Slashdot Mirror


Has Free Software Saved Any Schools?

morcego asks: "I think everyone remembers the case of PCs for Kids, the Australian group that donates computers for the poor children, when Microsoft asked them lots of money for the software on the computers they donated. I am trying to convince schools to start using free software, and I have heard arguments like 'all free software initiatives in public schools around the world have failed.' I know this is not true, but I need cases to show them. So, do you know of any school (public or not), or other educational institution that has been saved from paying large amounts of money (and closing its doors) by free software?" For those interested in this topic, you'll probably want to read up on the latest salvo in the Microsoft private antitrust settlement. It sounds like education, and Open Source, may now have an official relationship, and things are now getting kicked into high gear. While it's good to hear about the "SchoolForge" coalition (no relation to SourceForge or NewsForge), what educational resources are currently available to schools from the Open Source arena?

462 comments

  1. not the school I attend... by Anonymous Coward · · Score: 0

    the school district has a nack for wasting money on dumb stuff. Especially Micro$haft products.

  2. FPPPPPPPP by Anonymous Coward · · Score: -1, Offtopic

    Fistf-ck Post

    1. Re:FPPPPPPPP by Anonymous Coward · · Score: -1, Offtopic

      God, you can't even get a first post right dumbass. Why don't you just give up living now?

  3. Yeah by Anonymous Coward · · Score: 0

    schools that have a lot of money to pay an overpriced, uncommunicative geek for stuff they could have done themselves.

  4. first? by Scopedog · · Score: -1, Offtopic

    first?

  5. Here's One by ScumBiker · · Score: 4, Informative

    It's used in Albion, WI. Redhat on older Gateway hardware. It sits right along side of the Win95 and Mac boxen. I'm pretty sure they're going to be installing it on the rest of the x86 boxen.

    --
    --- Think of it as evolution in action ---
    1. Re:Here's One by ScumBiker · · Score: 1

      Umm, I meant "Linux is on..." Duh.

      --
      --- Think of it as evolution in action ---
    2. Re:Here's One by Julian+Plamann · · Score: 1

      I work as a computer intern for my High School (public school in northern California) during my spare time.

      Recently, the administration has run into quite a few problems with licensing with a company that we all know too well. You see, a few years ago, when Windows 95 was adequate in speed and stability for the hardware the school used at the time, licensing was relatively cheap. My school was able to purchase a Windows 95 license and use it again and again. It worked great.

      With the need for newer software solutions and the release of Windows XP and 2000, the school district is facing the fact that to continue supporting their hardware in an adequate manner, the school district will be forced to pay licensing fees in excess of $20,000. This is insane for any organization. Especially for a _public school system_.

      Myself and some of the administration at the school have been recently talking about converting some of the computer labs to 100% open source software. I know for a fact that it can be done, and can be done freely.

      Something of this nature also has huge potential into broadening the way high school students use computers. Once they see that there are better alternatives out there, who knows? :p

      Since introducing some of the students in the computer labs to Linux, I've already begun to hear the more technically savvy students comment on the possibilities of Linux and other open source operating systems.

      Open source has yet to reach its full potential in the public school system. A potential I hope to see it reach.

  6. Jsut spend the money on MS. by utdpenguin · · Score: 0, Troll
    It's not like we could use the money for other stuff. Like paying teachers, for instance. Teachers are gonna do a lto more than computers can ever hope to, and if we pay them more, we might even be able to attract people who could be great teachers.

    --
    In Soviet Russia you dant have to put up with these crappy jokes
    1. Re:Jsut spend the money on MS. by Chuck+Milam · · Score: 2

      "It's not like we could use the money for other stuff. Like paying teachers, for instance. Teachers are gonna do a lto more than computers can ever hope to, and if we pay them more, we might even be able to attract people who could be great teachers."

      There is a reason teachers aren't paid very much, and it's not because we don't value education or the teaching profession. It's just simple economics. For the "warm fuzzy" of getting to work with kids, the personal satisfaction the job brings, etc., people are willing to take a lower salary for teaching than they would for jobs in other fields. Teaching also seems to attract a number of people who don't really need the money at all (wealthy families, spouses, whatever) and are therefore willing to work for less. At least in my area of the country, for every teacher who demands a pay raise, there are a number of people willing to take that teacher's position at the current pay rate or even less.

      But, I digress. I absolutely agree with one of your points: A good teacher in the classroom is infinately more important than a computer in the classroom.

    2. Re:Jsut spend the money on MS. by Sparky9292 · · Score: 1

      for every teacher who demands a pay raise, there are a number of people willing to take that teacher's position at the current pay rate or even less.

      True, but this is a more accurate statement:

      for every teacher who demands a pay raise, there are a number of poorly qualified candiates willing to take that teacher's position at the current pay rate or even less

      There are always crappy instructors that couldn't get a job anywhere else that will take the job.

      Principals are not getting cream of the crop these days...

    3. Re:Jsut spend the money on MS. by oghmagod · · Score: 1

      This is a great point. I would love to teach. I come from a family of teachers. My mom's a teacher and has her Masters. The problem is that I barely graduated with a degree and I make twice the money she has after 20 years of teaching. Its simple economics, those who can't, Teach - (Unless they really love it.) The result will be poor education.

  7. Hmmmm by seanmeister · · Score: 3, Insightful
    "what educational resources are currently available to schools from the Open Source arena?"

    How about "source code"?

    1. Re:Hmmmm by Anonymous Coward · · Score: 0

      Wow, that'll really have them jumping on it. Really useful for 8-year-olds.

      Mmmhmm.

      Source code is not the cure for all of society's ills, sorry.

    2. Re:Hmmmm by jdmmmmm · · Score: 0

      I don't think it's realistic to expect a teacher to take time to, for example, spend time configuring linux for their hardware. One advantage MS has it that it often comes preinstalled with the OS and lots of other software.

      I've heard of companies that preinstall linux, but it seems to be the exception rather than the rule. The preinstall solution may be the best apporach to take, nonetheless.

    3. Re:Hmmmm by Sj0 · · Score: 2, Funny

      That's what school sysadmins are for.

      Besides, hardware configuration stopped being an issue under Linux very recently. The last time I had to configure something manually was RedHat 6.0. Ever since RedHat 6.2, the Kudzu(spelling on that? I rarely invoke it manually) program run at bootup would detect any hardware changes. Makes swapping IDE devices, PCI devices, and even ISA PnP devices very easy -- just boot up. Puts the Windows "Windows requires that you touch your nose three times, stand on your head, and insert the disk labelled "I downloaded this off the internet" to continue." device installation to shame.

      Remember, in a place like a school, with a bunch of bored kids, there will be a sysadmin ready to fix any problems which arise from the kids antics("I put my comb in the floppy drive, now it's stuck in there!"). Sticking a boot disk into a drive to install Linux over FTP or NFS is a piece of cake(assuming the floppy drive works :)).

      --
      It's been a long time.
    4. Re:Hmmmm by gorillasoft · · Score: 2, Insightful

      Often, schools do not have their own sysadmin at every single campus. They sometimes have ONE sysadmin that has to cover all of the campuses in the district. This means they will not have time for every little thing.

      Also, if you have seen what they pay sysadmins in many districts, you will know that it could be quite difficult to hire a good admin that knows Linux as well as MS or whatever.

      I'm not saying to give up hope; I'm just putting more light on the situation.

    5. Re:Hmmmm by Grab · · Score: 2

      Nope, there'll be a computer studies teacher. There's no guarantee that the computer studies teacher knows shit about the subject beyond teaching the kids how to use Word, Excel and Outlook.

      When I was a lad (back in the "good old days") our computer studies teacher was a waste of space (and there was a lot of her occupying a lot of space!). The school computers back then were BBC B's - marvellous! Anyway, she knew shit about the whole thing, and basically had to be tutored from scratch on how to run a network by those of us pupils who knew about how it worked. I mean, not just unfamiliar with methods on that network, but with the whole concept.

      More often than not, you'll find the computer studies teacher is someone who'd previously done maths or something at uni, and happens to know more than the other teachers about computers. This does not mean they're any damn good at it!

      I realise I'm generalising here, but schools really can't afford a good sysadmin - hell, most can't afford teachers and books!

      Grab.

    6. Re:Hmmmm by madfgurtbn · · Score: 1

      The school sysadmins I've known are up to their ears right now, and most of them are basically Apple admins who can also work in Windoze. Adding a third OS to the mix now is unlikely to happen on a large scale.

      --
      Send lawyers, guns, and money. Dad, get me out of this.
    7. Re:Hmmmm by SoftwareJanitor · · Score: 5, Insightful

      If there is a shortage of sysadmin resources then Linux is probably an even better answer compared to Microsoft. One central sysadmin can usually maintain a lot more Linux boxes remotely than Windows boxes, at least that has been my experience where I've worked. The only problem I can see is that schools are not as networked as they should be, which means that sysadmins may have to make more personal appearances than is typically necessary in a business environment. But the fact that Linux is generally more secure(able) than Windows or Macs (Macs are fairly network secure because they provide almost no inbound services - but as a broad generality they aren't as secure from the console as Linux is because they aren't designed for multiple users), and more reliable should also make it a win in reduction of need for sysadmin resources as a whole.

      As for it supposedly being more difficult to hire a good admin that knows Linux, it just doesn't seem to hold true. There are just as many good admins out there who know Linux as there are that know MS. Chances are it will be difficult to hire a good admin for what school districts pay, but it shouldn't be any more difficult for Linux than for MS. Look around at salary surveys -- experienced admins don't get paid that much differently based on platform.

      I think you need to examine your light again because you are buying into too many of the MS marketing promises that don't hold up. They want you to believe that any idiot who buys a bunch of "Exam Cram" books and gets a little certificate (after paying them a nice chunk of change) is qualified to administer your network. But it is a false economy to hire an idiot to administer your network because -- you then have an idiot administering your network.

    8. Re:Hmmmm by gfxguy · · Score: 1

      I have to agree with you 100% - The built in remote accessibilty of Unix makes Linux a much better choice for a light staff of administrators - especially when their computers might be across town.

      --
      Stupid sexy Flanders.
    9. Re:Hmmmm by gorillasoft · · Score: 1

      No, no, no - I said it would be hard to find a good one given what little school districts can afford to pay, not that it would hard to find one in general.

      Check your own facts before making snide remarks.

    10. Re:Hmmmm by MrResistor · · Score: 2
      But it's certainly reasonable to expect a high school or even grade school level programming instructor to use source as instructional aids; either as real world examples or as projects for the students to work on.

      Assuming that their existing hardware is fairly homogenous (not much of a stretch, since most schools buy their PCs in $50-100k chunks) they could deal with the install the same way they deal with their current Windows installs: One drive image that get's cloned to whatever drive needs it. Anyone who doesn't believe that school computers get reimaged at least once a month is living in a fantasy land. Kids are remarkably ingeneous when it comes to hosing up computers. The idea of relying on a preinstall with rescue disks in that environment is insane. They'd have to have techs working 24/7.

      --
      Under capitalism man exploits man. Under communism it's the other way around.
    11. Re:Hmmmm by MrResistor · · Score: 2
      Floppy drive?!?!?!?

      What kind of barbarian are you?!?!?

      Seriously though, the Linux distos I've installed recently have had excellent cd-boot, much better than Windows. The only reason you'd need a floppy is if you're BIOS doesn't support boot from CD.

      Definately have to agree about the sorry state of Windows "PnP", though.

      --
      Under capitalism man exploits man. Under communism it's the other way around.
    12. Re:Hmmmm by Sj0 · · Score: 1

      I thought I mentioned that it would install from an anonymous FTP server or an NFS partition.

      Also, a lot of schools are using *old* PCs. Think Early pentiums. No booting off of the CD-Rom, let alone over the network.

      --
      It's been a long time.
    13. Re:Hmmmm by Anonymous Coward · · Score: 0

      I believe he spent time explaining that the pay scale is the same, so that if they hire a MS admin they could instead hire a Linux one.

      Perhaps while he is watching his snide remarks you could be checking your reading skills.

    14. Re:Hmmmm by SoftwareJanitor · · Score: 2

      Snide? If I wanted to be snide, I would have been meaner than that... :-) I never said it wouldn't be hard to find a good Linux admin for what school districts want to pay -- just that I don't believe it to be any harder than finding a good MS admin for what they want to pay. Good admins aren't cheap regardless of platform. Idiots are cheap regardless of platform. I just don't see any advantage on Microsoft's side when it comes to the real costs of getting your sysadmin needs fulfilled, and I will stick by that.

    15. Re:Hmmmm by j-pimp · · Score: 1

      No booting off of the CD-Rom, let alone over the network.br Ok correct me if I'm wrong, but doesn't any x86 comouter witha NIC with a proper EPROM network boot? Iven if this isn't the case, the machines have hard drives which can contain a kernel and a small ramdisk image setup to remotly mount an NFS root partition. The master version of the boot kernel/ramdisk image can be stored on a server and a cron job can check if the image has changed and ddi onto the clients to upgrade. User authentication can be done with an LDAP directory or SQL database, or even yellow pages.

      --
      --- Justin Dearing http://www.justaprogrammer.net/ We're just programmers.
    16. Re:Hmmmm by Sj0 · · Score: 1

      the machines have hard drives which can contain a kernel and a small ramdisk image setup to remotly mount an NFS root partition

      The Idea would be that there's either nothing or Windows on the PC if it needs to have linux installed. :)

      The EEPROM thing may be true, but it's another thing which would be more a hassle than it's worth. Why preformat hard drives, or buy 200 EEPROM chips just to install linux when you could just use two floppy disks? :)

      --
      It's been a long time.
    17. Re:Hmmmm by larkost · · Score: 2

      Small point, but newer Mac's running MacOS X can actually be made more secure, as the OS is made for this and the Firmware can be locked and set to disalow booting off of any other media, and then if you have a kensington lock on the back, there is no way you can get at the protected files without either the password or damaging the computer extensively, while still being able to use the computer normally. This makes the most securable computer I have seen in a lab environment.

    18. Re:Hmmmm by spudnic · · Score: 5, Informative

      You are correct about the use of images in schools, at least at the ones I was at. I worked as a consultant for 13 small to medium sized school districts for 4 years, so I have some insight into this.

      School district admins wouldn't even listen to a suggestion of putting Linux on desktops. The rational? Well, I've listed a few:

      1) "The kids need to learn on the types of computers that they will be using in a typical office. They need to know how to use Word and Excel."

      - I know they could develop the same skills by using an alternative, but the name recognition thing is really important. Parents would be up in arms at the next school board meeting if they heard their kids weren't going to learn about spreadsheets using Excel.
      2) "We can't run Accelerated Reader and the other programs that are essential to teaching on Linux."

      - This is a huge argument. AR is used a lot in most schools. It helps teachers not actually have to teach anything. If you're not familiar with it, it's a pretty simple program that tests a students understanding of a book after they have read it. There was some chance of using the old DOS version on Linux, but we haven't been able to run the Windows version under wine. The program would be trivial to duplicate, but the real value is in all of the thousands of tests that are available for it.

      3) "Windows doesn't cost that much money for us, and most of our grants specify a certain portion of the funds for software purchase."

      - This is true. I know we where spending like $21 for a Windows 98 license, $45 for NT. And, the federal grants that we where writing (and helped spend the money from ;) for the schools required us to allocate for the purchase of OS and application programs or the proposal would be rejected. I'm sure we could appeal if this where the case, but schools don't like to risk it. Every t must be crossed, every i dotted, and the staple has to be in exact right spot.
      4) "We don't need to worry about maintaining desktops. Each teacher has a boot disk for all of the machines in their room that will automatically reimage the system if there is some sort of problem. Network apps and updates are provided via NAL or something similiar based on the user logged in, so we don't even have to touch a system to allow access to new programs."

      - The same system could be used by Linux, but because the same thing could be said about Windows it doesn't help the argument in their minds.

      Now I want to be clear that every one of the school systems that I worked in had at least one, usually quite a few, Linux boxes performing functions behind the scenes. After talking to some of the IT directors recently I found that these boxes where all just running perfectly. And they loved that, they just run.

      --
      load "linux",8,1
    19. Re:Hmmmm by pmumble · · Score: 1

      Uhh.. can't you lock the BIOS of most motherboards with a password? I fail to see how this is any better than *nix.

      -pmumble

    20. Re:Hmmmm by SnowZero · · Score: 1

      I started programming when I was 8 by taking apart the IBM Advanced Basic demos that came with our IBM XT at home. If it wasn't for that already working source code from which to start hacking I wouldn't have gotten started with programming until much later.

      Source code isn't the solution for everyone, but it can be for some -- especially for those of us who were quite bored with the regular curriculum.

    21. Re:Hmmmm by j-pimp · · Score: 1

      well true. being the hardware is already purchased, it makes sense to install linux on one machine and create a backup tape/cd/dvd to restore the image from. Although, depending on the size of the hard drives, your probally going to have to get a K6-2 450 to be a file server to mount /usr and /opt from.

      --
      --- Justin Dearing http://www.justaprogrammer.net/ We're just programmers.
    22. Re:Hmmmm by marclijour · · Score: 1

      I work in a school. I do 8 hours teaching (HTML, Office suites, Java, from grade 6 to 9) and I do 8 hours of system administration. Since september I installed 20 Linux boxes in old and less old hardware. I set up Apache, postfix, samba, a firewall, NFS, NIS, and I host myself the website. People are not impressed by Linux. It does the job that's normal...! But they rather talk about their solution : Mac guy about Mac, Win guy about.... (the less we know the more we seem to talk). I'm myself an ex-math-teacher converted to Linux especially. The kids who really like computing seem to have been briefed by people who complain a lot. This kind of client is difficult to make happy : the ones who don't order anything but expect the best. Star Office is too slow, working at the command line (eh, 16 MB of RAM!) scare the kids (although they just have to know between 3 and 5 commands they use each time), etc... They almost get me to believe what I expect is impossible from the kids, and that at the same time they are computer genius!!? Running a P1.7Ghz at home with the latest, greatest (supposed to be), and most expensive, makes you difficult to impress.... it's a pity. What can we do?

    23. Re:Hmmmm by psamuels · · Score: 2
      I fail to see how this is any better than *nix.

      ...because it is Unix. MacOS X == FreeBSD + custom GUI toolkit + various compatibility layers to make it look, feel and work like MacOS 9. Remember?

      --
      "How can you claim that you are anti-crack, while still writing a window manager?" — Metacity README
    24. Re:Hmmmm by psamuels · · Score: 2
      Ok correct me if I'm wrong, but doesn't any x86 comouter witha NIC with a proper EPROM network boot?

      You're assuming that the NIC has a boot EPROM. Remember, this is the same computer whose BIOS can't boot from CDROM.

      Remember, until a couple years ago the most popular NIC in the world was the ISA-based 3c509 series. [The RTL-8139 and 2114x chipsets are probably winning now.] And there are a lot of old Cabletron E2100s and NE2000s out there as well.

      --
      "How can you claim that you are anti-crack, while still writing a window manager?" — Metacity README
    25. Re:Hmmmm by seven89 · · Score: 1
      1) "The kids need to learn on the types of computers that they will be using in a typical office. They need to know how to use Word and Excel." - I know they could develop the same skills by using an alternative, but the name recognition thing is really important. Parents would be up in arms at the next school board meeting if they heard their kids weren't going to learn about spreadsheets using Excel.
      That idea might be worth challenging. There are reasons for having computers in school beyond the training of future office workers. For a typical college-prep course of study, for example, a simple word processor that offered few choices, but which allowed a student to quickly learn how to type in a term paper and get it printed in some locally standardized format, might be better than a huge program like Word, which always seems at war with itself on the simplicity vs. power front. (Clippy, R.I.P.) We shouldn't have to learn how to be secretaries just so we can write a paper on "Great Expectations."

      Future programmers, scientists, technicians, etc., would benefit more from learning languages and how to use a command line than from sweating over the arcane intricasies of Excel.

      If I were in charge, I'd have the future office workers learning Word and Excel on Windows, but I'd pursue Linux solutions for the other two cases.

      BTW, if I were in charge of an office, I would also consider "limited option, easy to learn" solutions. It might be easier to set such things up under Linux than under Windows, even though the whole of Linux itself is difficult to learn.

    26. Re:Hmmmm by AYeomans · · Score: 1
      1) Good argument for those about to leave school. But not for the K-14 ages, as the software they encounter will be different. Think back 8 years - is your knowledge of the word processor you used in 1993 relevant to Office XP?

      Far better to teach the concepts as they will apply to any future products. (And I thought that's what good education is about, teaching people to think.)


      2)There's always Citrix / Windows Terminal Server, and the free Linux ICA client.


      3)So make out the software bill to FSF, Gnu, or your favourite Linux vendor.

      --
      Andrew Yeomans
    27. Re:Hmmmm by eWulf · · Score: 1

      Think back 8 years - is your knowledge of the word processor you used in 1993 relevant to Office XP?

      Yes, it was pretty much the same. The interface to Word hasn't changed much at all.

      --
      "If Stupidity got us into this mess, then why can't it get us out?" - Will Rogers
  8. an interesting site by MoceanWorker · · Score: 4, Informative

    you should check out OpenSourceSchools. it's a great site that focuses on Open Source in the education system

    --


    "The ones who dont do anything are always the ones who try to pull you down" -- Henry Rollins
    1. Re:an interesting site by Anonymous Coward · · Score: 0

      OpenSourceSchools.org is very informative. Lots of good information reguarding the use of and the software avaliable to others. They are a good resource, Schoolforge.net will be a great place also to find information on the use of Open Source Software in the school systems. There are many great sites for educational software even RedHat has an educational focus. Blue Linux is building a BlueEDU Distribution only for the purpose of Linux in the educational district.

    2. Re:an interesting site by Ooblek · · Score: 1

      I hate to say it, but a lot of schools (at least the ones I've encountered in my dealings) want some sort of "title" as assurance of work quality. What this means is that, however wrong it may or may not be, they may want to use something that they can hire someone with an MCSE or CNE title to setup and maintain.

    3. Re:an interesting site by yesthatguy · · Score: 2

      If they're really worried about that, there are open-source related certifications available. RHCE comes to mind, but I know I've heard of a few others.

      --
      Yes! That guy!
  9. What about foreign schools? by alsta · · Score: 3, Interesting

    I think it would be interesting to hear what schools in other countries have done about this. Not because I doubt that American schools have done it, but because it would show how universal an Open Source solution could be.

    --
    Wealth is the product of man's capacity to think. -Ayn Rand
    1. Re:What about foreign schools? by KjetilK · · Score: 3, Interesting

      The Norwegian Skolelinux has worked hard and has been tested on some schools, and has received some money in governmental grants, but I guess has yet to really go mainstream.

      --
      Employee of Inrupt, Project Release Manager and Community Manager for Solid
    2. Re:What about foreign schools? by Anonymous Coward · · Score: 0

      I'm from a grammar school in England. We've just started using Star Office to reduce licensing costs but, as yet, have remained on Windows. We are looking for help in moving to open source and free software but have not yet found a UK based source.

  10. One blessing.... by ZoneGray · · Score: 3, Funny

    One thing working in your favor, ironicly enough, is Windows Product Activation. The more difficult it is to use bootleg commercial software, the easier it is to see the value of free stuff.

    1. Re:One blessing.... by Sj0 · · Score: 1

      In schools? I find that many schools are very strict about ensuring that their licensing is up to date, and I'm certain that any school would buy the corporate version which doesn't have product activation.

      --
      It's been a long time.
    2. Re:One blessing.... by Bonker · · Score: 4, Interesting

      The more difficult it is to use bootleg commercial software, the easier it is to see the value of free stuff.

      This is an important point. Most of the grade school teachers I've ever met who deal with computers have the attitude that anything short of organized for-profit software piracy is okay because they're teachers. They *have* to teach students on a limited budjet, are used to stretching any school supply just as far as it will go, and see copying software they've bought for home use, or ordering only one copy of windows to install on every computer in a lab as a necessity.

      This is the same thing as making xerox copies out of a book to hand out to their students, as far as most of them are concenred.

      Now, I'm personally inclined to agree with the morality of this little ethical short cut. I have a lot of problems with software licenses, and I think it would be a wonderful thing if being a teacher really meant you were exempt from copyright law for educational purposes.

      You can bet that Microsoft, Adobe, Corel, and the other members of the BSA don't agree with me, however.

      If you start stressing this fact, Free Software just starts seeming like a better and better idea in the classroom.

      --
      The next Slashdot story will be ready soon, but subscribers can beat the rush and slashdot the links early!
    3. Re:One blessing.... by Grab · · Score: 2

      Exactly. The more difficult (and expensive) it is to use Microsoft software on corporate machines, the more likely it is that Microsoft won't be the chosen solution.

      Grab.

    4. Re:One blessing.... by Sj0 · · Score: 1

      perhaps, but the program being easy to pirate is irrelevant.

      --
      It's been a long time.
    5. Re:One blessing.... by ZoneGray · · Score: 2

      Hmmm... "Moderation Totals: Redundant=1, Interesting=1, Informative=1, Overrated=1"

      C'mon gang. I just need Troll, Flamebait, and Funny, and I'll have hit for the cycle. Please help.

      (BTW, if you're good at math, you should be able to deduce which of the three haven't been used yet.)

    6. Re:One blessing.... by MrResistor · · Score: 2
      The drives in most schools (at least for the lab boxen) get reimaged at least once a month. How will that be effected by product activation? If product activation gets in the way of reimaging at the drop of a hat school IT departments are going to be very unhappy.

      Most schools keep their licensing up to date, yes, but having to prove it everytime some kid installs AOL Instant Messanger on a lab PC places an undue burden on an already stretched IT staff. (When I worked in a school lab AIM was the most common reason for reimaging. It hosed up the Algebra package we used, which was the primary purpose of those PCs.)

      It is precisely the need to keep all their licensing ducks in a row that prevents schools from buying the corporate version of their chosen Windows flavor. The corporate version is generally at least $100 more per station, and schools simply can't afford that. In my experience, schools generally have maybe 20 boxen running corporate (if they have some sort of admin class, otherwise there's no justification for the added expense in the eyes of the school board) and the rest run the home version.

      --
      Under capitalism man exploits man. Under communism it's the other way around.
    7. Re:One blessing.... by Sj0 · · Score: 1

      I wasn't aware of that drastic difference in price. I see how that could piss off a lot of support staff, since rarely is every single PC in a school exactly the same.

      On the other hand, I'm really hoping that XP isn't adopted by schools. Windows 2000 is fine(as far as windows goes...), and doesn't need the extra horsepower for the useless interface.

      --
      It's been a long time.
    8. Re:One blessing.... by MrResistor · · Score: 2, Flamebait
      What about Underrated? Or does that not exist anymore? I haven't been given mod points in a while...

      --
      Under capitalism man exploits man. Under communism it's the other way around.
    9. Re:One blessing.... by tryfan · · Score: 1

      :This is the same thing as making xerox
      : copies out of a book to hand out to their
      : students, as far as most of them are concenred.

      A good point. But, exactly what IS the difference??

    10. Re:One blessing.... by MrResistor · · Score: 2
      Actually, there are usually large blocks that are the same. You can generally assume that all the boxen in one room are the same. One reason is the ability to apply one drive image to as many systems as possible is incredibly important in that environment. Another is that schools usually get a large single grant to buy new computers every 3 years or so, anywhere from $20-100k, and it's a lot easier to buy in bulk.

      I totally agree about XP though. Not only is the new interface useless, it's also butt-ugly.

      --
      Under capitalism man exploits man. Under communism it's the other way around.
    11. Re:One blessing.... by ZoneGray · · Score: 1

      I dunno, I don't have any mod points right now, so I can't see the list.

      I'll go log in on my Signal11 account and check.

    12. Re:One blessing.... by Katharine · · Score: 1

      There is a very important reason why it is different. Good ol' fair use that we hear so much about on Slashdot. Copying a short section of a book and using it for teaching purposes is fair use because of the way it is being used. Copying a piece of software and using it in class every day is not. The relevant law is found at 17 USC section 107 (http://www4.law.cornell.edu/uscode/17/107.html), which sets out the factors to be weighed: (1) purpose and character of the use, (2) nature of work used, (3) amount used compared to the rest of the work, (4) effect on the market for the copied work.

      If you copy a word processing program and install it on a school computer, it isn't fair use because you are using it in exactly the way it was intended, and the only teaching you are doing is "how to use it"-- if any! You might just be using it as a tool for typing papers. This is even clearer if you imagine that same software installed on the school secretary's computer.

      On the other hand, if you copy a program in order to demonstrate something about it where you are actually teaching about the program itself, it is closer to being "okay." For example, perhaps you install copies of different word processors on the computers for a few days so the kids can try the different ones, or so you can test them to decide which to buy . . . Or maybe you made copies becaus your word processor is on backorder and school starts tomorrow-- but you are expecting to have enough legal copies in a few weeks.

      If you are curious about what teachers look at in order to decide what they can copy, you might want to look at the "fair use guidelines" which are found in comments of the West Publishing version of Copyright Act itself. Basically, they provide a kind of safe harbor in terms of copying for educational purposes. These guidelines are really called the "Agreement
      on Guidelines for Classroom Copying in Not-for-Profit Educational Institutions" (http://www.musiclibraryassoc.org/Copyright/guideb ks.htm)

      These guidelines take the guesswork out of figuring out what kinds of copying are "fair use" and what aren't. As long as a teacher stays within them, he or she knows its okay. But it is possible to copy more, legally, in some situations.

    13. Re:One blessing.... by laserjet · · Score: 2

      I had mod points a few days ago and it was still in the list.

      you can relax now.

      --
      Moon Macrosystems. Sun's biggest competitor.
    14. Re:One blessing.... by MrResistor · · Score: 2
      The question has been answered :)

      --
      Under capitalism man exploits man. Under communism it's the other way around.
  11. I'd say so, yes. by Bowie+J.+Poag · · Score: 5, Informative



    A couple guys I know of started an organization called the OSEF, or Open Source Education Foundation. They basically assemble machines and networks from spare parts, go out to a school and install the gear, free of charge. I know of at least one school they've helped, in downtown Tucson. About a dozen machines remotely administrated from a central server in the back room. Google for them, you might find a link or two.

    --
    Bowie J. Poag

    1. Re:I'd say so, yes. by five+dollar+troll · · Score: -1

      damn, dude!!! you're almost as ugly as those desktop "enhancements" (ha) that you've got on your site!!! Egad, man! Grow some hair!

      --

      Reading Slashdot for content is like picking peanuts out of shit.
    2. Re:I'd say so, yes. by Bowie+J.+Poag · · Score: 0, Troll



      If i'm as ugly as my tiles, i'll take that as a compliment. Thank you!

      And hey, don't blame me for going bald. History repeats an order it must protect, and dihydrotestosterone is the guilty party, not my barber. :)

      Trolls need love too,

      --
      Bowie J. Poag

  12. It isn't just free software by meckardt · · Score: 5, Informative

    Think about it for a second. There are three elements of the equation here: Hardware, Software, and Operations. If we are talking about computers to be used by a school, then first you have to have the boxes, then you have to have something to run on the boxes, and then you have to have somebody who knows how to make it all work. Of the three, the last is probably the biggest expense, and certainly the one that you aren't going to get for free. Even if its just a tech savvy teacher who maintains the things, its going to take a lot of his time to do so... time taken away from his primary job of teaching the kids. QED, it has a cost.

    1. Re:It isn't just free software by sirket · · Score: 2, Insightful

      A good computer system does not need a lot of maintenance. Besides which, in any school you can find technologically savvy kids. Make them a part of the computer team that maintains the network. Many a school is run in this way.

      Besides which, it sounds as if you are saying that a Windows alternative would require _less_ maintenance than a Unix solution. If a teacher has the skills to handle a Unix system, then that configuration will require a lot less time than the eqwuivalent Microsoft solution.

      -sirket

    2. Re:It isn't just free software by geekoid · · Score: 2

      true, but thats true regardless of OS. So why not choose an OS that doesn't have a liscense, and is a good learning tool?
      If its a high school, you have the computer class run the operations. Perferable the new student would be traind by student who where doing it the previouse year, under supervision, of course.

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    3. Re:It isn't just free software by Syberghost · · Score: 2

      A good computer system does not need a lot of maintenance.

      Horseshit. Any non-trivial setup needs quite a bit of maintainence, and a school needs a non-trivial setup if you want to get any non-trivial use out of it. Otherwise it's doorstop PCs in the wings of the physics class getting used by half a dozen kids a year.

      The answer for small schools is going to have to be outsourcing.

    4. Re:It isn't just free software by Anonymous Coward · · Score: 0
      Besides which, in any school you can find technologically savvy kids. Make them a part of the computer team that maintains the network.

      Right - schools are filled with dozens of responsible, intelligent, and mature Linux-savvy students that you want to trust your operations to.

    5. Re:It isn't just free software by Brendan+Byrd · · Score: 1

      Horseshit. Any non-trivial setup needs quite a bit of maintainence, and a school needs a non-trivial setup if you want to get any non-trivial use out of it. Otherwise it's doorstop PCs in the wings of the physics class getting used by half a dozen kids a year.

      When you have servers that have uptimes of two years (or more), something tells me that some of those servers are, more or less, a fire-and-forget system. Anybody who sets up a server right WON'T need to maintain it much. Hell, we even have programs that auto-update the files, when there's a security issue. (Not to say that I completely trust those programs, but they are there.)

    6. Re:It isn't just free software by bribecka · · Score: 2

      A good computer system does not need a lot of maintenance.

      Even if this is true (which it really isn't), you're thinking of the amount of maintenance required when a relatively tech-savvy person is using it.

      Now, think about schools. There are multiple users going on/off the computer each day, installing things, deleting things, many of the students *trying* to mess the system up. There is a lot more maintenance when (for example) 1 out of 10 students is trying to crash the machine so they don't have to do work. My mom teaches high school--she has had students do a lot of crazy shit to the computers, from deleting software to cutting the friggin power cords with scissors. Now, *that* kind of stuff doesn't happen in the real employment world.

      --

      Where are we going and why am I in this handbasket?

    7. Re:It isn't just free software by Syberghost · · Score: 4, Interesting

      When you have servers that have uptimes of two years (or more), something tells me that some of those servers are, more or less, a fire-and-forget system. Anybody who sets up a server right WON'T need to maintain it much.

      As long as there are no users being added, no programs being added, and you only have a handful of systems, you might be right.

      But let's say you have 200 systems, with a mean time between failures of 56,000 hours each.

      That's one failure every 12 days, more or less.

      A school has dozens or hundreds of systems, with much shorter MTBF on the physical hardware, and has hundreds of students using those machines. They require security monitoring, hardware replacement, software configuration and upgrading; near-constant attention, if it's larger than one server and a handful of clients.

      If I take any one of my servers and point at it and base my manpower computations on that server alone, the numbers will look deceptively like I can do it all myself. When I broaden my sights out to all of the several hundred large servers I manage, I instead get a 7-man team rotating on-call duties between 3 production and 5 test projects, and the thought of doing it all myself becomes laughable.

      A typical school is somewhere in the middle if you want to use computers for education, instead of (as I said) sticking a few PCs in the physics lab and letting the brightest students do WTF the want with them.

      If you just want to stick a file server in the secretary's office and put a PC on each of the administrator's desks, you're probably right. But I'm talking about a school using computers for educating the kids, not a school using computers near the kids.

    8. Re:It isn't just free software by SuiteSisterMary · · Score: 2

      Servers have high uptime BECAUSE of proper maintenance, not DESPITE proper maintenance.

