Slashdot Mirror
Hilary Rosen Defeated at Oxford Union
yogi writes "Oxford University Students' Union had a debate last Thursday, titled This House believes that 'the free music mentality is a threat to the future of music.'. Ordinarily, not too exciting, but since it is the Oxford Union, they get Hilary Rosen to speak. She lost the debate, and had to have pictures like this taken. Read the writeup at NTK, or a more detailed one here. I especially like the bit where she asked all the file downloaders whether it made them buy more music."
by walking out of the wrong door!
/usr/bin/awake/too/long
subject sez it all.
Gee, from the title it looked like it was a military defeat, but I guess this will do ;-)
Free Java games for your phone: Tontie, Sokoban
Does anyone else start getting sick of this? The debate is getting so old and the only people saying free music is damaging is some of the artists and the RIAA. I guess it will end up being like open source vs. closed source - and I bet the artists who embrace allowing online downloads will be more sucessful in the end (of course when I make that comparison I also mean that the artist is signed up with a label because they need some form of money - but yet some artists still support downloading their music for free because they have read the research). Hope that all makes sense. What do you think?
My blog [.net, rants, general IT]
When is this freak going to suffer similar humiliation and defeat?
So where can I get that?! I want it!
Hilary Rosen asks "Put up your hand if you download and burn music" (most hands go up). She then asks "Keep you hand up if you buy more music because of it" (many stay up). She gets worried and immediately asks some different and confusing set of people to put their hands up, causing everyone to look miffed, and everyone putting their hand down)
I call BS on this. What was the "different and confusing" set she asked for? I have a feeling it was the interesting part of this exchange... pop culture already tells us we should raise our hands for these first two questions.
Just look at that binder she's holding - full of arguments and facts about why the evil music pirates are devastating the economy, yet she still gets beaten by a couple of punk college kids.
She deserves a pat on the back, for at least trying to defend the glorious RIAA's noble quest against piracy (also known as "fair use")
I really feel that the music industry has, quite simply, realized that they're on the out-and-out, so to speak. With the advent of faster networking technologies over the past few years, and the number of kids attending 4-year colleges (all of whom have broadband connections), the industry truly feels that they lose $0.20 with every *.mp3, *.ogg, and *.wma file that's exchanged via TCP/IP.
Here's some sage advice (from here originally): "If you really want a change, don't vote for either party -- vote Libertarian if you're on the right, Green Party if you're on the left, and independant otherwise. Both parties are in the pockets of big business, and that's bad both for those who advocate freedom from the government as well as those who despise deregulation.
The more we have third party, the closer we get to fairer, European-style representation."
If you celebrate Xmas, befriend me (538
It'd be nice if we could have this sort of debate and result happen someplace it really matters like Congress :)
This sig has been temporarily disconnected or is no longer in service
to go to a university only to face a crowd of filesharing student can either be pictured as stupidity or courage, so let's at least give her that: she was coureagous. She ran into the wolves house!
About the filesharing issue? Depends on wether you recognize intellectual property as a valid concept or not...
http://www.pageliberale.org
...why the debate is framed as free music v. the music industry. We can decide to dislike both sides, and still get free music -- by encouraging musicians to self-publish either samples or entire albums as freeware or shareware. For those without internet connections and CD burners, music stores could offer a write-your-own-CD services (and I think I've seen this in prototype?).
Up to now the recording studios have been like the cartoon syndicates -- a necessary evil because they control the production, distribution, and promotion of music, with staggering overhead. Why does a 25 CD cost $18, anyway, about what it cost when invented 20 years ago? How many non-geek consumers know about this profit margin, and how loudly would they complain if they did?
It should be pointed out that the Oxford Union :-)
(which is where the debate was) isn't the same thing as the Oxford University Student Union. Probably only really of importance to people in Oxford, who know this anyway, though
Hilary Rosen is a woman.
SpamNet - a spam blocker that really works
I agree. It's getting to the point that EVERYONE has chosen sides and the resulting debate has a decidedly religious flavor (ie, no one will ever switch sides from this point on).
Interesting analogy. I have to agree with you: there is so much conflicting data that everyone seems to have made up their minds on the basis of their gut feeling. I imagine there isn't any way of resolving this.
However, I would think that we (the pro-filesharing crowd) could use this ambiguity to our advantage. The **AA wants to limit a powerful technology and impose some dubious laws. And they don't have any iron-clad statistics to back them up. It seems that the burden of proof should be on the **AA to show that filesharing definitely hurts sales. If they cannot show this -- and I don't think they can -- then all their technology-limiting plans should be rejected by the lawmakers. I'm not so naive that I believe this is going to happen, I'm just stating that in a perfect world this non-provable postulate that filesharing hurts sales should be a victory to us. There will always be people who have a "gut feeling" that this is responsible for the financial woes of the music and movie industries, but that shouldn't be enough to enact laws!
GMD
watch this
Come on, take a friggin joke. That was hilarious (or should it be hilaryous?)!
--Joey
" I really feel that the music industry has, quite simply, realized that they're on the out-and-out, so to speak. With the advent of faster networking technologies over the past few years, and the number of kids attending 4-year colleges (all of whom have broadband connections), the industry truly feels that they lose $0.20 with every *.mp3, *.ogg, and *.wma file that's exchanged via TCP/IP."
Would that happen to be the residential broadband that has limits and quotas, or the corporate and educational networks slammed with ceist and desist letters? Those networks? Or did you have some others in mind?
Reassuringly, the motion that "This House believes that the free music mentality is a threat to the future of music" was resoundingly defeated by a hefty 256 "Noes" to 72 "Ayes"
This is more of a popularity contest than a true debate. The RIAA's position is never going to be popular with an illegal file-swapping crowd filled with university students.
Regardless, The RIAA has every right to pursue its goals (i.e., profit) using legitimate business practices.
The RIAA is perfectly allowed to sell music using any method they want. It does not matter if downloaders purchase more CDs due to free advertising. If you believe that start a new record company with free music from your site. Nobody has a right to force a new distribution method on someone else. I prefer the BSD license, but I don't go out and illegally change GPL software to BSD. People have the right to use any license they choose. Similiarly, artists have the right to release free music if they want. They are not forced to sign a contract with anyone. Plus, the distribution method of choice - the Internet - is perfected suited for free music.
