opportunity to create a species able to developed a civilization, but what, I wonder are the probabilities of that happening?
Until we have another sampling, a different evolutionary chain to compare to, saying that a "civilization" is a natural (that is to say a probable) product of evolution is as faulty as rolling an infinitely sided dice and saying the number it lands on it is always likely to land on.
Only if we can show that evolution does not have an infinite possibility for creations and traits, can we really say there is likely another civilization somewhere. And sampling of one, just ain't going to cut it.
I'm just blathering. =]
Why can't we have some stories on concrete subjects like the furry Sasquatch or the ever playful Nessie?
-- "You used your dictaphone to post, didn't you?"
...something about Distributed Computing pops up but since I don't have the skills myself I feel it's important to pollenate the minds of as many people as I can. I might just get lucky. ;)
:)
;)
But anyways:
What is needed isn't multiple clints for each project, but one client which can take plugin's for any project that's out there.
Say you can't decide between Seti and Folding @Home projects, why not divide up the work units? For every 1 Folding unit you could to 3 smaller Seti units. That way you can help every group that you want. And if one group has problems you don't wait for days to get a new unit, you can just start on another group.
I'm just not sure how pretty screensavers would turn out with a plug-in method.
O.k... I'm done, you can go and ignore me now.
Wiwi
"I trust in my abilities,
but I want more then they offer"
I agree with you 100% about the bugginess of the Folding@Home client. However, I also agree with Vijay that it is a minor issue. (I still wish they would make it more like UD.) UD may have a nice stable client, but they're a bunch of pricks, and brute force drug searches don't advance pure science as much as the fundamental discoveries made by projects like Folding@Home. Vijay means well, so please forgive him for his lack of social refinement regarding his project. 263 units and counting; I feel good about the use of my spare cycles.
I think if you're this anal about donating a couple of spare cycles of your CPU while it's not processing porn, they'd just as soon as you not bother helping out anyway. :)
I was just in it for the cash prize....
10000/0.02 = 5000000
log2 = just less than 19
Applying moors law to the earth simulator in japan might be a better Idea than applying it to a desktop PC.
I've never seen desktop x-ray crystallography.
thank God the internet isn't a human right.
Or maybe like this...
ET: Nice to meet you...by the way, the entrance requirement for our ultra-powerful interglalactic league of creatures is the ability to properly model the folding characteristics of protein molecules...have you done this?
Earth: Well...um...uh...see, we were looking for you, and well...we kinda put that aside for a...
ET: Oh I see, well then we will just have to destroy you. Fire the "laser beam"!
Earth: SPLAT!
Yet another illustration that it is not a good idea to put the cart in front of the horse, nor to rely on others to solve your problems.
It is completely impossible to say anything intelligent or enlightening in a space this size, excep
When the only tool you have is a claw hammer every problem starts to look like the back of someone's skull.
"Now, for the first time, a distributed computing experiment has produced significant results that have been published in a scientific journal."
Does that mean all the giant primes that were published never happened?
No.
Here's why:If all the "yahoos" stopped crunching SETI, it WOULD go away. So you DO wish for it to go away. Let the MAC freaks do the annoying evangelizing, they are better at it.
Unlike other projects, everyone who works on a given protein works on it since it's a continuous process not a "you may be a winner" one.
- Adam L. Beberg - The Cosm Project - http://www.mithral.com/
SETI@home was around first. That's why it has more users. It's the old faithful that most people know about. (Compare distributed.net to SETI and see how much the public knows about either.)
Note to M1-ers: a curt but otherwise insightful message is not "Flamebait" or "Troll".
I am still an undergrad in this field, so I may be wrong here, but wouldn't another reason to start small be the avoidance of the need to simulate chaperone proteins? Considering the complex and poorly understood nature of chaperones (i.e. heat shock proteins), it would seem prudent to choose proteins that fold without them. Until we have a good model of the various chaperones and how they work (perhaps a future folding@home project) I do not see a way we could simulate them in silico.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
Take a look at the world, and our countless radio-based broadcasts since the invention of tuned transmition. Would you drop in to say hi?
Didn't think so. ;)
Ali
Ph33r m3!!!
Something is curable. People dont seem to accept the possibility that something is not curable in some way. Besides that, theyre folding a protein that doesnt do anything. According to the article, the protein is useless.
The big win with the toy protein is that it allows for experimental verification of the validity of data produced by FAH clients. That's a good thing, because biochemists are very suspicious of simulations and tend to ignore them until there's compelling correlation with results from a real lab.
Hopefully this will substantiate a large number of already-done simulations, or at least put them in a position where they suggest some very small amount of lab work to verify an interesting result.
To the folks complaining that only the big pharmas will benefit: This stuff is being done in academia. Would you prefer the big pharmas did it internally and there was NO CHANCE AT ALL for the results to make it into the public knowledge base? Be realistic - you KNOW the big pharmas will be the big winners on anything like this - that's the business they're in. For the rest of us, the best hope is to hasten the day when cheap generics of the resulting drugs are available for low-income patients.