      --
      Vintage computer games and RPG books available. Email me if you're interested.
    9. Re:It isn't just free software by Thatman311 · · Score: 0

      The point is at a school there may be only one server. Ok so that is one system they don't have to think about. Now think about the 30-60 workstations they have to think about? Man when I was in school we had Mac Classics and IBM PS/2 model 30 (the model could be wrong). The Mac's barely worked due to our..umm...fun with them and the IBM's were a joke (novel 2.1 wasn't secure at all). So why did these systems ever get fixed? Well it was because us students too the time to undo what we did to them when we were done. If we didn't..they wouldn't have been fixed until next year.

      --
      Silly Rabbit...Sig's are for kids.
    10. Re:It isn't just free software by Brendan+Byrd · · Score: 1

      Uhhh...so how is this different from Windoze machines? Are we trying to compare the two or not?

    11. Re:It isn't just free software by Jason+Earl · · Score: 3, Informative

      Actually this is precisely why Linux has the potential to be such a big win. Rolling out software to Windows desktops requires a ton of work, maintaining each of those fragile beasts requires even more work. Have you ever seen the systems at your typical school. They are a mess.

      Now imagine that the school took their money and bought one commodity Intel-based server and a great big pile of inexpensive thin-clients (like the ThinkNic). Adding or updating the software for your system now is a snap. You upgrade your server and the clients have immediate access to the new software. No CDs to lug around, no reboots, no problems. Heck, the administrator wouldn't even have to be on site. One quick "apt-get install foo-package" and it's done. Accounting, security, and other user management tools have existed for Unix forever. You can easily set quotas for nearly every resource that is available to end users and you can monitor your Linux server to the nth degree without leaving the comfort of your bedroom.

      Thin clients have been seen as the systems administrator's Nirvana for years, but it wasn't until Linux came along that there was really any useful software that would run on these systems. However, the combination of StarOffice + Mozilla is starting to look like a compelling combination. Especially in places like schools where money is tight and where it is important that the computers both allow easy collaboration and tight security. All of the students would essentially be sharing the same machine (making it easy to work on projects together), but none of them would have write access to any system files (much better security than Windows PCs).

      The trick of course, is in removing the PCs. That would leave the school with one server and a pile of essentially disposable devices. If you think replacing Windows PCs with Linux PCs, then you are almost certainly correct, the Linux solution would be more difficult to administer (or more expensive anyway as it would require a much more savvy administrator). However, if you replaced the hordes of Windows PCs with a single Linux server then even the slowest Windows admin could probably find the time to learn to administer Linux.

    12. Re:It isn't just free software by Syberghost · · Score: 2

      Uhhh...so how is this different from Windoze machines? Are we trying to compare the two or not?

      Different in the number of people it takes to maintain it correctly. That's about it.

      Oh, it's easier to maintain the Linux machines from off-site, but it's doable with Windows too.

      The key is the fact that it takes fewer people to maintain the Linux systems, and that it's easier to set them up so that the kids can't screw them up.

      But with either, it's going to take outsourcing for the smaller schools to afford to do it right. Right now they're mostly doing it wrong. Mostly.

    13. Re:It isn't just free software by sirket · · Score: 1

      Speaking of horseshit. No proper configuration needs quite a bit of maintenance. A well designed, properly configured system should run on its own, without user intervention, for long periods of time. How often do you need to make changes to a swuid web proxy? Or your DNS servers? The onyl systems which require any sort of serious maintenance are mail servers and shell machines. And even that maintenance can be kept to a minimum if you know what you are doing.

      -sirket

    14. Re:It isn't just free software by sirket · · Score: 1

      The original point of this article was Free Software, and how administrative cost is the most significant aspect of system operations. Since software updates and user additions are a part of _ANY_ coputer system, and are not specific to a Microsoft or Free Software solution, why are you involving them?

      Why not stick to the maintenance requires by free software systems versus Microsoft systems which was the original point. In that case, the Free Software solutions comes out ahead. Any Unix solution comes out ahead.

      -sirket

    15. Re:It isn't just free software by Anonymous Coward · · Score: 0

      56,000 hours is 6 1/2 years of 24 /7 or 29 1/2 school years 270 days long / 7 hours per day.

      As a public school instructor, I also took care of several hundred machines for two years and saw only three hardware failures. Considering that the machines were power cycled 3 times a day and that the machines were corporate cast-offs before we got them and that they were in use 60 hours a week (12 x 5) that seems reasonable. Considering the hard drives used stepper motors and two of the machines died of hard drive failure and one had a broken keyboard socket, I don't feel too bad at all. All three were returned to service with less than one hour of work apiece.

      Never once was there even the tiniest clue that the software was responsible.

    16. Re:It isn't just free software by sirket · · Score: 1

      Come to Stuyvesant High School in Manahattan sometime and that is exactly what you will see. I am sorry if my background is different than yours, but that is certainly what I witnessed.

      -sirket

    17. Re:It isn't just free software by sirket · · Score: 1

      How does one delete software or crash the system when running a real operating system instead of Windows?

      Also, all I said was that a good system does not need a _LOT_ of maintenance. I never said it needed _NO_ maintenance.

      -sirket

    18. Re:It isn't just free software by madfgurtbn · · Score: 1

      Yeah, I went to an educational technology conference once, and this guy was trying to sell me on a really bitchin' firewall that would keep out all those pesky hackers. That doesn't do a lot of good when the hackers are your users. Just a few of my own fond memories... when the new iMac's came out they had a drawer cd-rom where the cd mechaniwsm came out with the drawer, so within a week and a half all the mechanisms were long gone... Mouseballs have a shelf life of about a week, if you are lucky...pencils are made for breaking off in fdd's...And why do they put knobs on monitors? I need monitors that are only software controllable so they can be LOCKED (anyone know of such an animal? there must be some)...

      --
      Send lawyers, guns, and money. Dad, get me out of this.
    19. Re:It isn't just free software by Anonymous Coward · · Score: 0

      84.6% of all statistics are made up.

      You do realize the delicious irony of your sig after your post, right?

    20. Re:It isn't just free software by sirket · · Score: 1

      It was never my intention to imply otherwise. But preventative maintenance generally does not require a lot of work (certainly not as much work as fixing a destroyed system) _and_ it results in systems that are secure and stable.

      -sirket

    21. Re:It isn't just free software by markmoss · · Score: 2

      madfgurtbn: No, what you really need is some law enforcement. I assume this is a high-school, right? The vandals are old enough to be tried as adults then -- give a few of them a night in jail, plus six months of their weekends cleaning up the city park or something, and it might become possible to actually _teach_ at the school. But as it is, in most places (1) the school won't call the cops in the first place, except for making a drawing of a gun, and (2) if they do get busted, they get yelled at a bit and turned loose.

    22. Re:It isn't just free software by Old+Wolf · · Score: 1

      Which OS doesn't have a licence?

    23. Re:It isn't just free software by markmoss · · Score: 2

      Actually, I'd hire a Linux administrator first. His first job: call around and find companies that are scrapping out their 100MHz machines because they are outmoded -- but will really zip under Linux. Then you need a tiny budget for an install CD. The one thing I don't know about is finding applications -- how many educational programs are there for Linux (or other *nix), and will the mainstream Windows programs run under Wine?

      The problem with Windoze systems in schools is that it is not obviously necessary to start with a good administrator -- so the schools never hire one, and so they rarely get much out of the systems except for a few kids that tinker with them. Not that those kids are getting a proper training as administrators either...

    24. Re:It isn't just free software by madfgurtbn · · Score: 1

      You have to catch 'em first. There are too many of them and not enough of us.

      --
      Send lawyers, guns, and money. Dad, get me out of this.
    25. Re:It isn't just free software by JWW · · Score: 2

      You can turn the PC's into thin clients.

      See: Linux Terminal Server Project

      That's what you could do with the PC's. They talk on the site about building both the server and the terminals out of PC's.

      Thin client are the way to go. Easier to support, maintain, roll out software to, etc.

    26. Re:It isn't just free software by markmoss · · Score: 1

      No, I've seen cases where they _knew_ who it was and didn't do anything effective.

    27. Re:It isn't just free software by Jason+Earl · · Score: 2

      That's a good point. I have a 486 X terminal at home, and I am always surprised at how well it works. If you had a lot of volunteer work (or if the machines all had the same video card :), and very little money this would certainly be the way to go.

    28. Re:It isn't just free software by Jason+Earl · · Score: 2

      From my experience it only takes making an example of one (or perhaps two) vandals before the rest realize that they have better uses for their time.

      Chances are good you already have some prime suspects (am I not right), so dig up some evidence.

    29. Re:It isn't just free software by Syberghost · · Score: 2

      The original point of this article was Free Software, and how administrative cost is the most significant aspect of system operations. Since software updates and user additions are a part of _ANY_ coputer system, and are not specific to a Microsoft or Free Software solution, why are you involving them?

      I'm not; I'm responding to a post by someone who claimed that if you have machines with long uptimes, no maintenance will be required.

      I was showing how a school doesn't just have servers, it has desktops that must be maintained as well. I was further showing that long uptimes are deceptive, because even if every individual machine runs for a very long period of time, a large group of machines will have frequent failures, not all just go out at once.

      MTBF is just that; MEAN time. As in average. Not "guaranteed exact time of failure."

      If you have 2 years of MTBF, as the poster implied, and you have 24 systems, that's a failure a month. Long individual uptimes don't mean no maintainance is required, they just tell you how much workload will be likely for maintainance.

      Many schools make the mistake that poster is making; assuming that it is possible to set systems up so that they'll require no maintainance. It isn't; not with the money schools can spend.

      Everybody's accusing me of being anti-Free-Software here, but nothing could be further from the truth; I believe that the best thing schools can do is outsource their computer maintainance, and instead of saying "we want Windows" they should say "we need to do this and this and this" and let the outsourcer set up the best way to acheive those goals in a maintainable manner. I'm confident that will often involve free software, and when it doesn't it will often involve Open Systems (I.E., things like a Sun server and a bunch of SunRay thin clients), and only rarely a Windows-based solution.

      I make my living running non-Windows solutions, it's laughable in the extreme to call me pro-Windows. Hell, I'm making my wife buy a laptop so I can take Windows off the last remaining workstation in my house that dual-boots it.

  13. An anonymous school in Ontario, Canada by Sj0 · · Score: 5, Informative

    We're using RedHat 7.1 to host webpages here, which has saved quite a bit against the cost of a copy of W2k Pro. Also, if we weren't running Linux, our aging IBM server (60 MHZ, 64 MB of ram) would need to be replaced.

    In addition to that, we use Linux in our Cisco networking academies classroom because we can't get any of the software we would need under NT (no doubt it exists, but it would be hard to find, possibly expensive, and likely non-standard). We can use the free FTP, TFTP, and HTTP servers on paticularly ancient PCs(one of our more powerful machines is a 75 Mhz machine with two gigs of SCSI drive!) without the hassles of running Windows (windows will now reboot...).

    There was a plan a few years ago to turn the ancient machines on the network into X clients, for which they would be quick, but they are now sluggish W2K machines.

    --
    It's been a long time.
  14. ahh, open source by vorovsky · · Score: 2, Insightful

    I work as a pc/network technician in a school district with about 3000 students in Texas. Basically all of our pc's run the standard with 98/office 2000. I have however convinced my boss to let me put up a slackware server that we use for hosting a few of our web pages and may start doing some routing for our district. Anyway, I have wanted to try to get something like this going on here, but everyone is so stuck to using -only- office 2k that they would refuse to switch to an open source alternative. If anyone has any suggestions on what I could do to maybe get things going here, please let me know. I would love to get away from paying outrageous win/office license fees.

    1. Re:ahh, open source by RedOregon · · Score: 2, Interesting

      Set them up with the StarOffice 6.0 beta for windows machines. Once they get used to that (shouldn't take long) then tell them the _same_ interface is used in Linux, then start on the money angle.

      --
      Skivvy Niner? Email me!
      HEY! Look left just ONE MORE TIME!
    2. Re:ahh, open source by geekoid · · Score: 2

      take it to the people.

      Get a list of costs for the Win system
      Get a list of costs for the Linux system.

      Be sure to include the costs of any upgrades that may be neccessary.

      Be sure they understand Windows new Liscensing.
      Make them get a lawyer review both liscense.
      Point out the eduacational benifit of each system.

      Explain to parents that little Jimmy's education(and there tax dollars)is being wasted on upgrades and liscencing fees.

      Have them go to the school board.

      Another appraoch, talk to local politicians who use education on there platform, and inform them of how much money they can save the system, and how forward thinking about education they would be by going with a system that encourges learning, is cheaper, and has all the tools they need, so no application costs on top of the OS costs.

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    3. Re:ahh, open source by jobob · · Score: 1

      Turn them on to Staroffice. They can install in on there MS boxes right next to MSOffice to start with, and when the next pc comes through the door without Office, give it to the person who is the most comfertable with Staroffice. Move them one person at a time to Staroffice on Windows, after all it?s gust another pice of software from another big company (SUN in this case). Once they have most of there computer needs met by non MS software they will be more open to other changes.

      --
      -- For love of family, code, and carpentry
  15. Computer Lab by fishybell · · Score: 4, Informative

    Here at Westminster College, Salt Lake City Utah, we have a dozen-or-so-computer lab where every computer is running linux. I'm not quite sure, but I'm pretty sure that it is also the only non-classroom computer lab on campus. No there are not any classes that teach/use linux, but there is a horde of geeks that are every bit as useful as the teachers.

    --
    ><));>
  16. Sofia, Bulgaria by Anonymous Coward · · Score: 2, Informative

    the University of Sofia is using Linux as the primary operating system in most of the computer rooms to teach students Operating Systems and to handle the internal info. they also use NT workstations for Java and C/C++ education (for C they use Borland C/C++ 3.5 but i really think they must move on to GCC)

    so, it looks like this:
    -Linux for advanced students and general management
    -NT for beginners

    1. Re:Sofia, Bulgaria by Anonymous Coward · · Score: 0

      If universities count, every CS department
      (all 6 of them) I've seen here in the UK use Linux on the desktop. Engineering is generally unix oriented but everywhere else is windows. The bottom line is cost, less costs==more PCs, and student admins are cheap.

      I was surprised to see that US CS students think linux is crap, everybody uses it daily here.

    2. Re:Sofia, Bulgaria by VP · · Score: 2

      Unfortunately the Borg has deemed the technological development of this University as worthy for assimilation, so according to this article MS and Compaq are donating computers running MS Windows...

  17. try google... by SirEdward · · Score: 1

    I didn't look at all the results, but there appear to be at least two specific cases in the top three...

  18. Stuyvesant High School by sirket · · Score: 3, Informative

    Stuyvesant uses Linux for their shell machines, mail servers, web proxies and DNS servers. They also use Linux for a majorityof their lab computers. Many desktops still use Windows, but until office comes out for Linux, things will probably stay that way.

    -sirket

    1. Re:Stuyvesant High School by terradyn · · Score: 1

      i don't think the servers could have run a windows based system for those services... The server's haven't been updated in quite some time... hehe. In any case, they were rock solid while I was there.

      Rickie
      Stuy'98
      CMU'02

  19. Northern Territory Schools, Australia by phlako66 · · Score: 2, Informative

    This article on OpenSourceSchools.org relates how Australia's Northern Territory has just completed an installation of state- wide network infrastructure in all schools that is based on Linux LAN servers and makes wide use of open source software. I was very impressed with their accomplishment. They use SquirrelMail (PHP) for the mail, and the network infrastructure is Linux. The desktops are all Win 98 but they do include StarOffice as the productivity app so would save some more cash there.


    My experience over the last 3 months of OpenSourceSchools.org is that while a complete takeover of Linux in schools is unlikely, there are many places where costly licensing can be replaces with OS equivalents to great savings.

  20. Almost free by Anonymous Coward · · Score: 0

    At DTU (Danish Techical University) we run several different kinds of operating systems, but mostly solaris. We also have a linux databar and a small windows databar. By running solaris we can easilly install free programs made for linux and other unix clones. The largest databar runs solaris and has about 400 dumb terminals. Everything works fine! I should mention the we do buy commercial software when it's needed, but most of the software is free. Hope that's enough success for you :)

  21. link to several case studies by einreb · · Score: 5, Informative
    --
    sik
  22. Open Source In Schools NOW! by Anonymous Coward · · Score: 5, Informative

    This movement is gaining ground. Here's a ton of sites:

    Start with Why Use Open Source Software In Schools to answer your (and your superior's!) questions. Note that Microsoft is trying to keep a stranglehold on this and their salesmen are playing dirty; but we as free software activists have one thing they can not have: integrity. Teach the truth about Open Source, explain that this is the true American way, show how we need to use it in education to teach kids the right way to do things (and to share with neighbors) to make a productive world, and we'll go at it. Academia can't afford to lose itself in proprietary software; as this site explains, with free software we've got a chance for a blossoming in academia.

    The K12 Linux in Schools Project

    A good example is St. John's School in the UK (attention, USA education boards!)

    Open Source and Education tells you how to do it, what you need to know.

    Linux in Higher Education: Open Source, Open Minds, Social Justice is an important article in Linux Journal about this.

    K12 Linux Terminal Server Project for Schools is just one of the things you can do.

    K-12 Linux, another good site about this.

    A good technical primer on Linux in Education

    If you use free software in schools you will also need free documentation and training materials. Here is a list of the best of it.

    (Pls mod this up guys, I'm posting anon...)

  23. Free software + education == BAD IDEA! by SumDeusExMachina · · Score: 3, Insightful
    I think I could speak for many people when I say that using Linux along with other free tools like gcc is one of the best things that a developer can do. I personally use RedHat at my job as a developer, along with the whole development team, while most of the rest of the company uses Windows. You just get more done in Linux if you're programming.

    However, I think it would be wrong to try to foist Free Software upon unwitting schools before they knew what they were getting into. There is a very important reason that Linux has stayed at about .25% of desktop market share: it makes a crappy end-user desktop. Sure, you can use it on your network servers for Samba and mail and the like, but I would hesitate to train children on a system that will be ultimately useless to them when they get out into a world dominated by Microsoft software. Because, like it or not, high school is, for most, valuable job training before they leave high school and enter the work force, be that as secretaries using MS Office or accountants using Excel, etc. When you teach them to use software that is completely irrelevant outside of school, you are crippling them for life as they have to retrain themselves on all the applications that school had taught them in order to use something as commonplace as Office.

    Not to mention the numerous administration headaches that would result from your everyday highschool computer teacher trying to figure out Linux, let alone teach it. I personally could not imagine my glorified typing teacher in high school comprehending file permissions, much less understanding something as arcane as TeX or vi.

    All in all, its probably a better idea to stick with something like Macs which have a proven track record in education as well as most of the common office applications that can be found on Windows computers as well. Free Software has its place, but it certainly isn't on the desktop.

    --

    Is your company running tools written by ma
    1. Re:Free software + education == BAD IDEA! by Anonymous Coward · · Score: 0

      one reason Mac's have a good track record is they used to sell their puters to schools dirt cheap so that kids would learn on a Mac, then later in life, they would buy a Mac cause its what they knew.

    2. Re:Free software + education == BAD IDEA! by pubjames · · Score: 2

      When you teach them to use software that is completely irrelevant outside of school, you are crippling them for life

      Don't you think this is a tad, erm, extreme? You think that using StarOffice (or whatever) instead of MS Office is going to mean that they are going to have big problems when they start work? Is MS Word really that different to be "completely irrelevant".

      Anyway, school is about learning, not training, at least not where I come from. If an employer is unwilling to send new young recruits on a course to learn MS Office (if that's what they use) then they will have badly trained staff - the employers fault, not the schools.

    3. Re:Free software + education == BAD IDEA! by Anonymous Coward · · Score: 0

      There is a very important reason that Linux has stayed at about .25% of desktop market share: it makes a crappy end-user desktop.

      During its initial days, both Windows and Macs were crappy end-user desktops. However, through brilliant marketing moves on Microsoft's end, Windows became a desktop powerhouse. The problem isn't that Linux is any worse than Windows or Mac OSes, it's the fact that they don't have enough coverage. Until Linux is used on a regular basis by school students, Microsoft will maintain its stranglehold over the desktop market.

      We need to work to show educators that, in many ways, KDE is a much better desktop system than any Microsoft system. GNOME, on the other hand, I could take it or leave it. Once we demonstrate that, except for the "intimidating" messages at bootup, a Linux system running KDE is just as easy to use and more secure than any NT/2000 server, Linux will begin to catch on more.

    4. Re:Free software + education == BAD IDEA! by phlako66 · · Score: 1

      Totally agree. It's belittling to students intelligence to think that they can't go from Star Office to Word. I mean really - a word processor is a word processor is a word processor. If you're familiar with the tropes of one you can pretty much rest assure that you can figure out the next one. I don't buy this argument at all and in fact think that open source software actually in the long run may encourage *more* students to really see the power of computing is underneat the hood and not just in all the pretty widgets to click.

    5. Re:Free software + education == BAD IDEA! by Chuck+Messenger · · Score: 5, Insightful

      When you teach them to use software that is completely irrelevant outside of school, you are crippling them for life as they have to retrain themselves on all the applications that school had taught them in order to use something as commonplace as Office.

      Crippling them for life? By teaching them something? Kids are smarter than you give them credit for. So are adults.

      What kids need to learn about computers is not what keystroke combination does what in Application X. Teach them the principles of computer operation.

      Open source, in my opinion, is of immense use in education, precisely because it is open. Students can not only learn to use apps, but can delve as far into the system as their curiosity takes them.

      Schools should not be vocational training centers (for the most part). I mean, sure, there could be a Microsoft Office class, to learn how to use that software suite. That would be a vocational class, and it could have its place. But it shouldn't be the focus. Schools should not be fundamentally vocational.
    6. Re:Free software + education == BAD IDEA! by RedRun · · Score: 5, Insightful
      Because, like it or not, high school is, for most, valuable job training before they leave high school and enter the work force, be that as secretaries using MS Office or accountants using Excel, etc.

      How horribly untrue. For many, if not most, high school is a path to college. We shouldn't be teaching kids the ins and outs of whatever is the hot topic of today, because that can change quickly. When I started high school (1992), we were still using DOS. Not terribly valuable today. We should be teaching them how to learn. This would involve exposing them to as many computer interfaces as possible (Win, Mac, Linux), so that they learn the basin functionality of an interface and can learn a new interface relatively quickly. By limiting them to one single interface style, they have trouble understanding the difference between the operating system, the interface to that system, and the software that runs on it. Not to mention the numerous administration headaches that would result from your everyday highschool computer teacher trying to figure out Linux, let alone teach it. I personally could not imagine my glorified typing teacher in high school comprehending file permissions, much less understanding something as arcane as TeX or vi.

      There's no reason a teacher would have to use TeX or vi. StarOffice would do quite nicely as a word processor/spreadsheet combo. It has all the functionality a school could want. All in all, its probably a better idea to stick with something like Macs which have a proven track record in education as well as most of the common office applications that can be found on Windows computers as well.

      It's that kind of attitude that keeps our schools impoverished and our kids learning-impaired. If we showed them three different word processors, they would realize that they all do pretty much the same thing. Suddenly, they learn that change isn't scary. They learn how to adapt, and become more dynamic students. They learn that computers are just machines that follow instructions, and can be changed to suite the user's need. Those skills are way more important than knowing how to set a page break in Word XP.

    7. Re:Free software + education == BAD IDEA! by Morgoth_Bauglir · · Score: 1

      what?

      Do Win95 users need to understand the registry?

      Why would Linux users, in a gui, need to understand any of the "problems" you suggested.

      A gui is a gui. Some are prettier and better designed. But come on, point and click. Everybody uses it.

      I seriously doubt that school systems are using computers for TeX and vi. I doubt anyone sees a MS command line anymore in a school system, why would they have to see bash?

      mouse click FILE->Print works the same in Linux as it does in MS OSs.

      I used Word and WordPerfect (5.1 in DOS and 6 something in a gui) simulataneously for a couple of years, and remarkably, I did not die.

      If a person is going to become incapacitated because their new job uses a different GUI, perhaps they should look for a job that doen't use a computer.

    8. Re:Free software + education == BAD IDEA! by Anonymous Coward · · Score: 0

      Unfortunately, most kids figure out fast that the 'educational' equipment in school is NOT what they want to use outside of their school life.

    9. Re:Free software + education == BAD IDEA! by Cybersiren · · Score: 2, Informative

      Oh dear.

      I learned to use a word processor on a very strange old Amstrad. Then I worked on macs for a while. Then I had to switch to Windows when I went off to university.

      Now, I am comfortable using basic office software at an intermediate/expert level under mac, windows, linux, and am confident that I could learn to use basic office software under any given OS.

      Teaching to one set of office software is pointless. Eventually it will be outmoded, whatever it is. Teach kids to be comfortable with computers, and comfortable teaching themselves to use new software. It'll do them much more good than harm in the long term.

    10. Re:Free software + education == BAD IDEA! by W.+Justice+Black · · Score: 1

      Simple rebuttal: Sink or swim!

      While it is true that students should be learning general classes of applications to get work done, it is not written in stone that they have to be Office on Windows. If the students learn the apps well enough, there should be no problem going to the next app suite.

      During my years of school, I've used AppleWorks (on a IIe), Word on a Mac, WordPerfect on DOS, Works on a PC, and Office on a PC. The fact that I started on AppleWorks specifically had absolutely no effect on my ability to pick up Office. It's vastly more important to know that a spellchecker exists and to look for it than the keystroke combination used to conjure it up.

      Schools are there to teach general concepts and algorithms that will stick with you for life. In the computer world, they can do that with MS Office or StarOffice equally well. They can teach programming with GCC or Visual Whatever equally well. If the point were really to make a seamless transition into the real world without some capacity for independent thought and ability to figure things out, megacorps would be running all the schools (Intel presents Andy Grove Elementary School) and employing all the graduates. In fact, this may happen someday (there is already something of a trend there). We can only hope that it won't come to fruition.

      Honestly, if you can't figure out how to print from Word when you can do it in StarOffice and have no other particularly special skills (i.e. you're a general office worker), you don't deserve a good job. Figure it out or take a class at a private institution (who will have the money to spend on licensing software). If you have special skills such that the company wants to keep you anyway, make them pay for it, instead of the taxpayers.

      Arguing that we must use Office in schools because "it's the standard" is similar to the argument that millions of schoolkids have tried to use to not learn long division: "But real people just do it on a calculator anyway. Why do I have to learn it?" The fact is that schools are trying to teach concepts to open minds and make them better able to handle concepts. Running a relatively stable group of applications on a stable OS is vastly more useful than training a bunch of kids to run screaming in terror when something not in their tiny world hits them in the face (oh no! This is Office 2000! I only know Office XP!).

      If the kids complain, so what. If the parents complain, explain the costs involved and what you're trying to teach (concepts, not brand loyalty). If the parents don't agree and care enough, they will change the policy and pony up the money to do so. More likely, they care more about sports and music programs, as well they should. If this weren't the case, there wouldn't be any schools left teaching ClarisWorks or WordPerfect (and there are).

      --
      "Time flies like an arrow; fruit flies like a banana." --Groucho Marx
    11. Re:Free software + education == BAD IDEA! by Unknown+Lamer · · Score: 2

      People use what they know and are taught what is in the marketplace.

      So, if you teach people Free Software, they will use Free Software. And when they use Free Software, their kids will be taught Free Software. Or, you can continue the vicous cycle where you learn MS Office because that is what is used in the world, and because you know it you use it, and because that is what is used in the world your kids learn it...

      --

      HAL 7000, fewer features than the HAL 9000, but just as homicidal!
    12. Re:Free software + education == BAD IDEA! by SloppyElvis · · Score: 1

      I must disagree with your statement to the effect that while Free Software would be innappropriate for desktop training at schools, it would be ideal for training in Computer Science and Engineering.

      When I was in high school, the main computer lab was used almost exclusively for such training, there was another lab of computers to be used for word processing, learning apps, etc.

      *nix OSs would be wonderful tools for high school students to learn to administer their computer networks or learn to write useful, reusable, and platform-independent code from the start (given the ease of linking processes in *nix style OSs, I could imagine higher level students working on components of a real program, not just 'hello world').

      We have high school students working on second semester college calculus, but we are afraid they won't understand how to use a hash table, nor do we concieve that they could apply their knowledge of matrix math to interesting problems in computer science (teach them OpenGL, I say, that would spark interest, I guarantee). Instead, teachers of CS try to use windowing to get students involved and interested. After all, then the students get to see their work as a "real program", right? Such a tactic is not in the best interest of the science. Most of the real work in a program is done beneath the hood; simply teaching kids to write GUI code is a diservice to them and to the science.

      Many will say the slow pace of CS instruction is a condition of the lack of qualified instructors and this is perhaps true (if you don't think the pace is slow, then explain to me why it took our school three years at an hour a day to get to linked lists? All of us geeks were so beyond the level of instruction that class became a second study hall) However, while computers may confound a good portion of the masses today, this will not be the case in the future. As the science matures, general knowledge of the subject will spread and qualified instructors will be more abundant.

      If schools are resigned to teaching kids using Microsoft Visual Studio, they are going to suffer in not understanding the underlying mechanisms of windowing, figure a wizard will always write that stuff anyway, and be subject to Microsoft's idea of the best architecture for a program (Document/View?, don't get me started).

      So you say, well, you can do all of things I promote on a windows box, can't you? Sure, and as long as you don't need to pipe between more than two processes, you shouldn't have too much trouble. My point is, why spend the money if you don't have to? School budgets are tight, and monies would be much better spent on competent instructors than idiot-proof windows boxes and licenses. Limiting the machines in a teaching lab to windows doesn't make sense. Old windows machines can be recycled by loading them with free *nix-style OSs, at no cost. We do that here at work; a 133MHz machine is suddenly useable again! (Here's a thought, teach HS students to build a cluster out of "obsolete" machines). Also, with only windows boxes available, will students appreciate the reason open standards help forward the science, or will Microsoft be responsible for forwarding the science?

      IMHO, CS classes should be paced with mathematics classes at the high school level. Teach our kids critical analysis skills and emphasize the power of the concepts taught them. Most important, give them the proper tools for the job, and if one of those tools is available at no cost, then using it is a no-brainer.

    13. Re:Free software + education == BAD IDEA! by cavemanf16 · · Score: 2
      Unfortunately, most kids figure out fast that the 'educational' equipment in school is NOT what they want to use outside of their school life.

      Which is exactly why the original thread about how MS Windows was so great for education was so off base. Is it the easiest to use? Yes. Does it have the most applications and games available for it? Yes. But all of this doesn't mean that you shouldn't use Linux in the classroom. The cost savings are what really matter here. Linux is free, as are many programs for it. Windows and Mac OS X, are not. Period.

      If the kids don't like Linux, then fine, they can use WindowsXP at home on their own. My private school had Mac's and Apple IIG's back in the day too, but I didn't like them. So what, I still learned some simple computer operations on them, and used the budding new Windows PC at home. The tools will not make or break the students, the student's willingness to learn will make or break the student. Therefore, for your school's (and most importantly, teacher's) sake, why not save some money on the tools and use a free tool like Linux? No one NEEDS a $200 government-priced hammer, after all.

    14. Re:Free software + education == BAD IDEA! by SoftwareJanitor · · Score: 2

      Because, like it or not, high school is, for most, valuable job training before they leave high school and enter the work force

      Actually I don't believe that is true. I think that most high school graduates go on to attend some form of college. I don't think that a very large percentage of kids learn enough in just high school to get a good enough job that they would be using a computer much. If you only have a high school diploma you are probably going to be stuck flipping burgers, hammering nails on a construction site or bagging groceries rather than working in an office.

      And as for children learning one software package and it having no applicability to the "real world" unless it is the exact package that they will encounter later -- I don't buy it. There isn't that much difference between one GUI word processor and another or one GUI spreadsheet and another. Or for that matter one desktop environment and another. Just about all of them have some kind of pop up application "start" menu, and icons on the desktop you can click. Just about all applications have a menu bar, tool bar, etc. If you know one, you can figure out anything else in a short period of time.

      As for your assertation that Linux makes a crappy end-user desktop, I think it is largely a myth based on people being told that and not really taking the time to look for themselves. While your typing teacher may not be able to figure out a command line or power user tools like TeX and vi, she probably wouldn't have much more trouble figuring out how to use KFM/Konqueror and StarOffice than Windows Exployer/IE and Microsoft Office.

      As someone who uses a KDE desktop on a daily basis, I just can't agree with you about free software not having its place on the desktop. Even some of my Windows using coworkers are using StarOffice instead of Microsoft Office because there is no reason to spend a lot of money on something they don't use all that much.

    15. Re:Free software + education == BAD IDEA! by DrCode · · Score: 4, Funny

      By your reasoning, I'm only qualified to work in jobs that require a sliderule.

    16. Re:Free software + education == BAD IDEA! by Trekologer · · Score: 2

      Because, like it or not, high school is, for most, valuable job training before they leave high school and enter the work force, be that as secretaries using MS Office or accountants using Excel, etc. When you teach them to use software that is completely irrelevant outside of school, you are crippling them for life as they have to retrain themselves on all the applications that school had taught them in order to use something as commonplace as Office.

      Would any lessons learned on Office 97 become irrelivant when Office 2000 came out (and the same for XP)? Microsoft reworks the interface with every new version. Does someone taught on a new version need to be retaught?

      Of course not. If the students are taught properly, then they should be able to go from one version to another, one program to another. A word processor is a word processor, regardless of the platform or package.

      As Linux matures and administration becomes less complex, the savings of not having to buy licences to Microsoft software becomes clear.

      A little side note here... The reason Microsoft wanted to "settle" with the government by giving away software to schools is to prevent this from occuring. They'd put themsleves on a level playing field with Linux by taking cost out of the equation.

    17. Re:Free software + education == BAD IDEA! by Tasty+Beef+Jerky · · Score: 0

      The cost savings are what really matter here.

      Just because something's free doesn't mean it's the best choice. While "Walt's Rusty Scrapheap Playground Set" may be rather inexpensive, I'd rather not have my children dangling over crushed cars, broken water heaters, or old lockable refrigerators.

      --

      I'm the tasty treat nobody can resist!
      IM Me! AOL IM:Tasty Beef Jerky

    18. Re:Free software + education == BAD IDEA! by Karl+Cocknozzle · · Score: 1
      Because, like it or not, high school is, for most, valuable job training before they leave high school and enter the work force, be that as secretaries using MS Office or accountants using Excel, etc. When you teach them to use software that is completely irrelevant outside of school, you are crippling them for life as they have to retrain themselves on all the applications that school had taught them in order to use something as commonplace as Office.

      If you're hiring high school graduates, chances are you aren't hiring for accounting. Frankly, I wouldn't hire a secretary with only a high school diploma, either. After all, secretaries are often called upon to write letters for their employers. So far, I haven't met anybody who could put together a coherent thought (in writing) without at least some college coursework.

      I also don't see how having MS in the workplace makes Linux wrong for schools. 90% of the people using MS Office never use 90% of the features. The 10% of the features used by this supermajority are found in products like Star Office, OpenOffice.org or (Insert your favorite non-MS word processor here).

      Many people who argue against Star leave neophytes with the impression that Star Office lacks basic functionality when what it really lacks is excessive bloat: Features that are useless to most users, but that all users must pay for when buying Office.

      If MS-Office (any version) stripped out the bloat (and hadn't paid to develop the bloat) I bet they could make a profit selling it for $100. (Instead of the $400+ it costs now...)
      --
      Who did what now?
    19. Re:Free software + education == BAD IDEA! by Anonymous Coward · · Score: 0

      You close-minded fool.
      Damn, check out all those replies. You got fucking OWNED!

    20. Re:Free software + education == BAD IDEA! by goldspider · · Score: 0
      "Students can not only learn to use apps, but can delve as far into the system as their curiosity takes them."