If you go into a competition and everyone expects you to loose, but you don't loose as badly as expected then people will notice that and take more notice of you the next time.
Hilary may well have thought that they wouldn't out and out win a debate in such an environment but thought that it was still worth the effort. A strategic defeat perhaps.
Or...
This all reminds me of my old boss; 70+ yr old Jewish man from NYC who used Napster to download old speeches (Winston Churchill was his favorite) and such other things that were hard to find anywhere locally (library etc). He never once used it for music.
"You did very well considering your indefensible position"
har har
to go to a university only to face a crowd of filesharing student can either be pictured as stupidity or courage, so let's at least give her that: she was coureagous. She ran into the wolves house!
Disclaimer: because of the poor write-ups posted, I don't have a good idea of what actually happened at this debate and how fair it was. With that in mind, consider the following theory: Hillary figures she can 'win' no matter how the debate turns out. She has a chance to talk to the crowd that are the biggest filesharers. This is her chance to hopefully convince them that what they're doing is wrong. With a little luck, she'll be able to convince someone in the audience who happens to be in a position of power regarding the computer facilities of the school. She figures if the debate is 'fair' that she's got a reasonable chance to getting her message across. She won't be able to convince those whose minds are already made up, but perhaps she can bring a few students back from the Dark Side.
Now consider the case of an 'unfair' debate. If the debate is 'not fair', perhaps some students will realize that and sympathize with her. But even if she isn't able to convince anyone in the crowd that her position is right and the whole debate ends up being a crazy show, she can then take a videotape or transcript of the 'unfair' debate with her to other people (like politicians) and use that to convince swing-voters that the pro-filesharing crowd is just a bunch of hooligans. She willingly goes into the lions' den to gain sympathy from others when she shows them her 'scars'. "I tried to explain my position and look how they treated me? They're animals!"
This is just a theory. But to characterize her action as either courage or stupidity leaves out another very real possibility: calculating.
GMD
watch this
Asking whether she won or lost is like sending a republican to debate at a democratic convention and having the democrats vote on who won. Give me a break. Although she's bringing up the practical aspects of what p2p does to their business, this isn't even the issue. The issue is whether it is legal for people to share copyrighted without the permission of the copyright holder. The answer is no. It's very simple. Even Janis Ian agrees that you need the permission of the copyright holder. The RIAA has the right to do business anyway they choose. Your only right is to refuse to do business with them if you don't like what they offer. You do NOT have the right to violate copyright just because you don't like the way they do business. It's as unethical as stealing cable, photocopying books, etc.
Vote for Pedro
This summer, I had the opportunity to help officate at a debate held at the Oxford University Student Union. This was for an XML course that was developed by a consulting firm that was presented at the University. During the summer, Oxford hosts a significant number of for-profit and non-profit organizations holding conferences, seminars, and the like.
The city of Oxford and the University are stunning. If you've never seen them, you're missing out.
The debating hall is laid out similarly to the House of Commons, which us 'mericans sometimes get a glimpse of on TV.
At the head of the room is the debate chairman, who presides over the debate and makes sure that the rules are followed. To his left and right are the Union treasurer and librarian. Since this wasn't an "official" Oxford Union debate, all three of those roles were held by participants in the XML summer course. I sat to the left of the chairman, and helped decide matters of debate procedure and scope. (Don't laugh; there actually was one matter to review.On the main floor of the debate chamber is the Secretary's desk. The Secretary likewise assures debate procedure is followed and assists the chairman in doing so.
On either side of the Secretary's table are the proposer of the motion, and the opposer. Each of them leads a particular side of the debate.
Around all of them are the seats for the participants, arranged on both the main floor and a balcony surrounding everything.
Perhaps the most interesting feature of the debate hall are the doors. On the way in, they look like simple double doors. Only when you are inside can you see that over the right door reads a sign saying "Yeses", and over the left door "Noes." At the end of the debate all participants file out through those doors, their numbers counted by the Secretary as they pass. Then everyone files back in to hear the results read.
The Oxford Union is one of the oldest free speech organizations in the world, and certainly deserving of respect on that basis. The debating hall is a monument to civil society and free speech. The Union is also a completely private institution: a true union of, by, and for Oxford students.
Now, having said all of that, the fact remains that a debate at the Oxford Union is just a debate. It's not a UN Security Council resolution or a Supreme Court judgment. It's just the opinion of a bunch of people who happened to be in the hall at the time as to whether the proposer or the opposer made a better case for their side.
It's all good fun, and much needed at that. But let's not get all worked up about it.
This House believes that 'the free music mentality is a threat to the future of music
Well, "this house" believes that it is rampant commercialism that is actually a threat to the future of music.
She was in a room full of people who buy and listen to music.
This is definitely NOT the place for an RIAA exec to be. They should be with other executives and the occasional politician. That way they can avoid the whole issue of customers and business models, and focus on what's really important: new legislation.
Considering how online-centric we are now, how valid is it to ask about dirtworld CD sales without finding out what kind of behavior consumers would have, if it were easy to buy the music they like online, for digital download, with price-parity with CDs, adjusted for savings in fabrication and delivery costs.
They're asking us to pay for a distribution system we don't need, and that's what offends me as I'm struggling to tear off the stupid sticker holding my new CD's jewelcase together before I put the disc into the reader to be encoded to the only format I use anyhow.
Kevin Fox
Yes, asking people to vote on the extent of arbitrary government-granted power is always a bad idea. Better leave that sort of thing to the expert central planners!
I have one problem with your comments. It sounds like you are saying that we don't have the right to try to convince the RIAA that they are harming the industry rather than helping it. And saying "illegal file-swapping crowd filled with university students" is wrong because pretty much everyone that was there said they buy more music because of the file sharing. Talk to some RIAA execs for a bit about the subject. Not one of the ones that has been coached; a real one that is deeply entrenched in the Association and shares their values. You'll get the impression that they don't care about the artists unless they make mega-billions. And even then they only care about the money from the artist. I've gone a bit long on this. I'm not sure exactly what you meant by your comments, but implying that someone can't tell a draconic, corrupt corporation to kiss their ass will really piss lots of people off.
