Slashdot Mirror


Distributed Computing Attacking SARS

fwc writes "D2OL has added a SARS Target to it's distributed computing project which locates potential drug candidates for several viruses. At this point, I've replaced SETI@Home at least temporarily on all of my Boxen. There are clients available for Linux, Solaris, Mac OS X, and of course Windows."

327 comments

  1. a very worthy goal! by DataDevil · · Score: 2, Insightful

    Looks more usefull then finding the odd alien out there :P

    --
    -- signed for your pleasure --
    1. Re:a very worthy goal! by Tyreth · · Score: 1

      Especially for those of us who don't think any can be found.

    2. Re:a very worthy goal! by DataDevil · · Score: 1

      like me yes :P

      --
      -- signed for your pleasure --
    3. Re:a very worthy goal! by Anonymous Coward · · Score: 3, Funny

      Not if the alien has the cure!

    4. Re:a very worthy goal! by maeka · · Score: 1

      The quest for alien life and the quest for a cure for a viral disease have exactly the same success rate - 0%!

    5. Re:a very worthy goal! by Anonymous Coward · · Score: 0

      Ehmmm, sorry? Lifes CAN be saved from dying due to viral diseases. We see that almost daily, and it's thanks to medicine. Not thanks to trying to spot little green men talking on space. Sigh.

    6. Re:a very worthy goal! by obotics · · Score: 2, Funny

      Well, I don't think slashdotting their server is going to help them find the cure to SARS any quicker...

    7. Re:a very worthy goal! by AssFace · · Score: 1

      Are you implying that we (humans) have never found a cure for a viral disease?

      If so, then you might want to look into the commonality between mumps, smallpox, rubella(German measles), and polio.

      Although I would have to agree with you that the quest for alien life is pretty pointless if they are going to put the "intelligent" marker on the requirements for what they seek. "Intelligent" is not a fixed term and varies by culture and ... well, by species.

      --

      There are some odd things afoot now, in the Villa Straylight.
    8. Re:a very worthy goal! by maeka · · Score: 1

      A vaccine that prevents a disease is not the same as a medicine that cures a disease. We have never cured a viral disease.

  2. Damn, how drunk am I? by Anonymous Coward · · Score: -1, Offtopic

    I thought the headline was, "Distributed Computing Attacking RIAA" ... I guess when I see a four-letter acronym it always triggers a negative in my brain. Here I was hoping there was a distributed riaa.org DDoS program floating around!!

    -MFS

    1. Re:Damn, how drunk am I? by Neuropol · · Score: -1, Offtopic

      'sup homes?

      That could be RIAA attacking Distributed Computing if we aren't careful.

  3. Don't all move to this! by ChaosMagic · · Score: 5, Funny

    If everyone stops doing SETI@home and moves to battling the SARS problem then we may miss a vital signal from outer space from an alien race that has a cure to SARS and all the other nasties roaming this planet!

    --
    ... I guess
    1. Re:Don't all move to this! by The+Original+Yama · · Score: 2, Funny

      ...then they'll enslave us and make chickens grow out of our arses. It's true! It happened to a friend of a friend's uncle's niece!

    2. Re:Don't all move to this! by Anonymous Coward · · Score: 5, Informative

      Except that seti@home does not analyse signals in real time, they've got a huge evergrowing database of signals recieved and we're analyzing that... we aren't going to miss a signal, we're just going to find it few hours later.

      AFAIK.

    3. Re:Don't all move to this! by aarondyck · · Score: 5, Informative

      Actually, the way SETI works allows for any workload over an extended period of time. The samples that your computer is analysing have been around for quite some time; they are transmitted from regions that are light years away! In addition, it is only once every year or so that they have a real chance to look for anything interesting that they find. As far as a cure for SARS goes, I have an elderly grandmother who was rushed to the hospital for unrelated reasons shortly after the start of the SARS scare in Ontario. She was taken into an ambulance by men and women wearing full environmental suits. She has since been released, quite possibly too early (they still don't know what was wrong with her), so I'm anxious for the world to just deal with SARS. This is a prime example of the Fear Consumption Model brought to us by Marilyn Manson and Michael Moore. The more we fear, the more we consume. As a whole our society has seen millions of dollars spent on research on a disease that has only killed 295 people out of over six billion. When diseases were feared in the past it was worth fearing them: Justinian's Plague (541-544AD) killed 40% of the population of Constantinople; In the 14th Century we saw as many as 800 people a day dying of the Bubonic Plague -- 30% of Normandy's population was decimated. By comparison, SARS has managed to destroy less than 0.0000005% of the world's population, infecting a mere 0.000077% of the population.