      I can picture it already: a clueless teacher who unwittingly gives all of his high school students root access, only to wonder why nothing works after a day of curiosity-exploring.

      --
      "Ask not what your country can do for you." --John F. Kennedy
    21. Re:Free software + education == BAD IDEA! by edack · · Score: 1

      Opps,

      I have 4 kids aged 5-16 and ALL are equally comfortable on Linux, Win98 and Apple.

      My school system uses Apple in K-5th grades and Wintel for 6-12th. I read these comments an think back to the old days when Apple dominated the schools and IBM dominated in business. All those kids learned on Apple, moved into Corp America and are now on Wintel stuff. No problems seen. People can and will adapt to whatever you have to give them. Granted all the 5&6Yr olds do is games but they have logons to my Lixux box, they have figured out how to customize their display and have even shown a preference for KDE or Gnome

      My kids learn MSOffice at school and then come home and use StarOffice or Koffice (their choice) for their homework. No problems and no complaints about missing features either.

      School is about learning not rote memorization

  24. Here in Seattle, at GHS by Anonymous Coward · · Score: 1, Informative

    We've installed Linux to save us money. We're involved in a charity program that sends computers to developing countries (called C4W), and we usually install Windows. To set up a Windows OS that would run on the latest batch of them would require that we purchase XP for each of them then buy a license to downgrade XP to 98 (they were too old to run XP). Instead, one of our resident Linux experts installed Debian on all of them. I don't know how it turned out for the recipient, but it saved us a lot of money.

  25. StarOffice is being used! by Anonymous Coward · · Score: 5, Interesting

    Where? Moose Jaw, Saskatchewan, Canada.

    For those of you who don't know MJ is a city of about 30,000. My girlfriend's little sister (gr 3. I think), needed to write a letter one day when she was over visiting. I said I don't have Office, but I have staroffice which is pretty much the same. "Don't worry that is what we are learning in school". I was shocked and thrilled.

    I am 99% sure that they were using a windows version of StarOffice, but it is still free.

    ~S

    1. Re:StarOffice is being used! by archen · · Score: 1

      When you think about it, this actually makes a lot of sense. I mean a lot of businesses are forced to upgrade because everyone else did and the older MS office programs won't open the new formats. Schools probably wouldn't be under such pressure. Generally students just use a program for writing papers anyway. I suppose we could hope that this is the beginning of Star Office catching on. Start in the schools, then kids install it at home - no pirating required.

    2. Re:StarOffice is being used! by Jason+Earl · · Score: 2

      Microsoft shouldn't be worried about Linux, it should be worried about StarOffice. After all, people get the operating system "for free" and Linux still doesn't have the wealth of software available for it that Windows has.

      MS Office, on the other hand, is always an added expense, and it's expensive to boot. With the price of computers falling like a brick it won't be too long before the added cost of Microsoft Office doubles the price of a computer. Not only that, but there are probably more folks running Linux than folks that use a feature in MS Office that doesn't exist in StarOffice. In other words, the group of people that absolutely have to have MS Office is relatively small.

      If the Office Suite were to become a commodity market Microsoft would be in a world of hurt (which is almost certainly why Sun is funding the effort).

    3. Re:StarOffice is being used! by mgkimsal2 · · Score: 2

      With the price of computers falling like a brick it won't be too long before the added cost of Microsoft Office doubles the price of a computer.

      It already does, for low end stuff. I put together a low end system for about $500. Drive, motherboard, processor, RAM, case, etc. To install a retail copy of Win2k and Office XP (no upgrades, just fresh) is

      Office XP - standard (not professional) $479 US
      Windows 2000 professional - $319 US.

      Yes, I'm sure there are stores with cheaper prices. Even if you got them both together for $500, that's STILL doubling the price of the system. Pricing of this stuff for average Joe Consumer is all based on them "upgrading". People just starting out, who don't/can't pirate but want all the MS goodies are in for sticker shock, imo.

    4. Re:StarOffice is being used! by kesuki · · Score: 1

      My only argument with you is that $800 isn't 'low-end.' $800 is enough to buy a lot of very reasonable hardware. A $500 computer is low-end. So, if you're paying full price, it's doubling the price of a mid-range PC.
      Another thing is Microsft just wishes it could force you to pay every single year for your OS. So how long until XP activation is turned into a 'Subscription' model. "Windows will stop booting until you send a $50 payment to Microsoft." Every 30 days... "Pricing subject to change without notice..."

    5. Re:StarOffice is being used! by tomhunt · · Score: 1

      It's likely they're running on Solaris using Sun's Sun Rays. See: http://www.ssta.sk.ca/news/stv5n9.htm

    6. Re:StarOffice is being used! by osod! · · Score: 1

      Yup -- they're using it on Solaris
      We (another Saskatchewan school division) have used Star since the 5.1 days on Winboxen and now use 5.2 and 6beta on Windows, Linux and Solaris platforms. We haven't seen any reason to buy an office package for instructional use for years.

  26. Reality Check by clinko · · Score: 1

    Reality Check:

    Have any of you actually had to work in a lab full of "Easy to use" windows machines. And the people couldn't figure that out.

    Just imagine how difficult it would be if they were all linux/BSD/whatever.

    Here's why i'm jilted by this:

    About 2 weeks ago I had to argue with a girl for about 1/2 hour that should couldn't print her report on the Solaris machine she was trying to use in our lab. Then she went to the windows machine and still couldn't figure it out.

    If this does happen (open sourced schools) I REALLY feel bad for the admins. May god have mercy on their souls.

    1. Re:Reality Check by Anonymous Coward · · Score: 0

      its not that bad. a lab full of machines set up by a reasonably competant admin would have large buttons on the desktop and nothing else. 1 button for print a document, 1 button for wordprocessing, one for web browser and so on. BTW, why cant you print documents from a solaris box ? a competant solaris admin woulda installed staroffice and let her print from it.

    2. Re:Reality Check by Anonymous Coward · · Score: 0

      From one example you're willing to generalize that no students can figure out how to use a Linux GUI to get work done? Wow, are you bold.

      The admins won't have any more troubles than they would in a mixed Win/Mac lab. Once everything's been set up correctly, the students will be able to print on the lab LAN printer, and if the student use accounts are set up correctly, they won't be able to mess that config up.

  27. Although... by Anixamander · · Score: 4, Interesting

    One of the arguments (which I consider fallacious) against Macs in the schools is that kids need to be prepared for the "real world," one that involves a Microsoft OS and Microsoft applications. As Linux has yet to be embraced on the desktop to a great extent in the business world (still largely relegated to server duties), does Open Source hinder their abilities to function in the business world? Furthermore, are the support people in these schools equipped to deal with the support issues of a new platform? Linux may indeed be easier to support than its windows counterpart, but without the appropriate training (which is always hard to come by when delaing with public school funding) it may be difficult.

    Ideally, schools would shift their software budget to a training budget to bring their support gurus up to speed. And the children would gain a comfort level with technology, though not necessarily the technology they will be using in the real world. Unfortunately, I have more questions than answers here.

    I'd be interested in hearing a reasoned response to my questions. Dogmatic zealots need not apply.

    --
    Do not taunt Happy Fun Ball(TM)
    1. Re:Although... by Anonymous Coward · · Score: 0

      My teenage daughters are well equipped to use any computer. The trick is to expose them to many different types of os and software. Have you ever seen the so called computer expert look absolutley dumbfounded when sat in front of a MAC? The idea is to teach principles and common things that all computers and software have. Try installing a linux box at home and get them using several different window managers, themes etc. What happens is they adapt to any situation they are faced with. By limiting them to one OS and software made by one company you not only further MS's obsene monopoloy, you make them afraid to try anything else. The PC is only 20+ years old. The world and technology are going to change drastically by the time a teenager reaches 30 so what exact OS they are taught from is not going to matter as much as you think.

    2. Re:Although... by DrEldarion · · Score: 2

      This is EXACTLY what I was thinking. The whole point of putting computers in schools is to get kids aquainted with them and for them to get to know how to work them.

      If the computers in a certain school run Linux, what happens to those kids when they go on to higher schooling or get a job somewhere? It's quite likely they won't run Linux there, and many kids will have no clue what to do.

      It seems that with the state of things right now, it'll just cause more harm than good.

      -- Dr. Eldarion --

    3. Re:Although... by Anonymous Coward · · Score: 0

      > If the computers in a certain school run Linux, what happens to those kids when they go on to higher schooling or get a job somewhere? It's quite likely they won't run Linux there, and many kids will have no clue what to do.

      That's exactly the reason for not teaching students specifics of how to (only) use Windows, but general computer use concepts, and use Linus and Windows and Mac as examples of these concepts. Then, whatever they wind up using, they'll be able to adapt to it with little effort. Some, yes, but not the overwhelming work you've FUDed here.

    4. Re:Although... by ilsa · · Score: 1
      The "but it's what they use in the real world" argument is a complete red herring. Let's take a group of Junior High School students. They are 5-10 years away from the workforce. Now then, what OS were you using 5 years ago? I guarantee if wasn't Win98, let alone Win2k or WinXP. What were you using at work 10 years ago? Depending on your profession there might not even have been a computer on your work desk 10 years ago.

      This line of reasoning is made more pointed when applied to grade school kids, who are about 15 years away from the workforce. Of course (again, depending on your profession) you might have been using some form of Unix 15 years ago.

      These things being true, and the amount of time kids have for actually learning stuff being reduced by stuff that neither educates them or enriches thier lives, I must agree that technology training in the classroom should be concept based, not content based.

      As a disclaimer, I beleive that IBM should never have changed thier corporate motto from "THINK."

      In conclusion, and getting back to the topic of whether Open Source/Free Software belongs in schools, I certainly think the reduced deployment costs are enticing. This is particularly true in the world of software companies auditing your licenses. Furthermore, Linux has some appeal inasmuch as it introduces Unix-like systems, which have been around quite a while and show no signs of going away anytime soon. Unfortunately there is not yet (to the best of my knowledge) a lot of Linux/Unix educational software. This is obviously one of those "no software because there's no users because there's no software" infinite loops, and the only solution is for somebody to stick his neck out and be the first user and the first developer.

      --
      -- I Am Not A Terrorist.
    5. Re:Although... by The+Cat · · Score: 2

      Anyone who can "only" operate a Linux workstation or server will have no trouble clicking icons and typing Word documents.

      Now, someone who can only operate Windows presented with

      $

      ..THAT'S a problem.

    6. Re:Although... by swv3752 · · Score: 1

      Abiword sure looks like Word97. Gnumeric looks acts like Excel. Wordperfect looks like Word. Does it really matter what they use. If the students are not able to use similar programs how are they goingto be able to deal with updated programs that change the interface. If we only teach kids to click on this and that pixel, we have already done them a disservice.

      Schools are suppose to train children how to learn. Any immediate training is icing, but will be outdated in 5-10 years in any event. If you don't have flexibility, you will get passed over.

      Go get the latest Mandrake Power pack or server edition or whatever they call it now. It has GUI tools to handle Admin tasks now. They are sufficent for most tasks and when something comes up that they can't handle, the admin should have had enough time to learn the command line.

      If you don't beleive me, check out the register http://www.theregister.co.uk/content/4/23436.html

      So sue me, I'm too lazy to do html formatting.

      --
      Just a Tuna in the Sea of Life
  28. Wrong question! by bluGill · · Score: 5, Interesting

    This is the wrong question. The right question is why computers in school.

    Learning is universial, not applied. You need to learn to reading writing, and arithmatic. There is no need for comptuers in that. Sure there are some good computer programs to help there, and typing is a skill that needs to be learned, but computers are the implimentation detail, not the meat. Until you have something to do with the comptuer there is no point in having one. Young kids need to learn to write things out by hand.

    Yes computers are important to the world today, but comptuers change fast. when I first started with computers wordStar was the big program in industry. In High school they braged that we were learning the latest word processor that industry is using, wordPerfect 5.1 for dos. And at the time it was the biggest, but today everyone is using Word 2000, and looking at an upgrade to that. Teach the kids to think with whatever tool is avaiable, and you will be fine, but teach them that the tool currently in vogue is the only one to use and you do them a disservice.

    Yes I know industry has a lot of obsolete, but fast enough comptuers they would love to donate to any charity that will take them, but that doesn't mean you have to take them. A computer is a means to many good ends, but do not allow a computer to become the end itself.

    1. Re:Wrong question! by Morgoth_Bauglir · · Score: 1

      Popular software changes, but computer literacy is still increasingly a necessity.

      Granted, good software should be user friendly and require little education to use, but that's not the case yet.

      Someone needs to write that software, and those people need to be comfortable with the state of the art.

      Computer use still requires reading and writing. But computers are cheaper than the ancient alternatives.

      I'd much rather have had access to many many multimedia presentations like my children will have, than to have sat through all those horrible tape and filmstrip nightmares of my youth.

      Word Processing is a tiny chunk of computing. And word processing is probably the least necessary. Does every child's report on Dickens need a bold 6 pt title? Nope. And you didn't get that with pad and pen. And you don't need it with a computer. \n and \t are sufficient typesetting for nearly any student paper.

      I used word processors extensively for writing (in college and HS) but now I only use them to read what other people write. I write email and plain text (code) in various text editors. Emacs isn't going anywhere. Nor vi. Nor cat . Nor ed. Nor sed...

    2. Re:Wrong question! by gorillasoft · · Score: 1

      I'd much rather have had access to many many multimedia presentations like my children will have, than to have sat through all those horrible tape and filmstrip nightmares of my youth.

      I'd much rather watch those filmstrips than sit through YAPP (yet another PowerPoint presentation), which is what passes for multimedia in most classrooms today.

    3. Re:Wrong question! by Junta · · Score: 2

      So, if I understand you right, you are saying that it is better that they do everything by hand than to use a word processing application that will be outdated by the time they use it? I think the pen and paper approach is more archaic and a waste of time. Besides, the applications used by high schoolers are a lot more mature than they were in the days of Wordperfect 5.1 for Dos. The office apps of 95 don't look drastically different from today, for example.
      High school provides more than reading, writing, and arithmetic, at least beyond grade school.

      Even in grade school, "edutainment" software is a very good tool to instruct children. Besides, I think you underestimate how far high school went for you. In my Senior year I was admining a network of Sun4 systems running SunOS 4.1.3 for the school. Don't think that can be done on pen and paper... Granted, this was a very different high school than normal...

      In normal high schools, there are some curriculums that include at least rudimentary programming. In most other classes, as well as in libraries, computers serve as a good research tool. Also, even for something like learning typing, a computer keyboard is a lot different than, say a typewriter.

      Computers have become such a ubiqitous thing in our lives that it would be insane to say the kids have no business having them in school. Yes, applications change over time, but with current versions widely used and understood, companies shy away from the idea of changing interfaces drastically anymore for fear of losing consumer loyalty.

      --
      XML is like violence. If it doesn't solve the problem, use more.
    4. Re:Wrong question! by dillon_rinker · · Score: 4, Interesting

      There is no need for comptuers in that.
      You are wrong. Computers are a force multiplier for teachers; rather than one thread of instruction at a time, there can be many. For $30,000, you can get one teacher or 20 computers...do the math. (Warning - minor parental boasting ahead). I have a child in kindergarten who is learning to read. Most of his classmates are not. Why? Because the school has reading software that paces itself to the student. This is a supplement to the curriculum, not the main curriculum. The kids can learn at their own pace; those who can progress farther faster have an opportunity to do so that they wouldn't have before.

      So, this is nice and all, but why do I think it's necessary? Most of the world will work for pennies on the dollar compared to US workers. The only advantage future workers in the US will have are in the educational opportunities offered to them. The more opportunities my kid has, the more likely he'll be able to compete against coders in India.

      In High school they braged that we were learning the latest word processor that industry is using, wordPerfect 5.1 for dos.
      I assume this was in a class designed to give you a job right out of highschool; otherwise, you're correct - the curriculum designers were morons. You should have been using a multiple free word processors to study concepts common to all word-processing systems, such as cut, paste, format, etc. You should have been considering information as a stream of bytes, as in Word Perfect, or a collection of objects, as in Word. You should have learned timeless concepts, not rapidly obsoleted procedures...

      do not allow a computer to become the end itself.
      Hear, hear. I knew of a principal who bought computers for his school because he'd promised parents that their students would spend an hour a week using computers. As much as we all enjoyed playing Oregon Trail, I never learned anything from it. I certainly didn't learn anything by playing it week after week. On the other hand, I learned a great deal that remains with me to this day (though I'm not sure of its immediate applicability) when my science teacher had us spend an hour running a simulation of the process that seismologists use to measure the distance to epicenters of earthquakes, and using that information to pinpoint the epicenter of a quake. That one hour solidified in my mind everything we'd learned about earthqukes during the previous two weeks.

    5. Re:Wrong question! by BlueFrog · · Score: 1
      Hell yeah.

      This focus on skills, rather than knowledge is, I think, causing many of the problems in the United States' educational system. Kids don't learn to think, they memorize specific processes. "You just stick the right formula in; a solution for every fool."

      I've heard it said that some IT managers prefer to hire people with Mathmatics, rather than CS degrees, "because they want people who can think." For as long as there have been books and teachers, kids have been asking, "but when am I ever going to use any of this stuff?" It worries me that the educators are now asking the same question.

      Educators increasingly focus on getting students to come up with good answers. It is infinitely more important that they teach students to ask good questions.

    6. Re:Wrong question! by Anonymous Coward · · Score: 0

      Even in grade school, "edutainment" software is a very good tool to instruct children.

      Edutainment is, at best, babysitting. Kids learn through human interaction. That's what we pay the teachers for, isn't it?

    7. Re:Wrong question! by madfgurtbn · · Score: 1

      I think you have it backward. Teaching skills is a means of applying learning. You can teach "knowledge" until you're blue in the face, and the kid won't really learn it until it is applied. I agree that any specific skillset is not the ultimate goal, but I believe acquiring skills is essential to the any higher level learning because applying the learning as you go is where the real "education" takes place.

      --
      Send lawyers, guns, and money. Dad, get me out of this.
    8. Re:Wrong question! by ChristTrekker · · Score: 1

      I think that he was saying that focusing on the tool is wrong. Teach skills, not the tools. If you are spending more time showing kids how to run the spell checker in word-processor-of-the-month than you are the skills (like grammar, critical thinking, etc) then the computers aren't helping you, and you would be better off going back to pencil and paper.

      Since the 60's (at least) we've been throwing more and more and more money at education, but it isn't really improving. Do 4th-graders need an "edutainment" application on 900-MHz PCs to learn multiplication? No. Not when a $4 deck of flash cards will do the job just as well as when I was in school.

      There may be a correlation between test scores and those families that have/don't have computers. But there was a correlation in test scores to families that bought "instructional" toys for their kids, or just read books to them, too. Computers can encourage young minds to play and explore. But so can Legos, Lincoln Logs, The Adventures of Tom Sawyer, etc.

    9. Re:Wrong question! by gmhowell · · Score: 2

      Unfortunately, we largely pay teachers to babysit. (Note: wife is a former teacher.)

      With various standardized tests and curricula, there is little room for teachers to go beyond the text. There is little time for human interaction.

      In a perfect world, teachers would be paid to teach. Supposedly they are; in reality, they are paid to read from the state mandated (and now federally mandated) instruction book.

      --
      Jesus was all right but his disciples were thick and ordinary. -John Lennon
    10. Re:Wrong question! by Monkey · · Score: 1

      I don't know about you, but when I was in K-12 school, I spent a lot of time sitting bored stiff at a desk listening to an equally bored teacher recite a lesson. This was a hell of a lot less productive than messing around with some the educational software we had installed on the classroom computers.

    11. Re:Wrong question! by GMontag451 · · Score: 3
      Disclaimer: All three of my parents (father, mother, and stepmother), as well as two of my grandparents, have been teachers. So you might say I am kind of biased.

      For $30,000, you can get one teacher or 20 computers...do the math.

      One teacher is worth infinitely more than 20 computers. COMPUTERS ARE NOT TEACHERS, period. And I find it sad that $30,000 can get you one teacher anyway, teachers are paid way too little.

      As for your earthquake example, your science teacher could have done a simulation of that same process with a couple seismograph readings, and a class set of compasses and maps. This would have saved tons of money, or at least freed up the computer lab for some other class that actually needed it.

    12. Re:Wrong question! by aardvarkjoe · · Score: 2
      I have a child in kindergarten who is learning to read. Most of his classmates are not. Why? Because the school has reading software that paces itself to the student.


      Um. We've had ways of teaching kids how to read that paces itself for much longer than computers have been around. It's called a library. You set the kid loose, and he finds something appropriate to his level.

      --

      How can we continue to believe in a just universe and freedom to eat crackers if we have no ale?
    13. Re:Wrong question! by johnlenin1 · · Score: 1

      I agree with you totally. The funny thing is, every time I have this discussion with non-tech inclined friends, they absolutely insist that computers are necessary for kids to learn. If you are taught to think, then a computer becomes a particularly useful tool. If you are taught to think side by side with a computer, the danger that you'll become dependent on it is great, I think. Just as pencil-and-paper math skills decline with dependence on a calculator.

    14. Re:Wrong question! by SIGFPE · · Score: 2
      Computers are a force multiplier for teachers

      Is that why the US has the highest standard of education in the world? Because it has the greatest number of computers in the home and schoolroom?
      --
      -- SIGFPE
    15. Re:Wrong question! by bADlOGIN · · Score: 1
      This focus on skills, rather than knowledge is, I think, causing many of the problems in the United States' educational system. Kids don't learn to think, they memorize specific processes. "You just stick the right formula in; a solution for every fool."

      This is the way it's always been. Someone somewhere comes up with a cannon of material and it's downloaded into skulls so that K-12 is all nice and homogonized. It's only getting worse. In Washington state, it's become the yardsick and my wife (a highschool English teacher) has been forced along with others into dealing with the a nasty state mandated exam. There's no room for critical thinking when you have facts to memorize.

      I've heard it said that some IT managers prefer to hire people with Mathmatics, rather than CS degrees, "because they want people who can think."

      Hahah:) Ahhh... not quite. IT managers hire people with Math degrees because they tend to have the same discrete math, logic, and problem solving skill set as the CS degrees. Of course, they'd rahter have the CS degrees, but they command too much money and would rather CREATE technology (software, firmware, whatever) than be chained to a pager 24/7 fixing crap for a bunch of tech-illiterate suits:)

      Educators increasingly focus on getting students to come up with good answers. It is infinitely more important that they teach students to ask good questions.

      Unfortunatly, the "educators" that make the decisions on course curriculum are the equivalent of government middle-management *SHUDDER* and have no interest in doing anything but paying lip service to anyone who interacts with them. There are all of these fools out there with thier "Masters in Education" who couldn't stand up and teach a classroom of students for a one or two week unit let alone for a quarter who end up running things. Asking questions means challenging authority, and in the modern educational process this is not allowed.

      Short of your confusion over Math majors in IT, I agree with your overall statement. However, computers in the classroom or no, the only thing that is going to give the American Educational system a fighting chance is privitization. There is no incentive for the system to fix itself, so solving the problem will require an outside force.

      --
      *** Sigs are a stupid waste of bandwidth.
    16. Re:Wrong question! by johnnyb · · Score: 2

      Actually, _programming_ is a skill that helps thinking. It helps you learn to break problems down into discrete manageable steps.

    17. Re:Wrong question! by The+Cat · · Score: 3, Funny

      For $30,000, you can get one teacher or 20 computers...do the math.

      Or the administration can renovate the conference room in the elegantly appointed downtown offices.

      Given these choices, I think that the newly-retired teacher will be starting a computer sales business while the administration decides between the walnut or mahogany paneling.

    18. Re:Wrong question! by johnnyb · · Score: 2

      _Programming_ actually is kind of a universal. Learning to program a computer helps people understand many things about logic, sequence, and other stuff.

    19. Re:Wrong question! by Ioldanach · · Score: 1

      $30,000, you can get one teacher or 20 computers...do the math.

      Going over to thenerds.net and piecing together a basic computer, assuming about 24 computers (so I can scale the costs to bulk easier), I can put together a computer suitable for the classroom for about $385/each. That means for 30000 I can get you 60 computers, with nearly $7000 left over for networking and a server to put all the kids' accounts on, so they can log into any machine and see the same data. That's 3 full classrooms of machines at a cost which'll probably reoccur every 5 years, so if the pencil pushers can figure it out, that's about $6000/year for 60 computers. (AMD Duron 950,128MB,10GB,56xCD,10/100eth,snd&vid on mb, 15"Monitor w/spkrs)

      Of course, if there's no teacher, the whole concept of buying computers would be rather moot.

    20. Re:Wrong question! by cronio · · Score: 1

      I agree with you mostly, but your argument about your kid is rediculous. I learned to read in kindergarten too...without computers. There are these things called books, you see, and they have words in them just like computers do. Each set of books was a different reading level. I learned to read at my own pace, because I could choose what I wanted to read. I had that opportunity (and many did before me) long before I ever had access to a computer.

      Just because some kindergartens (the one you went to maybe?) don't have the right materials, doesn't mean the only way to do something is by computer. Let's see, $800+ for a computer, or $80 for a set of 40 books...

      --


      My plan is to pimp before they realize I'm a jackass. Hit 'em hard and fast.
    21. Re:Wrong question! by MrResistor · · Score: 2
      I have a child in kindergarten who is learning to read. Most of his classmates are not. Why? Because the school has reading software that paces itself to the student.

      I was reading at the 1st grade level when I started kindergarten, as were 90% of the kids that went to my preschool. Not because we were super genius kids, but because one middleaged woman named Norma decreed that all the kids would gather together for 5 minutes a day and sing the alphabet song twice; once the usual way and once phonetically (making the sounds rather than saying the names of the letters. Try it sometime. It sounds awkward and silly, which of course means kids love it) while following along on a big alphabet chart stapled to the wall. The younger kids picked it up from the older kids by hearing it everyday and could usually sing the whole thing in a couple of weeks. In the process they began to make the connections between the sounds they heard every day and the arcane symbols that make up our writen language, the first steps toward reading and writing. If we wanted to read and had trouble with a word, we asked for help, but that usually happened at home rather than at school. No computer necessary, easily repeatable in any school environment.

      Please don't think I'm belittling your childs achievment. He's obviously doing very well with the tools he has available and the system he has been put in. But also don't think the computer is some magic cure to the ills of our educational system. Kids are ready to read at around 4 years old, the problem is that nobody's really trying to teach them.

      Other than that I totally agree with you.

      --
      Under capitalism man exploits man. Under communism it's the other way around.
    22. Re:Wrong question! by tsm_sf · · Score: 1

      This is the wrong question. The right question is why computers in school.

      Makes Comp Sci classes just that much easier...

      --
      Literalism isn't a form of humor, it's you being irritating.
    23. Re:Wrong question! by crucini · · Score: 2
      This is the wrong question. The right question is why computers in school.

      I agree, and I think the real answer is that there is little or no legitimate role for computers in class. I do think there should be ample computer labs for kids who wouldn't otherwise have access to computers to play around with. The bottom line is that schools are already doing a lousy job teaching the minimum knowledge that underpins civilization. People come out of high school pathetically ignorant, aliterate and unable to form a valid sentence. I don't see the point in taking up more of the school day with trendy computer stuff which kids can learn on their own time (I did.)

      None of the good programmers I know had significant interaction with computers in school (excluding college). We learned on our own. It's far more important to know reading, writing and arithmetic.

      I think an educated, alert teenager of 1901, if transported by time machine to our era, could easily learn how to use Microsoft Office. But his counterpart of today, if transported back to 1901, would have no hope of keeping up with the more intensive curriculum.
    24. Re:Wrong question! by Anonymous Coward · · Score: 0

      One teacher is worth infinitely more than 20 computers. COMPUTERS ARE NOT TEACHERS, period.

      But one teacher and 20 computers is worth more than two teachers and no computers.

    25. Re:Wrong question! by dillon_rinker · · Score: 2

      Um yourself. Perahsp you missed the point of my example? Or do you know some magical way by which libraries help kids who don't know what sound "k" makes? :)

      Moving on to your point, though - pacing older kids. I'd assume that you, like I, learned a lot by reading books from libraries, and that the reading and fun of learning was motivation enough. News flash - not everyone is like you and me. How do you motivate someone to learn who does not have an intrinsic desire to learn? How do you reward them for learning? Computer games are a great way. There was once a little girl (about 9, I think) who created a Logo program to make a very complicated geometric figure. It took her a while to make it look just the way she wanted. A visitor asked her what she thought of math class. "I hate math," she replied, while the turtle went through its geometric gyrations. She thought she was playing with an immense toy; she had no idea that she was learning "math" - but she was.

    26. Re:Wrong question! by dillon_rinker · · Score: 2

      Yup. (More bragging ahead). I had my son adding at three, and I'd started to teach him phonics when I re-evaluated what I was doing. I don't believe that you learn everything you need to know in school; they teach you reading, writing, arithmetic, and some other stuff, but there are other important things to learn. I decided to concentrate on those other things. I did not want him to be too far ahead of other students and get bored; I had that problem. School was easy for me, and thus it was not good preparation for life, which is not easy. I decided that it would be easy enough for him anyway without my adding to his problems.

      On the other hand, if we'd decided

      But also don't think the computer is some magic cure to the ills of our educational system
      Correct. However, let me take an analogy from carpentry. Circular saws don't build houses. Pneumatic nailers do not build houses. They make it much easier and faster to do so, though. Neither will make up for a stupid carpenter; in fact, they can make the final product worse.

      Computers are a TOOL, a useful and powerful one. They are not a magic fixall and we should not put them in schools because we think they are. But neither should we remove them from schools, or prevent their deployment there, because we know they are not magic fixalls.

    27. Re:Wrong question! by dillon_rinker · · Score: 2

      One teacher is worth infinitely more than 20 computers.
      Yes. Let me suggest an analogy...one combat soldier costs about as much as 20 rifles and ammunition loads. But would you rather have 20 soldiers with rifles, ammo, and grenades, or 21 soldiers? Weapon systems force multipliers - they make your people more effective. I would suggest that the same is true of teachers and computers.

      COMPUTERS ARE NOT TEACHERS, period.
      They are also not typists, but they make typists more effective. They are not accountants, but they make accountants more effective. They are not lawyers, but they make lawyers more effective. They are not network administrators, but they make the admins more effective (ever pore through a stack of hardcopy logs? Ever do a search for a single IP address?)You see my point?

      My point was not that computers could replace teachers (they can't), but that they were a cost-effective method of augmenting existing teachers. A teacher with several computers can accomplish more than a teacher alone. 1 teacher + 4 computers = 5 threads of instruction. You couldn't get a teachers aide for the cost of 4 computers (amortize over three years).

      teachers are paid way too little
      No offense, but I disagree. I believe that most teachers are paid...exactly what they're worth. I observed very little excellence in the teachers I've taught with (I did mention I'm a former teacher, right?) Many taught because they got summers off, or they weren't good enough to do anything else, or they didn't have the ambition or imagination to do anything else - the only careers they saw growing up were teaching and whatever their parents did. Of course, many teach for love of the students and the subject; sadly, these are a minority. I left teaching and am making more now, five years later, than I ever could have as a teacher - and I would have needed three more years of school and 25 years of experience to max out the pay scale and come close to what I'm making now. I think if pay scales were higher, the schools would be able to weed out the poor-quality teachers and retain better ones. I don't include myself in the latter category, BTW; I was a lousy teacher - I had no classroom control (ie discipline) skills and didn't want to make a go of it after the first year.

      As for your earthquake example...I'd estimate that it'd take an entire class period to do one or two simulations. We spent half an hour on it and did about six. We had the seismograph readings on screen. We had to measure the different types of waves, determine when they arrived, and calculate the distance from that station to the epicenter. We didn't need manual dexterity; the computer did the plotting. We didn't need good arithmetic skills; the computer did the calculations (there are pros and cons to this, I'll grant, but it can be useful to permit the person who is lousy at math to be successful at something else; success at science can lead to a love of science which can lead to motivation to learn the math that science requires, while frustration in math AND science produces nothing). We were able to focus on the objective: studying how seismologists pinpoint earthquakes. Furthermore, the computer was able to generate a unique problem for each student, so it was impossible to copy off of someone else; this had the side benefit that no one was pressured to give someone else the answer. Overall, I'd have to conclude that it was an effective use of the technology, and it was better than the low-tech way of doing it. You really should trust my opinion on this, because I was there and you weren't.

    28. Re:Wrong question! by dillon_rinker · · Score: 2

      I learned to read in kindergarten too...without computers.
      Me too. Hmm...if what's in the past will work now, too, why stop at 20 years ago, with no computers? 200 years ago, no pencils, no pens, no erasers, no slates. Not too many books teaching five-year-olds to read, for that matter. 2000 years ago, not much of anything. Not too many were literate, in fact, yet society seemed to function just fine (we're still here, right? descended from people who lived then?)

      So, if I understand you correctly, you don't want anything better for your children than what you had? You think that children can learn nothing from computers? You think that a computer can't present EXACTLY the same material as a teacher? You think a computer can't present questions for a pupil to answer, then adjust future material presentation based on responses? You, sir, are completely ignorant and I will respond no further.

    29. Re:Wrong question! by MrResistor · · Score: 2
      Correct. However, let me take an analogy from carpentry. Circular saws don't build houses. Pneumatic nailers do not build houses. They make it much easier and faster to do so, though. Neither will make up for a stupid carpenter; in fact, they can make the final product worse.

      I love this analogy, because I worked in construction for several years. I knew a few carpenters that kept small chainsaws in their trucks. Certainly, a chainsaw is useful and powerful tool if you happen to be cutting wood, but is it the right tool? If you're bucking firewood, it's certainly the tool of choice. If you're framing, it may be acceptable in certain circumstances. For finish work, you should be shot for merely looking at it.

      Personally, I think that in many educational situations computers can do more harm than good, precisely because they're such powerful tools.

      You really have to think about what's best for the child. To learn to spell, or to learn how to use a spellchecker? To learn to add, or to learn what buttons to push on a calculator? I am constantly seeing (through my 11 year old brother) schools making the wrong choice, falling victim to the public excitement for technology.

      We need to take a step back and really think about the place of technology in our education system, think about how it's being deployed and why, and weigh the costs against the benefits. When I was a math tutor in college I saw far too many students, most claiming A's in math through high school, who couldn't do basic operations like multiplying by 10s without pulling out a calculator to believe that this isn't a problem; and my english tutor collegues had constant complaints about students who were totally dependant on spelling and grammar checkers.

      This really is a huge problem. Think about a carpenter who doesn't know how to use a handsaw, that's the kind of students our schools love-affair with technology is turning out. All most of these kids know is how to use the tools of today, and they lack the basic understanding they'll need to create the tools of tomorrow.

      Computers certainly have a place in education, but that place is not everywhere.

      --
      Under capitalism man exploits man. Under communism it's the other way around.
  29. Schools should switch to Linux, NOT BSD. by Tasty+Beef+Jerky · · Score: -1, Troll

    While *BSD may be appropriate for weekend hackers and tinkerers, it is entirely inappropriate for any school computing solutions...