Two things are infinite: the universe and human stupidity, though I'm not yet sure about the universe. - A Einstein
http://www.cafeshops.com/cp/store.aspx?s=corruptcd
don't you think that rosen actually believed she could win by going to oxford? ithink she truly believes that she'll be able to win the greater fight, what is troubeling is she won't be stopped until someone stops her completelly. how do you do that though???
does anyone other than me find it interesting that the chief exec of chrysalis is on one side ( Chris Wright ) and the co-founder ( Doug D'Arcy ) is on the other? I can just see the post-debate conversation :
...
Chris : Doug, you know, the board has been thinking about your future here with the company...
Doug : Yes, really?
Chris : Well, with the beliefs that you have espoused, and your stance on some matters, we've been thinking that it might be time for you to move on to other projects...
Doug : Remember those pictures of Hilary, you, and an inflatable sheep? Well, I still have the negatives...
Chris :
on a side note, is anyone really surprised by their defeat? they are wrong on most of these issues, and really have very little evidence other than FUD to back anything they say. no big surprise there.
PC moderators can suck my White pierced, tattooed dick. If you think pride == hate, s/dick/Aryan meat mallet/g.
Is Hilary Rosen married? In the picture she doesn't have a engagement/wedding ring on...
;) I was just wondering if being such a zealot for the music industry had an impact on one's personal life.
Not that I am personally interested, she isn't my type.
"Zeal is fit for wise men, but flourishes chiefly among fools." ~ John Tillotson
I told the FBI about someone that is linked to credit card identity theft and presented the evidence. This person also told me he downloads mp3's of popular music, burns cd's, and sells them to friends, which I related to the FBI as well. Why has there not been an investigation?
Popular music is a joke and its thieves are even more of one. If it is such a horrible crime, why doesn't the FBI and RIAA start making some arrests?
Will I retire or break 10K?
vi is better.
subject sez it all.
Why does a 25 CD cost $18, anyway, about what it cost when invented 20 years ago?
Actually, $18 in AD2002 dollars is much cheaper than $18 in AD1983 dollars. Though the cost of mechanically replicating the product has gone down over the years, the cost of production (writing the songs, performing them, mixing, mastering, designing the cover, writing the manual, storing them in warehouses, shipping them to retailers, and selling them to the end user) is largely bound to the cost of labor, which (when measured in current dollars) has gone up with inflation.
Will I retire or break 10K?
So yeah, I'm gonna download songs from the album first before I buy the CD because I'm not paying $15 for 1 (one) song I liked from the radio.
Provided you know which track you want to keep, then download the song on Rhapsody ($1/track) or eMusic ($15/mo), which are legitimate sites that have licensed labels' catalogs.
Will I retire or break 10K?
What about the free thought mentality then?
Cds are still in the 16-20 dollar range
So? Dollars are cheaper now.
Will I retire or break 10K?
and the figures look fairly equal, which makes sense when you consider that the cost of the media represents a small fraction of the total cost of getting an album to market.
- None can love freedom heartily, but good men; the rest love not freedom, but license. -- John Milton
Arrow's Theorem doesn't draw any such conclusion. Sure, there's no perfect system (by Arrow's set of criteria), but there are systems that are much better than what we've got. Moreover, all that Arrow did was define a set of criteria, and proved that the criteria couldn't be met. He didn't prove that his criteria were correct, because that's a subjective decision that can't be proven.
For more on this, read this rebuttal of Arrow's theorem-based fatalism.
You can always spot a poor debater when they ask a question they do not know the answer to. That is always the key: reduce the argument to only the points where you are unequivocally right and your opponent is not. Of course your opponent is trying to do the same thing.
And the big "raise your hand" thing doesn't prove anything. It is like "proving" someone has no business talking about African economics if they have never been there. It is all opinion and subjective, like those CNN polls.
In the end I just see this as broadening the rift. She now can be assured that most students out there are "pirating" music and thus beyond communication. Likewise everyone else here is treating this like it means anything. The RIAA will probably just go and get more federal signatures while we sit around feeling all good about this "victory". And its that sort of thinking that will probably mean we will never get the compromise we ask for.
Demanding total victory is asking for total defeat.
What is music when you despise all sound?
Hillary Rosen's womanhood was never seriously in question.
I do have serious doubts about Janet Reno, though...
>> Regardless, The RIAA has every right to pursue its goals (i.e., profit) using legitimate business practices
Bribing Congressmen to pass a rampantly unpopular law that criminalizes fair use copying rights does not fall under the heading of "legitimate business practices". Neither does deploying technological measures to make it impossible to exercise said rights.
I'm disgusted by how many so-called libertarians are so quick to jump to the defense of the RIAA when it's obvious they have no interest whatsoever in playing by the rules of the fair market. The market has sent a pretty unequivocal message that they want the middle man out of the loop, so the middle man tries alternately to make it either illegal or impossible not to play by their rules. Bleh.
25% Funny, 25% Insightful, 25% Informative, 25% Troll
Why wont prices on CDs and DVDs go down?
Well the answer to that question is spelled greed, for record industry its never enough, they always want more. The same goes for some of the artists, why earn only $1 milion for a album then you can earn $10 milions. So theres no reson to cut CD prices from $20 to $5 even if they easily could do. They will continue to rip off the consumers as the only thing they do care about is the money flow and increasing profits. At a certain point the consumer will stop and say ENOUGH!. Greed will kill RIAA and the big record companies, P2P and CD burning is the sword that will cut the head of the beast.
Hilary Rosen was a woman.
One huge win for the voice of many against the new evil empire (read : RIAA). Now, if only my university could stand up against RIAA instead of harassing their students regarding "copyright" crap by some fscking Tr8cy M1tr8n0 (IT Lawyer), then RIAA would loose their battle forever.
I can't believe people modded up a goatse shop.
But why do CDs cost much more than cassettes??
Higher demand for CDs than for cassettes leads to a higher price.