    4. Re:Don't all move to this! by silentbozo · · Score: 4, Interesting

      While much of the public fears of SARS is definitely overplayed in the short term, in the long term there is a justifiable fear of the risks posed by a fast-spreading, lethal, and poorly understood pathogen. Especially one that coincides with the cold and flu season (thus masking the symptoms of a more severe disease), and may share similar traits in terms of easy transmission via airborne droplets. Remember, highly infectious pathogens are much more dangerous to the world population than they were prior to the jet age (think Ebola...)

    5. Re:Don't all move to this! by kcelery · · Score: 1, Interesting

      SARS stands for Senior-citizen Accelerated Reduction Scheme. Anyone at a 3-feet radius around a SARS patient will be sprayed with thousands of droplets from his/her mouth. Medical mask alone is not enough to stop the spread you'll survive better with a pair of goggles and a detail aseptic training. Motality rate is about 5% in Asia, 10% in Canada. If 10 million got the disease, you will find 1 million graves more somewhere. A little bit more than the Hiroshima blast.
      At first no one will believe it, it's just common cold flu. Then people start to cough and cannot breath. Next, you'll find the ICU in the hospital is jammed with respiratory patient and to make the matter worse, the medical front-line is collapsing one after the other.
      Please study the disease and avoid it before it ever begin in your city.
      SARS kills, SARS also kill your tourism, restaurant, hotel flat. Business will go down 90%. By all means, avoid SARS.

    6. Re:Don't all move to this! by McDutchie · · Score: 4, Interesting
      When diseases were feared in the past it was worth fearing them: Justinian's Plague (541-544AD) killed 40% of the population of Constantinople;
      [...]

      If we had lived in that time, SARS would probably have killed a similar percentage of the population. Nowadays we have modern concepts of hygiene, we know what bacteria and viruses are, etc. so we know how to contain epidemics. That doesn't mean that the disease is any less worth of fear. It's that fear that motivated humanity to get to this level of medical knowledge in the first place.

    7. Re:Don't all move to this! by Anonymous Coward · · Score: 5, Funny
      Nowadays we have modern concepts of hygiene,

      You're talking to a crowd fascinated with moist towelettes here...

    8. Re:Don't all move to this! by lewp · · Score: 0

      You're talking to a crowd fascinated with moist towelettes here...

      So moist... mmm.

      --
      Game... blouses.
    9. Re:Don't all move to this! by benny_lama · · Score: 1

      Guess you missed the day in math class where they talked about exponential functions. You might want to go back and review that part.....its kinda important.

      --
      "No Comm, No Bomb"
    10. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      So, Iraq's war is worth one, cause there are *only* hundreds American army death?

    11. Re:Don't all move to this! by thamaht · · Score: 1

      The Bubonic Plague started in China in the 1330's, actually. I wonder what would have happened if they'd spent some cash doing research on that "crazy backwoods disease" before it hit London in 1665?

      I'm not going to touch the Moore side of things, I have several problems with his "documentary", and the contents thereof, and how it is presented.

    12. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      On the other hand modern transportation makes the disease a lot faster to spread. How badly would a disease spread if it kills in less time than it takes to travel from one place to another.

    13. Re:Don't all move to this! by BrokenHalo · · Score: 4, Informative
      it's just common cold flu.

      Make up your mind. Never mind, I'll do it. The SARS virus is a coronavirus, a family that includes infectious bronchitis. Colds are typically caused by paramyxoviridae, which includes things like mumps, measles and pneumoviruses.

    14. Re:Don't all move to this! by Gerald · · Score: 1
      30% of Normandy's population was decimated.

      ...so 3% of Normandy's population died?

    15. Re:Don't all move to this! by FroBugg · · Score: 1

      Actually, a disease like that wouldn't be so bad, as nobody would quite survive to spread it.

      The worst one is the disease that, after contraction, remains relatively dormant long enough for the carrier to move to a new location before they realize they've contracted it.