    • FreeBSD lacks the sophisticated and user-friendly installation systems offered by the most recent distributions of Linux, e.g. those of Mandrake, Red Hat or Suse.
    • FreeBSD lags behind Linux in its adaptation to newer hardware developments such as USB interfaces, and tends to lack both kernel support and specific device drivers for such features. Linux has acquired a degree of plug-and-play functionality (e.g. it will recognise a change of network card and install the appropriate drivers with no user intervention) which is not such a high priority in the FreeBSD philosophy
    • Major companies (including Sun, IBM, Silicon Graphics and Hewlett Packard) are now making significant components, originally developed for their own proprietary Unix systems, available for use under Linux as well, mostly without licensing fees being payable. These components are not always available for FreeBSD, and if they are ported to that system, it is generally after a considerable delay and without the wide and intensive testing that Linux ports usually receive before full release.
    • Commercial support and training is becoming widely available for Linux: this is not the case for FreeBSD.
    • Since very few schools run FreeBSD, the possibilities of mutual help and advice at a school to school level are more limited than they are with Linux.
    • In the area where FreeBSD is commonly regarded as superior to Linux, the ability of its networking subsystems to cope smoothly with high demand and heavy load, the level of network traffic at which such differences become measurable is some way beyond what a typical school system experiences. In any case, improvements to the Linux network code, together with advances in the key server applications (especially Apache 2 with its use of threads) mean that the advantages of FreeBSD in this area are no longer as clear as they were until relatively recently.

    As you can see, Linux is the clear choice for any school based computing initiative. Yet another reason why...

    BSD IS DEAD

    --

    I'm the tasty treat nobody can resist!
    IM Me! AOL IM:Tasty Beef Jerky

    1. Re:Schools should switch to Linux, NOT BSD. by tshoppa · · Score: 2, Insightful
      While *BSD may be appropriate for weekend hackers and tinkerers, it is entirely inappropriate for any school computing solutions...

      Dude, you *do* know that the "B" in "BSD" is a rather famous public school?

    2. Re:Schools should switch to Linux, NOT BSD. by Tasty+Beef+Jerky · · Score: -1, Troll

      Dude, you *do* know that the "B" in "BSD" is a rather famous public school [berkeley.edu]?

      Yes, the "B" refers to the University of California - Berkley, and the "SD" refers to the University of California - San Diego. Even for them, BSD is more of a tinkerer's toy. They're about the only schools that could get away with using it. They have the development know-how right there. For any other school, the down-time alone while figuring out how to fix a problem would cost more than a site-license for Windows NT (And that doesn't even mention any of the other costs associated with getting BSD running - Man hours work, cost of supported equipment (of which there's not much to choose), etc.).

      Just because a public school created BSD doesn't make it appropriate for every other school system in the world. The Model T was created by an American, but the Model T certainly isn't suitable for every American.

      --

      I'm the tasty treat nobody can resist!
      IM Me! AOL IM:Tasty Beef Jerky

    3. Re:Schools should switch to Linux, NOT BSD. by Mayflower · · Score: 0

      Who is moderating this discussion? Interesting????? The poster is a well known troll responsible for hundreds of posts with nerly identical FUD. It's obvious that whoever moderated this post up to interesting hasn't been paying much attention.

    4. Re:Schools should switch to Linux, NOT BSD. by Mayflower · · Score: 0

      You are obviously flawed in your cluelessness.

      Plese put a gun to your head and pull. You will be doing us all a fovor.

    5. Re:Schools should switch to Linux, NOT BSD. by Anonymous Coward · · Score: 0

      Ummm... replace "Linux" with "Windows" and "FreeBSD" with "Linux"... and that sounds like a Microsoft press release.

      *scary* - is this the way that Linux is moving?

    6. Re:Schools should switch to Linux, NOT BSD. by Anonymous Coward · · Score: 0

      Yes. With one exception. The difference in quality between *BSD & Linux is greater than the difference in quality between Linux and Windows.

    7. Re:Schools should switch to Linux, NOT BSD. by Anonymous Coward · · Score: 0

      > Yes, the "B" refers to the University of California - Berkley, and the "SD" refers to the University of California - San Diego.

      [Spewing my drink here - that was hilarious!]

      BSD == Berkeley Software Distribution. UCSD, my alma mater, had no part in this.

    8. Re:Schools should switch to Linux, NOT BSD. by Anonymous Coward · · Score: 0

      "Score:1, Interesting"? Score:-1, Troll, more like it. What's with the moderators today?

    9. Re:Schools should switch to Linux, NOT BSD. by Tasty+Beef+Jerky · · Score: -1, Troll

      You think I'm Egg Troll? No sir, I most certainly am not Egg Troll.

      The only FUD to be found anywhere in any of these posts is the FUD deep in your heart where you know BSD was crap, is crap, and will continue to be crap until the end of time.

      --

      I'm the tasty treat nobody can resist!
      IM Me! AOL IM:Tasty Beef Jerky

    10. Re:Schools should switch to Linux, NOT BSD. by Mayflower · · Score: -1, Offtopic

      You sound like Egg Troll in so many ways. From your clueless statements, it's obvious that you have idea what BSD even looks like. Much like Egg Troll. Your post was off topic. Much like Egg Troll's posts. The same points in your post are those raised by Egg Troll. Your conclusion is the same as that of Egg Troll. And you have a pointed head and a deviated cleft lip just like Egg Troll.

    11. Re:Schools should switch to Linux, NOT BSD. by Tasty+Beef+Jerky · · Score: -1, Troll

      And just why do you think Egg Troll would go through the trouble of getting a new login? He could very well post the same thing under his own. Even though he's modded down to -1, he certainly still seems to get bites.

      Based on your logic, I can accurately say that there are approximately 4 users of Slashdot. Between those 4 users, there are nearly 550,000 login names distributed between them. They all post the exact same stuff over and over again.

      I'm sorry, but I am not Egg Troll. There are other independent thinkers on this board, but you obviously are not one of them.

      By the way, proofread your posts next time. You're making yourself look like an idiot with your grammer and spelling.

      --

      I'm the tasty treat nobody can resist!
      IM Me! AOL IM:Tasty Beef Jerky

  30. Who is willing to take a pay cut? by Martigan80 · · Score: 0

    As many have said you need the boxes, software, and a person to run it. It would be best to have a person seperate from the faculity to run it, BUT who? Considering the schools don't have enough money to pay the teachers right how can they pay one Linux Tech enough to keep the system running?

    --
    This SIG pulled due to lack of funding. (This damn war is costing too much!)
    1. Re:Who is willing to take a pay cut? by vorovsky · · Score: 1

      I am one of only 2 technicians in the school district I work for and just happen to have extensive linux knowledge/experience. The problem here is the other way around though, trying to convince other people that linux isn't just "some OS only those really smart people use." Plus getting _teachers_ to try to learn a different interface is worse than trying to get a squirrel to do the polka.

    2. Re:Who is willing to take a pay cut? by madfgurtbn · · Score: 1

      I'm hoping that the LTSP for education project is going to be the killer app for people's "why learn another OS" problems. One thing schools have plenty of is obsolete hardware. If we can start using the old junk as web surfing terminals we are on the way...

      --
      Send lawyers, guns, and money. Dad, get me out of this.
  31. Free? by TeleoMan · · Score: 2, Insightful

    It took me a while to figure out what this article is talking about. When the author says "free software" what he means is _not_ the same free as the FSF. He actually means "getting commercial software for free" and not "free software like Linux." The problem with this whole thesis is that I just can't imagine that it's particularly true of Linux writers, because the amount of money you save by getting a free copy of RedHat or Mandrake is pretty trivial, since you can just download them for free off the net.

    However, in the world of non-free software, where "review copies" of software can cost hundreds or thousands of dollars, it gets a lot more tricky. I have had plenty of personal experience with people (myself included!) who want to write reviews of product X in order to get a free copy. And that can definitely influence what you write...



    "I'm not joking. I'm really running for President." - Pat Robertson

    --
    $6.21 is the number of the beast before sales tax. Meh.
    1. Re:Free? by morcego · · Score: 1

      The author, if you are refering to me, meant "Free" and in Free Speach. Exactly the definition FSF uses.

      --
      morcego
  32. the real question is by nomadic · · Score: 1

    Has free software saved Christmas? It could be just like a bad sitcom (wait, maybe that jolly old bearded UNIX hacker really WAS Santa Claus). I'm not making much sense I guess, but the way the story title was phrased it made me think of bad Christmas specials. Come on, SAVED schools? Aren't we getting delusions of grandeur here?

  33. Keep dreaming. by mister_sparkle · · Score: 2, Insightful
    The sad fact is that there are _no_ open source alternatives that provide the wealth of features that Microsoft Office does. I have been using office XP, and you have to admit that it is pretty nice. Open source alternatives are so far behind that I really don't see them catching up. Besides, the rest of the business world has standardized upon MS Office. That is the de facto file format, and I don't see it changing anytime soon. Office XP on Win2000 is stable and packed with features. I think people just need to accept that software costs money, instead of looking for a free lunch.

    You wouldn't expect your teachers to work for free, but you expect highly skilled software developers to give their work away. Think again, my friend.

    1. Re:Keep dreaming. by phlako66 · · Score: 1

      Ever tried Evolution by Ximian Gnome?

      How many k-12 kids do you think need to learn Office productivity suites? Not many my friend.

    2. Re:Keep dreaming. by Anonymous Coward · · Score: 0

      Ahhh, nice, fresh, pungent smelling apologist/maybe paid astroturfer.

    3. Re:Keep dreaming. by abolith · · Score: 0

      You wouldn't expect your teachers to work for free, but you expect highly skilled software developers to give their work away. Think again, my friend.

      No you wouldn't, However they are also doing this FOR A LIVING, as thier primary income.. where as those developers are oft times doing Open source development because they ENJOY IT. it is not thier primary means of income (most of the time anyways)


      --
      if you want "No More Hiroshimas" then I say "You First. No More Pearl Harbors."
    4. Re:Keep dreaming. by mister_sparkle · · Score: 2, Insightful
      Gee, you're right, high school kids sure don't need to learn to use office productivity suites! I mean, it's not like they will ever be expected to, say, type up a document, or come up with a spreadsheet. And do you think the office they work in is going to have Gnumeric/Evolution, or Outlook/Excel? Hmm, I wonder.

      Take a hint from Ximian's frontman, Miguel. He's not a glaringly anti-Microsoft person. At least he's honest enough to admit that they've done some things right. I mean, Evolution is a blatant Outlook clone, people. Sheesh.

    5. Re:Keep dreaming. by mister_sparkle · · Score: 1

      Right, I'm saying something positive about Microsoft, so I'm an apologist. Typical Slashdot hive-mind mentality. "M$ SUKZ, LINUX ROOLZ JOO!" Yawn.

    6. Re:Keep dreaming. by mister_sparkle · · Score: 1
      And Microsoft employees aren't doing this for a living? And Ximian isn't selling subscription services? Last time I checked, the Ximian folks did this full-time, for a living. And who says you can't enjoy your work because you get paid for it

      I write software. If I gave all of it away for free, I would have no income. Are you suggesting that anyone who wants to write software has to do it in their spare time and give it away, and find another job during the day? Why is it that software is supposed to be free, but other services you have no problem paying for? I think you proved my point.

    7. Re:Keep dreaming. by SoftwareJanitor · · Score: 2

      How many people need the "wealth of features" of Microsoft Office? I can't ever get anyone to tell me what it has that StarOffice doesn't. For that matter, from what I see 90% of Windows and MS-Office users use only about 10% of those features. Not always the same 10%, but there are a lot of those features that just about nobody uses. How many of them would be happy with something that was smaller, cheaper and faster? I've been using StarOffice for quite a while, and I have to say, it has always done what I wanted. If anything the complaint I had about the 5.x versions was that it was too much like MS-Office in that it was big, used a lot of resources and was slow. 6.0 has made a lot of improvements on that in that it seems much faster, especially on startup. StarOffice hasn't failed to open up the MS Office format documents people send me (unlike some of my co-workers who were using MS Office 95 and couldn't open some documents created in newer versions of MS Office -- they've since switched to StarOffice), so I just don't see the point in paying money for Microsoft Office.

      As for MS-Office being the standard file formats, that is true for now, but unless you've got some kind of crystal ball, it is dangerous to make a prediction on that not changing in the future. If you went back 10 years, and told people that Word Perfect and Lotus 1-2-3 wouldn't be the standard file formats in a couple of years, people would have looked at you with the same kind of disbelief that you do now regarding MS-Office. If you went back 10 years further it was WordStar and VisiCalc. Things change, and few people will accurately predict the way things will be in the future, especially not those without a view of the past.

      Do I have a problem paying for software? No, if it is worth it. Am I going to pay for something I can get free? Probably not. And I certainly don't want to pay money for software that isn't worth it. And frankly, that is what I think about most of Microsoft's products, especially since it seems like their prices have gone up over the years.

      Do I expect highly skilled software developers to give their work away? No, at least not unless they want to. But do they? Yes, and I thank them for that.

    8. Re:Keep dreaming. by phlako66 · · Score: 1

      I'm not glaringly anti-Microsoft either, but as someone rightly pointed out in response to another post how many high school kids go and work in offices anyways? With just a high school diploma you're likely to be flipping burgers, or helping people at Home Depot.

      The point is that in a school if you need an office suite application then Star Office will save you heaps compared to all the licensing costs of Microsoft Office. These aren't the type of apps most schools need anyways. Take the GIMP for example, which is currently being ported to Win and works great on Mac OS X. If you had to install Photoshop for kids to fiddle around with image manipulation on 20 machines it would cost you about $10000. One macGIMP CD on the other hand will cost you $25. You do the math.

    9. Re:Keep dreaming. by mister_sparkle · · Score: 1

      Uhh, what about those students who (gasp) might want to go on to college? Or, why doom students to a life of flipping burgers, precisely because they have no other skills? This is the 21st century, people. Computer skills are not a luxury, they are a necessity. that includes being able to fire up a word processor or use a spreadsheet. The more kids we have with technical skills, the better this country is going to do. It's people who say "forget about the kids, they're gonna just flip burgers anyway" that keep this country from rising up in the world.

    10. Re:Keep dreaming. by jobob · · Score: 1

      As someone who found the cost of upgrading 4 home systems to the new version of MSoffice unaceptable, I now use Staroffice for everything I once used MSoffice for at home. I find that Staroffice more than meets my needs, in fact I just finished my year end performance wrightups with Staroffice and the company provided MSoffice template. I must admit that some of the features are hard to find at first, but it was that way in MSoffice when I first started using it too. I don't expect a free lunch, but I do expect more for my munney than MS seams to think I should get.

      --
      -- For love of family, code, and carpentry
    11. Re:Keep dreaming. by phlako66 · · Score: 1

      Student's who go to college should hopefully be able to figure out that if I click this button for save on AbiWord, it is the same as clicking this button on Microsoft Word. Technical skills might better be served using Linux systems where the actual workings of software, the operating system, etc are apparent rather than Microsoft products where the assumption is that the user doesn't want to and shouldn't have access to this stuff.

    12. Re:Keep dreaming. by Anonymous Coward · · Score: 0

      I must admit, there is a good deal of MS-bashing going on in the Slashdot posts. But as of late there are also many more anti-MS-bashing and anti-linux complains. Complaints that have nothing backing them up. Yes, many people who visit Slashdot DO use Windows. I am personally not one of them. Most people who use any time of linux distrobution do it because they LOVE the operating system. I have never once met someone that was running linux because they had to.

      For the moment everyone who uses linux is doing so by excersizing their freedom of choice. If they dont like it they can and often do go back to Windows for their desktops and servers. But once they get that little bit of the answer to "Why is everyone talking about Linux now-a-days?" they seem to be impressed by the open, free-choice, anti-monopolistic movement that they decide it is worth sticking with it (as long as there is progress).

      They help by supporting it and doing excessive testing. It's the love of the machine, not love of the name. Please dont confuse the two. Everyone has a choice and it just seems that most people on Slashdot choose the cute little penguin.

      ______________
      sig: No, I can't spell.

    13. Re:Keep dreaming. by gimpboy · · Score: 2

      i think you proved your own point. ximian poduces software which they give away freely and make their money selling services-much like redhat does. by giving away software they can attain a large userbase, at the same time they can sell services to those that require it. this enables them to provide free software and make money.

      --
      -- john
    14. Re:Keep dreaming. by mister_sparkle · · Score: 2, Insightful

      Yeah, and the money sure is rolling in for Ximian, isn't it! The whole "selling services and giving away software" thing has worked so well for people like SuSE (layoffs), Caldera, Ximian, LinuxCare (dead), Easel (dead), etc. It's a stellar business model! And free software that provides services is always undermined by some free software project that offers the same services for free. Why pay for Ximian Update when apt-get does the same thing for free? And don't tell me that "newbie users" would pay for it, because they aren't exactly running like mad to dump Windows for Linux. And for that matter, Windows provides updates for free. I still fail to see the difference between selling software and selling services. Selling software makes Microsoft evil, but selling services is OK. Of course, these are the same people who scream bloody murder when they hear about .NET and the idea of Microsoft selling services. Sigh.

    15. Re:Keep dreaming. by gimpboy · · Score: 2

      i did not mean to suggest that selling software is evil. if i gave that impression then i apologize. ximian just recently began to sell sell their services, so i think they should have their chance at failure.

      the current state of the economy is thinning up the ranks a bit in many areas, open source software companies are not excluded. business models derived from open source software are in heavy evolution by the very nature of their newness. this is bound to result in a fair number of failures.

      people new to linux are more likely to purchase boxed versions of redhat and are also more likely to look into support. i dont believe companies are looking to them for all of their revenue. i believe the corporate market is a more practicle source of revenue. for example, look at the support contracts between redhat and ibm.

      microsoft is evil in my opinion, but not because they sell software. i believe they are evil because they are monopolistic, and anticompetative. evidently there are alot of people who believe this. this is one of the many reasons people turn to opensource software.

      when your business is so successful at stomping out the competition, that your main competitor has gained its place because it is available for free-this is a good indicator that you are a monopoly.

      i've used both windows and unix (solaris, irix, linux, etc). for me the unix paradigm is prefered. granted i quite using windows over 2 years ago, after the fourth install of windows nt in the same day, died. i plugged in my roommates redhat 5.2 cd and never turned back.

      i would be lying to say that i have never had problems with linux. the community that surrounds linux is one of it strongest points and weakest. the zealotry can be a big turnoff, but a wilingness to help new users is a big turnon.

      if this zealotry has effected you negatively, then i am sorry and would encourage you to look past that at a community who are more than willing to help.

      --
      -- john
    16. Re:Keep dreaming. by blkros · · Score: 1

      My stepdaughter uses Abiword at home (on Win98) and MSWord in school. There are very few things that you can't do in Abiword, that you can in MSWord.(Like put charts into a document, I haven't figured that out yet.) She saves in RTF here and can take it to school on a floppy. Probably StarOffice would be a better program for us, but I haven't taken the time to download it yet, and last time I tried it on Linux (a year or so ago) I couldn't get it to work for me.

      --
      Damnit, Jim, I'm an anarchist, not a F@#$!^& doctor!
    17. Re:Keep dreaming. by Anonymous Coward · · Score: 0

      As much as Linux is a clone of Unix, anyway. The care and originality is in the details. Just look at the Evolution source and you'll see that it copies interface only - from a conventional 3 pane newsreader.

    18. Re:Keep dreaming. by Anonymous Coward · · Score: 0

      You can't do tables in Abiword. You can do columns. I like tables.

    19. Re:Keep dreaming. by Anonymous Coward · · Score: 0

      The death of a business doesn't invalidate a business model. Redhat are doing very well.

    20. Re:Keep dreaming. by Anonymous Coward · · Score: 0

      Office is nice. But are are the features worth the price? When you can get all the features most people ever use for free?

      Not in a school, it isn't.

  34. Offer a choice - with VNC by sunset · · Score: 1

    How about setting up a Linux box as a VNC server at some of the schools. The Windows VNC client is free and works great. Combine that with some educational material on the basics of what's good about open source software and what's not so good about Microsoft, and you're off to the races.

  35. Kabul elementary by junis+from+afghanist · · Score: 5, Funny

    I just wanted to let you know that Kabul Elementary school, which operates out of my neighbor Mustaffa's barn, has been running the new version of ISLAMIX. ISLAMIX is a revolutionary open-source operating system which Mustaffa and I developed recently for our Commodore computers. The kids at Kabul Elementary think ISLAMIX is the greatest thing since sliced camel! We will have a website soon with more information about ISLAMIX and it's many features (including Beowolf clustering in order to download and play movies from the Internet.) We are also working on porting the Katzbot to ISLAMIX, but we've not had any luck getting things to compile. It seems that our copy of endlessramblings.h may have been corrupted during the modem transfer. -Junis from Afghanistan

  36. The Free Software movement started in a school. by Anonymous Coward · · Score: 0
    "All free software initiatives in public schools have failed".

    Let us please remember that the Free software initiative started in a school. Specifically, the GNU movement at MIT. Granted, it's not a public school, but it still is an educational institution nonetheless.

    The stunning success of the GNU movement is just one more reason why more public schools should educate themselves and make use of its many advantages.

  37. h3llz y3ah! phr33 s0ftwar3 sav3d my sk00l! by Wakko+Warner · · Score: 4, Insightful

    We were gonna have to shell out MAD DOLLARS ($$$) for windows XP until me and my friends found a L33T 0-DAY KRAK for it on IRC!!!

    Now the entire library network is running XP Server!!!

    Free software r0x0rs!!!

    - A.P.

    --
    "Remember when the U.S. had a drug problem, and then we declared a War On Drugs, and now you can't buy drugs anymore?"
    1. Re:h3llz y3ah! phr33 s0ftwar3 sav3d my sk00l! by mosch · · Score: 1
      you are a bad person. stealing is wrong, even when you're stealing from the devil.

      Use truly free software

    2. Re:h3llz y3ah! phr33 s0ftwar3 sav3d my sk00l! by Anonymous Coward · · Score: 0

      first off learn how to spell this isnt some stupid ass wanabe hacker site...second off is winxp server even out yet??? to my knowledge it wont be out for a while and third you didnt save your school with xp you totally destroyed it xp is the worst os that ms has put out other than me....Ac

    3. Re:h3llz y3ah! phr33 s0ftwar3 sav3d my sk00l! by Anonymous Coward · · Score: 0

      LOL! y34h, crax r0x0r$ ur3 s0x0r$!

    4. Re:h3llz y3ah! phr33 s0ftwar3 sav3d my sk00l! by Anonymous Coward · · Score: 0

      you're the second worst os ms has ever put out?

      You suck it, dumfuk.

    5. Re:h3llz y3ah! phr33 s0ftwar3 sav3d my sk00l! by Anonymous Coward · · Score: 0

      Insightful? WTF? It's funny, yes, but advocating something that could get a school into deep shit is hardly insightful...

  38. our high school uses apache by madmancarman · · Score: 5, Interesting
    After having tons of problems with NT 4 and IIS crashing our high school's web server on a daily basis, we switched to Apache on RedHat 5.2 (about 3 years ago). Since then, we've switched machines a couple times (as better machines are hand-me-downed to us) and upgraded the Linux distro, but we've had great uptime.

    The success of our web server allowed us to push for a perl/apache/linux-based attendance system that let us get rid of scan-tron sheets to be filled in every morning. Now, our teachers open up their web browsers in the morning, log in, and they check off their absent students 1st period. In the afternoon, they can check who was here and who wasn't, and it saves us about a ream of paper per day, since we don't have to print out attendance bulletins any more. Most of the work for the attendance program was done by one of my students who was learning perl on the fly.

    I also teach a class for A+ and Network+ certifications, but we cover Linux both semesters (especially when we do network security in Network+). I'm hoping that next semester, we'll be able to use Linux as the primary desktop OS for most of the networking stuff, but we'll have to see what happens.

    There are two major problems, in my opinion: businesses want students who are proficient with Windows and Office, and schools don't have the resources to hire people who are competent Linux admins. If the demand for Linux users starts going up, then maybe the number of computers running Linux in schools will increase, but for now, it's probably limited to servers.

    One funny tidbit - earlier this school year, Code Red and Nimda running on local districts' NT/2000 IIS web servers took down the WAN access for most of the schools in Southwest Ohio. Seems that the servers weren't patched or maintained as well as they should have been. Web servers running Apache, of course, didn't have this problem.

    First they ignore you, then they laugh at you, then they fight you, then you win. -Ghandi

    --
    First they ignore you, then they laugh at you, then they fight you, then you win. -- Gandhi
    1. Re:our high school uses apache by Anonymous Coward · · Score: 2, Funny

      >>Most of the work for the attendance program was done by one of my students who was learning perl on the fly.

      How much you want to bet that this kid just happens to graduate school with perfect attendance?

    2. Re:our high school uses apache by FatHogByTheAss · · Score: 1
      businesses want students who are proficient with Windows and Office

      Fair enough. And they shall have them. Linux will never take over on the desktop, nor should it. It can take over at the server end, though. Thats where energy should be focused.

      and schools don't have the resources to hire people who are competent Linux admins.

      Meaning what? They have the resources to hire incompetent NT admins? Or that competent NT admins are cheaper than competent unix admins? Competency in systems administration has nothing to do with the systems to which you administer. You help perpetrate the myth of "Linux is hard, MS is easy" when you make this argument. Linux admin is hard to find, and so is NT admin. Thats because good administration is hard to find. NT's slick interfaces make PHB's *think* it's easy (all ya have to do is clickclickclickclick!), but that's not the same thing.

      --

      --
      You sure got a purty mouth...

    3. Re:our high school uses apache by geekoid · · Score: 2

      I think it would be really usefull if you could write down what you did, the benefits to the school, some stories about how the non-MS system sttyed running when the MS system went down.
      Include the totla cast savinges from licensing, to paper savings. Get some of the teachers to write a couple of paragraphs on what they think of the syste.
      Then send a copy to every school, teacher, and linux group you can. I would send a nice Hardcopy to the schools a teachers, and a link to a soft copy for the Linux group.
      Yes, I know its a lot of effort, but I think this is an important issue for the Nation, not just to the linux community. The cost saving and educational opportunities are huge for tax payers.

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    4. Re:our high school uses apache by Chris+Parrinello · · Score: 1

      I think what the poster was trying to elude to is that NT admins are fairly cheap because there are a lot of them. Unix (and Linux) admins are expensive because the supply is low.

      He could also mean that a school might not want to hire an NT admin AND Linux admin. It is the rare individual who has expertise in both area so what ends up happening is two people are hired.

      But that's just my take one the whole situation.

    5. Re:our high school uses apache by Cerebus · · Score: 1
      ... businesses want students who are proficient with Windows and Office ...

      I was recently ordered to a course on web page design, for inscrutable managerial reasons. The course covered basic database-driven stuff, using Microsoft's ASP. (I duplicated all the work using Perl ASP on my Linux laptop.)

      When I asked why the instructor-- who clearly had a lot of UNIX experience-- why the course was taught using MS products, he replied:

      "UNIX people can always use Windows. Windows people can't always use UNIX."

      'Nuff said.

      --
      -- Cerebus
    6. Re:our high school uses apache by Cerebus · · Score: 1

      Unfortunately, this isn't the case. Recent IT salary surveys show that UNIX and NT administrators with equivalent experience and skill draw similar salaries, with the NT side showing faster growth.

      --
      -- Cerebus
    7. Re:our high school uses apache by FatHogByTheAss · · Score: 1
      I think what the poster was trying to elude to is that NT admins are fairly cheap because there are a lot of them. Unix (and Linux) admins are expensive because the supply is low.

      And there is that popular myth again. There are lots of people that can point and click, and convince you the are "admins."

      --

      --
      You sure got a purty mouth...

    8. Re:our high school uses apache by Geekboy(Wizard) · · Score: 1

      i did the same thing (run the school's computers) and did the same thing (graduate with perfect attendance) ;-)

    9. Re:our high school uses apache by Bandito · · Score: 1

      Meaning what? They have the resources to hire incompetent NT admins? Or that competent NT admins are cheaper than competent unix admins? Competency in systems administration has nothing to do with the systems to which you administer. You help perpetrate the myth of "Linux is hard, MS is easy" when you make this argument. Linux admin is hard to find, and so is NT admin. Thats because good administration is hard to find. NT's slick interfaces make PHB's *think* it's easy (all ya have to do is clickclickclickclick!), but that's not the same thing.

      We're talking about a high school here. Most if not all of these kids have only seen Windows up to this point. I know I had when I was that age. Even if you've only used Windows at home but gotten good at it, you can do a good enough job to pass as a NT admin.

      The problem here is that a lot of people haven't been exposed to Linux at this age. Given the choice, you'd probably stick to what you know, too.

      Linux is not hard, it's not intuitive.

    10. Re:our high school uses apache by FatHogByTheAss · · Score: 1
      We're talking about a high school here. Most if not all of these kids have only seen Windows up to this point.

      That is my whole point. A kid that can navigate the Windows UI is *exactly* who I don't want administering to my enterprise systems. I don't want kids, I want professionals. There is a huge difference between the two.

      Kids in my day used to disect frogs in school, too, but we never called 'em doctors, no matter how good they were at it.

      --

      --
      You sure got a purty mouth...

    11. Re:our high school uses apache by laserjet · · Score: 2

      I did pretty much the same thing as you guys state, and I didn't abuse it much. The thing is, I may have abused it a couple of times, but I sure did learn a lot. And that is what is important.

      --
      Moon Macrosystems. Sun's biggest competitor.
    12. Re:our high school uses apache by laserjet · · Score: 2

      Excellent quote. Mind if I steal it for my sig one of these days?

      --
      Moon Macrosystems. Sun's biggest competitor.
    13. Re:our high school uses apache by Geekboy(Wizard) · · Score: 1

      heh...i only abused it once....the day before graduation, after everything was verified...;-)

    14. Re:our high school uses apache by sheetsda · · Score: 2

      How much you wanna bet he HAD perfect attendance. I am that student.

  39. SEUL.Org by 0A4h · · Score: 2, Informative

    It seems nobody has mentioned www.seul.org, the section education. There is a lot of software and some (for you valuable) testimonies.

  40. OpenOffice by DamienMcKenna · · Score: 1

    Wait until next summer when Open Office hits 1.0 and then show how they can do everything in it that they have been doing in MS Office, including file compatibility.

  41. Not especialy free software, but free content by Anonymous Coward · · Score: 0

    is available for german schools produced by the
    Open Web School.
    It consists of lessons produced by pupils for pupils.

  42. I must protest... by WheelDweller · · Score: 2, Flamebait

    I keep hearing about how Windows is so easy to use, but moments ago I showed someone (Again!) how to drag and drop a file. She's be at this job since before 1995 when the computers were installed; some people you're never gonna reach.

    But I'm not seeing an old Slackware, install-by-tarballs machine running a monochrome
    monitor being installed into school desktops; anyone trying that should be shot, and allowed to admin windows for a living.

    I use Redhat and Ximian here. I don't have time to put on my programmer-hat every time I install something, and the RPMs cover my ass so I don't crash libraries or something, and keep in mind I can install them from the comfort of my own desk instead of walking the halls to get to the Windows box.

    And Ximian is a big help, too; their latest offerings are at least as good as Microsoft for the things that matter (Spreadsheets, Word Processing, etc) and get better every month. If you haven't tried them, now's the time to start watching; they've done a superb job.

    And as for learning....how'd these people ever migrate off of WfW? And then to Win98...then to 2000? It's not the exact same thing, and that's rather the *point* isn't it?

    --
    --- For a good time mail uce@ftc.gov
  43. Corbett School in Tucson by r_j_prahad · · Score: 5, Informative

    OSEF has a great article from a feature story the Arizona Daily Star ran on them. URL below, but here's some quickie quotes from the story....

    "As such, they're entirely unimpressed that Corbett is among a mere handful of primary schools around the world with a computer network that runs Linux, the flagship of the fashionable free software movement. They probably can't appreciate the amount of money the school is saving, or the thousands of hours that Linux devotee Harry McGregor has donated to transform a collection of PCs past their prime into a Net-connected laboratory that's ahead of its time."

    "A lab similar to Corbett's could cost the district $100,000 or more if it were set up with new computers and commercial software. Instead, the school spent just $12,000 to convert its donated PCs into a Linux network that offers similar access to the Net and educational programs. Moreover, Corbett's pupils will gain experience with an operating system that's becoming more popular every day."

    http://www.osef.orgarticles_and_letters/azstar/whi zkids.html

  44. Saved? by kk5wa · · Score: 1

    Probably saved more souls than schools.

    --
    sine puella vita suget
  45. Is Linux really cheaper in the end? by SumDeusExMachina · · Score: 1, Troll
    I know that all of this evangelizing to get Free Software into schools is well-intentioned, but I can't help but wonder if we are doing more harm than good. Sure, the software that these people want to provide to school districts comes at zero initial cost, but what happens when something goes wrong? What if the mail server is misconfigured and starts causing problems later on? What if they get hacked (certainly not improbable with an abundance of hacker-familiar Linux machines on the network)?

    Does anyone know what the support costs will be once this school runs into the inevitable problems imposed by either poor configuration by hobbyists or the need to scale? What if they need more email accounts or something? While these problems would be easily dealt with on a Windows-based network (I think even your average high school computer teacher could handle it, or, barring that, a couple of MCSEs, who are a dime a dozen these days), it has been proven that there is a chronic shortage of people who are Linux-competent. This mostly stems from the fact that Linux is much less common than Windows in today's business world, so naturally there is a labor shortage. Any causal student of economics knows that a shortage in labor leads to skyrocketing salaries and consulting fees when it comes time to fix problems, money that a school district simply can't spend on expensive tech support.

    Really, when it comes down to it, you have to look at the total cost of ownership associated with installing a certain platform at a school. While the initial cost of a Windows site license may be high, it is a lot cheaper to maintain overall due to the abundance of people who can fix problems for a relatively low fee. Compare this with Linux, where whole companies base their business plans on providing support for an arcane system that can often suffer failures. In the end, perhaps these evangelization efforts would be better spent on coding software that makes Linux more user-friendly and less of a hobbyist's toy.

    --

    Is your company running tools written by ma
    1. Re:Is Linux really cheaper in the end? by Anonymous Coward · · Score: 0

      back in the dark ages, my high school left the operation of a newly installed VAX 11/750 to a few students... worked well for all concerned!

    2. Re:Is Linux really cheaper in the end? by johnnyb · · Score: 2

      You know, I haven't seen anyone who has rolled out Linux in the past year who has turned back. In the schools where they are trying it, it is actually proving to be a great success.

  46. My experiences by James1006 · · Score: 5, Funny

    My school district currently uses a mixed Microsoft/Linux environment. Until last week, our primary www server was Linux. However my boss got grumpy and decided to switch it to Win2k+IIS w/FP Extensions, so that he could update it easier via Frontpage (I'm gagging too). However, within 30 minutes of him installing Win2k and IIS, it got Nimdaed. Nice job! Right now, we have: A secondary Linux www server, for PHP/MySQL things. A SMTP/IMAP/webmail server in Linux. This is one area where Linux paid off. MS wanted thousands for Exchange, Win2k with the necessary hardware. Old machine (We don't have a ton of users) + Linux + exim + uwimap + Apache/PHP/MySQL = total new costs of $0. We are also implementing a Linux firewall to segment the network into DMZs (Something thats never been done, because as with most projects it is "Lets get it done and up as fast as possible". sigh.)

    --

    - Nothing is true, everything is permitted
  47. CA school district adopted linux last year by Anonymous Coward · · Score: -1, Flamebait
  48. Programming by finity · · Score: 3, Funny

    My high school offers programming classes, but we do all our programming on windows machines. I don't know why we don't switch over to linux and GNU, it being free and all. It seems like it would all be a better learning experience if we could easily see the source for more complex programs. My friends and I have setup a Slackware box, but the school system doesn't know yet and we don't plan to tell them. Last time we did, the next day we came to school and the power cord, monitor, keyboard, mouse and network cords were all gone. They thought it was a "virus" ;-)

  49. Have Any Schools Been Ruined by Free Software? by Anonymous Coward · · Score: 1, Insightful

    It's a legitimate question to ask it any schools have been closed by Free Software also.

    Has the increased cost of using unsupported or difficult to maintain free software forced any schools to find it impossible or difficult to keep their systems running?