Will I retire or break 10K?
Actually, I did consider inflation and the average selling price, as opposed to MSRP, but figured these were too nerdy to go into. :)
Check out an inflation calculator such as http://www.westegg.com/inflation/ -- what cost $18 in 1983 would cost about $30 today.
HOWEVER, CD production costs have dropped radically in the interval, and economies of scale exploded when the CD finally replaced the LP in stores. I think the 25 per CD I speculated is likely far that true cost of 2 or whatever. Distribution costs likely plummeted as well. Look at how cheap CD-R's are at wholesale. They probably spend more on the packing or that little anti-shoplifting tag.
It's like software or CPU's or Wheaties -- the cost of the materials is meaningless. It's the chain of middlemen that establish most of the price. And it's this chain that the industry is really trying to protect; the music is irrelevant. (One "downside" to the CD's is probably that they're a lot harder to wreck than LP's.)
It is good that these types of debates go on, but at this point how does this even matter? We all know Rosen is not going to be like, "Oh, I was wrong after all, music should be free for all." And nor is the opposite party going to say, "Damn, we are horrible people for stealing those poor people's livelyhoods from them."
No one is going to change their position. On top of that, this nice little debate is more or less useless. None of those students are congress people, and Berman is has shown his resolve. Nothing has changed in that exchange; we are still hurtling towards an unknown conclusion which this debate does nothing to address or even pretends to address. In the end, the students went and drank some beers and the 'big-wigs' went back home to their legal documents. This is an intellectual excersize and shows zero results other than some transcriptions and a couple webpages. We would be better off sending mailings to our representatives than listening to some nice, feel-good debate that made Rosen look foolish for a couple minutes.
"What can a thoughtful man hope for mankind on Earth, given the experience of the past million years? Nothing." -Bokonon
We all know that this is literally true. No one is forcing these people to sign contracts. I wish some of them would have been forced not to sign contracts, in fact. I'd have held the gun on Don Henley. If I'd have been alive then.
I'd have held two guns on Rod Stewart.
But on the other hand, if you want to be a music superstar, you have to sign a contract with a major label. Otherwise you don't get put on MTV/VH1, you don't get put on Clearchannel, you don't get put in the major record chains across the country who are penalized (by withholding of ad material and certain albums, or pushed-back release dates) for stocking music which doesn't come from a member of the RIAA.
So sure, no one is forced to, but you cannot "win" the game (assuming you are measuring success monetarily... at least it's a numeric metric) without signing with a major label.
"You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
As another Libertarian, I agree wholeheartedly with you.
In fact, I often find myself at odds with other Libertarian-leaning individuals on the whole copyright/piracy debate.
Certainly, Thomas Jefferson himself was not a fan of the ideas of patenting ideas or extending terms of copyright out to great lengths of time.
"It has been pretended by some, (and in England especially,) that inventors have a natural and exclusive right to their inventions, and not merely for their own lives, but inheritable to their heirs. But while it is a moot question whether the origin of any kind of property is derived from nature at all, it would be singular to admit a natural and even an hereditary right to inventors." - Jefferson
"He who receives an idea from me, receives instructions himself without lessening mine; as he who lights his taper at mine, receives light without darkening me." - Jefferson on Copyright
I'm an RIAA detective and my partner and I noticed that you were singing. May I please scan your universal id card. Enter your secret password, please and I remind you that refusing to supply your passcode is an offence.
It says that you are not licensed for singing. You haven't submitted the proper fees. Your cable bill is also overdue. I suggest that you take this summons and pay the fine and get these matters in order.
(There was music before the music industry and there will be music after.)
"You do NOT have the right to violate copyright"
I'm sorry, but I simply don't just see the law as right and prohibitions that I should take for granted. I have a mind of my own. If I want a law overturned the easiest way will be to show people how much better the world is without that law, i.e. breaking it.
Especially if the law was passed over my head, against my will and the will of my peers. If the law contradict our ethics and morals. How can we be espected to abide by it?
The geeks created the beauty of the p2p nets, decentralized infrastructures of information and art (and hot grits, but that's beside the point). Was it illegal? Possibly (the law is vague). Was it a Good Thing? Yes. It's beautiful. It's functional. It's practical.
We've seen no decline in production of free software and of free, alternative music, free books and free documentation.
Interesting times and I'm almost holding my breath with anticipation.
Truth hurts doesn't it Pezpunk?
I think you need to ask yourself... What is it that you really want?
The Bolshevik's had a purpose behind their revolution. They knew what they were trying to accomplish when they set out. What I hear being argued here is that you want to hurt the music industry, and your going to do so by stealing the music that they market to you.
You've already lost this argument as long as you keep consuming the music that has been marketed towards you. You don't effect change in a capitalist society through theft. You effect change by spending your money on alternative products.
Money is the motivator. Nobody is going to change their business model unless they see a profit opportunity. You can't explain to them that there is a profit opportunity through words, either... You have to show it.
Start buying all your music from mp3.com, then you'll have a point to make.
Hey, Tracy's great! I was in the same law school class at Cornell Law. Really, she was one of the nicest people I met there. You may rightfully dislike the message, but don't shoot the messenger.
the person just expressed their opinion
should they not have the freedom too?
from his point of view the music sounded bad.
now...i'll go listen to it myself, so that i may judge for myself.
like they say in marketing, there's no such thing as bad advertising.
so now that one person was very critical...you have at least one more person going to check out the music...and i suspect more then that.
SO WHY DON'T YOU SHUT THE FUCK UP YOU BIG PUSSY WHINER.
HOPE THE MODERATORS SNEAK UP ON YOU WHILE YOU SLEEP AND TAKE BARS OF SOAP AND A FEW SOCKS AND GIVE YOU SOMETHING TO CRY ABOUT.
BWHA HAHAH HAHAHAHHAHAH HAA
so please keep your hand off my precious computer!
"Babeality"
For more interesting debates like this, check out Radio EFF. The Lessig (Standford Law, EFF) v. Valenti (MPAA) debate mp3 is here.
Because anyone under the age of 25 or the age of 35 does not matter in the United States. req. to be a U.S. House Representative? age 25 req. to be a U.S. Senator? age 35.