    16. Re:Don't all move to this! by slowtech · · Score: 1

      Thanks for the link! I just saw Bowling for Columbine last night, and I loved it!

      Your logic of risk, however, is very flawed. The Justinian plague killed 40% of the population. SARS has killed less than 0.000005% of the world population, but your denominators are all screwed up. Only a very small portion of the world population has been exposed to the SARS virus, so you cannot use the whole world population as a denominator. (That is like saying that only a tiny fraction of the world populatoin has died in accidents related to space travel, therefore space travel is the safest transport possible - very few people have actually been out of the Earth's atmosphere).

      SARS is a threat because it is spreading, very contagious, and - most importantly - because it kill relatively young, healthy people. The 5%-10% death rate may be much higher without effective medical care (respirators, etc.). We don't know what the death rate is in rural China. I have heard estimates of up to 50%.

      In the face of an unknown disease, it makes sense to take precautions that do no harm to anyone. Those EMTs were not executing potential cases - just using standard barrier protection. I will too if SARS comes to Boston (I work in an immunology research lab, but we are in a hospital).

      --
      "Well it's not Victory - but then it's not Death either."
    17. Re:Don't all move to this! by Idarubicin · · Score: 4, Insightful
      As a whole our society has seen millions of dollars spent on research on a disease that has only killed 295 people out of over six billion.

      How many people does it have to kill before we decide that it's important?

      I'm actually pleased to see millions of dollars being spent now, both on contact tracing and quarantines, and on longer term research projects. If the disease can be contained at this early stage, that's a tremendous public health success, IMHO. How much time, money, and effort could have been saved (and lost productivity avoided) if we hadn't had to deal with the bubonic plague?

      After decades of effort, the World Health Organization is finally close to eradication of polio. How many billions of dollars were spent there? How many iron lungs did we buy before developing a vaccine? How many people were paralyzed? The earliest evidence of polio dates back to roughly 1500 BC--but suppose it appeared today. Let's say there were only two thousand cases--total--before medical science put out that brush fire. Perhaps twenty cases of permanent paralysis, a couple of deaths, a footnote in medical literature. People might complain that the response was 'disproportionate'. Money well spent, I think.

      The problem with any new disease is that you just don't know. Far better to hit too hard than to let loose the next smallpox, Spanish flu, or pneumonic plague. If we discover that SARS has a large animal reservoir or something similar, we'll be glad that we started vaccine-related research now rather than later.

      I have an elderly grandmother who was rushed to the hospital for unrelated reasons shortly after the start of the SARS scare in Ontario. She was taken into an ambulance by men and women wearing full environmental suits.

      SARS seems to kill between five and ten percent of its victims, and it can be spread through aerosolized droplets. In Ontario, most new cases are occurring among health care workers. Quite frankly, if the ambulance attendants are able to do their jobs while wearing appropriate protective equipment, good for them. Remember, they're also protecting your grandmother from the last patients to use the ambulance.

      I live just outside of Toronto. Many of my friends live and work in the city--some in downtown hospitals. After an initial uproar, the average person on the street is only mildly concerned about SARS. Most are quite happy to put up with a little inconvenience now to (hopefully) avoid endemic disease later.

      --
      ~Idarubicin
    18. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      It also includes Rhinovirus which is one form of the common cold.

    19. Re:Don't all move to this! by Corporate+Troll · · Score: 1

      The french call SARS "Pneumonie Atypique". Seems a very accurate description of the medical condition.
      But, of course the french are always wrong, right? ;-)

    20. Re:Don't all move to this! by aminorex · · Score: 1

      There is good reason to doubt that SARS is in fact
      a coronoavirus. Only 40% of Canadian cases tested
      positive by nasal swab PCR for the suspected
      coronavirus, and less than one third of them tested
      positive for serum antibodies, according to
      this press report.

      --
      -I like my women like I like my tea: green-
    21. Re:Don't all move to this! by JohnsonWax · · Score: 1

      How many people does it have to kill before we decide that it's important?

      Probably more than are killed by things that we decide are unimportant. I understand the sentiment, 300 deaths is in the grand scheme quite irrelevant - that's a train accident in India or a typhoon just about anywhere.