    1. Re:Have Any Schools Been Ruined by Free Software? by Anonymous Coward · · Score: 0

      How are you going to ruin a school? If they don't have someone who can do what they need the software to do, then they can fork out the millions of bucks that they were going to before someone showed them another way. The only thing I see with that is administration getting jaded. They can happily crawl back into their BSOD'ing Winblows GUI and be just as clueless and in need of just as much support as ever.

    2. Re:Have Any Schools Been Ruined by Free Software? by evilpaul13 · · Score: 1

      I don't know of many businesses/organizations that get "support" from Microsoft. The difference between a Linux server and a Win2k server is you pay a lot more money for the software that crashes your Win2k server.

  50. My story by Anonymous Coward · · Score: 4, Insightful

    I was involved in a project to donate computers to a middile school in the mountains.

    We had computers donated from Goodwill and managed to get our university microsoft rep to donate Windows.

    Or first thought was to use Linux, but the schools ruled it out since none of the teachers
    would have been able to use it.

    We did manage to get them Office 2000, though, and
    I thank the people at Microsoft that helped us with that.

    Moral of the story though -- many schools are too afraid to learn new things, and that prevents free (and often better) software from taking hold.

    Linux developers do need to develop a more integrated desktop. Should there be a "X-with-training-wheels" we'd see a lot more Linux users!

    1. Re:My story by johnnyb · · Score: 2

      It's really sad when the _schools_ are afraid to learn new things.

    2. Re:My story by Anonymous Coward · · Score: 0

      You don't know how bad it is: at a Trade School/MCSE factory the teachers have found out that Linux is now to be introduced in the curriculum. These folks are actively hostile to the command line, believe that no one needs to know scripting, and would be happy to continue teaching on 98, and Netware 3.12 till hell freezes, or they retire. NT4 is considered a frighteningly complex OS.

  51. Political reality by Mr.+Fred+Smoothie · · Score: 2
    Besides which, in any school you can find technologically savvy kids. Make them a part of the computer team that maintains the network.
    In this age of lawsuit-happy parents and grandstanding local politicians, I don't see many school board members or superintendants who'd likely wan't to be associated with the idea of kids controlling their own use of technology, however flawed the idea of controlling access to technology in schools may be.
    --

    1. Re:Political reality by Brendan+Byrd · · Score: 1

      Ummm...I was one of the resident techs at my high school. Sometimes, I'd even have an excuse from class to fix somebody's computer.

      Screw PC legalize shit! Somebody had to fix these computers, and they weren't about to hire somebody to do it, when I could do it for free.

    2. Re:Political reality by Unknown+Lamer · · Score: 3, Informative

      I am part of the back room "bench tech" team at my high school. It is part of the tech research class. We set up new machines when they come in, service broken ones, and install new software while we aren't working on our research projects. The only thing we aren't allowed to do is open the cases, the county techs have to do that. Of course, I don't do much work because Windows and the Mac OS confuse the hell out of me. I am so used to just popping in, editing a text file, and reloading a daemon that pressing graphical buttons (the fun part is finding the buttons you need to click) and rebooting five or six times before it works is impossible. The other people (that actually use Windows at home) do a lot of "bench teching" though.

      --

      HAL 7000, fewer features than the HAL 9000, but just as homicidal!
    3. Re:Political reality by sirket · · Score: 2, Interesting

      Considering the plight of public schools in America, and the wonderful job that our politicians have done with the issue, it is the responsiblity of students, parents, and the school itself to solve the problem.

      In my high school, the computer network was run by the students. Contrary to what some people thought, when these students were given the power to abuse the network, they reacted in exactly the opposite way. They became very responsible. They took their position seriously and did not abuse it. Perhaps it is time we stopped treating high school students like children.

      The school administration accepted the situation because it was the only way they got working computers and an Internet connection. The parents accepted it because it resulted in a better environment for their children.

      Some safeguards were put in place, such as no students were allowed to work on the file server. This was to help prevent any students from reading other students email and files, but it was more of a token gesture than real security because real security would have stopped things from getting done.

      -sirket

  52. riverdale school by McVeigh · · Score: 4, Informative

    www.riverdale.k12.or.us/linux/ good linux info there also

    --
    "I drank what?" - Socrates
  53. It could be a really good thing . . . . by actappan · · Score: 2, Interesting

    My father teaches CS at a small private school, and while they're not by any means struggling financially - they are somewhat apprehensive about Microsoft's new fervor for license enforcement.

    They're seriously considering a move from their current student lab environment (Win 9x with Novell Netware) to a Linux thin client environment - what would basically be X terms. This has huge resource allocation advantages and because it's open source - the licensing restrictions are few if any.

    This could literally save them millions over the next few years (The hardware life cycle for thin clients is considerable longer, and new server hardware, while expensive, is cheaper than buying several hundred new desktops every few years - not to mention say $100 dollars per system savings against XP Pro licenses)

    That millions could keep them afloat in thin times, or could mean that they can provide scholarships to needy students.

    See related: K12 Linux Project

    --
    \Drew National Data Director, John Edwards for President
  54. OK troll by Anonymous Coward · · Score: 0

    Reasonably nice troll. Not bad for a novice.

    You blew it by going over the top in the last paragraph and using the H word.

  55. This won't sit well with the Open Sourcers... by Anonymous Coward · · Score: 0, Insightful

    but, why put it in schools.

    The Pros:
    1. Expense is cut drastically
    2. Open source benefits some with early exposure to alternate OSs and software to potential future code writters and sales people

    The Cons:
    1. MS is the mainstream... if you teach a child a radically different system than from what they will face a few years down the road, either in terms of software or the core OS, they are unprepared for college and/or the working world they are supposed to enter into. Seriously, how much of the world is open source in business? Not nearly as much as MS or even Mac (or both), not even close. These kids need realistic education.

    2. Support. How many open source gurus are going to work in education for the low pay offered. How many current education IT employees and teachers actually know open source software and OSs. Not nearly enough.

    3. Variance from what is at home. There are compatibility issues with files, and an overall difference (as stated above) between the mainstream and the niche in use, and most home users are NOT open source (and won't be for quite a while if ever given the fratricidal nature of the open source "movement")

    Sure, the savings could translate into more money for teachers, but do you honestly think that is how it would work. Politics will ensure that the money saved is either spent on salaries for administration or cut from the budget since it no longer is needed. Teachers wouldn't see a dime.

    1. Re:This won't sit well with the Open Sourcers... by phlako66 · · Score: 1

      1. MS is the mainstream... if you teach a child a radically different system than from what they will face a few years down the road, either in terms of software or the core OS, they are unprepared for college and/or the working world they are supposed to enter into. Seriously, how much of the world is open source in business? Not nearly as much as MS or even Mac (or both), not even close. These kids need realistic education.

      The point of education is not to prepare little business people. And besides, I think that you underestimate peoples intelligence when you suggest that just because the learn KDE or Star Office that they're not going to be able to figure out Win XP or Microsoft Office. Come on. It's a damn GUI. They're basically the same thing. I don't buy this argument at all.

      I don't think that Linux is poised to take over many schools completely, but I do think that schools can benefit greatly from looking at alternative software to replace some of the costly packages they're stuck with now. I just convinced the Psychology Dept at UCLA to install GIMP on 20 or so machines running OSX in a lab rather than Photoshop for every one. This saved the dept around $7000 with one change, and for what students do with photoshop the GIMP does exaclty the same.

    2. Re:This won't sit well with the Open Sourcers... by Shao+Ke · · Score: 1

      1. MS is the mainstream... if you teach a child a radically different system than from what they will face a few years down the road, either in terms of software or the core OS, they are unprepared for college and/or the working world they are supposed to enter into. Seriously, how much of the world is open source in business? Not nearly as much as MS or even Mac (or both), not even close. These kids need realistic education.

      And how much of business is Wordperfect 5.1 for DOS and Apple IIs (what we were using when I went to grade school)?
      Why worry about where your software came from in the educational system when by the time they have to use those wizzy & wiggy features computing has evolved into something completely different in five to ten years?
      Give them the tools that they have to use to get the job done now and make it so they don't look like a User Friendly poster child when confronted with something new.
    3. Re:This won't sit well with the Open Sourcers... by Anonymous Coward · · Score: 1

      No, that's wrong. If you are using MS in school and have to go home and user your home computer, you are using MS most likely there (As a kid and student in the average, with average parents). Sure it changes over time, but not in the extreme as shown in your post (which indicates your age as well).

      I worked in a school district, doing IT, for years, and that suposition is just flat arse backwards and too short sighted. Mac users usually have little trouble transitioning to a more powerful PC system, but you can't say the same about Linux based systems. And, since Apple Corporation is not handing out Macs and associated Apple products like they once did to schools, Macs are now either aging in the schools they are in, or disappearing except where the administopo is so entrenched he or she can't change.

    4. Re:This won't sit well with the Open Sourcers... by Rogerborg · · Score: 2
      • MS is the mainstream..

      What you are saying basically boils down to: it's easier to support an illegal monopoly than it is to support alternatives.

      I find anti-trust laws distasteful, but you've just demonstrate exactly why we actually need them. Laziness, least-common-denominator thinking, quantity before quality. Not values I want my children to learn, not at all.

      --
      If you were blocking sigs, you wouldn't have to read this.
  56. Also in belize. by Malcontent · · Score: 3
    --

    War is necrophilia.

  57. big mistake by Anonymous Coward · · Score: 1, Interesting

    We had done this exact same project some years before, and we had managed to replace Windows 98 with Linux on the school's network. We had convinced the administrapo that the network would be secure from viruses like ILOVEYOU and that there would be no software licenses. Everything went well -- for the first three days. Then the support issues started trickling in.

    We decided to use KOffice for our standard office suite, and HTML would be the file format standard in which to save in for interopability with the remaining Windows segments of the network -- after all, I didn't see Office 2K have a converter for .kwd files. However, KOffice would completely mangle the document once it was saved in HTML, making it virtually unreadable. I don't know if this was a bug in KOffice, but it sure raised a lot of hell.

    Remember the GNOME Usability studies that Sun did? Remember how confused the participants were?
    Take that and multiply it by 100, and you have what our school experienced. We had training for the teachers in order to prepare to this switch to Linux, but many of them were confused when confronted with folders like /bin, /opt, stuff like that. Some were also angry because their Windows programs wouldn't work.

    We scrapped the entire idea after three weeks, and reverted the entire network back to a Windows-based solution. While Linux is a great server OS, its desktop solution leaves something to be desired, and I would not recommend replacing what works for the school.

  58. Not Saved...but aided by Luminous · · Score: 4, Interesting

    I know of one school in particular, the school my boss sends her kid to, that has benefited tremendously. My boss is a Microsoft devotee and has scoffed at the Free Software movement, until she went to a school meeting and realized the computer lab that was donated (just the systems and OS nothing else) wasn't up and running yet. The reason was the school didn't have the money for Microsoft Office.

    Long story short, she told me, I pointed her to StarOffice and a few other apps that are readily available. It wasn't a difficult sell, because it was the difference between getting use out of the computers or just teaching Windows. The school wouldn't have 'collapsed' without the free software and they would have gotten the money for the applications next year, but now they can use that money to implement a replacement program for the systems they already have.

    All of this goes back to the fact that there is a bias against Free licenses on software. My boss always considered them to be amateurish, less reliable, than the NAME BRAND software. Not anymore.

    --
    This is not the way to build a lasting empire.
  59. My experience with Linux in schools... by Adrian+Voinea · · Score: 1

    In my first year of college there were 25 Windows computers and one Linux server in our laboratory.
    After I became the admin I started converting the teachers and students to Linux.
    In the beginning it was hard but after they learned to read/send mail with Pine they became curious...
    So when I finished college there were 26 Linux computers and everybody was happy using them :)
    Linux is schools is a great idea.

  60. Local High School Uses Linux Here by LowellPorter · · Score: 1

    The local newspaper here in Springfield, IL ran an article a year or two ago about some hight school students (Springfield High School) who networked the schools computer lab to a Linux server so students could have a place to store their stuff without having to bring floppy disks. I don't know if it's still around, but the students did it all themselver including building the server and installing all of the software. The teacher that was in charge of the lab was impressed mostly because he didn't know anything about Linux and networking.

  61. It's had a huge impact by Nelson · · Score: 2
    I doubt that you could find a case of a school keeping it's doors open when it otherwise would have closed because of free software. Personally, I would hope that a school would stop using computers before it stopped teaching, but that's just my opinion.


    Realistically though, free software has made a huge impact. I think the most obvious exmaple to me is the use of GCC in college classes. Hundreds of colleges use it that otherwise might not be able to teach courses behind computers. (note: you don't need a computer to teach C or C++ or to learn it, plenty of people have done it that way, I think it's a bit more enjoyable with a computer though) Compilers on multiuser UNIX systems are traditionally very expensive, as are site licenses to compilers under Windows.


    I also think that there is a behind the scenes factor that has always been very hard to measure with linux. I know that my old school district, Boulder Valley Public Schools, has several Linux machines in various capacities. A couple are used as lan servers in some schools, a couple are used as firewalls and proxys and email and web servers. I'm certain that some act as bridges and routers. That's stuff that makes their life easier, serves a purpose and it's really hard to measure. Off the shelf firewalls can cost thousands of dollars. I have no idea how much it costs to buy the hardware, software and then hire someone to build you an exchange server for email or setup an email server with something non-linux.


    As for teaching software and that kind of thing, I think it's still in the infancy.

  62. Who cares about open source? by Anonymous Coward · · Score: 0

    Why do we need open source in schools? Just because most technical people us it, (mostly because they don't like M$) doesn't mean students need to as well. I wouldn't take anything over my Unix machine for development work, but how many students in a high school are going to be engineers? For the casual/word processing PC user, Linux might as well not even exist. Besides, can you imagine the support nightmare that would be created by putting Open Source in schools? What are they going to do? Hire on a System Administrator that gets paid as much as the principal? I don't know any SysAdmin's that make as little as teachers do. This even applies to colleges. At Penn State we could have used open source software for CSE purposes, but that only accounts for a handful of students. Try telling the entire college of education or business that they need to start using Redhat!

  63. Depends on the level of the student by Mr.+Fred+Smoothie · · Score: 3, Insightful
    They teach auto shop in high school. Of course, fixing cars is not as "essential" as reading, writing and math, either. However, not *all* students will go on to college. Most will probably own a car at some point. For some, getting a job fixing cars out of high school may be an attractive option. So knowing how to do simple repairs on a car is a very *practical* thing for *many* high school students to learn, and I think that a lot of people would argue that therefore it's a valuable addition to the curriculum.

    Many kids will either own computers or work with them daily after high school. Some may want to go on to work in an explicitly computer-oriented career, which however doesn't require much specific post-secondary education (hardware repair in a small shop, for instance). To the same degree as auto-mechanics (and probably far more than say, wood shop), computer education in secondary schools is a valuable addition to the curriculum.

    For primary education, heavily computer-centric instruction may be overkill. But at the high school level good arguments can be made for it.

    Of course, it won't be too useful to students who just want their school to subsidize their bong-building activities, but that's what metal shop is for.

    --

  64. Clark County School District by Anonymous Coward · · Score: 0
    (think Las Vegas, but covering the whole southern corner of Nevada. Very spread out.)

    I think they use a couple of different Linux distros. I know they use Mandrake for desktops, but maybe other distros for limited server ops.

    That doesn't mean they are exclusively Linux, though. It's only a small piece.

  65. Re:Free software + education == GOOD IDEA! by Anonymous Coward · · Score: 0

    Escpecially within large pools of computers like you have in schools or universities, Linux is far superior.
    Having an consistent way to get the system centrally configured and maintained may not be impossible with windows, but it is a pain in the ass.
    For an good admin, linux boxes are much easier to maintain and to keep stable and running.

    And for the DAUs: People cannot use windows, either. When they are used to, they may protest. But I never saw any DAU, that could use Linux less easier than Windows.

  66. Sorta... by suwain_2 · · Score: 1
    I actually go to a (private high) school, and know the network admin. (So I speak as a computer-obsessed student, not a school employee.)

    We're "in bed" with Microsoft or something; they won't stop sending us loads of their latest software. All the computers run Win2000, with the lastest versions of VisualBasic, Office, etc. all installed. Under the MS Academic License, we can essentially install any Microsoft product on as many computers as we want; they can also give out software. My friend brought home .NET... (It screwed up his computer and he had to do a complete re-install...)

    Anyway... Even with what's essentially infinite access to anything we want, we're looking at switching some servers over to Linux. Even though we keep up with all the security patches for our servers, they're constantly getting infected with worms/virii. The whole network came down one day - because a large file was being moved off of the file server. The constant headaches from this crap has caused him to give a serious look at Linux, at least our webserver is likely going to migrate to Linux soon. Maybe the fileserver/mail server will follow suit...?

    So, in conclusion... Linux hasn't saved my school, but Windows does nothing but constantly screw us over. So I guess I'm answering your question from the opposite side...?

    --
    ________________________________________________
    suwain_2 :: quality slashdot p
  67. Such a stupid attitude - by Anonymous Coward · · Score: 1, Interesting

    I'm _nearly_ speechless; but this IS /. after all so here's my piece:

    I have heard arguments like 'all free software initiatives in public schools around the world have failed.' I know this is not true, but I need cases to show them.

    Is that really their concern or just the excuse they use to avoid having to actually deliver on the promise of "education"?
    My first rebuttal would question the validity of such an attitude. If that "lemming" attitude were valid then the horse-n-buggy would never have been replaced by the automobile because it requires a "non-standard" fuel to run amd previous attempts at the internal combustion engine were pooly implemented.

    They should really be asking the questions "is it feasible for our organization to do this?" with "how much would it cost versus how much could we save for reinvenstment back into the system?"..

    BTW: I applaud your effort to deliver hard fact to dispell their fud. An analysis of the actual numbers should demonstrate that the savings from using *free* versus proprietary equals out even taking into account the added expense of a sys admin specific to *nix. Additionally not being beholden to the schedules and monetary coffers of companies like MS should be priceless from the standpoint of an educational organization.

  68. Computers are life... by Brendan+Byrd · · Score: 1

    (Why is this modded up? This is flamebait, and a stupid response at that.)

    Why computer in school? That's like saying "why chemistry in school", or "when are we ever going to use computers". Computers are everywhere. I can understand if the software becomes obsolete, but it's still should be required to learn about computers.

    Even if WordPerfect isn't the hot thing anymore, it was good that you learned it. From it, you learned typing, mice, how a GUI works, and other basics about word processing. So what if the "hot keys" are different in Word 2000?

    Also, if you load these machines with an alternative OS like Linux, then they'll know Windows is not the only tool out there. And isn't that what you want?

  69. What about applications? by KurdtX · · Score: 1

    Ok, this is slightly offtopic, but...

    From my experience school's interest is computers works like this:

    Business - Teaching the MS way
    Math - Making the churn of math easier, like graphing equations and solving systems of equations
    Science - Reports, reading lab equipment, and calculations
    English - Typing papers, internet for research
    History - Typing papers, internet for research
    Art - Using Photoshop (preferably on Macs)
    CS (if they have one) - teaching whatever C++ compiler the teacher is most familiar with

    Sorry if I've left some out, but you get the point. Since we've already had the discussion on how easy Linux is to a newbie, I'm more interested in what free software/OSes would fullfill each departments needs (kudos if you can satisfy business!). And remember, you're dealing with uninterested kids, so the software pretty much has to be point & click.

    --

    Kurdt
    I'm not anti-social. Just pro-technology.
  70. European schools (and a mini-rant). by Hiro+Antagonist · · Score: 5, Interesting

    You'll have better luck looking at schools in Europe, especially Germany, France, and the U.K. The U.S. public school system moves about as quickly as a lowered Honda Civic in an off-road rally race; and, in my experience, most public school IS/IT administrators know less about computers than John Ashcroft does about electron field dynamics. This is why few high schools have local area networks or decent internet access, and why fewer still have classes in things as simple as programming in Basic.

    Since U.S. schools aren't adeqately funded by the government, they gobble up as much of the private-sector "technology money" as they can possibly gorge themselves on; a signifigant chunk of which comes in the form of discounted licenses for Microsoft software. Kind of ironic that the school still has to buy the computers to run the software (and keep them updated); but I guess by reducing their profit margin from 99.998% to 98%, Microsoft has done their part. Those computers have to be upgraded pretty regularly, of course, and some of the money for that comes from "less worthwhile" programs -- like English, Art, Music, and History.

    We are raising a generation of Americans that won't know the difference between a verb and a posessive pronoun, but they'll be able to use the Word grammar-checker, so it all works out in the end, right?

    These, among other reasons, are why the U.S. imports its computer engineers from Europe and southeast Asia.

    By contrast, European schools don't get the same deep discounts, and the foreign-language support in Windows is pretty horrible (although W2K has made some signifigant improvements in this area). European schools (at least in the three countries mentioned above) are supported wholly by the state, and as such don't require outside funding. This means that, for the most part, the software and hardware are chosen to fit the needs of the instructors and students, rather than to fit the discounts, freebies, and funding-with-strings requirements assigned by the technology companies.

    This is why you'll find SuSE, Mandrake, and Debian pretty heavily used in many European schools (and thus, businesses).

    But that's just my opinion; I could be wrong.

    --

    --
    I Hit the Karma Cap, and All I Got Was This Lousy .sig.
    1. Re:European schools (and a mini-rant). by cascadingstylesheet · · Score: 1

      Since U.S. schools aren't adeqately funded by the government, they gobble up as much of the private-sector "technology money" as they can possibly gorge themselves on; a signifigant chunk of which comes in the form of discounted licenses for Microsoft software.

      Sigh. Many "failing" US schools spend enough per student they could hire them tutors and take them to lunch at fine restaurants by limo, if they wanted to. They aren't inadequately funded.

      European schools (at least in the three countries mentioned above) are supported wholly by the state, and as such don't require outside funding. This means that, for the most part, the software and hardware are chosen to fit the needs of the instructors and students, rather than to fit the discounts, freebies, and funding-with-strings requirements assigned by the technology companies.

      So, European schools choose free software because they have better funding? I don't follow you here.

      These, among other reasons, are why the U.S. imports its computer engineers from Europe and southeast Asia.

      No, US companies do that because they work cheaper, and have less job mobility (which is part of why they work cheaper). I'm sure they'd love to deport citizen employees who quit too, if they could figure out how.

      We are raising a generation of Americans that won't know the difference between a verb and a posessive pronoun, but they'll be able to use the Word grammar-checker, so it all works out in the end, right?

      That's more likely the result of abandoning the three Rs than the choice of non-free vs. free software.

    2. Re:European schools (and a mini-rant). by Anonymous Coward · · Score: 0

      As a sixteen-year-old American who's coded GUI client/server apps and framebuffer libraries, I have to say it's quite a ridiculous assumption that people get 100% of their knowledge and intellect from the school system. I sure as hell didn't.

    3. Re:European schools (and a mini-rant). by the1trex · · Score: 1

      There is a Norwegian projekt to make a linux distro ment for norwegian scools. the homepage of the projekt is: http://skolelinux.ping.uio.no/ It is in Norwegian though.

    4. Re:European schools (and a mini-rant). by the1trex · · Score: 1

      There also is a Norwegian school using linux. http://www.hole.gs.rl.no/linux/linux.htm this site is also in Norwegian.

  71. MS Academic Software is cheap by Anonymous Coward · · Score: 0

    My company provides IT support to a small-medium sized K-12 school district. They have 5 NT servers, and approximatly 250 workstations running Windows2000/Office2000. I can see no scenario where it would make sense to move them to a free software platform (Linux). MS academic software is not that expensive to start with, so there's not much money to be saved here (approx $50 for Win2k and $50 for Office per station.) Most of the software used by the district would not run under Linux anyway. Aside from the webmail app and their web based library system nearly everything else they use is written for Windows. They couldn't run any of their current educational software packages, including those provided by the state! I love Linux and see that it has a place on the server, embedded in devices and running on hobbiests' machines. However considering the realities of IT today, it just doesn't make sense to roll out Linux on the desktops of organizations either commercial or educational.

    1. Re:MS Academic Software is cheap by Hiro+Antagonist · · Score: 3, Interesting


      My company provides IT support to a small-medium sized K-12 school district. They have 5 NT servers, and approximatly 250 workstations running Windows2000/Office2000. I can see no scenario where it would make sense to move them to a free software platform (Linux). MS academic software is not that expensive to start with, so there's not much money to be saved here (approx $50 for Win2k and $50 for Office per station.) Most of the software used by the district would not run under Linux anyway. Aside from the webmail app and their web based library system nearly everything else they use is written for Windows. They couldn't run any of their current educational software packages, including those provided by the state! I love Linux and see that it has a place on the server, embedded in devices and running on hobbiests' machines. However considering the realities of IT today, it just doesn't make sense to roll out Linux on the desktops of organizations either commercial or educational.


      Commercial, no.

      Educational, yes.

      I can see no reason that students can't be taught to use a word processor rather than just Microsoft Word -- learning basic concepts instead of "monkey see, monkey click."

      Educational software is, for the most part, a complete crock; and, with the exception of grade-keeping software, doesn't belong in schools. Teachers are paid to teach, not to sit a student in front of some so-called "educational" program and baby-sit them. Some of the computer tutorial software, like the programs that teach you to use Word and Excel by visually showing you what to do, are effective; but these aren't the types of things schools are trying to teach.

      The hardware costs make it much more expensive to run Windows in a school environment; Windows and Office 2000 require fairly high-powered workstations which cost the school real money to purchase; comparitive systems to run OSes like BSD and Linux are often donated en masse.

      Having all of the computer equipment donated to a school by a business that wants the tax write-off can save even a small school tens of thousands of dollars; which, in turn, can go into things like art programs, improving science education, and hell -- even keeping the school in sporting goods. Go and ask a local principal what they would do if they were given an extra $20,000 to spend at the school on anything but salaries or computers.

      As far as not being qualified for anything but "hobbiests", what do you think students are? A hobbiest is someone who is interested in learning as much about something as possible; and a student is someone who is supposed to be learning as much about the subject material as possible. Students aren't like employees -- there is no bottom line to watch, and no such thing as wasted time as long as it's spent learning.

      --

      --
      I Hit the Karma Cap, and All I Got Was This Lousy .sig.
  72. NC Universities by November11 · · Score: 1

    One of the Universities here in North Carolina has a big Computer Science program that actively participates in advancing Linux (great project). NC State University also has their own Linux distro based on RedHat...I believe all of the engineering students use their Linux distro, but the rest of the students still use Windows.

    1. Re:NC Universities by Anonymous Coward · · Score: 0

      Go to Hell Carolina! GO STATE!

  73. Well, my son's grade school, for one... by freebsd+guy · · Score: 4, Informative
    About two years ago, my son's grade school upgraded their computer lab and, as a concerned parent, I was on the advisory committee for that. Originally they had planned to do an all-NT installation for security and usability reasons, but we did a cost-benefit analysis and found that the licensing would have cost us an arm and a leg.

    So, we arrived at a compromise: although I wanted a straight FreeBSD shop, we settled for Linux on the desktops and FreeBSD on the servers, provided that the Linux USB support and stability improved. We still use the 2.2 kernel series with backported USB support, and are running FreeBSD 4.0-STABLE on all of the servers (which, by the way, have not been rebooted since they were installed).

    When the numbers came in, we found that we were able to afford 20 extra computer systems (!) by not paying the Microsoft tax. Also, we were able to hire a sysadmin very cheap who works remotely (he has been banned from the school grounds), and found in our analysis that we would have needed to pay about three times as much to get the MCSEs that it would have taken to keep an NT shop running smoothly.

    So, the school board wins and the kids win with Open Source. That is the way it should be.

    freebsd guy

    1. Re:Well, my son's grade school, for one... by Morgoth_Bauglir · · Score: 3, Funny

      >> (he has been banned from the school grounds)

      You can't just say that and not tell the story.

    2. Re:Well, my son's grade school, for one... by Anonymous Coward · · Score: 0

      we were able to hire a sysadmin very cheap... he has been banned from the school grounds

      Look man, I told you 100 times. I was TESTING the porn filtering software.

  74. While free is good... by hether · · Score: 5, Interesting

    I can see plenty of problems with implementing Linux in schools, especially when I think about how it would go in my local district.

    1. All the teachers know Windows. My bet is that even many of the computer teachers do not know Linux well enough to run it in their labs. They can't teach it if they don't know it and teacher training could be expensive and take a lot of what's probably considered unnecessary time.

    2. They would have a lot harder teaching a completely new OS AND classes on how to use the programs than to just teach the programs. You'd probably have to have a intro to Linux class before you could ever teach whichever programs you choose to use - and that's another issue in itself.

    3. Students probably have Windows at home. Would they have problems with converting documents between systems? Say you create your report in Word at home, could your bring it school and use it there?

    4. The local tech support and computer stores would not be able to help them if something went wrong. 99% of the techs around here don't know anything about anything other than Windows. Who would know enough about Linux to help them??

    5. The students would learn programs and OSes that would different with what they would have when they go to college, go to work, etc. Since there are very few offices and colleges using entirely Linux, they would be at a disadvantage right away.

    Of course there are a lot of plusses too, but these negatives sprang to mind right away. Of course they are all refutable. I think that the schools would choose easy and expensive over difficult and cheap any day. If they didn't have a choice and were nearly out of money, my guess is they would let the computers sit/

    --

    Most people would die sooner than think; in fact, they do.
    1. Re:While free is good... by Jason+Earl · · Score: 3, Insightful

      Let's take a look at this point by point.

      1. All the teachers know Windows. My bet is that even many of the computer teachers do not know Linux well enough to run it in their labs. They can't teach it if they don't know it and teacher training could be expensive and take a lot of what's probably considered unnecessary time.

      What you really mean to say is that all of the teachers know how to log on and fire up Word. Most teachers don't really know anything about Windows administration. That's why the computers in most classrooms work poorly.

      This simply means that whatever Linux front end was offered would have to be similar to Windows. It would have to be at least as similar as Windows XP is to Windows 95. For the simple things both KDE and Gnome can be set up so that the teachers wouldn't miss a beat.

      2. They would have a lot harder teaching a completely new OS AND classes on how to use the programs than to just teach the programs. You'd probably have to have a intro to Linux class before you could ever teach whichever programs you choose to use - and that's another issue in itself.

      Once again. The teachers aren't teaching the students to use the OS. Most teachers don't even know that right clicking on objects gives them a different menu. Teachers are teaching students to "click on the Word icon" and then word process. If you created icons for the StarOffice programs you would be 90% of the way there.

      3. Students probably have Windows at home. Would they have problems with converting documents between systems? Say you create your report in Word at home, could your bring it school and use it there?

      This is already a problem. Even if you have Windows. Many students who have computers don't have MS Office (it's expensive), and if they do have MS Office there is a good chance that they have an older version like Office 95 that won't open the newer formats (easily). With a switch to Linux the school could easily (and inexpensively) hand out copies of StarOffice for Windows or Linux (it's free).

      4. The local tech support and computer stores would not be able to help them if something went wrong. 99% of the techs around here don't know anything about anything other than Windows. Who would know enough about Linux to help them??

      This, in my opinion, is the one legitimate point. However, the answer to this is to not roll out Linux PCs but instead to have one Linux server and a pile of thin-clients. That way all the local tech would have to do is throw out the old thin-client and plug in the new one. My guess is that the current Windows administrator could easily learn to be a fairly competent Linux admin if they didn't have to worry about all of the failed client PCs. He/She would have a whole lot more time on their hands with only one machine to administer.

      5. The students would learn programs and OSes that would different with what they would have when they go to college, go to work, etc. Since there are very few offices and colleges using entirely Linux, they would be at a disadvantage right away.

      Anyone that can learn to use StarOffice will have no trouble using MS Office (and vice versa). These applications are nearly identical.

      Of course there are a lot of plusses too, but these negatives sprang to mind right away. Of course they are all refutable. I think that the schools would choose easy and expensive over difficult and cheap any day. If they didn't have a choice and were nearly out of money, my guess is they would let the computers sit

      And that's precisely the information that is needed to sell schools on Free Software. Demonstrate to them how much easier it would be for them to administer one Linux server and a pile of disposable ThinkNics and you can bet that they will sit up and listen. At the very least public schools should be giving StarOffice a look. It would save them a bundle in licensing, and will even run on their existing Windows systems.

    2. Re:While free is good... by dR.fuZZo · · Score: 3, Funny

      3. Students probably have Windows at home. Would they have problems with converting documents between systems? Say you create your report in Word at home, could your bring it school and use it there?

      That's nothing, sonny. Why, back in my day, we had Windows at home and Apples in the schools. We had to pay for everything, we couldn't work on the same document at home and at school then either, and we liked it!

      --
      -- dR.fuZZo
    3. Re:While free is good... by Danh · · Score: 1

      Note that your five points, which can be summarized as

      1. and 2. teachers know only Windows
      3. students only have Windows at home
      4. tech support knows only Windows
      5. colleges and offices only have Windows

      show how the market primus is advantaged in this winner-takes-all market, independently of the quality of the software. It is thus better to resolve the problem (the use of proprietary instead of free software) sooner than later, when the grip can be tightened even more. And the fact that despite all Linux goes so well indicates that it has real and strong winning points (hey, it's free and developped by potentially so many people).

    4. Re:While free is good... by Anonymous Coward · · Score: 0

      Um, don't all these points apply to the use of Macs in schools, where I gather Apple still has a strong marketshare?

    5. Re:While free is good... by hether · · Score: 1

      Ummm. No. Because not near as many teachers know about Macs, not as many kids have Macs as home as Windows, tech support doesn't know much about Macs, etc.

      --

      Most people would die sooner than think; in fact, they do.
    6. Re:While free is good... by David+Rolfe · · Score: 1
      5. The students would learn programs and OSes that would different with what they would have when they go to college, go to work, etc. Since there are very few offices and colleges using entirely Linux, they would be at a disadvantage right away.

      Not to cause strife or anything, but tonnes of colleges still use unix in their campus computing cocktail. Sure there's mac labs, and windows labs, etc... but kids leaving AP Compsci in highschool will be stepping straight into *nix enviornments (usually solaris or hp-ux) in college. It's a disservice to fledgling geeks to say they aren't going to be using linux in college- they will. When it comes to the non geeks, getting them a little aquainted with StarOffice in highschool won't hurt them any... they'll be able to use the solaris lab when the windows or mac labs are full :-)

      --
      Read Heinlein's 1953 Revolt in 2100, now more than ever.
    7. Re:While free is good... by Anonymous Coward · · Score: 0

      (It seems I haven't posted to Slashdot in so long my login won't work.)


      >I can see plenty of problems with implementing Linux in schools, especially
      >when I think about how it would go in my local district.


      I can see plenty of problems with allowing schools to continue to be
      entrapped by MS, and not just the continued waste of my tax dollars.


      >1. All the teachers know Windows. My bet is that even many of the
      >computer teachers do not know Linux well enough to run it in their labs.
      >They can't teach it if they don't know it and teacher training could be
      >expensive and take a lot of what's probably considered unnecessary time.


      1. I don't know about your local district, but around here, teachers are
      people. They are capable of learning. At one time, all teachers knew were
      slate tablets.


      >2. They would have a lot harder teaching a completely new OS AND classes on
      >how to use the programs than to just teach the programs. You'd probably have
      >to have a intro to Linux class before you could ever teach whichever
      >programs you choose to use - and that's another issue in itself.


      2. What's the difference between teaching how to click an Open Office icon,
      for example, and 'Start->Programs->MyPOS->MyOfficeDocs'?


      >3. Students probably have Windows at home. Would they have problems with
      >converting documents between systems? Say you create your report in Word at
      >home, could your bring it school and use it there?