Oxford is in the United States now?
I heard a song the other day by someone named Norah Jones which I very much liked. I decided to stop by Best Buy and buy it. The CD cost me $11.99.
Then I was looking at the list of upcoming releases, and thought I'd stop back next week and buy the new Tori Amos album. It too is only $11.99.
Then I thought of a couple of other albums I didn't yet have I wanted. For instance "Heart Shaped World" by Chris Isaak, I checked and it is $9.99. Also "Warning:" by Green Day, I checked and it is $15.99.(Wow that's the first one I've seen close to your price range)
Then I thought... You know, I really need to broaden my horizons and stop listening to off beat music and pick up some top-40. So I looked up the latest album from Eminem. I found it for $12.99. Then I decided to find Pink, her album is $13.99.
I've been buying music since 1987 when I purchased my first CD player. Back then the first CD I bought was the Top Gun Soundtrack, and I paid $16.99 for it. Now if you go look at the historical value of the dollar, you'd find that $16.99 in 1987 is worth $26.48 today. But I'm not paying $26 for my music, I'm paying an average $12-14 for it, or about half the price. You should also note that in 1987 I could buy a Cassette for about $6-7, today they are $10.
Basically it seems like you have two problems.
First, you don't understand what the value of money really means. In 1987 I was working as a student and receiving $4/hour. Want to take a guess as to how much students receive now for working on campus?(Try $8-10/hour) It's called inflation, go look it up.
Second, if you are paying $16-20 for your CDs, then you are a really really stupid consumer and PT Barnum was correct. There are many places to buy music cheaper than that.
And as far as DVDs go... You know what, just quit yer whining and go back to playing Nintendo. (BTW, want to take a guess as to what I paid for Atari 2600 video cartridges?)
I'm against unreasonable lengths for copyright and patent protection. The patent granting process is way to easy and the length of patents provides more than enough incentive to innovate. But come on, even Britney Spears deserves a couple of years of copyright protection.
Keep you hand up if you buy more music because of it"
Hmmm... heard Funker Vogt on shoutcast a few weeks ago.
Enjoyed it. Downloaded a few tracks via gnutella. Yup, this definitely is a group I like.
Went to Best Buy. WTF? No Funker Vogt. Went to CD Warehouse. Nope. Never even heard of them, let alone my fav Apoptygma Bezerk, VNV Nation, Front Line Assembly, etc. "Sure we have industrial..." as the salescritter points at the rap section (ugh... where do they hire these people from?).
So Ms. Rosen, how am I supposed to be a complying RIAA citizen when you won't even sell me the music?
As usual, it was off to cdnow.com, buy one of everything Funker Vogt, and wait for the UPS guy.
Conclusion:
1. I'm waiving money in your face but you won't sell product to me.
2. You can't seem to figure out how to distribute music worth a damn.
3. You keep signing a few worthless artists and pumping their music (while we still don't buy it), rather than understanding the market changed on you.
4. You and the radio broadcasters sign deals trying to limit airplay to the same crap you signed, but now the radio broadcasters can't find listeners and had to destroy Internet broadcasting before it destroyed them.
So, maybe there's another problem that explains why your sales numbers suck?
*scoove*
Fuck you, Eric Krout.
I want to know what slashdotters think about this. Personally, it definitely has. I like to be able to try out bands online and then if I like their stuff, I go and buy it. Not only does it ease my conscience, but also I can get nice clean copies of an entire album. And it helps me pick out the albums that I want too.
;-)
So far I bought a bunch of Orbital and Orb, and a Dire Straits album (good old stuff) because of that, and avoided needlessly contributing and funds to the pockets of Fleetwood Mac
simon
home page
But still nobody representing the artists themselves...
I've got a video clip of a guy trying to TURN HIMSELF IN to all levels of government, he starts with local police, they refer him to the mayors office. the mayors office refers him to the attorny general, and they refer him to the maker of the program he claimed to have been pirating (microsoft)... well, in the end, no one would send a police officer down the street to arrest this guy on software piracy charges, or even file some kind of report! the worst thing they told him was to either delete or buy it, but not once did they offer to arrest or prosecute him. he was even begging to be arrested, and they declined. i know piracy is illegal, but if you dont make profits on it, there's a VERY low chance of anyone getting in trouble from police... almost every cd that i've purchased i've discovered/previewed with mp3 downloading. i attempt to be one of the semi-honest music downloaders... downloading/listening to lots of stuff, but buying the good cd's. the RIAA is just scared that people wont buy CD's for 1 song anymore.. i sure as hell wont, i'll listen to almost 1/2 of an album before i'll buy it. same thing with many people that I know. I dont think I've met many people who have 400 CD-R collections of full pirated albums. also, couldn't mp3 recordings be considered "time-shifting"? time-shifting is the same principle that keeps Tivo's legal. you can either listen to crappy radio (or crappy tv/commercials) and wait for the good stuff, or you can just (record it with tivo) download it and listen to it repeatedly, or at your leisure. effectivly, both with tv and music, the conecpt is to record/obtain a recording of a show/song and view/listen to it anytime? just a few thoughts...
Well, I wouldn't necessarily disagree that "even Britney Spears deserves a couple of years of copyright protection" -- but that's far from the situation we have today.
The very definition of what users can and can't do with a work covered by "copyright" in America has been twisted by the industry lobbyists. (Consider this: Every time Britney Spears puts out some new music on the DVD audio format, you're breaking federal law to even play the thing back on a machine running Linux!)
Furthermore, instead of works being covered "for a couple years", we have people lobbying to extend it to well past the artist's own lifetime. (Heck, it already extends out decades and decades as it is.)
You can point much of the blame for this on organizations like the RIAA. Every time they "win" an extension of copyright, it gives them something to wave in front of the artists signed up with them, to say "Look what we did for YOU!" Meanwhile, everyone else is losing out.