I question the thinking that much would be gained by fighting the big pharmas (quite aside from the complete ineffectiveness of a typical /.er in doing so). They are bearing the research costs for the drugs, as well as the expense of pushing them thru the FDA pipeline. Open-source bazaar-style development will not work for new drugs, no matter how much we wish it would.
WWJD for a Klondike Bar?
I'd run the folding project, but the source is closed. I've got a lot of machines with spare cycles, but I sure don't want to grab some bit of code and run it 24/7 if I'm not free to peek under the hood in exchange.
Says the RIAA: When you EQ, you're stealing bass!
The only reason I can think of is for cryptography purposes.
My personal opinion (again) is that it's a fairly bunk reason to spend CPU cycles on - it doesn't really enhance cryptography much, and modern crypto is either secure enough for a long, long time or it's doomed to insecurity no matter what (which viewpoint you take depends on how successful you believe quantum computing will be).
Of course, I'm not a mathmatician either, so I may be missing out on other practical uses for large primes.
My general attitude about such software is to give it a shot, but only in a chroot jail. This particular software, the Folding@home binary, has been unsuccessful in running under such an environment. It will start running, but it won't retrieve data sets from the servers.
Whose loss is this? Not mine. If I can't get something running in a satisfactory environment after spending a reasonable amount of my valuable time on it, I don't run it.
Has anyone had success in running the Linux binary in a chroot?
assert(expired(knowledge));
Shameless plug for 2cpu team, ranked 25th & rising!
Mod me down, and I will become more powerful than you can possibly imagine!
If we all donate our computer time for this and then we help figure out how {whatever the target is} works - what will stop the medical companies from patenting and sucking our wallets for treatments later on?
What we see depends on mainly what we look for. -- John Lubbock Now search for that bug slave!
This is a good point. Full simulation is very difficult, but where are the manual tweaks on a protein molecule? Do we know the problem envelope well enough? There is a lot of 'domain knowledge' on airframe engineering, but are we there for protein molecule folding?
> Vijay means well
;)
True, and he probably doesn't need 500,000 clients, so no big deal. Better that his efforts go to analyzing the output than trying to make something so perfectly stable and run that it attracts more CPUs than his group can handle...
I think I used the word buggy too many times, I was never driven to anger. It just wasn't worth it to keep running it, as far as I was concerned. No hard feelings and no harm done, well not too much. My time is in fact relatively cheap
Sure, that's a lot harder than pointing a telescope at the Sun and having "HELLO WORLDS" coming at you in Morse Code on a single frequency, but it's still possible.
Any sufficiently advanced technology is indistinguishable from a rigged demo
--Andy Finkel (J. Klass?)
Funniest post, EVER!
--- Nothing is secure.
Hey, Is there a Team Slashdot for the FAH project? I bet it'd be able to destroy a bunch of other teams.
Yes, of course, you are right. Gosh, my phrasing was horrible. My motivation was not rooted in egotism. Really.
My main concern with F@H and S@H is that their central question is not based on a falsifiable hypothesis. These projects are basically open-ended or exploratory searches. It could very well be true that there exist(ed) alien civilizations, while at the same time it can also be true that we may never detect them. Resource after resource can be put into something whose progress you really cannot evaluate. Still, neither project is entirely in vain because it can produce some results, information, or guides for how to proceed. With such projects, obtaining any single positive result is remarkable.
To-do List: Receive telemarketing call during a tornado warning. Check.
you've neglected the prime directive...
________________________________________________
First of all; better uses for spare cycles:
Microsoft@HOME:
While on the surface the client application would collect information on software vulnerabilities and then simulate different instances of a MS installation and try to exploit the system, but the client would also have a built in backdoor that would continuously send microsoft information about how badly you want to find these vulnerabilities, all on accident of course.
recode@HOME:
The client would access google's web database, access pages that used certain kidns of code, specified by the user of course, and then analyse that code and try to produce a faster less bloated replica. Thus providing webmasters much more efficient versions of their own pages allowing the internet to be much easier to navigate.
ada@HOME:
This client software would also use Google's cache, however it would simply analyze a website for ADA compatability. If a violation is found, a lawsuit is immediately set against the offending website and the money goes to.. um.. me.
Second of all, for the record, I would have to say 90% of the geeks in the world that do distributed anything do it for stats. Hell, I didn't spend two weeks compromising the computer lab at DeVRY in order to setup RC5 as a system service just so I could 'help out', hell no, it was all about the stats baby. 120 kkey/s was well worth the trouble. And I'm on SETI right now because I want to catch up to some of my friends, and I have some available horse power to do it.
It's all about the stats.
on the sixth day God created man.
on the seventh day, man returned the favor.
Ok, so we know who these guys are: http://folding.stanford.edu, but who are these guys: http://www.foldingathome.org
The hieroglyphics are all unreadable except for a notation on the back,
which reads "Genuine authentic Egyptian papyrus. Guaranteed to be at
least 5000 years old."
- this post brought to you by the Automated Last Post Generator...