      3. Surely the students can learn how to click 'Save as...' and select a
      format not so frequently made incompatible as that .doc thing.


      >4. The local tech support and computer stores would not be able to help them
      >if something went wrong. 99% of the techs around here don't know anything
      >about anything other than Windows. Who would know enough about Linux to help
      >them??


      4. The local tech support may become as close as the kid who's been craving
      a look at the insides of programs, or the one who just can't get enough of
      those 'HOWTOs' he/she just discovered. The old local tech support generally
      consisted of "reboot, reinstall, wait for the next patch". Teachers already
      rely on the class 'geek' for a lot of assistance. With Windows systems,
      however, a lot of the troubles come from the childish file and directory
      permissions of the system and the ridiculously fragile nature of that
      house-of-cards operating system/gui/intertwined functionality.


      >5. The students would learn programs and OSes that would different with what
      >they would have when they go to college, go to work, etc. Since there are
      >very few offices and colleges using entirely Linux, they would be at a
      >disadvantage right away.


      5. Excuse me? How is knowing more a disadvantage? How is a
      mouse-click memorizing consumer at an advantage over someone who is free to
      explore as deeply into the internals of the software as he or she chooses?
      Probably a lot of students will not be interested in the source. They will,
      at worst, learn how to spot that "Help" thing that comes with just about
      every high-level program. This is a good thing, since MS chooses to shuffle
      things around a lot with every release, and since there is a lot more
      software out there than just MS stuff. And why do you stick in that bit
      about "very few offices and colleges using entirely Linux"? What's your
      point? There are very few offices and colleges using entirely No. 2 pencils.
      The people at those offices and colleges probably have little problem
      switching from No. 2 pencils to ball-point pens. The lack of total
      domination by No. 2 pencils would not likely be a hardship.


      >Of course there are a lot of plusses too, but these negatives sprang to mind
      >right away. Of course they are all refutable. I think that the schools would
      >choose easy and expensive over difficult and cheap any day. If they didn't
      >have a choice and were nearly out of money, my guess is they would let the
      >computers sit/


      How about the schools choose easy and cheap? Would that be acceptable? Maybe
      the kindergarten teacher is tired of having to call daily for a
      reinstallation because one of the wee ones didn't click things Bill's way.
      Maybe this teacher would love to have a machine set up with only Gimp able
      to run, to let the little ones play with paint without the cleanup. Perhaps
      the elementary lab (yes, many schools still isolate computers in 'labs' as
      if they're the electronic equivalents of biological experiments) needs to
      have computers that actually work, instead of mysteriously crashing and
      keeping the teacher hopping around playing tech support instead of teaching.
      Perhaps teachers, staff and school administration would appreciate being
      able to click a fetchmail icon and receive email instead of one of the
      endless notices of the network being taken offline, disconnected from the
      internet, due to the latest virus, Outlook exploit, IIS vulnerability,
      Exchange defect, Windows attack, latest rebootathon to apply the patches for
      the preceding, or the wait for MS to figure out how the latest patch broke
      so many other things.

      I'm married to a teacher. These are not hypothetical imaginings; they are
      real, ongoing troubles. Teachers now have to spend too much time either
      fixing problems they shouldn't have, or letting the computers sit idle while
      waiting for some overworked technical support person to catch up on reboots
      and patches and upgrades, or wasting their time in seminars learning how to
      deal with the illogical, unfriendly requirements of MS crapware.

      Wouldn't it be nice if computers in schools were set up according to what
      each teacher wanted? With free, open source software, this is usually no
      problem at all for most *nix enthusiasts or, if need be, a competent *nix
      admin. How easy is it to customize a MS machine and still be able to admin
      the network?

      http://edge-op.org/grouch/schools.html

  75. Forgot the link... by appleprophet · · Score: 2, Informative

    It's kind of funny how SourceForge and NewsForge were linked to... But the site that I've never even HEARD of before was completely omitted.

    SCHOOLFORGE

  76. Making old system last longer... by sterno · · Score: 4, Insightful

    In reading some of the case studies on this, it looks like the biggest use for Linux is in two realms:

    1) Servers - file sharing, web servers, e-mail, etc
    2) Making old machines useful again

    A lot of schools have old 486's and Pentium lying around which are pretty much useless as a Windows desktop, but set these systems up as X-terminals and throw a sub $1000 server behind it, and suddenly they are rejuvenated. This also has the benefit of making the management of these systems much easier.

    I know I've seen a number of initatives where some politician gets the bright idea that the secret to making schools better is to buy a lot of hardware. This usually helps for a little while, but then in 3 or 4 years the hardware becomes nearly useless and nobody's throwing more money at it. By going with Linux, it seems like they can extend the value of that initial investment a lot further and thus save hugely in the long run.

    --
    This sig has been temporarily disconnected or is no longer in service
  77. Double standard by mrroot · · Score: 1

    So you say software to schools should be free, eh? I happen to agree with you, but this topic reminded me about this BusinessWeek article in which the author, Charles Haddad, criticizes Microsoft for its plans to donate $1,000,000,000 to 12,500 poor schools in the U.S, saying that the only reason they are doing it is because they want to take over and control the education market.

    It seems like MS will get criticized for making schools pay for software, yet they also get criticized for donating software.

    (Automatic -1 for not being anti-Microsoft)

    --
    I Heart Sorting Networks
    1. Re:Double standard by Macrobat · · Score: 1

      The reason MS is criticized for this is because the price is supposed to be a part of punitive damages, and it costs them next to nothing to stamp out a jintillion copies of Windows. It's like paying a fine for fraud with counterfeit money.

      --
      "Hardly used" will not fetch you a better price for your brain.
    2. Re:Double standard by chrisv · · Score: 1
      It seems like MS will get criticized for making schools pay for software, yet they also get criticized for donating software.

      That's more likely because of the fact that in the long run, these schools that MS is donating software to will end up paying the Microsoft Tax that we've all grown to know and hate.

      Besides, once they've got their foot in the door, most places won't turn back so quickly. "It's here, and we've already spent $xxx making it work...".

      The software may be donated software, but it's never actually free. Sure, you don't have to pay for the $100 software tax, but you still have to have the people around who are knowledgeable enough about said software in order to make it work properly. The same is true for all pieces of software, Linux included.

      Until Microsoft can provide the bang-for-the-buck that other alternatives can provide, I think that they'll still be criticized for moves such as this.

      --

      Dogma: Dead (mostly because your Karma ran it over)

  78. -1 clueless by jslag · · Score: 1

    But let's say you have 200 systems, with a mean time between failures of 56,000 hours each.

    That's one failure every 12 days, more or less.



    Looks like your grasp of statistics is about as good as your grasp of systems administration.

    1. Re:-1 clueless by Syberghost · · Score: 2

      Ok, I'll bite. How do YOU calculate it?

  79. fazekas.hu by Anonymous Coward · · Score: 0

    Hi,
    Fazekas is a K-12 public school in Hungary equipped with a network of one gateway, 5 servers and about 100 workstations in classrooms, offices and labs.
    The servers are all Linux (SuSE 7.3), the clients are dual-boot Linux and window$, but students access their unix home directories from windown as well. Of course, everyone starts off using windown, because that's what they know, but after one or two semesters many begin to discover Linux.
    The network started off as a 2-server 12-workstations government-grant, but it has been so successful that the school got the rest of the equipment as a reward from the city council as the most successful secondary-level IT education institute. We've been using Linux as our server platform from the very first day. Now, we have about 1000 users, and a constant network load around 80% BOTH WAYS!
    The webpages are Hungarian only. Sorry about that!

  80. Send the story to Katz by bstadil · · Score: 1

    Maybe Katz will do a write-up of your interesting story.

    --
    Help fight continental drift.
  81. My company just hooked up Wentzville, MO by Mustang+Matt · · Score: 1, Redundant

    www.wentzville.k12.mo.us, hosted on SuSE 7.3 running apache.

    We setup their email, we also setup DHCP, NAT, and a firewall.

    We're going to replace all of their existing novell junk with linux.

    They will save a ton of money over the years with the new setup (vs paying novell licensing fees).

    They are very happy with it as well.

    --
    The man who trades freedom for security does not deserve nor will he ever receive either. - Benjamin Franklin
    1. Re:My company just hooked up Wentzville, MO by Anonymous Coward · · Score: 0

      http://www.hocking.edu/computer_and_information_te chnology/index.htm

      my sister goes here and they use linux quite a bit...and i believe most schools should, because linux/unix is the defacto standard when it comes to large scale networks/supercomputing.

  82. Linux behind the scenes at an HS by justinstreufert · · Score: 1

    The high school I went to (a private school in Maryland) adopted Linux about four years ago, but for use as a network server. They had it in a closet, hooked up to an array of six 56K modems. The modems were load-balanced together to provide a pseudo-broadband connection MacGuyver would have been proud of.

    They saved a lot of money with Linux, but probably lost it all again due to the contractor the clueless Admin used to cobble it together. GAH.

    (Side note: A few friends and I offered to do the networking and Linux admin for them, but our FREE proposal was turned down due to "security concerns." Of course, later, we rebooted the Linux box into single-user mode and added ourselves a root account, but that's another story)

    Justin

    --
    "Why would God give us a waist if we wasn't supposed to rest our pants on it?" - Rev. Roy McDaniels
  83. Brazilian Federal Universities by Anonymous Coward · · Score: 1, Informative

    I am a brazilian Computer Science student. Don't
    know very much about schools, but I can tell about
    universities.

    Government here in Brazil do not care very much
    with the public Universities, so they're always
    short of money. Federal University of Parana,
    where I study, is one of these. Years ago the
    Computer Science laboratory used Windows on most
    machines. Besides the blue-screens and security
    problems, Microsoft made some obscure legal
    actions that implied in heavy charges. These
    became just too heavy to pay as the computers --
    mostly Pentium 100-150, even 486's -- became
    too weak to run newer versions of Windows and it
    software.
    Then, we installed Debian GNU/Linux on all machines.
    With a few expensive X-servers, all the other
    machines are now X-terminals (many of them
    diskless), thus saving those old computers.
    Debian give us all the software we need to study,
    and is far more fast, stable and secure than the
    old Windows "solutions". And it's all free.

    I believe there are more cases like this in other
    brazilian public Universities. A little research
    will help.

    Federal University of Parana is at
    http://www.ufpr.br
    Computer Science department at
    http://www.inf.ufpr.br
    Prof. Marcos Castilho, the person you should send
    e-mail about our experience with Debian:
    marcos@inf.ufpr.br

  84. Less $ on licenses = more $ for teachers by SloppyElvis · · Score: 1

    Good point, instruction is expensive.

    A good source of boxes is from recycling machines that can't run windows anymore.

    Sorry, maintaining a good machine requires less time than patching for viruses every day.

  85. In a related news by jsse · · Score: 2

    Here in Hong Kong there's a similar project(in Chinese) like ' PCs for Kids'. At first I thought it's doomed, until I know Microsoft is involved.

    Well Microsoft does not alway mean to charity - especially when a shiny Microsoft logo is behind it.

  86. Since when is free software only in Linux by Vicegrip · · Score: 2

    Many GNU tools have been ported to many other OSes including MS Windows.
    There are a host of free software applications available for many OSes including MS Windows.

    This, not to mention that, Linux distributions have achieved the point where most previously 'complexe' administration tasks are now done inside friendly GUI applications.

    GNU's Not Unix is an acronym with a meaning that seems sadly forgotten in some of these discussions.

    I personally think that teaching teenagers why they should be concerned about their intellectual heritage and about free software an important proposition regardless of what OS they are running.

    --
    Do not spread "09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0" over the internet, thank you.
    1. Re:Since when is free software only in Linux by krasni_bor · · Score: 1

      This is an important point. I'm a new tech coordinator in a public high school and we're installing python, vpython, perl, and a bunch of other free as in beer and/or speech software on our Windows 2000 and Mac OS X images. I thought about installing Cygwin but that seemed a bit much. Once I catch my breath I'll work on setting up dual-boot configurations.

      --Tom

  87. cunt tease by Anonymous Coward · · Score: 0

    i'm nothing but a cunt tease. fuck you

  88. The problem with acceptance is the educators by Monkey · · Score: 1

    I work for a government central IT agency. A couple years ago, there was a requirement for a shared infrastructure between all of the K-12 schools in our jurisdiction.

    We came up with what we thought was a really great Linux solution based on K-12 Admin.

    After submitting our proposal to the education types, they were all for it.
    A few weeks later, Apple sent some slick marketing representatives to talk to our clients and much to our disbelief, the schools bought into it. Today, they are running an expensive, proprietary Macintosh solution, and I find it grimly amusing that it isn't meeting their expectations.

    I guess what my point is, is that teachers have a similar attitude to other highly paid professionals like lawyers or doctors. They think they always know best. To them, if you're not an educator, you're an idiot. This makes it difficult to sell them on anything that doesn't have strong marketing hype, flashing colors and smooth talking sales reps. The unfortunate thing is, in most educational environments, these are the people who have the final say as to what products are used.

    1. Re:The problem with acceptance is the educators by krasni_bor · · Score: 1
      I guess what my point is, is that teachers have a similar attitude to other highly paid professionals like lawyers or doctors.

      First of all, teachers are poorly paid professionals.


      They think they always know best. To them, if you're not an educator, you're an idiot. This makes it difficult to sell them on anything that doesn't have strong marketing hype, flashing colors and smooth talking sales reps. The unfortunate thing is, in most educational environments, these are the people who have the final say as to what products are used.


      You're mixing two issues. Sure, teachers are likely to be swayed by glitz, like most humans. Good teachers do know what would be helpful to them, more than anyone who hasn't done serious classroom time as a teacher. Teachers should make the choices, or they just won't use them.


      Our school was recently approached by some folks from the University of Chicago to work on a project developing some student information software that is more "teacher-centered" instead of "administration-centered." This ties in with some work I've started with Zope. I'm not positive that this will turn into an open source project, but considering I talked their ear off about free software when we met, and they decided to work with us, I think there is a good chance.


      Seems clear to me that foundations and universities are going to have to get behind free software in schools if we are going to make a lot of progress.

  89. Tracking licenses is a major operations headache by JimmytheGeek · · Score: 1

    In my experience as an admin, the busywork involved in proving the right to use software is a major resource sink.

    For example: CA has *terrible* product activation routines that take longer to complete (if successful- not at all a given) than the installation itself. They are also spam vectors.

    Checkpoint firewall products are also a PITA. Long strings to enter, confusing docs regarding which license keys to enter where (fear upgrades), topped by a buggy compliance routine that somehow confuses ip addresses behind the firewall, so it comes to believe you are out of compliance and pegs the cpu with multpile license violation log messages/second. Piss on them. There is really nothing significant they offer but heartburn.

  90. Here's a link for ya by Anonymous Coward · · Score: 0

    http://www.mandrakebizcases.com/

    Look in Education heading for some high school and university cases. Good luck.

    DigitalOx

  91. Free Software forbidden ... by Anonymous Coward · · Score: 0

    I have a friend that teaches in a local high school with whom I've discussed the merits of free software, and how it could be used in his school. There are several reasons this isn't going to happen at his school soon, or possibly ever. First of all, and most importantly, it is explicitly against school-board policy. Installation of any unauthorized software on computers under the school-boards juristiction is forbidden. ONLY Windows and other commercial software packages for which they have paid large licensing fees, will be considered authorized. The school board (and most teachers) don't understand the whole free software concept, and stick tenaciously to the idea that 'free software' is another expression for 'pirated software'.

    Secondly, most teachers are almost completely computer illiterate. They can barely manage the 'Window's devil they know'. They recoil in fear and dig in their heels at the first suggestion of anything different.

    All I can say to anyone wanting to employ free software in our schools as both a money saver and a teaching aid is good luck! It would be easier to get Playboy sold in the cafeteria....

  92. **volunteer** by Erich · · Score: 5, Insightful
    I think that most of us that use linux on a regular basis know that given a good setup (reliable server with a bunch of diskless netboot clients, all running KDE or Gnome or whatever with SomethingOffice installed, and doing an autoRPM or apt-get upgrade every few days automatically, and a nice fast postscript laser printer) know that a good setup can require basically ZERO administration after setup (and not too hard to set up for someone who knows what she is doing).

    The problem is that when someone in the education system goes to CompUSA or their local Mom and Pop computer store, they don't get someone who will set them up with that sort of thing.

    So here is what you need to do: volunteer your time. Set up that computer network for your school, especially those of you with children in it.

    You can also help the school with find good deals on businesses wanting to get rid of equipment ... those old PII 233's that they don't want to use anymore can be a big tax writeoff for them, and would work fine as a diskless workstation.

    But the problem is that most school teachers don't have much of a clue in the realm of computers. They don't know how to make a dozen half-broken computers into a lab. So volunteer your time and help them get set up!

    --

    -- Erich

    Slashdot reader since 1997

    1. Re:**volunteer** by gmhowell · · Score: 2

      This is a good idea, but...

      Not all pricipals, administrators, etc. are interested in volunteer work. I think it falls back on the old "who are you going to blame if it breaks" scenario. Some are also afraid that only pedophiles want to spend time in school. The best opportunity is if you are a parent, and volunteer or speak up at a PTA night. Unfortunately, most others are often screwed.

      Good luck with it though.

      --
      Jesus was all right but his disciples were thick and ordinary. -John Lennon
    2. Re:**volunteer** by lynx_user_abroad · · Score: 1
      Schools are an interesting sort of business.

      The users (students) have virtually no say over what tools will be deployed, but then again we're not expecting them to produce anything, or to innovate.

      The people specifying the tools (teachers and administrators) are primarily after a tool which will get out of their way and let them teach.

      The people supporting the tool (who? a teacher, maybe, or an overstreched support staff) are so non-existant as to be politically powerless.

      The people paying for the tool (the school district in the case of a Public School, school regents in other cases) are usually much closer to the money than in a typical corporation, and at any rate are not expecting to garner a profit or expand their market share.

      This would appear to be an ideal setting for a free-software solution. So why don't we see this happening everywhere?

      Think about how a school goes about purchasing a computing environment; for any reasonable large site it's still a case of "meet with the sales folks, post the contract, accept bids, award the contract"; an art software marketers (like Microsoft, Apple, and even Intel) are well practiced in.

      It occurs to me that a company like Red Hat could could really clean up in this market by acting as a go-between for the free software community. I imagine it would work something like this:

      Accept resumes' from *volunteers* in selected geographic areas.

      Organize the appropriate ones into sales teams, providing them with sales material and a 'heads up' when a school has opened a bid, and training in how to submit a bid based on Red Hat Linux and other free software components.

      Organize other *volunteers* into teams of support personnel to handle the remote administration of the resulting contract wins. (Hardware support would be sub-contracted out to a local firm, as happens in most of these contracts.)

      Red Hat benefits by:

      Brand Exposure to it's emerging market.

      The support team volunteers become the "farm pool" from which future Red Hat Linux support engineers can be culled.

      Attacking the account with a dirt-cheap, motivated, locally connected sales team, and a dirt cheap and motivated, if not locally connect, support team. About the only thing Red Hat would have to buy is the T-shirts ;-)

      And while I imagine some people would be hesitant to volunteer their time to help out a commercial organization like Red Hat, if they play up the fact that the real beneficiaries are the students, as well as pledge the net profit from these accounts (if any) to an educational cause, this could turn out to be a very powerful rallying flag. They could get a lot of mileage out of the "no vendor lock in" and "not pre-addicting our kids to Microsoft" memes alone.

      Just seems like one of those cases where a little bit of organizing could go a long way.

      --

      The thing about things we don't know is we often don't know we don't know them.

  93. SDU In Denmark by Anonymous Coward · · Score: 0

    I know that the computer and mathematical dep. of SDU (Southern Danish University) uses only Linux. In the start of a new year the new students are all given a course in how to work with it - and apprently it works and saves the university a lot of money.

    I myself have many times tried to 'convert' my local high school but there's always one barrier - the teachers don't know enough about it and the computer teachers don't want to convert because they are use to Windows.

  94. What is your goal? by 5KVGhost · · Score: 1, Interesting

    So, you're trying to convince schools to start using free software. Why, exactly?

    What educational objective are you trying to achieve? How will free software bring you closer to this objective? Which free software in particular? How will this benefit the average student?

    Who will train the faculty? Who will support the installations? Will this cost money? What are the advantages to the institution, aside from the lower initial cost?

    These are the kinds of questions that any responsible educator should ask, and you have to be prepared with good answers if you expect to make any progress. If you don't have those answers, then maybe you need to rethink your goals. Free software may, in fact, be the solution, or part of the solution. But you can't start from that assumption and expect others to leap on your bandwagon without a second thought. Except on Slashdot, of course.

  95. ummm, just a sec... by primenerd · · Score: 1

    If the logic that whomever dominates the education market will by default dominate the rest of the OS market were true... Macs would rule the world.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    1. Re:ummm, just a sec... by eWulf · · Score: 1

      Here in the UK we would all be using Acorn Electrons or Archimedes'. God those were the days.

      --
      "If Stupidity got us into this mess, then why can't it get us out?" - Will Rogers
  96. I don't know about save, but we use it extensively by phoenix_rizzen · · Score: 2, Insightful

    Our district (K-12) uses open-source and free software fairly extensively. In the past year, we have:
    -- moved all web and e-mail servers from NT to RedHat Linux 6.2
    -- put in FreeBSD 4.x-based firewalls in all the high schools and admin buildings
    -- replaced the IBM NetVista Proxy Server software running on NT with proxy servers running RH 6.2, Squid, DansGuardian, and the like
    -- implemented a very successful pilot of the Linux Terminal Server Project thin-clients in two elementary school labs (one school only uses Windows on administration desktops)
    -- promoted StarOffice 5.2 as an alternative to MS Office, on both Windows and Linux
    -- most IT desktops run either FreeBSD, RH Linux, or both

    Currently, all servers in the district run either FreeBSD, Linux, or NetWare. There are no NT servers left in the district.

    Most computer labs run Windows 95/98, a couple 2000, and one or two are still running 3.1. Some are now running Linux, with more planned for next year.

    The goal is to have all elementary school labs running Linux, all servers to be running FreeBSD or Linux, and all high school Internet access to be policed by Unix servers.

    Working quite well for us. Saved $30,000 is licensing fees so far (that's for the IBM software), enough to hire another tech if needed. Should see greater savings as time goes on. Also were able to purchase 200+ lower-end PCs for the elem labs as opposed to just 30 high end machines -- that's close to 30 labs for the price of one -- as the elem labs will be running Unix.

    The interesting thing here is that the teachers and principals are behind this 100%, and are clamoring to get their labs set up. It's too bad there are only 5 techs for 50+ schools. :(

  97. One example (not k-12, but heck) by dilger · · Score: 2, Informative

    The Networked Writing Environment would probably exist without free (freedom or beer) software, but the applications available to students would be very limited. We have 150 seats in five classrooms, using thin clients (SunRays, NCDs, etc) with Solaris servers.

    If we spent only $100 per seat on software, that would be $15K -- and I bet replacing StarOffice, The Gimp, our HTML editor, tkMOO-lite, exmh, Xplore, and other applications would cost a lot more than that. Not to mention that Solaris is free (beer) for educational use.

    I'm sure there are also cost savings from using the client/server model instead of 150 workstations. We have two system administrators and one half-time graduate student, and a few hangers-on like me who poke stuff around when time allows. :)

    The NWE has been around since 1995. With education budget cuts in Florida reaching into the hundreds of millions this year, and maybe more next year, I don't see the Solaris/free software setup being replaced with a non-free model anytime soon.

    cbd

  98. free software by vicious_sloth · · Score: 2, Informative

    DO college's count, becuase here at The Cooper union most of the stuff we run is Win95 and Red Hat Linux. Mostly becuase this school does not charge tution, does it see the value in running Free software like Linux. They've made it work rather well. and espcially since all the computers are at least 5 years old.

    --
    Sun is Warm, Grass is Green
  99. Why bother? by snipingkills · · Score: 1

    Why should we even bother with computers in the classroom until students get into high school? I live in Southern Louisiana and know for a fact that the elementary schools in my area have faster computers than my personal computer at home.
    The majority of the computers that are in classroom in the high schools out here are not used regularly because the teachers either don't know how to use the software or they are intimidated by the technology at hand. I believe that the high school out here has two computer labs running 733+ Mhz computers where people browse the internet and do research through online databases. All of those PC's run Windows 98 and Netscape Navigator connected through a Novell gateway. Personally I believe that thin clients running linux/netscape/X would be a better deal.

    How many people would notice the difference anyway? IF they have reports to type as well why not through StarOffice in the mix too. The schoolboard contracts all of their networking and maintenace jobs. The IT staff on hand is clueless about the most basic Windows options as I have had discussions with them before in the past.

    It isnt that people are too ignorant to use computers, they just are intimidated by the technology.

  100. Not Just Kernel Source for education by Vinson+Massif · · Score: 1

    There's more than just kernel source as a teaching resource. The shell scripts that are part of any distribution can be used as examples of basic programming concepts; likely with better results.

    --
    "Remember, any tool can be the right tool." -- Red Green
  101. Re:It isn't just free software, it's freedom by i_am_nitrogen · · Score: 2, Informative
    Your argument, while sound, lacks a few key points of information:
    1. How much does it cost to maintain a Windows network?
    2. How much does it cost to maintain a Linux network?
    3. How many kids are going to notice that you switched the color of the borders around the browser they use to check their e-mail when they should be working?

    When I was in high school, my school had 6 or so labs of Windows 98 boxen. In especially the writing lab, during any given 90 minute class period there would be at least 5 or 6 BSOD's. There had to be a semi-admin in each room, plus one overworked guy over the whole school. I recall hearing numerous discussions about threats from the SPA to shut down the school's computers if they couldn't produce a license for each computer, etc. Viruses were a major problem as well. They had some insane security system set up using Novell Netware, and because Windows 9x is inherently r00ted the moment you install it, there are bound to be places they missed (and there were, trust me -- I know). There were many a day when my buddies and I would play Starcraft instead of work, simply because we could. In a Linux system, you need a third of the people, and they can administer each computer from a remote location. Most of the school's admin's time was spent running from one end of the maze-like structure to the other. Tools like ssh, and even basic UNIX security principles (with a more granular system such as SELinux even better) would've saved a lot of time and money. Even though a Linux admin costs more money usually, they need fewer of them.

  102. Oh that's a bunch of bullshit... by PeachesPi · · Score: 0

    I don't know about you guys, but I'm able to check out MS products (including visual studio + MSDN) for free from my library. I can also purchase MS OS's / Office for 10 bucks at my university bookstore. It's all legitimate and obviously quite cheap. If they're going to offer it at such affordable prices, why wouldn't I take them up on it? Linux may be free, but most of the US population doesn't know how to use it. It's going to take awhile before it becomes common place in K-12 when a lot of teachers and parents don't know how to support their students /children. Most of the places around here (Ohio) still use Macs (and very old macs at that) in the schools even! As far as usability goes, Linux isn't very intuitive and not very usable (IMO), and it would take a great deal more time to teach than a mac / windows system. Why don't you spend the time that you would otherwise spend teaching the students how to use Linux and spend it educating the children on core subjects? The quality of education in a lot of places around the US is highly lacking. How about we focus on a better education before we go throwing linux at students.

    --
    Do you chat your mother with those fingers?
  103. Web/e-mail stations by swankypimp · · Score: 1
    When I was in college, we had a number of aging Windows machines all over campus (in the cafeteria, in the Student Union, etc) that were web/e-mail stations. You could browse the web, launch an e-mail client (Mulberry?), and telnet/ssh, but not write a paper or whatnot. This could easily be done as a Linux solution with minimum fallout, since the main reasons non-geeks shy from Linux/BSD are (1) logging in (create a user that's always logged onto the web station), (2)configuration: "how do I install program x? Can I do it without becoming root? And I first need the widgets from such-and-such toolkit, and then when I run the installation script it gives me error y..." and (3) no Microsoft Office (Sorry, kid, you have to go to the licensed Windows machines in the main computer lab for that).

    Since these web stations won't allow these activities, and web browsers are fairly standard, you run less of a risk of confusing the average student than with a computer lab full of Slackware machines. This is a good way of introducing students to the web, and would require less administrative overhead since users can't do anything but execute programs ("I deleted all those 'dot' files in my directory. Is that bad?").

    --

    --All your stolen base are belong to Rickey Henderson
  104. My School Uses it by Anonymous Coward · · Score: 0

    We run a dual pentium pro 200 with slackware 8.0 to act as a dhcp server and ghost image server. dhcp in Linux is defintley better than M$. My school in FL we have a full time sys admin and a team of 12 students to administer all the computers.

  105. Computers Allow For Otherwise Implausible Methods by SloppyElvis · · Score: 1

    ... of Analysis and Communications.

    For certain mathematical and statistical problems, computers give people a means (not an end) to learn methods of analysis far too time consuming to perform by hand. Likewise, computers give people a means of communication not possible in their absense.

    Having computers in schools allows students to develop an understanding of where, when, and how to use these iterative methods. This falls under 'rithmetic.

    Like all sciences, computer science has its own language. Knowledge of the English language is usually not enough if you want to read a white paper. This falls under reading.

    To contribute to the science of computer science, one must know this language well enough to compose in it. This falls under writing

    By your argument, physics, biology, and chemistry are also unnecessary components of the cirriculum.

  106. Apache + FP extensions by CaptainSuperBoy · · Score: 2

    Why not use Apache with frontpage extensions? That way you get to use your PHP/mysql, and your boss gets to use Frontpage to update his pages.. everyone goes home happy.

    1. Re:Apache + FP extensions by jeeryg_flashaccess · · Score: 1

      Yep, the install CAN be a little tricky but if you read the tutorial on linuxnewbie.org it's soooo simple. My company has been using it for about a month and a half and it works flawlessly. My main reason for setting it up BTW was so I could convert our NT server into another linux server! BAM! If you have any questions i'd be happy to answer them as I wrote down the entire process for installing FP 2002 extensions on Linux with Apache. Cheers!

      --
      Life is like pants... fit in or you don't fit in.
  107. Free Software on Schools in Brazil by j_bittencourt · · Score: 1

    The Government of Rio Grande do Sul, a state of brazil, is using Free Software in 5 public schools as a experimental project. It will reach 2.220 public schools until june, 2002.The government will save about U$ 16 million using Linux and StarOffice. You can see more details on http://www.redeescolarlivre.rs.gov.br/. Unfortunaly you must speak portuguese to understand. :-)

  108. Need for compatability by primenerd · · Score: 1

    It needs to be remembered that the majority of HS students are not technically savvy. Imagine you are a member of the cheerleading squad, you want to write a report and check your hotmail account, are you going to care about the cost of the underlying software? No, you want the MS Word doc you wrote on your Daddys laptop to open (and save) correctly, you want the floppy or zip disk you brought from home to mount (of course you wouldn't know what mounting a disk is). You want the internet browser to function correctly and you want to be able to view the latest flash content at MTV.com. Any system in an education market would have to be configured to be totally transparent to the end user. Remember the end user does not care how cheap or easily configured the software is.
    On a side note, since the majority of schools use and continue to buy Apple... wouldn't there come a point where OSX is prevalent enough that ported open-source software would make sense?

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  109. Then you should read this... by Anonymous Coward · · Score: 0

    "The point of education is not to prepare little business people. And besides, I think that you underestimate peoples intelligence when you suggest that just because the learn KDE or Star Office that they're not going to be able to figure out Win XP or Microsoft Office. Come on. It's a damn GUI. They're basically the same thing. I don't buy this argument at all."

    Wrong! Well, right and wrong. The current primary education system is supposed to educate K-8 students on the primary and basic language, math, writting, communication, and science skills... it's prep-school for High School. HS is supposed to give students more advanced concepts, hone their abilty to think freely and with clarity (nominally from multiple perspectives), and prepare them for adult life. This INCLUDES working and living in society (which are intertwined). By extension, they are being prepared to enter the working world, society. This preperation also transfers to College, which is more of the same.

    Alternately, it is indeed just pure preperation for entering the working economy. It depends on your view point. I prefer the second, given how poor the majority of educators and education administrators are, the lack of funds, the malaise in education technologies and methods, and the government pentant for steering people down the middle and away from controversy or independent thought.

    Additionally, the MAJORITY of people surely can figure out a GUI to some degree (though most far less than IT pros and support people would want them too). However, most people are resistant to serious change, and there are serious and distinct differences between the XP/Win/NT GUIs and Linux GUIs (especially the less popular and geeky linux GUIs). Small, minor, subtle change over the years is easy for most people, and MS has excelled at this in their GUI designs... note that XP is probably the single most radical divergence or change in the GUI in 7 years... big changes are not so easy and most people cannot adapt or refuse to adapt... it's in our nature, for good or bad.

    "I just convinced the Psychology Dept at UCLA to install GIMP on 20 or so machines running OSX in a lab rather than Photoshop for every one. This saved the dept around $7000 with one change, and for what students do with photoshop the GIMP does exaclty the same. "

    You are not seriously suggesting that GIMP is the same or even close to equal to Photoshop are you? Granted, alot of students probably would not need the advanced features of PS, nor do they want to learn them... but what about the students who need advanced features or want to expand their knowledge and learn them... you just screwed them. Just an observation... I HATE GIMP, free or not... it is so often misconstrued as a competitor for PS, when in fact it is not even in the same ball park.

    1. Re:Then you should read this... by phlako66 · · Score: 1

      You are not seriously suggesting that GIMP is the same or even close to equal to Photoshop are you? Granted, alot of students probably would not need the advanced features of PS, nor do they want to learn them... but what about the students who need advanced features or want to expand their knowledge and learn them... you just screwed them. Just an observation... I HATE GIMP, free or not... it is so often misconstrued as a competitor for PS, when in fact it is not even in the same ball park.

      Sure am. I've used both extensively over the past 4 or 5 years and I don't see many advanced features in Photoshop that aren't in the GIMP. Besides, these people aren't high level graphic designers and most k-12 kids aren't either. Photoshop is overpriced for what it is. It's not the features that make good graphic designers, it's creativity.

    2. Re:Then you should read this... by Anonymous Coward · · Score: 0

      I have used it too, and there is a HUGE world of difference, even at my intermediate skill level.

      And I wouldn't suggest that K-12 kids are not able and capable of using any and ALL features in PS (or Gimper). We had kids in our district get scholar ships on their PS and graphic art skills, and a few even went directly into CG houses on the West Coast (including one who was a key designer and artist for Bab 5 CG). Careful now... don't be little the youth, that's one central issue in the education debacle our country faces...

    3. Re:Then you should read this... by phlako66 · · Score: 1

      I'm not belittling the youth, just suggesting that it wasn't photoshop that made these kids good designers.

      What are the HUGE differences that you notice between the two?

  110. Teachers knowing file permissions by mgkimsal2 · · Score: 2



    Perhaps teachers SHOULD know a bit more about file permissions. If they did, they'd have a much better understanding, which could be taught to the students, if often only by example. More people understanding file permissions (whether under Win or Lin or whatever) will generally be more knowledgeable about at least BASIC security issues, and will be more prepared to deal with viruses and worms in the future (which will surely never completely die).

  111. Come see a 4th grade Linux Classroom right now... by pnelson · · Score: 4, Informative
    http://k12ltsp.org/classroom.html

    It works, it's fast, it's free, we like it.

  112. More than 100 Michigan Schools running FreeBSD by Anonymous Coward · · Score: 0

    I worked for a couple years as a student intern at Michigan State University working for the SCNC project.
    It takes FreeBSD as the server OS and the programmers hack it up a little and also create custom web interfaces to do admin stuff that normally would be done by a unix admin.
    I don't know if it saved any schools, but has brought the internet, samba, news, email, and many other internet services to more than 100 different Michigan schools. Link provided to the SCNC website below. The project was also taken over to Africa and is serving some schools over there too.