As modern music becomes ever more dependent on samplers and "re-mixes", the current copyright gets in the way and impedes creation of new music more and more. (Though some might not choose to respect it, the ability to copy/paste portions of existing musical works into a "collage" of something new counts as a valid form of artistic creation, in my way of thinking.) Right now, doing this generates a massive pile of paperwork for an artist. You have to request permission for every single lousy section of a work you sample, pay royalties out to everyone involved, and some might even say "No, sorry. I don't like your type of music, so I'm going to disallow your use of that sample from my album."
IMO, artists disallowing use of small clips from their songs are usually just trying to be vengeful against the other artist. What harm can it possibly do? Even if you hate the style of music being created - it doesn't change anything about your original work. If anything, it might turn more people on to it.
All our movies are belong to us!
Slashdot: Where people pretend to be twice as smart as they really are by behaving like children.
This may sound a little odd, but I feel sorry for Miss Rosen. She is, after all, merely trying to do her job of defending the recording industry and its business model. I think it would be fascinating to sit down with her over lunch and listen to her side of the debate without so much of the hype that seems to accompany this topic. I do not think she would convince me to see the world her way, but it would be an interesting way to spend my lunch hour. Who knows, she might just be a very nice person outside of the Internet music nastiness we are all familiar with.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
The main problem I have is that you don't need a majority vote of 50% or more to win an election. With 4-5 or so major parties, you only need like ~30% of the vote. This leads to major populist movements all of sudden coming into power. I mean look at some of the elections in Europe. The very-right sometimes gets enough seats to actually have power. To me this seems dangerous and it is.
At least with a two-party system you get politics that are basically centrist. The Republicans and Democrats may differ but its not a gap that you see in some European parliments. Also to me this means its easier to get compromises on bills. I can go on and on about it really. However to sum it up the two-party system is just more stable, yes it has problems but a deeper investigation will reveal these problems have alot more to do with capitalism then the democratic infrastructure.
The best education consists in immunizing people against systematic attempts at education. - Paul Feyerabend
I know there are going to be those that rally for proportional representation, but you still have bribery targets in that type of system. It would be easy to switch to democracy now that we have technology like television, radio and telephone. And it would be bribery immune, or at least require that the funding for the bribes would be not be off the backs of at least half of the 30%* of the population that votes in Senate elections. 15% is a lot better than the 4.8% support you need in the USA to elect a majority Senate now. The house seats are effectively unelected in all but a dozen cases, no point in even thinking that's an elected body. But while you could elect representatives with proportional representation, all would still accept bribes, 40 million people are much harder to bribe effectively than 51 Senators (or less if you actually have anyone agreeing with you before they see the check.)
* 30% guestimated, all other figures calculated from 30% times known figures.
The hemp the constitution is written on is wasted. Keep the bill of rights, strengthen it, and then start over on the rest. We don't need a Senate to preserve slavery anymore, and the House is an outdated concept, elect some people to debate each side in an issue before bills are proposed, but god forbid don't let those scoundrels vote!
The DMCA would not have passed the Senate 99-0 in a democracy, hell none of it would have passed except the safe harbor for ISPs.
The guy who didn't vote, Gregg, is trying to pass a law making encryption illegal unless you give the secret key to everyone first. I can't believe such an idiotic walking turd wouldn't have voted against free thought if he were there that day. The internet cencorship bill(CDA) passed 84-16, a little better you think? But then that one was blatantly unconstitutional, in any fair system passing such laws should not only be illegal but punished with jail terms or fines. 99-0 on the DMCA! An issue where the informed public is somewhere much much nearer to 0-99. Passed without debates or amendments allowed...
Without considering the bribery, err donations and gifts, you'd think a cat at a keyboard passes the Turing test better. But these are not severely mentally challenged men but simply career criminals that just happen to run our government.
They need to understand that modern consumers, many of whom are now college students, are less and less frequently buying music by artist or genre. It is becoming far more common for consumers to acquire merely the songs that they like. Since the music industry refuses to accept this mentality, filesharing is the most effective way for consumers to acquire only the music they want. Until the music industry realizes that there is a lot of profit to be had in giving consumers exactly what they want, they're going to continue to suffer whatever losses they suffer now. Music distributors must have the authority and means to give consumers exactly the songs they want. If consumers can cheaply rip-mix-burn, there is nothing preventing music producers from doing so even more cheaply. If they do not make these changes now, when the university students become adult consumers, the music industry is really going to feel the pain they've been complaining about all this time. There's no reason why they should not take steps to prevent such discomfort, especially since doing so would probably increase their profit margin, since it would draw in people who currently avoid commercial music, for the inability to avoid the 6 bad songs that come with the 3 you like.
Virtue finds and chooses the mean.
Aristotle, Ethica Nichomachea
I was there, I wrote about it http://www.mba-experience.com and for me the real point of interest wasn't Hilary Rosen. Well, thats not quite true, she was *really* agressive challenging facts, leaping up to make points and generally looking like the record industry's personal attack dog, you get the feeling Ronnie Gurr might have worried for his personal safety at times had the despatch desk been narrower.
Anyway, daydreams of celebrity deathmatch aside Rosen wasn't that interesting. Jay Berman was interesting, he's President of the Federation of Phonographic Industries who among other things lobby for new copyright laws. He was the one who came out with
"Each generation has had their own music. For your generation it's filesharing. And I think thats a pretty terrible thing"
Now if its the case that the record industry suddenly doesn't like its audience anymore thats interesting. Its damn difficult to sell things to people who you don't like. It may also mean that even the industry don't think they're being strictly 'rational' about this anymore, if folks like Berman and Rosen belive that they have some kind of moral obligation to kill filesharing for the good of mankind this one could run and run
Damn, I though it was Hilary Clinton.
You know, I really need to broaden my horizons and stop listening to off beat music and pick up some top-40
This is true. You failed to mention a single non-Top-40 release--on either side of this statement. Your "off beat" tastes are an inspiring (and, of course, self-image-shattering) example to us all.
Your mouth is like Columbus Day.
Do you really want to use Paypal ? :-)
And I don't mean Record and Tape Traders (although they are a bit better than most chains and mega marts). Here in Baltimore, MD we have Soundgarden (not related to the band); I would guess that most cities of moderate size have a store which mainly caters to less mainstream music. If you can't find one in your area, you'll have to order online, but try checking around; if you've got a local college radio station, ask them where they buy their music.