      Considering the fatalities are currently among older individiuals (>30 - shut up, I'm in there too) then you really need to examine what a comparable mortality rate is for similar individuals that could come into contact with SARS. For those that live in Hong Kong, this is a crisis since they can very casually come into contact. For those in Des Moines that travel to Des Moines, this is not a huge problem since the accumulated risk of travelling there, acquiring some other bug that Iowans aren't resistant to, and so on add up. Sure, they might bring SARS home and infect their family, but that's been true of virually every flu strain that emerged from that region, are equally transmissible, target the same population, and have been known to kill in the tens and hundreds of thousands.

      I think the people that are hand waving here are arguing that SARS is no different than one of the many aggressive flu variants that kill as many or more people, yet we don't get so worked up about them because they are just the flu and we've come to expect that we'll get the flu and some will die of it. SARS is a new disease. The last two new diseases that caught people's attention were ebola and AIDS, and that's some nasty company to get tossed into...

    22. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      I just saw Bowling for Columbine last night, and I loved it!

      As long as you realize that it's a work of fiction, that's perfectly okay.

    23. Re:Don't all move to this! by dragons_flight · · Score: 1

      The more we fear, the more we consume. As a whole our society has seen millions of dollars spent on research on a disease that has only killed 295 people out of over six billion. When diseases were feared in the past it was worth fearing them: Justinian's Plague (541-544AD) killed 40% of the population of Constantinople; In the 14th Century we saw as many as 800 people a day dying of the Bubonic Plague -- 30% of Normandy's population was decimated. By comparison, SARS has managed to destroy less than 0.0000005% of the world's population, infecting a mere 0.000077% of the population.

      I've been following the statistics published by the WHO. You realize that despite all the attention that has been leveled against SARS, that it still has an accelerating growth rate? The number of deaths have been more than doubling every two weeks. From six deaths in early March to 293 at present. It fits a very nice exponential, with little sign that containment efforts have slowed it down.

      But let's all just ignore SARS till it's killed it's first million people. If containment truly fails we could see that by the end of the year. Frankly I think we can do better than that, and that we do have a chance to beat this thing before it settles in for the long haul, but not if people like you whine about how little impact it has had, while ignoring the impact it could have.

    24. Re:Don't all move to this! by Talinom · · Score: 1

      What methods have we used in the past to kill the following:
      smallpox
      polio
      yellow fever
      measles
      mumps
      rubella

      Vaccinations. If you come down with any of those today you are just as screwed as you were in the past. With childhood vaccinations you are protected from them pretty much for life. IIRC dead samples of the virus to be protected against were injected into the person to stimulate the immune system into producing the appropriate antibodies.

      How have we done with the following:
      AIDS
      the common cold (I know, not a virus)
      pneumonia
      viral meningitis

      We haven't. The best we can do at this point is adopt a wait and see posture for the last three. AIDS still has us baffled.

      Antibiotics only help with bacterial infections so if you come down with ANY viral infection you are screwed.

      I am NOT saying that we shouldn't find way to kill a (as in any) virus, but we should be prepared for lots of failure along the way. After all, didn't the medical community predict a cure for AIDS within about three years of it having been discovered 20 years ago?

      --
      "Giving money and power to governments is like giving whiskey and car keys to teenage boys." - P.J. O'Rourke
    25. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      I live in Beijing. Thert is nothing remote or unreal about the mortality rate here - whether it is 6% or 15% is not significant in the context or a readily transmissable fatal disease.

      It makes sense, it seems to me to work on understanding the underlying viral cause because in places like Canada, Singapore and HK the medical profession are having difficulty with controlling this. There is simply no reason for anyone to feel sanguine about this particular virus.

      If you want to contribute to the research, please do so - if you want to continue with SETI, please do so.

      Please do not trivialise a disease that is killing people every day.

    26. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      No, that solution was the alien who came to earth and presented the UN with a huge book, promising to cure disease, end war and famine, etc.

      And finally the one guy figured it out on his way to the spaceship. The book was a cookbook: "To Serve Man"...

    27. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      ...and the Anthrax "attack" was not the best time to be getting a chest cold post-9/11, either.

    28. Re:Don't all move to this! by austad · · Score: 1

      The spanish flu kill something like 15 million people, and it's mortality rate was around 2.5%. SARS mortality rate is more than 4%, even with our modern medicine and technology. If a cure/vaccination isn't found for it, it has the potential to spread as rampantly as the spanish flu did and have an even worse death toll. There are more densely populated areas now than there were in the early 1900's also, so it will likely spread to many more people than the spanish flu did, especially when you take into account how much more travelling people do now than they did almost 100 years ago.