    SCNC Website and history

  113. NYC schools using linux by factor2 · · Score: 1

    Two public schools in Manhattan use linux.

    The Beacon School and http://www.beaconschool.org, as well as Stuyvesant, http://www.stuy.edu

    Both have developed simple software tools using open source licenses.

    --
    lambda = h/p
  114. Brazil Rulez (need translation) by Anonymous Coward · · Score: 0

    http://olinux.uol.com.br/news/open_news.phl?id=575 9

  115. you could try this. by jslag · · Score: 1

    http://www.efunda.com/math/reliability/reliability .cfm

    But the real issue here is deducing something about a group of units, based on one unit's MBTF. Some discussion towards the bottom of this doc: http://www.hardwaregroup.com/faq/gen_mtbf.htm

    1. Re:you could try this. by Syberghost · · Score: 2

      In your second link, the very first part of it says I'm right; if you have two disks eith an individual MTBF of 10,000 hours, you'll have a failure every 5,000 hours on average. Which is exactly what I said, only I was using 200 units with an individual MTBF of 56,000 hours.

      I pulled those numbers out of my ass as examples, but the math was 100% correct, according to the very links you quoted as rebuttal.

  116. Would OpenSource create the shift in the OS market by mcdade · · Score: 1

    This could be the initiative that is required to bring Open Source OS's to the enduser desktop. I remember back in the school days of wanting whatever computer was in the school system. Then you know how it works (or are taught) and moving files and programs back and for is simple. You already have a network of friends who will have the same thing too. I remember first wanting an Apple cause that's what we used at school, and I got an Apple. Then later IBM's with MS products were used (in highschool) so when it was time to get a new computer .. you guessed it .. IBM based machine with MS on it.

    So as it would work out, the child would get into Linux (pick any distro) and StarOffice, and what ever other software at school then want the same thing at home too. They would teach mom and dad how to use StarOffice to work on thier .doc files from work. Little johnny would be asking for a PC with linux on it pretty soon...

    Only problem is kids love games.. and who's still got the best gamming platform.. Microsoft.. damn them..

  117. SHUT THE FUCK UP!!! by Anonymous Coward · · Score: -1, Flamebait

    But, I digress. I absolutely agree with one of your points: A good teacher in the classroom is infinately more important than a computer in the classroom.

    SHUT THE FUCK UP COCKSUCKER!!! A good teacher is complete shit! Microsoft is the best teacher. "Good teachers" should be exterminated. You make me fucking puke you stupid faggot. YOU ARE A PIECE OF SHIT! You sick FREAK!

    1. Re:SHUT THE FUCK UP!!! by Anonymous Coward · · Score: 0

      Whoops, another Mentally Ill post.

  118. Wrong Answer! by Greyfox · · Score: 2
    About the only occupation that I can think of that wouldn't require at least some direct interaction with a computer on a day-to-day basis is garbage collection. And I could be wrong about that one. And a fairly high level of computer literacy is required at any university -- many of them require incoming freshmen to own a computer now.

    In many cases the poorer students will not encounter computers at home. If they don't encounter them at school, we will be very effectively leveraging the digial divide into a more serious socio-economic problem. And I don't think that is what this country's about. At least not intentionally.

    --

    I'm trying to teach myself to set people on fire with my mind... Is it hot in here?

  119. In Norway by kiowa · · Score: 1

    Here in Norway there is an organisation called SkoleLinux working for deployment of Linux in schools. It's currently working on an easy installer and proper translations of Office-products. It just recently got an 200.000 NOK in funding from the Education and Research department.

    --
    =-kiOwA-> EOF
  120. California School that uses Mandrake... by Rob.Mathers · · Score: 1

    There's a story on the Mandrake website about a California school that has replaced their entire (very large) IT department, as well as other parts of the school with computers running Mandrake. They still use macs for most of the student work, but are slowly switching those too.

    --

    My other sig is funny!
  121. The Chico Unified School District... by cduffy · · Score: 2

    ...has several Linux boxen up in different schools (one primary, one junior high). While the clients run Windows and MacOS, the fileservers and other backend systems are Linux boxen; thanks to Samba and Netatalk, they can share files to both sets of clients simultaniously, and they require very little maintenance (I do volunteer work when they go down -- it's been about a year since I touched one of them, though a few months less than that I wrote a trivial python script recompressing all students' GIFs into JPEGs for one teacher adminning the labs).

  122. A student learns to think, by thinking, not by by HanzoSan · · Score: 2



    Not by doing work, homework, tests, paperwork, all that will teach them is how to complete a task in a timely fashion.

    You teach a kid to think, by having discussions, having the kid write about the discussions and share their thoughts in debates. Having kids research on their own independently and gain knowledge, and then form their own conclusions.

    --
    If you use Linux, please help development of Autopac
  123. It's the other way around by Anonymous Coward · · Score: 0

    They got fucking owned.

  124. Green men by Macrobat · · Score: 1
    Help me out on my mythology, here. Trolls were the "green men" of myth, right, corrupted tree spirits? (Or am I mixing in a little Tolkien here?)

    So what does that make a spirit made of corrupted astroturf?

    --
    "Hardly used" will not fetch you a better price for your brain.
  125. logic only counts!!! by air1 · · Score: 0

    if schools can save money using free software (linux or not) then it's good!!!

    the whole idea that people can't switch between gui is just wrong
    schools should just teach you the basics of using a spreadsheet program wether it's Gnumeric or Excel you just have to click on the little printer and there you go it's printing.

    and the formulas to feed your spreadsheets are what really matters, teach a kid to understand that and he'll be ready for Gnumeric 5,star office 22,or MS office 2006

    now maybe there's also a fault in our educational systems in that we learn to only be proactive in a specific environment, instead of learning the basic logic of something!!!

    by the time they get out of school, students are not expected to be power users of any piece of software anyway, how many kids do you know learnt how Win98 works just from using it in school???

    i could teach anybody how to use KDE, as long as they know they need to click here to
    connect to the internet, here to launch a browser, even my granny!!!

    at home i'm teaching my flatmate how to play a little with linux, just the basic things, and he's doing well, he prefers black box and windowmaker as window managers and the gnome if he needs a desktop
    the result, he knows just as much as one should know about the internet by the time one gets out of school!!

    windows or linux really doesn't matter, it's the logic that counts!!

    --
    if the sites slashdot links to get slashdoted, how come slashdot itself never gets slashdoted??
  126. Linux & Open Source by jcuzzola · · Score: 4, Insightful

    We have been successful in installing three Linux labs (approx 35 computers per lab) with Open Source software using the computers as thin clients (see LTSP.org). The system has been received very well by students and teachers. We were even able to give 486SXs with as little as 12Megs ram internet access - these systems are now in the classroom. We have approx. 10 schools scheduled for conversion to Linux by the end of 2002 with the goal of having all our elementary schools (60+) switched over in three. It's always an uphill battle but I feel we're fighting "the good fight". When they(Microsoft & others) tell you every open source initiative has failed tell them otherwise. I equate Microsoft with the movie "The Matrix" in which everyone goes on with their everyday lives while only a small liberated few no the truth. Our Linux Labs have worked better than anything Windows has ever given us for a cost that can't be beat.

    John Cuzzola
    jcuzzola@sd73.bc.ca
    1383-9th Avenue
    System Analyst/Programmer
    Kamloops, BC V2C 3X7
    School District #73
    Phone: (250) 374-0679

    1. Re:Linux & Open Source by brock10 · · Score: 2, Interesting

      What John didn't mention is that the trial schools were actually dual boot Win/RedHat. The kids preferred the RH (and that cuddly mascot) and simply didn't use the Windows. It was removed as a consequence.
      The potential to reduce tech support is also huge - the kids can't screw things up without some sophisticated knowledge. Can't say the same for Windows boxes! Now the techs can do real work instead of 'clean up' chores ;-)

  127. Me too! by kimihia · · Score: 1

    Plenty of me too comments, but here is another.

    Carey College in Panmure .nz, is using a Linux server on a 386/25 using recycled hardware. Their web site is hosted on Apache and uses a PostgreSQL backend.

    Desktops were Windows 95, and I think there may have been some Windows 3.11 too. (There was also OS/2 at one time, but that was replaced with Linux.)

    But that was when I was there - a couple of years back. I don't know what the story is now. I heard rumours of thin clients and application servers but haven't really kept up with it.

  128. GVSU - Linux usage by Anonymous Coward · · Score: 1, Informative

    Last I knew, Grand Valley State University, in MI,USA used a number of Linux distributions in it's classroom environments; including Debian, Red Hat and Mandrake.
    Granted, when I witnessed this it was in 300 and 400 level classes. However, it was the entire development/workstation environment.

  129. Seems be working fine in one school by Anonymous Coward · · Score: 0

    There is school I installed Linux at.
    It was running Novel and about 20 stations.
    Now the linux station is a Domain Controller for the 20 Windows pc (soon to change ( -:)
    There have been almost 0 problems.
    1. Printing color photo's could be better..(settings CUPS)
    2. Printing had to be updated do to a glitch (easy over internet via Mandrake update)
    3. Novel (one program) runs via Novel server emulator (mars) but then the desktops want to use the novel protocol for everything but I don't want them to just that one program. Samba for the rest. I think this is just a setting as well per station.

    Otherwise the principle commented that I am there so much less than the Novel guys.
    And the teacher confirs that she wishes she did this ealier.
    Thanks for the topic.
    Al
    nutile@ureach.com

  130. Re:Tracking licenses is a major operations headach by sirket · · Score: 1

    I am not a CheckPoint fan, but I have never seen their license routine cause problems. CheckPoint identifies every IP Address behind the firewall, whether they use the Internet or not, as a client IP. The reason is, as far as CheckPoint is concerned, any IP addrsss behind the firewall is an IP address being protected by the firewall. In that sense they are correct.

    As far as processor power required to print those messages, well a) it is not a significant use of processor power and b) if you are not in comliance, why should the product operate at its most efficient? Many companies would shut down the software if it were not in compliance, or perhaps refuse to protect more IP Addresses than you have license for. CheckPoint does not and they deserve credit for that.

    -sirket

  131. My boxen are haxored but I'm still l33t by Unknown+Bovine+Group · · Score: 1
    Can we please stop saying 'boxen'? It's just one more reason for a non-geek to want to punch you in the face....

    --
    m00.
    1. Re:My boxen are haxored but I'm still l33t by flacco · · Score: 5, Funny
      Can we please stop saying 'boxen'? It's just one more reason for a non-geek to want to punch you in the face....

      Yeah, well I'd punch you back, and then we'd be boxen.

      --
      pr0n - keeping monitor glass spotless since 1981.
    2. Re:My boxen are haxored but I'm still l33t by ScumBiker · · Score: 1

      Arrrrgggggh. That's pretty horriden. To the "Unknown Bovine Group" clown above, why don't you suck my hemmoroiden. I'll fscking talk^H^H^H^H type however the hell I want to.

      --
      --- Think of it as evolution in action ---
    3. Re:My boxen are haxored but I'm still l33t by tryfan · · Score: 1

      Yes! I agree!

    4. Re:My boxen are haxored but I'm still l33t by Anonymous Coward · · Score: 0

      oh my gawd thats funny!

  132. Teaching To What Is Used by elefantstn · · Score: 2

    I've heard this argument more than once, and here's how I always respond:

    "Yeah, I guess you're right. That WordPerfect for DOS training I got in high school [class of '97] is really paying off in the business world now."

    There's no point in trying to teach applications, because even if the one prevalent today is the one used when you graduate, it will still be totally different. Schools should be teaching general computer knowledge and UI paradigms -- give kids the tools to figure it out on their own. Teaching Word and Excel should be kept to one-week night classes and "...For Dummies" books; it has no place in the education system.

    --
    If it ain't broke, you need more software.
  133. Another Example by lnbertagnolli · · Score: 2, Informative

    Springfield High, in Springfield Illinois.
    They have a student organization, Students for Integrations of Technology and Education (SITE),
    and have established the first high school chapter of the AITP. Everything has been done with donated hardware/software/linux, by the students.Check it out:
    http://www.shs.springfield.k12.il.us/clubs/site/ in dex.html

  134. Here's one in sweden by Znork · · Score: 2

    Interesting thin client solution running linux on even old 486 computers.

    The implementing companys press release is here: http://www.codefactory.se/news/?1+1.

  135. "Need" for Windows / Mac by goatmon · · Score: 1

    Many elementary schools today are very dependent on software built for Windows / Mac OS. Packages like Accelerated Reader (a quizzing program with tests on every book imaginable), JumpStart edutainment software, Mavis Beacon Teaches Typing, WinSchool / MacSchool administration software, and a slew of other titles don't run well, if at all, under Linux.

    I would love to move our school to Linux on desktops, but I cannot afford the loss of some very valuable software titles, nor the cost of training teachers on a new platform.

    Until Linux gets a good, free windows emulator (i.e. when WINE meets its promise), or until these titles can be ported or replicated for Linux, there are too many sacrifices required for some schools to move to Linux. For schools that do not have any software yet, Linux may be a good choice, but for others the tradeoffs just do not seem to be worth it ... yet.

  136. Nimda == Your Fault by nuxx · · Score: 1

    If your machine got hit with Nimda that soon, you were obviously installing it after Nimda started going around. Since it was already going around, you should have known about it and taken necessaray precausions (eg: installing the OS with the network cable unplugged, only plugging it in to download and install patches AFTER IIS and Indexing Service have been disabled). If you (or whoever did the install) didn't think enough in advance to keep and properly install a machine securely, it's your fault. Linux won't save you if you're not bright enough to think ahead.

    -Steve

    1. Re:Nimda == Your Fault by evilpaul13 · · Score: 1

      Having to disconnect the network cable just to install the OS without being infected with a virus? Is that absurd sounding to anyone else?

  137. logic fallacy by Anonymous Coward · · Score: 0

    So he knows this isn't true, but now he needs us to tell him why? God exists, and yet only God can prove it?

  138. hamburg, germany by demon-cw · · Score: 1
    Right now my company is working with the local schools and the university to build a (you guessed it) linux based network.
    We're setting up a wireless backbone using cisco equipment (so not the most cheapest alternative, but afaik the most configureable) and linux based web/mail/groupware/whatever servers...


    No license-fees here. Only one Box of (SuSe) Linux.

  139. An open source elementry school by tyrani · · Score: 3, Insightful

    I am the system administrator for a moderatly sized private elementry school. When I started, the school had very few computing resources at it's 2 campuses. After making a list of what I wanted to accompish in 2 years, I added up the costs and found that they it would be beyod my budget to buy new workstations and build a dedicated server all based on commercial software.

    Here's what I've been able to create for the school:

    1 workstation for every 4 children
    So when a class is in the library there is 1 student per computer. They all run win98.

    I am working towards 1 laptop for each teacher
    So far there is 2, they are wirelessly 802.11b connected to the network.

    A dedicated Red Hat 7.2 server
    Squid proxy, web page filtering and monitoring Squirrel Mail IMAP web based e-mail, samba, LDAP student/teacher contact and vital information, a MySQL powered bookmark database, Apache Web server, and a digital picture gallery.

    Everything on the server is open source and works flawlessly. All of this would have cost a fortune to buy and maintain on a NT server.

    I am very interested in what software other people are running if they are doing the same thing that I am. Reply to this comment or e-mail me with what you run, I'd love to share tips.

    --
    rejected (19) accepted (0)
    Is there a psychological term related to getting your stories rejected on slashdot?
  140. School linux by vegardolsen · · Score: 1

    In Nortway, a group of programers have started making a linux distr for schools. It's called skolelinux (school-linux). The distro is (offcourse) free, and is now in a very early beta stadium. Also, many schools in Norway use Linux. All these projects have worked out fine. They usually use a really good computer as a server, and 486's as thin clients. check http://www.skolelinux.no if you know Norwegian :p

    --
    Sig e godt =)
  141. Strategy for getting Linux into public schools.. by Sparky9292 · · Score: 1

    I have six years experience teaching Advanced Placement Computer Science in a public high school.

    To introduce a non-MS OS, you will have to sell it to your computer science/Cisco/A+ teachers first. Those teachers are always hurting for extra dept cash for materials, and not having to be Microsoft's bitch for NT Server and Workstation licences would be wonderful. Just take an inservice day to do a Mandrake install on those select group of teachers, and you got the ball rolling. High school Cisco training programs require FTP servers, webservers, and other client/server software to make the labs interesting.

    Knowing how my business computer teachers operate, it would be a cold day in hell before they adopt Linux. They would not only have to learn a new OS, but also rewrite every one of their 32438430 dittos.

    There's also no textbooks or handouts for teaching at a high school level of Linux or Linux apps. Compare this with the phenominal amount of offerings for teaching MS software.

  142. Linux/OSS in Schools by Anonymous Coward · · Score: 1, Insightful

    "Free" software is in use here and there. I've not heard of any schools who were "saved" by its use, but I do know several schools who managed to save quite a chunk of money by moving some of their server functionality to Linux and FreeBSD servers.

    Coming from the perspective of someone who developers student/school management systems, there are two competing factors at work as far as getting open source solutions implemented in the schools:

    1) Microsoft's prices have risen drastically (and Oracle/Sun/IBM prices have never been particularly cheap), and this is forcing schools, districts and states to consider options that they might not otherwise consider.
    2) Perceptions prevent the adoption of open source solutions. Microsoft is trusted, no matter what their "tech" reputation may be, and support is infinitely easier to acquire. Oracle/Sun solutions are hellishly expensive, but they have a certain reputation for speed and stability. IBM solutions tend to waver between these two "poles". Facts being what they are, most of the open source/free software solutions do not have anything approaching the "trust" that schools are willing to place in these.

    I have seen some larger districts flatly refuse to accept a Linux or FreeBSD implementation of the web server (just the web server, mind you), even though this would have saved them 20-30 grand.

    Management systems being absolutely critical to the schools, they simply are not willing to take a chance that "you get what you pay for" is not always true.

    And, of course, any company developing apps for schools has to accept the fact that it is very much easier to acquire (or replace) experienced developers and administrators in the non-OSS world.

    Things change, of course.

  143. Re: Has Free Software Saved Any Schools? by andfarm · · Score: 1

    No. All that giving kids Micro$oft programs will accomplish will be to tie them to this corporate giant, making them more slaves of this opressive orginization. /rant on Is this what schools really want? And will this really do anything to correct Micro$oft's antitrust tendencies? NO! If anything, it will make things worse. /rant off

    --

    TANSTAAFI: There Ain't No Such Thing As A Free iPod.

  144. Closing the ditgal divide by galluk · · Score: 1

    There is another organisation in Australia called computer bank http://www.computerbank.org.au that provides PC's and computer training for disadvantage groups
    They use a open source solution involving Linux so that licencing issues that effected PC for Kids do not trouble them.

  145. free software may mean more money by Proud+Geek · · Score: 2

    Using Linux on file servers and web servers is almost always a clear win for schools. Most computers in schools aren't file servers or web servers; they are desktops for students to complete assignments and do research.

    Unfortunately, Free desktop environments like GNOME and KDE are much more resource intensive than Windows. For schools with middle aged hardware, running these environments is not an option. In this case, there is a clear cost win for Windows.

    Luckily, it will all change with Windows XP (or should that be Windows PX for PentiumX required).

    --

    Even Slashdot wants to hide some things

  146. Donated computers generally don't help schools by John+Murdoch · · Score: 5, Insightful

    Hi!

    The scene: "Public Comment" time at a school board meeting. The previous speaker, a senior citizen, has spoken at length about the burden of school taxes on the elderly in the community. He has particularly emphasized his opposition to the blatantly gold-plated technology proposals in the school budget (including the 4--count 'em, 4! PDAs for the district IT staff). Then the school board's self-designated Taxpayer Advocate clears his throat, and says, "Y'know, I was talking to our IT director at work the other day, and we're getting rid of a bunch of computers. Some are 486s, but a lot are Pentiums--we could provide a lot of those machines to the district at little or no cost....

    ...And another dumb IT decision is in the offing. Lots of people want to donate their downstreamed equipment to the schools. Sometimes they genuinely think they're doing good: most of the time they're trying to claim a tax credit for the contribution, and will "suggest" valuations for each machine that they drop off. All too often those donations cost the district actual cash--because you have to pay a HazMat hauler to take the monitors these days.

    Linux and other free (as in beer) software may well have a place in education. There is a very powerful argument, for instance, for creating an Office-type suite with extensive classroom management tools. Given that school environments can be extraordinarily hostile (think of the kinds of behavior that occurs in a middle school classroom if the teacher steps out into the hall) there is a persuasive argument to be made for a robust platform like (ahem) FreeBSD.

    But. Please please please do not even think of saddling the poor, overworked techs at your local school district with your worn-out, leftover, good-for-nothing junk. You are doing them no favors, you are doing no good to the district, and you are probably preventing adoption of a well-thought-through technology plan by "donating" your scrap equipment.

    Computers in schools
    I'm on the Technology Committee of the Nazareth (Pa.) Area School District. We've played out that scenario at the top of this post several times. We have had several area companies offer to donate their scrap to us. We have had several board members get positively indignant that we have spurned those offers. We did spurn those offers, and if I have any say in the matter we will continue to spurn those offers--here's why.

    This is a hostile environment
    Suppose your employer decides to install a new computer system. And suppose a computer-phobic customer service rep decides that he doesn't want to use the new system. Your employer has a simple remedy: fire the CSR. Doesn't work that way in American schools: if you want the teacher to use a computer, you have to persuade her/him.

    This is a hostile environment #2
    Teachers (no surprise, right?) don't want to look stupid in front of their students. But the kids are substantially more adept with computers than the teachers--so the teachers have a built-in ambivalence (at best) about computers.

    So we have to persuade teachers to use a device that potentially can humiliate them in front of their students. How?
    From hard-won experience, the district IT staff has to offer absolutely bullet-proof reliability. They have to be able to guarantee--and deliver on that guarantee--that the computers will be there, working flawlessly, whenever the teacher wants. No reboots, no network hassles, no video driver conflicts (elementary teachers probably use more video games than CmdrTaco), no need to get an MSCE in order to teach 3rd grade. In other words, the district IT staff has to provide Service Level Agreement-style functionality.

    But...
    do you think this means that anybody is willing to pay for a district IT staff? Funny boy--the school board will fund an extra assistant to the wrestling program in a heartbeat, but they won't spend a dime for a part-time LAN geek unless you do some major politicking. So what IT staff you have (4100 students, 450 employees, 7 buildings over 80 square miles, 3.5 IT staff) have to make do with what they have.

    Which means...
    They have to standardize, standardize, standardize. Every elementary classroom has to have the same video cards; every machine has to have the same network adapter; every machine in the high school has to have the same monitor. They have to develop a formalized bug-tracking system to identify recurring problems, and they have to take a systemic view of the entire IT picture in order to maintain 100% uptime. Because if they provide less than 100% uptime the teachers will stop using the system, and the parents will start calling the school board. And so forth....

    So please...
    Don't "do the kids a favor" and ship them junk. If you want to make a meaningful donation, call the school district and ask if you can give them the money to buy another one of their reference desktops. If they're running Windows, hold your nose and buy Windows. If they're running a bunch of out-of-date kiddie games, hold your nose and buy the out-of-date kiddie games. Do not make their lives miserable by sending them leftovers, or by going out to Circuit City and buying a $399 special. (God save the IT staff from the enthusiasm of the PTA.)

    If you want to champion Open Source in the schools
    Don't go preaching Linux as religion. Get involved, go to meetings, be prepared to make a reasonable case, and be prepared to argue for a complete replacement of the entire district IT infrastructure. And be prepared for war from the elementary teachers and the PTA: elementary school software runs on Windows, period. If you want to replace it, you'd best have a bunch of kids games tested and ready to go.

    Bottom line:
    Computers are crucial to education in the 21st century. I teach in a graduate program, and I'm constantly amazed at the number of MBA students with only the faintest glimmer of understanding about computers and technology. But the route to learning about computers and technology is not with leftover junk--it is with a carefully-developed, meticulously-managed, (and yes, sometimes rigidly enforced) IT plan that promises a "100% school time up time" service level, and delivers it. If the users can trust that the computers will be there, they will learn. If they can't trust the computers, they will learn to hate them.

    1. Re:Donated computers generally don't help schools by pnelson · · Score: 1

      John, I understand the what and they why of your comment but you are wrong.

      Donated equipment can be well used by schools to provide reliable access to technolgy. I think you should come and visit our 4th grade classroom via this link: http://www.k12ltsp.org/classroom.html

      We faced the same problems you addressed but we did something about it and it's working. ;-)

    2. Re:Donated computers generally don't help schools by John+Murdoch · · Score: 2
      We faced the same problems you addressed but we did something about it and it's working. ;-)

      I beg to differ.

      I applaud the success that you have had--but I note that on your demo site you take pains to point out the specific motherboard, video, and network adapters that you used, based on your prior knowledge of their reliability. Which, um, sounds like precisely what I was saying. If the local mill walked into one of your managed classrooms and dropped off a stack of IBM Micro-Channel PS/2 boxes, what would you do?

      And more to the point, what would you do if you had to support not that one classroom, but scores of classrooms across a large geographical area? And support all the other aspects of the district's technology program at the same time? (The telephones, cable TV, building security systems--even the headsets for the football and soccer coaches.)

      I note, particularly, that your organization focuses on 4th to 8th graders. It would be very informative to hear why you do not provide services for pre-K through 3rd grade. Is it, perhaps, because of the massive amounts of curriculum software available (not to even mention the "third-party" game software teachers always use) all of it depends upon DOS and/or Windows? And getting any two packages to work together simultaneously on most video cards is a cast-iron b*tch? (Lurkers: if you're not familiar with the problem, trust me: the hardest classrooms to provide computers to are the K-3 classes. The video driver problems would curl your hair.)

      A working solution in a single classroom is not, by a long stretch, the same thing as providing IT services across the entire school district.

      Please forgive me if I sound a little petulant. But I take umbrage at the toss-off line at the bottom of your post to the effect that "...we did something about it." I resent that--we busted buns to develop a district-wide IT plan. We measured user ability, satisfaction, and use before we implemented the plan; we measured ability, satisfaction, and use after we implemented the plan. We deliver "100% school time up time", while computer usage in the district has soared, and machine outages have dropped to essentially zero. The IT plan has done so well that the IT staff has effectively slit their own throats: the school board almost eliminated one of the (3.5) positions last year because things were going so well.

    3. Re:Donated computers generally don't help schools by SmOldGzr · · Score: 1

      Hey John, you better check out ALL the postings because it seems like there are a few people/communities who have overcome things that you and you collaboraters were not able to hack.

      But, you are right, the problems are not the same. Your problem was conceived in your mind, and theirs in theirs.

      -- All religions are the same, especially Buddhism.

    4. Re:Donated computers generally don't help schools by John+Murdoch · · Score: 2
      ...it seems like there are a few people/communities who have overcome things that you and you collaboraters were not able to hack.

      I've looked through most of the higher-mod'd posts--paying particular attention to been-there/done-that posts. Let me suggest that the stories fall into three categories:

      1. We set up a Linux box! One or two volunteers set up a Linux box as a web server, proxy server, mail server (or all three).
      2. We set up three Linux boxes! A squad of volunteers set up several Linux boxes as network file storage. Great idea--but once again we come back to the scalability problem. One box functioning as a NAS server sounds great--but how do you back it up? And if you have 3, or 5, or 8 boxes with different hardware configurations, scattered across the district, how do you back them up? Remember--school districts have lots of buildings across big geographical areas. Sending somebody around with a stack of DLT tapes is not a good solution. A standardized NAS box (with a standardized tape drive, or a centralized backup method) is a lot more maintainable solution.
      3. I scrounged up 5|10|25 386sx|386|486 boxes for my classroom, and installed Linux! I have tremendous respect for teachers willing to do this--but the consequence is inevitably the circumstance that I described in my original post: the fact that somebody can cobble together two dozen cast-offs encourages the school board to cut funding for new hardware or IT support staff.

      It's easy to applaud that heroic teacher with 25 386 computers in his classroom at a high school in New Orleans. But that guy is almost part of the problem, not the solution. Because the school board is doubtless saying, "see--we have computers in our schools." They're computers most Third World educators would be ashamed of, but they have computers in the schools, by golly.

      Think about the end result:
      At the end of the student's school career he or she will go off to college, or go into the work force. If the student gets a job, he or she will be confronted with systems that are radically faster, more capable, and substantially more complex. The student will be substantially behind the curve. His peer that went to college will be worse off: competing against students from districts that invested in technology and offered things like AP courses in programming (C++). The kids in a New Orleans classroom with 25 386sx and 386 boxes are dead meat on a stick when they have to compete against kids from a district that assigned PowerPoint slide projects as homework for 7th graders. (Not that PowerPoint is good--I think PP numbs the brain. But kids who are familiar with the tools at that age have a HUGE advantage in college and in the workplace.)

      Bottom line: shipping scrap to the local schools may give you a tax write-off, but it ends up doing nothing (or worse) for the kids.

    5. Re:Donated computers generally don't help schools by pnelson · · Score: 1

      Hi John,

      I'd suggest that you learn more about k12ltsp. The whole point is that it turns old hardware into usable thin-clients.

      I mentioned the hardware for the server because I wanted folks to see that we were using common hardware available almost anywhere. We use all kinds of hardware for our clients.

      As for seeing what works in one classroom, well again I would invite you to visit k12ltsp.org. We have lots of clients up in our clasrooms, library and even on the superintendent's desk. I am able to manage servers from home or from any of my schools because I can secure shell in and do updates or even reboot. I don't have to do that often though. Our average up time is about 6 months for servers. That's not uncommon at all for Linux boxes. I don't even have to sit down at the computer to work on it. Yes, this is a great solution for over worked and under staffed IT departments to use in multiple buildings K-12. That's exactly what I do. We use Linux in schools all over the county. The county lan/wan guy manages over 60 servers right from his desktop. He doesn't have an IT department. He's just one guy.

      Your school board member is correct to question your rejection of donated hardware. If we can't use we recycle it. See the STRUT.org site for more info on that. Again, if you look at the k12ltsp.org site you would find that link too. You are missing out on a solution that can stretch your IT $$$.

      As for different video cards, yes that can be a real pain. That's why LTSP 3.0 auto configures the client based on a PCI scan to find the video card. It's pretty cool! It does it all on the fly.

      I spent three hours this week trying to get an NT2000 machine to work with a Riva TNT video card. This is a very common card but the MS drivers only gave me the BSOD. I ended up searching google groups and found that MANY other users had the exactly same problem. Had this been OpenSource software the problem would have been fixed. As it was I had to ferret my way through many suggestions to find one that would work. The same machine configures perfectly with Red Hat Linux.

      Kids and software are another can of worms.
      We use Macs in K-3 classrooms. They work well and we get them free now from the STRUT program. The PPC machines we get seem to do just fine with the kids software. We don't use a lot though. There are many things young kids need to do in K-3 and I'm not sure that using a PC is real high on the list. Studies of kids using drill and kill software have shown only mixed results at best. If you're interested in reading more about thoughts on kids using pc's head for http://www.k12ltsp.org/educational_software.html

      I would encourage you to do some more research before rejecting out of hand a solution that schools all over the world are discovering.

      It only takes 20 minutes from power on to install K12ltsp and have a working terminal server. Feel free to download the install CD's from one of the ftp sites. You might give it a try after the newest release comes out in January.

      Rather than a toss-off line, I think doing something about it is much better than not knowing about good solutions and not being open to trying them out. Next time someone gives you some old PC's see if you can use them. It's better for the environment, your students and your budget all at the same time.

  147. GNU skole (GNU school) by Nau.dk · · Score: 2, Informative

    GNU skole is a project, working to bring free software (GNU/Linux) into elementary school in Denmark. Run by admins for admins.

    They do an effort to get educational software translated into Danish, and they're writing guides to other admins wanting to integrate free software in their school network.

  148. WHY? OH WHY by parasite · · Score: 0

    What the hell is it with you people and computers in schools ? How RIDICULOUS CAN WE BE ?! There is no worst waste of a computer -- and that includes throwing one in the garbage heap. At least if you throw it in the heap there is a chance a trash collector, or junk scavanger will find it and use it. If you put a computer in a school it will collect dust, occasionally increase the school's electric bill, and get a couple kids in trouble for bringing up some hot pornographic images--THAT IS ALL. There is absolutely no sense in having computers in schools. And anyone who believes that there is has NO SENSE IN THEM. Do you fuckers even realize that those who go into education are the consistent bottom of the barrel, lowest SAT, the people who SHOULDN'T HAVE GONE TO COLLEGE BUT DID ? You think they're going to want their students, or at least the 90% who are smarter than them, showing them up ? Hell no. These are the kids that made FUN OF THEM, they remember back when they were in school, and they arn't about to going using a computer in the classroom and being the fools again.

    SO PISS THE FUCK OFF
    And quit spreading your Linux propaganda. Why do you want normal people to use it ? Aren't you happy being part of something that is for YOU and YOUR TYPE, but is notably incompatible with the majority of intellectually inferior, technologically unsavvy computer users ?

    1. Re:WHY? OH WHY by maroberts · · Score: 1

      I know this is a flame...but what the hell

      Why do we keep spreading Linxu propaganda?
      We want our OS to become usable by the majority of intellectually inferior, technologically unsavvy computer types. You see when we succeed that means there is something called a MASS MARKET and business types can see the sense in investing money in us technologically savvy Unix sysadmins and developers, and maybe just maybe games will start coming out for Linux at the same time as they do for Windows, 'cos there is a mass market.

      So the answer is don't look down on unsavvy users, as directly or indirectly they can pay our way to savvy nirvana!

      Now lets go on to the other point - computers in Schools. Ask yourself why Microsofts proposed settlement included giving away lots of educational resource - the answer is he who controls education and fun controls the OS world, as every student leaving will at least know about the OS's they've used at school and what they can do - it's not enough for Linux to do its job sitting in the backroom - unless it is in front of the user we won't get more disciples and converts. Idon't care what a persons IQ is, if he adopts and uses Linux he/she should be able to join the congregation.

      --

      Donte Alistair Anderson Roberts - hi son!
      Karma: Chameleon

  149. Teachers Are Paid Too Little? by Nail · · Score: 2, Insightful

    Disclaimer: My wife is a teacher and I would benefit economically if they were paid more money.

    I find it sad that some say "teachers are paid too little" when quoted this price or that, but never seem to be able to put a dollar value on teaching labor themselves.

    It irritates me because I think if someone is going to complain about a problem, they should at least offer solution to it (even an imperfect one). If they don't, it doesn't even matter whether they fully understand the problem or not, they are simply 'stirring the pot'.

    --
    ...yellow number five, yellow number five, yellow number five...
  150. Not Cheap... FREE by Anonymous Coward · · Score: 0

    I don't know about anyone else, but when the last couple years I was in college, Microsoft software was free to all university students. Office, Win2k, XP, 98, 98SE, FrontPage, Visual Studio... pretty much everything. Using open source only saves on the tip of the glacier. It isn't the operating system that costs money. It's the specific applications that people use in each major. I know my department was paying $16,000 per license for Synopsis. And there are approx 70 people take that class at any given from semester to semester. That's more than half a million just to use one program for one class.

  151. SEUL.ORG by tacocat · · Score: 2, Informative

    SEUL.ORG has some educational experiences that they have been gathering up. I am also working on starting one in SouthEast Michigan. I also know of a few others in this area that have gone well. Contact me for more information if you need to.