WMBC freeform/independent online radio.
I'd also say that this was a stacked audience. Let's see, you have a bunch of college students that use p2p on a regular basis, many of whom were spreading anti-RIAA propaganda
I followed the discussions and preparations in the CDR, although I didn't go myself. I have to say that we were not at all sure that the debate could be won. Oxford is a very strange place, and Oxford Union is stranger -- a private members-only debating society which perhaps could be described as a little bit elitist.
As to why Hilary Rosen chose to go to an debate with students -- it is because of the prestige of debating in one of the oldest debating societies in the world. You have to dress up (black tie for men), you go to a special dinner with weird and ancient customs (if you've never been to an Oxford college, you have no idea!), and so on and so on. Take a look around the Oxford Union site.
Also, with a place like Oxford Union, this isn't some shallow debate. Rather it prides itself on getting to the bottom of the issue, with lots of intelligent minds on the job. If the RIAA's case stood on logical grounds, she would likely have won the debate. That is why this is a significant result! The truth of the matter is that even with all the conservatism of Oxford, Hilary and friends couldn't make their arguments stick.
I'm sorry, I've had to live in Oxford for a good proportion of my life and I just can't sit by and listen to this shit.
I agree, the UNIVERSITY has some nice buildings, and the debating chamber in the union is very nice, but most of Oxford is a complete shithole. I can understand people coming here and seeing the pretty bits and thinking the city is great, but live here for a while, and I think you'll see what I mean...
This isn't a troll or a flame - this is my honest opinion which I have built up over the last 20 some years I've been here
[All Your Fish Are Belong To Us]
Who cares what the Oxford Union says about anything? William Hague - the hapless and useless ex-leader of the British Conservative Party was a past president, need we say more?
Seriously, the fact that the elitist twits of the Oxford Union vote this way or that matters not a jot. Sadly, it is only the credulity of some Americans and a few wannabe Brits that keep this institutionn going.
The other reason for its existence - to provide the next generation of our "natural" rulers (ie the Tory party) has been well and truly destroyed by Tony Blair. A man who went to Oxford but demonstrated his innate good sense by having nothing to do with the Oxford Union.
The debate was not about whether file-sharing was legal or illegal, or even whether it would hurt the profits of the big music labels. The debate was about whether it is "a threat to the future of music".
The music industry seemed to argue that without the current system, there would be no music or at the very least no creative/exciting/new music. I am certain that this is not so.
Even the assertion that one cannot earn money with music in an mp3-sharing world is hard to swallow, considering the amount of people happy to spend 100s of dollars for rock concerts etc., the only thing that might be in danger is the current business model of the big music labels...
But on the other hand, if you want to be a music superstar, you have to sign a contract with a major label. Otherwise you don't get put on MTV/VH1, you don't get put on Clearchannel, you don't get put in the major record chains across the country who are penalized (by withholding of ad material and certain albums, or pushed-back release dates) for stocking music which doesn't come from a member of the RIAA.
Of course, if the record labels weren't so inflated in the first place, then all artists would have an equal chance of getting noticed. You'd get big purely on account of how good your music was, and it wouldn't be affected by which record manager's cock you'd been sucking. The only reason that not having a record contract is disadvantageous to a band is that when some other talentless eejut has got a record contract, their expensive hype automatically trumps anything you can drum up. Smash all the record industries and everything will be fine.
Damn, it's the capitalism debate again.
- HMV Canada - their selection of music beats Amazon.com hands down. Doing a search reveals that they sell "Funker Vogt"
- Amazon Germany - great source for music tailored to the german market. The only catch is that you need to understand German (quite normal really
;)
- Amazon UK - great source for music tailored to the german market.
- HMV UK
- HMV Germany
- FNAC - online version of the French media store
There are others, but these are the ones that I know of. BTW The Funker Vogt web site is here: Funker Vogt website.BTW If you want to know what is hot in th UK, then BBC1 Radio 1 is a good site, and IMO is info-marketing ratio is 9:1, which is nice to see.
Jumpstart the tartan drive.
obviously it's not for everyone. it's punk rock. but we're a good band and we put on a hell of a show. your reaction doesn't bother me.
i could live a little longer in this prison
Any government must get support of >50% of parliament, that is of the votes (since parliament is elected almost proportionally to the votes). So 2 or more parties must cooperate in a coalition; in practice it is seldom that one party gets a majority, so you get always coalitions.
This creates centrist policies, because the government partners must give and take, so you get more consensus based government style. In the U.S., while as single parties the republicans and the democrats may be closer than some parties you find in Europe (including the so called populists), any party has to give in so in the end the goverment is more moderate, and less susceptible to sudden changes after new elections.
.. that we were the beginning of the forces that liberated the musicians from the iron claws and leather whips of the recording industry.
Once we get to the point of being able to disseminate music to the masses in a cost effective manner (read: recording studios in a garage in Omaha that are better than the super high priced ones in LA), and can get the information into well known online music stores with preview, then the era of the 15 billion dollars that goes to 5 companies is OVER.
"To make a mistake is only human; to persist in a mistake is idiotic." Cicero
PLEASE stay away from musical instruments, for the sake of humanity. Either that or stop distributing your aural disease.
PLEASE
That was classic intercourse!
Is english your native language? Or is my writing so bad you missed my entire point?
Look if crazy right-wing facists can get 30% of the vote then get a proportional amount of seats, something is wrong. As long as Europe has this philosophy of "representation by proportion' there will be always raving lunatics swaying the public to vote for them. Europeans are just as stupid as Americans; at least our government protects us from our own stupidity.
The best education consists in immunizing people against systematic attempts at education. - Paul Feyerabend
GOD is she (Hillary Rosen) Ugly!
(This is the first time I saw her picture - even the "try-to-be-flattering" ones, and I am still trying to overcome the shock)
It's (I guess that's supposed to be "she's," eh?) like a cross between that octopus woman (from Disney's Little Mermaid (Ursula or something?) and a mutated Phillsbury Doe-boy.
yuck. *shudders*. If I ever wanted to delay ejaculation during intercourse - I'm prepared. In fact, I think I might be mentally scarred.