  152. Schools are like any other network. by talon77 · · Score: 1

    The problem is many school systems rely on Attendance/Grading/seating/management applications that are very, very costly. The vast majority of these platforms only run on a Windows Platform. I do computer support work for a number of schools around omaha nebraska, the one thing you see in common with them right now is they all run a Novell Server, they all run Groupwise, and they all run windows 2k/9x workstations.. Why do they all run the same type of file servers/workstations? Because the vendor of their core applications tells them to. Plain and simple.

  153. Saved anyschool yet? Nope, but soon! read on. by stephdau · · Score: 1

    I am in the process of organizing a charitable project that will be fueled by donations that will benefit both underprivileged children and the Open Source community at large.

    Official release date for the project is Jan. 1st 2002, and will hopefully work, not on saving the schools, but on empowering the next generations of kids, and teach them to excel in an Open Source / Free Software environment, regardless of their social class.

    The project will first start as a Canadian charity (that's where I am), but hopes to gain volunteers throughout, who will directly benefit their own locality.

    I'll make sure /. is my firs posting when we go live with our endeavor.

  154. Get a Job by krasni_bor · · Score: 1
    I, for one, got a job as a tech coordinator in a high school (I'm a certified English teacher and self taught Linux (sorta-)admin) by pointing out in interviews how many services and programs I could provide the school through my knowledge of free software.


    When you actually explain this to teachers and principals in concrete terms, they are receptive. On the other hand, if you're being interviewed by the IT people, you're probably screwed (unless they already have seen the light).

  155. Thomas Jefferson High School, Fairfax, VA by dwheeler · · Score: 1
    Go see Thomas Jefferson High School, Fairfax, VA's Computer Systems Research class, where the goals include such things as "develop computer skills appropriate for summer employment such as proficiency in UNIX (Linux), mastery of languages such as C, C++, Java or Perl, and familiarity with Web technologies and Internet resources." It's obviously a lot more than simply learning some skills; there's a great deal of emphasis on learning general concepts (see the link).

    Thomas Jefferson is a magnet school in Northern Virginia; its students are often quite extraordinary.

    --
    - David A. Wheeler (see my Secure Programming HOWTO)
  156. Schools in eastern europe by Anonymous Coward · · Score: 0

    I know schools in Eastern Europe use loads of free software, esp. Linux but not only. Lookup the Soros Foundation and you will see. I know this because I used it for like 4 years high school + 6 years college and master = 10 years.

  157. My School by tlipcon · · Score: 1

    I attend Wayland High School in MA. Our computer lab consists of a bunch of iMacs and G3-All-in-ones. This year we also acquired a bunch (15/20 maybe) iBooks and Airport Base Stations. A teacher can sign out the iBook station for his or her class to use for a period. Supposedly, they all really like it (the labs can be crazy to run a class in).

    Earlier this year, however, I was involved in a Computer Graphics independent study. I was writing my software to run on OpenGL/X11 in LinuxPPC. I tried to get the computer people to even let me install Linux on a single computer, but there was no such luck. Her major point that she used against Linux was that our school has over 900 software programs that run on MacOS and she couldn't justify losing even one computer that could run them.

    I think this is something Linux users forget. Linux office apps are OK, but school isn't all about Office. Sure, Linux can handle word processing, web browsing, etc. But how many "Mario Teaches Typing", "Interactive Physics", "Electric Field Hockey", "Geometric Golfer", "Geometry Sketchpad", "Green Globs and Math Equations" (to name a few of the ones I've used in various classes) are there for Linux? Sure, Linux can take care of all the work, but how much learning can it provide?

    Maybe some company could take on writing a bunch of educational apps open-source, and then make a profit on binary CDs, etc.

    -Toad

    --


    --
    - It ain't easy, being green.
  158. Penguin, Tasmania by GreyMatter · · Score: 1
    I've been waiting a long time to tell this story..

    I went to some sort of festival in the town of Penguin, Tasmania (part of Australia) a couple of years ago. There were a lot of displays, and I went looking for someone with computers to hassle them about using Linux. The only display I found was a small christian (primary) school .

    Guess what! They were using Linux! Had a nice chat with the guy, who said they were using it to save money, and it was working out well.

    I don't remember who they were, but it wouldn't be tough to find out. (Tasmania has less than 500,000 people, and Penguin is small even by Tasmanian standards).

  159. Here's a case study by Storm+Damage · · Score: 1

    A local Linux company, IDEAL Technologies, helped a local private school set up a Linux-based infrastructure, and provided training to the school. The company mentions it on the Community Involvement page of their web-site. The school also has a web-site running with contact info. It might be useful to contact them for more details.

  160. Schools shouldn't waste money trying to be OJT by agravaine · · Score: 1
    Because, like it or not, high school is, for most, valuable job training before they leave high school and enter the work force, be that as secretaries using MS Office or accountants using Excel, etc. When you teach them to use software that is completely irrelevant outside of school, you are crippling them for life as they have to retrain themselves on all the applications that school had taught them in order to use something as commonplace as Office.
    Learning to use some spreadsheet and wordprocessor while you're in school is probably a good thing, but don't get hung up on learning to use the market leader.

    When I was in Junior High School, my computer lab taught us how to use word processing software on the most common PC available: the Apple IIe - I don't even remember what software we used. In high school, we had a lab full of really popular TRS-80 Model IIIs with WordStar or somesuch. In college, we had a huge computer lab chock full of IBM PS/2 workstations with the spiffy new 3.5" disks, and I took a [required, but lame] course on popular business software. We learned how to use the industry-leading WordPerfect and Quattro packages, and some dBase clone for a database. It was imoprtant to learn those packages, because that's what industry was using, and we wanted to be ready for the 'real world'. :^/

    Guess what? The world doesn't stand still. A kid in Junior high today who learns to use MS Word because that's what his mommy uses at work will probably find that knowledge irrelevant in 2010, when he graduates from college. At least the typing skills will probably transfer.

    So I don't wory too much about these kids learning to use StarOffice while the 'real' world uses MS Office. A wordprocessor is a wordprocessor is a wordprocessor, and everytime the world forces them to "upgrade" to a new one, they'll adapt, learn the new keystroke combination for bolding text and creating bullet lists, and then move on with their lives.

    In the meantime, our schools are desperately short on cash; we would be far better off spending the money that would have gone to Micro$oft for their overpriced office suite on things that will still matter 10 years from now, like rasing salaries to attract smarter teachers, or hiring more teachers to reduce classrom sizes, or ... [insert your favorite expensive school reform idea here]

  161. Osef.org by mtstump · · Score: 1

    the open source education foundation is probably the most successful foundation at putting open source software in schools. Our co-founder, Harry McGregor, is a keynote at this year's LinuxWorld. I highly recomend looking at our site, and/or contacting us if you are interested.
    osef.org

  162. Microsoft is the *curriculum* by aking137 · · Score: 1

    As someone who uses only free software at home, and the network administrator for a medium-sized (~500 kids aged 11-16, ~50 staff) high school, I'm very keen to push free software in there wherever possible/appropriate. I've got kids, teachers, my boss, the head teacher and even some of the bureaucracy beyond the head all very interested with the philosophy behind it all, and very impressed with the demos.

    But the fact remains: the kids have to use Microsoft. They have to use Microsoft Windows, Microsoft Office, and Microsoft Internet Explorer. All I can do is implement free software around all that (i.e. by making available alternatives, such as OpenOffice) and try and educate as many people as I can; until that changes, it simply isn't a possibility. The people are there (at least in our circles, where we *are* those people) and are all very willing and capable to implement free software in schools, but until we get the right people to make some changes, most of us are stuck with Microsoft.

  163. two words by Anonymous Coward · · Score: 0
  164. the question is too narrow! by osod! · · Score: 1


    I am involved with a school division which uses Win, Mac, Linux and UNIX OSes and tries to use free (as in speech or beer) ware as much as possible.

    After all the talk re the Microsoft/DOJ agreement with M$ setting itself up for increased profits using the poorest school systems in the country to do it and after Red Hat and various open source orgs have had a chance at counter proposing, here's another modest prop0$al related to the topic:

    Public schools should only be using free (as in beer) software for instructional purposes where the product is released into the general marketplace. --OSs and application software. Schools have been willing assistants of private enterprise in advertizing the goods the kids will be buying at a future date. And we love to spend large chunks of our budgets to do this! What other industry has such a cohort of willing salespeople pushing product on a captive audience?
    Public education is often criticised as having a prime focus on creating good consumers. We do that in spades when it comes to software use.

    The ethics and legalities are at opposite poles. Ethically we should be exposing kids to all sorts of appropriate tools with an eye on the social and economic impact of what we do. We do exactly the opposite. Typically we get Windows onto a machine get Office and a few multimedia 'educational applications' and sell that to our community as being a complete solution. Ethically we should be doing something very different --rather than being front-line salespeople for Bill or Steve.

    And legally we have to pay for the honor of being big business's flunkies! We have to pay a per-student or per-station license for most products from the private sector. As the useful life of hardware increases (ie using old machines as terminals on 'hot' servers as in the Linux Terminal Server Project) and the new boxes get cheaper -- as the ratio computers:people approaches 1:1 the system fails having to transfer huge amounts of capital to Redmond or Silicon Valley.

    So schools should not be allowed to buy any general purpose commercial software and vendors should not be allowed to sell this stuff into public education!

    That would leave budgets to buy 'real' instructional and administrative applications designed for the educational market and encourage development of needed software instead of the large amount of 'edutainment' ware targeted primarily at the home market.

    So what are some of the free offerings we use:
    Linux - all file services (netatalk samba, nfs) and all infrastructure services mail, web, DNS www proxying/filtering, nis ...

    Linux user applications: Star Office, GIMP, Netscape, Opera. Logo & Python in Computer Science (the games that go with K and Gnome)

    Under Solaris: Netscape and Star Office on terminal (SunRay) servers as well as web proxying

  165. You did it wrong by Anonymous Coward · · Score: 0

    Your mistakes are so obvious.

    First, did you test moving koffice files to msoffice before you rolled it out? Doesn't sound like it.

    Second, teachers are angry that their windows programs didn't work? Did you ever think to ask the teachers what they need before you "upgraded" them? If you have functional equivilants, I don't see the problem. This falls into 2 categories. Programs that they need and must be there (determined from your requirements analysis), and unnecessary fluff that they shouldn't be running at "work" anyways. Seems simple to me.

    Third, why do the teachers even *see* /bin, /opt and stuff like that. You can't just dump a default distro setup onto their screens and expect them to "figure it out." You need to put icons on the desktop for each application that they need. Office apps, gradebook, web browser, email, maybe a teaching program or two. Thats it! You need to treat the classroom systems more like kiosks than a sysadmin/programmer training ground.

    If you can't think like an end user then I'm not surprised it failed.

    Brian

  166. Critical Misunderstanding of Teaching by philovivero · · Score: 1

    I'm not surprised to see you don't really understand the purpose of a teacher, and that your teachers are, in general, crap.

    First, my qualifications. I spent the better part of 25 years with an elementary school teacher at least 5 hours daily. (That is, 7 days a week, 365 days a year) and he tended to try to teach me a lot, being as he was my father.

    A teacher's purpose, first and foremost in life, is to let the students excel.

    It does not matter one single little bit if your students are better, smarter, and quicker than you. As long as you can guide them in a positive direction, you are a successful teacher.

    The best teachers I've ever had in my life knew about 1/100th as much as me about computers, math, English, or art. It was obvious my computer teachers would never think about computers outside the classroom, whereas I have been a full-on computer geek since 10 years old.

    But you know what? IT JUST DIDN'T MATTER, because when they realised that I had obvious talent in these 4 little areas, they pointed out sources where I could learn more. They gave me guidance, much like a good art critic gives guidance on brilliant pieces of art that they themselves could never actually CREATE.

    Your schools, and all schools, should accept every single piece of scrap hardware it can get its hands on. And every single copy of Windows and Linux it can get (for free).

    And here's how the class should be run. Since the teacher obviously couldn't install Windows or Linux or anything, the teacher can print out the READMEs and the Windows docs, and give them to the students.

    All the computers in the classroom are, you guessed it, BLANK. They have formatted, empty hard drives.

    The students would install Windows on this machine, Linux on that machine. Oh! That machine has no CDROM, so the students would create net boot floppies and install Linux via HTTPd.

    You think this is too tough for students? BULLS**T. I learned enough about installing Linux that I could do it on my own, using no outside guidance, in about the length of time of a single-semester course. Give the students a year to go from blank computers to a basic, functional Win2K, Mandrake, Debian, and Redhat.

    Second year course can be configuring X servers, development environments, make, configure, word processors, spreadsheets, email, etc.

    A lot of you probably don't have faith that students are as smart as I propose. You probably think what I propose is simply impossible, that no such course could possibly work.

    For such doubters, it's time to do your research. One name. John Taylor Gatto. Google is your friend.

    Go to it.

  167. Re:Tracking licenses is a major operations headach by JimmytheGeek · · Score: 1

    We were in compliance. We had 75 hosts, total, and 100 licenses. It incorrectly identified IP addresses, and it's not really my problem to figure out why. It's the vendor's problem not to cripple the product without reason.

    And the license logger was in fact pegging the cpu. You are simply wrong about this. It did in fact hamper the performance of the firewall and the only thing they could have done worse was permit unexamined traffic through.

  168. A school succesfully running linux (lots of it) by night-shade · · Score: 1
    I am the network manager for a large secondary school (Parrs Wood High School) in the UK. We have ~30 major servers in the school running various parts of the network but only 7 of them run windows (6 citrix desktop servers and an MSSQL / IIS box for the information management system, yes yes I know we are working on it), all the rest run linux. We also have about 50 printerservers running linux, all our 300 thin clients do and our full clients offer a windows / linux dual boot option. All auth is handled via samba-tng, webfiltering is via squidguard+dansguardian, file and print serving is done via samba, mail via Qmail.

    I am now talking to the city council's eduction department about getting major deployments of linux city wide (Manchester in the UK)

    We are widely acknowlaged as the most advanced in terms of computer and network use in the city, and one of the most advanced in the UK and the headtecher says that "This would not have been posible without linux it has saved me money"

    People who are interested in this sort of thing please contact me we are more than happy to act as a referance site for linux and open source in schools.

  169. Education link by elias142857 · · Score: 1

    Mandrake maintains an area of their site about successful business cases. Here's a link to their education section:
    http://www.mandrakebizcases.com/categories.php?o p= newindex&catid=26

    One of the schools (K-12) provides "Internet connections for our students. In fact, we are our own ISP with a OC3 backbone connection to the net. We handle dialup Internet services, email, FTP, student web sites, company web site, web-based calendars and databases, video-conferencing, as well as web office suites, for approximately 7000 students."

    Hope this helps. :-)

  170. Breeding kids that are more compliant with DMCA? by rickthewizkid · · Score: 1

    The idea here is not to teach kids a particular OS or software that happens to be the latest fad in computers. What is needed is to teach the kids the theory of how a computer works. This is how I learned... When I was first starting school (1982!) we had back then the top of the line Apple II computers - that we had to learn how to load with a cassette tape! To this day, the concept of "loading an application into memory" has not changed - be it with tapes, floppy disks, cd-roms, etc. The same goes for the concept of a "file" - A file is a file is a file, be it on an Apple II, a PC, a Linux box, or even a Kaypro II - and at a young age (6) - I was able to understand the concept of a word processor file being different than a, say, database file.

    My 5th grade teacher had a great way of teaching us how computers worked - that is - the theory of how they worked - by having us use different applications such as AppleWorks, Bank Street Writer, and AppleWriter, we were able to understand the concept of using a "word processor" and able to deal with the concept of saving a file, printing, etc... rather than simply knowing that "to get a paper copy of what you are doing, press Open-Apple-P" By being introduced to the concepts of what we were doing rather than being trained to be button-pushers, we learned a lot more about computers. This trend has reversed itself in recent years though. Now, students are forced to do things "one way" on the computer - only use one brand of word processor, etc. Any student that shows the least bit of problem-solving ability or interest in what's going on other than what the teachers "want" you to see is immediately declared a "hacker" (in a bad sense)... one person my sister (who is still in high school) told me about got suspended for HAVING WINDOWS PRINT TO THE PRINTER OTHER THAN THE DEFAULT PRINTER - that is, to say the student wanted to print whatever was on the screen to a different printer than the one that was set up as the default.

    Why is this? Kids should be encouraged to understand the concept of what "networking" provides, rather than hiding the innards of the operating system from students.

    Or are today's schools merely trying to educate kids to be more compliant with laws such as the DMCA?

    -Rick

  171. Is it "High School" or "High Training" ? by rainer_d · · Score: 1

    Hello ... ?
    I thought School is about education.
    At least, here in Germany it is (or was, last time
    I went to school some years ago).

    "Valuable Training" ?
    So, your "High School" in USA is basically a state-funded training-academy for "The Industry" ?
    Geez - and I thought You were against too much
    state-influence and subsidies ;-)

    cheers,
    Rainer

    --
    Windows 2000 - from the guys who brought us edlin
  172. it is different for us here... by john_uy · · Score: 1

    my scenario is from a university.

    we are giving literacy programs to faculty/staff to beef up their knowledge in computer apps. majority of the them have 0 IQ in computers and it is actually difficult for us to even pursuade them to use computers for their own benefit. i am not sure if teaching them linux at start may have a good or bad reaction based on userability of it. we may have lots of time giving our support to do small functions compared to windows where it is point and click.

    is there any real math that really says that using linux will indeed save you? meaning if you have 2000 faculty/staff to train all of them to linux and then providing support compared to train all of them to windows then buying software then providing support? **assume these people do not know anything about computers and all computers will be brand new so do not include the savings from not upgrading**

    is there any study made how a user will be able to absorb concepts and functionality of linux with windows? this will more or less determine the support and training costs.

    we are buying microsoft products here and there are numerous ways of licensing available. it is just finding the right combination in order for you to save money. there are certain options which we can get around 50% of the academic license price (this is legal.)

    microsoft is less than half of the story. we buy more expensive programs like avid express, adobe photoshop, premiere, illustrator, pagemaker/indesign, macromedia flash, director, dreamweaver, authorware, autodesk autocad, 3dstudiomax, retas pro, and other engineering/graphics design software. is there any opensource alternative to all of these? i think windows is cheap compared to the others. office will be used in the office and it will not be that much compared to the ones used in the classrooms.

    we are also doing some outsourcing of certain programs and we are looking at companies some with background in opensource and linux. even though the software may be free, the development is not and i think it is almost comparable to the development in visual basic (where it is rather easy to create programs.)

    your feedback will greatly be appreciated.

    --
    Live your life each day as if it was your last.
  173. Careful which geeks you punch.. by Anonymous Coward · · Score: 0

    Some geeks are large and psychotic.. like me.. and I have one programmer friend that is almost as tall and along with being a great programmer teaches Kung Fu classes. Sometimes when you hit a nerd they turn around and knock you on your ass and then delete your bank account and disconnect your phone service. In my last year of high-school there were two of us exceptionally scary geeks and for once the geeks in the school were shoving jocks out of their way. Protection for your own is a great thing.

    1. Re:Careful which geeks you punch.. by Anonymous Coward · · Score: 0

      where these jocks in question hot?

    2. Re:Careful which geeks you punch.. by flacco · · Score: 2
      In my last year of high-school there were two of us exceptionally scary geeks and for once the geeks in the school were shoving jocks out of their way. Protection for your own is a great thing.

      Protection from your muscle-bound cousin, who was a runner-up in a state-wide body-building contest, is also a good thing :-)

      --
      pr0n - keeping monitor glass spotless since 1981.
  174. Linux in schools in Finland by mystran · · Score: 1

    I would like to note two examples of linux use in schools: first my former senior secondary.

    We had a single mail + web server. I was running Debian GNU/Linux.

    Now, I was running on the hardware (and actually still is) that was too old for the Windows workstations. I think the one now in use is P120 with 96 MB ram (more ram was added and a larger hard drive was installed when we made it a server, but otherwise it was just an outdated workstation).

    The was some problems, but none of them took too much time to fix. Worst case was when both hard drives broke (physically, nobody actually knows why). Ever tried to get a Windows web + mail server running in one day ? I haven't, but a whole new linux system was installed in three days.

    Got old web pages and mail boxes back using alternative ext2 superblocks and heavy use of e2fsck. At least most of it.

    There has been but one problem since the installation about 2 years ago. It was a APM problem with the mainboard. Fixing that no reboot (apart from power outages) has been done.

    And with almost zero adminstration.
    Voluntary administration by hobbyist students.

    I think somebody updated Apache at some point but
    that was more like "let's update to get this fancy thing" than from need.

    Another example is my university (Helsinki University of Technology). About half of the workstations are running some kind of Unix. To my knowledge most of the servers are running some kind of Unix. And you have several "stupid terminals" around the school to connect to the shell servers.

    Debian Linux is what atleast some of the newest computers are running. As there are hundreds of computers using Free OS really makes a difference.

    Of university I can't tell much more as I'm just a first year student, but many people prefer using UNIX terminals/workstations to do simple tasks like reading mail etc because they work faster and are more stable. Many people with not much experience with computers actually find learning to use unix more easy than learing to use Windows. Futher they find that with UNIX computers they can actually specify what they want to do rather than hoping windows to do what it wants :)

    The dual OS sceme (actually multi as there are also atleast SUN's and IBM's unix workstations too) works fine. By using Linux they probably cut down the UNIX expences even more than they could cut down expences by turning all windows machines into Linux machines.

    --
    Software should be free as in speech, but if we also get some free beer, all the better.
  175. Re:Tracking licenses is a major operations headach by sirket · · Score: 1

    I think, perhaps, that you misunderstand how CheckPoint works. Are you taking into account printers and other devices on your network with IP addresses? These all count towards the host limit. Were you swapping IP addresses frequently and perhaps not giving the license manager time to timeout old addresses? Did you have rogue laptops that you are not counting?

    The only thing that CheckPoint does, which bothers me is that a single host with multiple IP addresses count as multiple hosts in the license manager. To me, CheckPoint should be protecting hosts and not IP's.

    As far as the license manager goes, I think you are simple wrong about this, or perhaps have a seriously under-powered system. Have you actually tuned the system for CheckPoint? Are you running on Solaris? IPSO? NT? Does the system have enough memory? There are a number of system performance tuning documents for Firewall-1 which are available from CheckPoint's web site. You may want to look into these. If you are running Firewall-1 on Solaris, and have not made changes to /etc/system, the box is probably not configured for optimal performance.

    -sirket

  176. Oh, what luck! by _Knots · · Score: 1

    I've just set up an old, donated PC box at a church I work for (as a volunteer) to be a firewall - they have recieved a sizable donation to be used as a computer lab by the community kids who attend the Homework Help Club and other such services (at which I also tutor).

    This is a fairly decent machine (pentium 233, 32M RAM) - more than enough functionality to be a firewall (IPChains/IPTables, BIND, SQUID, DHCPD). My question now is, are there any programs that can utilize the remaining time effectively?

    I would love to have the following features, if at all possible:

    - access to GNU compilers (free) over the network. Editor tasks run on (windows) clients and just compiliation and execution takes place on firewall box. Possible? Or should I look into CGYWIN?

    - access to Linux proper. X servers for windows (for free, and open source) anybody? Telnet's the *easy* part.

    - easy re-imaging of all client systems. Should I look at samba for this or does anybody have better sugguestions?

    Any other help appreciated! Thank you in advance!

    --_Knots

    --
    Anarchy$ dd if=/dev/random of=~/.signature bs=120 count=1
  177. Critical Misunderstanding of My Post by John+Murdoch · · Score: 2

    Hi!

    Thanks for taking the time to write. However, I'm not sure we're communicating. You have described a splendid concept for a computer-oriented program for older students. You suggest that you could have done all of what you propose at age 10 (start from fdisked machines, a stack of CDs, and a pile of printed README documents). You seem to suggest that since you could have done this, anybody could have done this. And you seem to think that spending an entire year doing this would be beneficial.

    Alas, the Pennsylvania Department of Education would probably disagree. They would vastly prefer if the district's 10-year-olds were engaged in other pedagogical pursuits: reading, writing, 'rithmetic, sex education, drug-awareness education, enviro/political behavior modification, etc.

    Please forgive the sarcasm, but please also understand that the focus of computers in classrooms is not to make computer techs out of the 6th graders. The point is to use the computers to learn academic subjects. We don't want students, or teachers, to ever have to think about partitioning a hard drive or re-compiling the OS kernel. We want them to think about using e-mail to collaborate with an "email pal" across the world; or to use NetMeeting or Groove to collaborate with students in other district buildings. The computer is not the raison d'etre--it is the tool.

  178. DONT FEED THE TROOL! by Anonymous Coward · · Score: 0

    Don't feed the troll people, are you stupid? HE"S A TROOL! A TROLL!!!!

  179. schools by Anonymous Coward · · Score: 0

    http://www.riverdale.k12.or.us/linux/k12ltsp.html

    for starters. Plus the linux terminal project.

  180. Transgaming and School educational software... by Anonymous Coward · · Score: 0

    ALot of the software for the school desktops are like games. If we could get these educational games to run via Wine or Transgaming then i think the linux desktop would be a possibility.
    Of course the natural progress will be better apps for linux like tux typing, but for now?
    Anyone want to help?
    Alfred Nutile
    nutile@ureachc.com
    http://co-op.web9k.com/tfe/

  181. Have you seen Xanadu? by Graymalkin · · Score: 2

    Free software ideologically works well in schools. It can be inexpensive to impliment and once you've got a good set-up going you're pretty much set unless you need to do like some major overhaul of something. Linux and FreeBSD are just a bit more robust than Windows and have enough software available for them to teach people the computer concepts they need. It's better to teach them concepts anyhow, the OS underneath doesn't matter much if you teach them the difference between ASCII and binary files, that it means when something is executable, and the basic tenents of word processing. They don't need high school to teach them highly technical skills, thats what they pay to go to college or trade school for. Trying to make the high school responsible for producing workplace ready people overextends their already meager funds.

    However the bad thing about Free software is the lack of an educational infrastructure. Linux works well if you wanna use a computer to teach people about computers but what happens when you want to teach people about literature or history? Responses to that question including the word "internet" will be ignored. Why? When you're looking for something specific most of the internet is just complete cruft. Although there are some good sites you can use it sucks trying to them for educational purposes at times. It'd suck to have a page up on the projector and then have some x10 popup dominate the screen. It's far too distracting for trying to teach somebody something. Using the web as a info reference is tricky because if they don't know anything about what they're researching they'll grab a bunch of "facts" from Joe's House of History and turn it in not having learned anything. I think a free OS would be a good idea for schools if you could build a curriculum and not have the OS holding you up. Computers are information tools, not an end unto themselves. If you're going to deploy a free solution to your problem make sure it fills ALL of the requirements, not just be less expensive than Microsoft.

    --
    I'm a loner Dottie, a Rebel.
  182. LATIS by wermspowke · · Score: 1
    The Northern Territory Government in Australia have something called the LATIS project (Learning And Technology In Schools) which involved rolling out a Linux server with a satellite based connection to the Internet, and Windows desktop PCs to every school in the state (territory) including the very remote and very small Aboriginal community schools; 190 odd schools in total.

    The servers provide file and print through Samba, authenticated web and ftp proxies via squid and the potential of an email address for every member of the school system, all tied together through an LDAP directory (provided by OpenLDAP).

    The desktop PCs are, as I said, Windows boxes but the office suite provided is Sun's StarOffice 5.2 (presumably to be upgraded to 6 when it is finalised).

    Check out www.latis.net.au for more info.

  183. Another project by Anonymous Coward · · Score: 0

    Here is a pointer to an article about a swedish high school using Linux and old PCs as thin clients.

    The article is in swedish, but I expect you to be able to read it and get the general meaning by using googles translation services. The headline says "Old computer gets new life in school project".

  184. Linux for schools by wolf2q · · Score: 1

    There is a project going on!

    http://www.riverdale.k12.or.us/linux/

    Wolf

    --
    Where ever you go, There you are
  185. most schools are too afraid by Anonymous Coward · · Score: 0

    I dunno if this relates to anything but i attend a high school in kelowna, BC canada and i LOVE LINUX. I am constantly giving presentations to kids and teachers that are interested in linux and what it can do. my highschool alone has at least 150 computers in it with many labs, unfortunatly all windoze crap. i once had a convo with the head network admin. of the school district and asked him if linux would ever make it in anyway to our school's (as servers or workstations) and he told me that linux,in his opinion, would never make it to the school system. I figured that he either had no experience with linux what so ever or that he was just too afraid to change. I personally would really like to see linux used in schools more but i am convinced that it would take somthing HUGe just to get the network admins/school officials to see that linux would save them money and time, because of the main reason that most of these guys are old foogies that know nothing about linux. You know what they say about teaching a old dog new trix eh? well thats just my 2 bits.

  186. Couldn't agree more. by Bob_Robertson · · Score: 1

    Well said, bravo, so true, couldn't have said it better myself.

    Bob-

    --
    The Ludwig von Mises Institute. The reasoning individuals economics
  187. French canadian contribution by rip42 · · Score: 1
    If you can read french, there is a lot of schools listed on Quebec (French Canada) LUG. You can find them on http://www.linux-quebec.org/ecoles/Ecole.html

    Happy reading!

    Richard

  188. sounds are bad! by chocolatetrumpet · · Score: 1

    I learned to read using the sounds of the words and that has led to a very slow reading style. It takes me a long time to read because I need to hear things in my head to read. Now I must spend much time learning how to get the meaning of the word by seeing it. Please, teach your kids the right way to read, the first time!

    --
    Spoon not. Fork, or fork not. There is no spoon.
    1. Re:sounds are bad! by MrResistor · · Score: 2
      Retention and comprehension is more important than speed. So what if you read 25% slower than everyone else if you only have to read it once and they have to read it 2 or 3 times? That's been my experience, anyway.

      But, if you really want to read faster, try tracking under the words with your finger. It sounds stupid, but the increased focus allows you to read much faster with the same retention and comprehension.

      --
      Under capitalism man exploits man. Under communism it's the other way around.
    2. Re:sounds are bad! by dillon_rinker · · Score: 2

      NEWS FLASH! The written English language is based on the way words sound! Each sound is represented by a (non-unique) letter. Pedagogical techniques for teaching children to read should include phonics; lots of practice reading permits you to move on to memorizing how words look. If you haven't moved on, I'd suggest you're either fairly young or have a learning disability of some kind. I was taught only phonics but I can tell at a glance what a word is.

      The reason for using phonics is that most people who learn to read already know the language. They don't need to learn it again. They merely need to know how to translate what they hear and say into writing and vice versa.

      Whole language reading is useful but not all encompassing. The same is true for phonics. Both have their place; you can't advance as a reader (as you point out) if you continue to be dependent on phonics, but you can't leverage years of experience with the English language unless you use phonics. A mixed approach is highly effective.

  189. Multiple factors by Anonymous Coward · · Score: 0

    In and of itself, I doubt donating code or boxes will cause some general shift in someone's attitudes towards school and education.

    However, it might contribute to a solution.

    I think that is something that needs to be always kept in mind.

  190. French experience: Pingoo by loopkin · · Score: 1

    in France, there's a huge program about that, based on a distribution called Pingoo, based on Debian.
    Informatiens about deployment here

  191. Here's One Far Away by SgtChaireBourne · · Score: 1
    A colleague has scrapped most of the MS workstations in her school library and used the money to hire a part time 'gardner' to tend to both the Linux and MS-Windows stations. She now has the highest ratio of public workstations to students in Finland and has reduced unemployement by 1.

    The term 'gardner' rather than sysadmin was an acceptance of the bit rot that accompanies the various windows distributions and a recognition that even unix machines need tending/monitoring.

    Anyway, it's catching on and the kids like it because its faster than NT. The bureaucrats like it because not only does the money stay local, they get more service per dollar (mark/euro).

    --
    Beta is broken and the link to classic doesn't work. Stop wasting our time or there won't be anybody left here.
  192. The three elements of the equation. by jotaeleemeese · · Score: 1

    Lets see:

    Hardware: same hardware (this could be argued, Linux solution could be run in cheaper hardware becauss the options exist to do so, for the sake of argument lets say both solutions use the same hardware).

    Software: depends. For a start OS and Office Suite it costs nothing in Linux. You can moan, scream and pull your hair: what is available in Linux is more than enugh for teaching basic skills, let your company in youf first job pay for your proper introduction to the wonderful world of MS computing.

    If you need computers to run an application that works only in Windows well, tough luck, you have no choice and your choice is gone. But we are teaching computing skills right? Programming, working with images, Office Suites. All that is available in Linux. So ,assuming that applications exist in Linux and Windows, you can't beat Linux in price.

    Operations: you have one guy that has to administer the computer infrastructure, a guy that either knows nothing or very little about computers (if he/she know a lot about computers, this becomes mooth point: a proficient administrator can do either solution, so no differences there). Can you seriously claim WIndows is easier to administer than Linux? Then all those books by droves about "Making windows easy" and "windows for dummies" are completely unnecesary, aren't they?

    I am sorry, but I fail to see why a generaly cash starved school with a clue would use MS products (or commercial products for that matter) at all. No advantages at all: one becomes hostage to MS policies and anti-piracy orgnizations raids and licensing hikes for very little benefit, if any.

    --
    IANAL but write like a drunk one.
  193. I will, thank you... by Svartalf · · Score: 2

    Most people will not use the "wealth" of features Office provides. What they use, is already there for Linux. Seems you're missing out on something as I've been using Star Office with MS Office only workplaces for 5 years now without any real issues on my or anyone else's part. "Behind" is a relative term, mister_sparkle, and I've seen Office XP and wasn't impressed- the offerings are less behind than what you think.

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
  194. What about teaching them to think for themselves? by Svartalf · · Score: 2

    That is what school is all about, isn't it? If you're going to teach them about the real world, then perhaps yes, you need to teach them about MS Office, but you also need to teach them about WordPerfect (MS Office doesn't run on Mainframes, but it does- and there is a LOT of places that still use Mainframes in the office context), StarOffice (there's a lot of places out there using that as well- more than you'd like to think), and others.

    The real world is less homogenous than you and MS would like for to believe it is. Teaching them just MS Office isn't preparing them for office work- it's preparing them for insisting on a monopolist's product offering. Doing what I suggest would be real training for that.

    And, I hold that schools are not for training laborers (office or otherwise)- they're to get everyone on the same common ground of knowlege so that we can work together in many contexts.

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
  195. VNC doesn't do multiple sessions... by Svartalf · · Score: 2

    It only does one. Think of VNC under Windows as more of a Carbon Copy replacement (which it does a fairly good job of...).

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
  196. Art- use a pencil or brush by Anonymous Coward · · Score: 0

    I don't think you can truely learn what Art is about without using traditional media. The tactile part of the experience is invaluable. The computer _can_ be a tool, and a type of media in it's own right. However, there is so much to learn using graphite and paper.

    Chasd
    Silver Oaks Communications

  197. This also goes with the plans to give laptops out. by Graemee · · Score: 1

    Not only are software licenses, educational uses of computers/apps, and connectivity issues in schools. But with the plans, like the State of Maine to give laptops to schools kids, it makes the selection of a good secure & stable OS important. I believe the issue is best applied by not using a commercial OS but a solid simple embedded OS in a device that can easily be upgraded as each year passes. A small handheld or slim notebook with a set of standard tools that can change with the needs of the student and school instruction. As you move ahead in the grades, the device gets updated to a tool set that the level of teaching requires. Why you can even have the years reading material and notes pre programmed and releasable on a certain time or demand. Add connectivity software to your "standard OS's" and it could be interfaced with anyones home PC regardless of what they use. Forget free or opensource, make the student and school be able to rely on the computer to help them learn/teach and still be usable for more than the next OS release.