My life in the land of the rising sun.
Look if crazy right-wing facists can get 30% of the vote then get a proportional amount of seats, something is wrong.
Crazy perhaps, but absolutely nothing wrong with that, it's democracy in action. Don't forget Democracy means rule by the people for the people. People living in democracies get the governments they want and deserve.
Remember that while the Lunatic Party with 30% of the vote might be the largest party they cannot govern because they do not have the majority of seats in the House. It is quite possible for there to be a situation where the largest party is in fact the Opposition, because the other 70% of the House has formed a Grand Coalition with a very substantial majority.
Before you throw stones in the glass-house don't forget that much of the world is firmly of the opinion that the current incumbent of the White House is in actual fact a "crazy right-wing facist" who got there without a proper mandate.
It has happened more than once that some lunatic party wins most of the votes (mostly on a lower level such as communal however). But since they are so extreme, none of the other parties want to cooperate with them, so the other 70% will rather form a great coalition excluding the 30% lunatic party from power.
Being the largest party does not automatically mean that you get power, except if you get more than 50%. The only thing that matters is that a coalition of parties that is able to cooperate together (and a common enemy eases such cooperation if necessary) gets more than 50% together.
A recent case in Holland, a right wing somewhat populist party got 15% of the vote out of nothing. Two other middle and right wing parties felt obliged to give them a chance, so they formed a coalition with the three of them (holding 55% of vote in total). The populist party of course had to give up a lot of there more extreme views, the other two had to give in some to the populist party, everyone was kind of happy with the 'government contract'. Now after less than 100 days the government has broken over internal struggles in the populist party, and their voter support (according to polls) has decimated from 15% to 2%. New elections shall follow and everything returns to normal. Well not entirely, because the other parties have understood the message of the voters, and have incorporated some of the issues of the populist party, though in the more moderate and reasonable form.
MUSIC AS FREEWARE:
As far as publishing music for freeware/shareware, this is my opinion on the music I create(as I am not enslaved by a contract or record label):
As long as I maintain legal control over my own music, I will not prosecute those who wish to advertise for me for free(with much strong emphasis on accurate id3 tags!)...heheh.
THE DEBATE:
I'm glad that the debate at Oxford Union happened as this must surely spell out to the Music Industry that the idea is to work WITH the music fan, not against him/her.
CD PRODUCTION COST:
As an indie musician, and without mp3.com affiliation, it's going to cost me about $3.00 to create and mail 1 cd package(CD,inserts, jewel case, etc), due to smaller bulk materials requirements, and therefore higher per unit rates. This will be the base from which I have to work to come up with a CD cost that is usefully profitable, but at the same time reasonable for the buying music fan.
These majors MUST get their stuff cheaper per unit because they buy more, but unlike me, they have more hands in the moneypot, in the form of producers, engineers, managers, marketers, and lastly, musicians, so I think that is why their CD's are so expensive. They don't want their profit margin to absorb these costs, not even a little. Hiring people who know how to use Pro Tools well(for the music)and Photoshop or Draw well(for the artwork) costs more.
They're definitely not in it for love of the art, but if they're trying to develop a business plan that involves them moving away from CD's and people paying for downloads/streams as their sole means of listening, and so that the labels can cut out a big part of their distribution costs, I can see why they have their panties in a bunch about filesharing.
Personally, I don't think pay-to-download makes for a good business plan. All it takes is one generous p2p user to ruin the profitability of that idea, and we all know how much of a waste of time SDMI was.
I say leave the intangible free and pay for the tangible. I agree with the notion that if people like it/listen to it/use it enough, they'll buy it.
I AM NOT A CONSUMER!
I AM A CUSTOMER!
Listen;
Anyone who calls you a consumer is assuming you do not have choice.
I am a customer when I choose to purchase/use/etc.
I am a consumer when I don't have a choice.
I consume air, I consume food and water.
I do not consume music.
Haven't bought a CD in 3 years because of the "one good song per CD" quota
that has been going on. I am the reason your profits are down. I am the one who invalidated your precious business model.
Until you get your shit together and offer us what we want and not what you want to sell us, you can expect your profits to keep falling.
And in case you wondered, no I don't download. I have better things to do than spend endless hours on the internet, looking at things which don't interest most people, taking the time to write an informative opinion....
Oh, Nevermind. Voice of Emily Litella
It's been said a hundred times on this topic, but I'll say it again: it's all about the money. Let's face it, the music industry is well aware that with file-sharing systems readily available, one-hit wonders are a thing of the past. Nobody in their right mind is going to pay 16+ dollars for a CD when they only want *one* or sometimes two songs. The RIAA is simply upset because in order to get a profit (or so they believe - I'll believe filesharing hurts sales when I see some concrete figures) they have to produce quality CD's, not the teenie-bopper crap they've been shoving down our throats for a long, long time.
For the record, I do buy my CD's, but only ones that are consistently good, and there isn't a mainstream song in my entire collection.
I don't have a problem supporting artists(true artists, that is. And no, Britney Spear's belley button doesn't fall into that category). But I do have a problem with the Recording Industry making more from an artist's album that the artist themself.
And the masses cried out, "09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0!"
What happens if I have a nasty HD crash, or some similar disaster, can I re-download the song I already paid for or not?
Windows Media Player lets you back up your license file. Rhapsody should let you do the same thing; ask the support team.
Are there copying or format restrictions on the tracks?
Once you've downloaded a legitimate "keeper" recording at $1/track (rhapsody) or no-marginal-cost (eMusic), you have all the rights that copyright law gives you. In the United States, assuming that you have a record in vinyl, 1/8" cassette, CD Digital Audio, Ogg, MP3, or some other format that carries no "effective access control measures" (17 USC 1201), these rights include the right to time-shift (Betamax case), format-shift (Diamond Rio case), and make private temporary derivatives of (Nintendo v. Galoob) the work.
How does this stack up to being able to drop into an IRC chan and get any song you want at varying bitrates from 96 up to 256?
The download queues on the official services are likely to be shorter.
Will I retire or break 10K?