      The only reason it hasn't spread that fast now is because we recognized the threat fairly early on and are trying to contain it as best as possible. That's not really working as it's still spreading, and it is very likely that we will reach a point where it can no longer be contained. We need to find a cure or a vaccination before this happens.

      --
      Need Free Juniper/NetScreen Support? JuniperForum
    29. Re:Don't all move to this! by Idarubicin · · Score: 1
      What methods have we used in the past to kill the following...Vaccinations.

      There is one other way to eliminate a virus. If you treat and isolate all infected individuals, and the disease doesn't have any animal hosts, then you get rid of a virus. We're still at that early stage with SARS, where it is possible to catch and trace each infection.

      If we're on the ball now, then we can eliminate this virus without a widespread vaccination campaign and decades of effort. What if polio or smallpox appeared today, rather than in antiquity? If public health officials caught them early, they might just become textbook footnotes--maybe a few hundred or a few thousand cases of each.

      --
      ~Idarubicin
    30. Re:Don't all move to this! by instarx · · Score: 1

      While much of the public fears of SARS is definitely overplayed

      In 1914 the Spanish Flu killed millions of people in the US and Europe. MILLIONS. And it was just "the common flu".

      Just because we have not had a major killing pandemic in 80 years doesn't mean we can't have one again. I don't think the public concern over SARS is overblown. These illnesses have to be taken seriously. We may very well be at the tipping point of controlling it or having a major world-wide disaster on our hands. A six to ten percent fatality rate is a major killer for a virus that is so easily transmitted. We are really in not much better shape to counter a worldwide virus outbreak than we were in 1914. As you point out we are really worse off in some ways because of air travel.

    31. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      How many people does it have to kill before we decide that it's important?

      How many people have to die before we put an end to death altogether?

    32. Re:Don't all move to this! by hesiod · · Score: 1

      I don't doubt that it has the potential to be a very deadly disease (or infection, whatever), and may already be, but we have enough other things to worry about from which we have just as much chance of dieing. If I worried about every nasty little thing (not to underplay the significance of SARS -- I work in a hospital) that cropped up I would drive myself insane.

    33. Re:Don't all move to this! by TheLink · · Score: 1

      Uh. So far the spread of SARS has been slowed down BECAUSE people are taking action. You may think it's over-reaction, but consider these:

      1) SARS is a moderately contagious humanly transmitted disease that kills 4-10% (10% = more recent estimates) of all infected people and requires significant medical care & treatment for that survivability percentage.

      2) Even if it were 2%, it's still quite bad, and we don't need such another blooming disease going around the world for who knows how many more decades - esp if the virus mutates - already it seems to have significantly mutated in one Hong Kong incident. If we can quarantine it out of existence lets do it NOW before it gets near impossible. Why let it join the ranks of the others?

      3) Most people can easily control their risk vs AIDS with minimal impact to their lifestyles. But SARS is too contagious for that.

      --
    34. Re:Don't all move to this! by Anonymous Coward · · Score: 0

      or more.. ...to reduce drastically especially in number "cholera decimated the population"

    35. Re:Don't all move to this! by Lazyhound · · Score: 1

      the common cold (I know, not a virus)

      Uh, what?

    36. Re:Don't all move to this! by superwai · · Score: 1

      I'm very happy that they can take SARS very seriously. Since the technology advances so rapidly during last century, I don't think the comparison of different diseases in time is appropriated. One thing that is worth to note is that we are living in peace for long time after world war 2, and the new generation of human being is different than the old generation. Most of them live in a peaceful and safe country. We are more cautious about life and we don't want to repeat what was happened in the past. No one will like to wait SARS to kill 40% of population before starting to do something. I think that in these days, human takes life much more serious than the old days and of course, we will do anything to stop the spread of the virus. If money can help to eliminate this virus, then I think it is worthy and people are doing the right thing.
      In addition, SARS not only kill people, it kills the world economy. People go out less, spend less, economy slows down, there is a chain of bad effects coming if we don't act quick. If the country's econ dies, the country dies. So SARS affects human in many ways. I hope that it will be eliminated soon.

  4. Good idea by Daath · · Score: 4, Interesting

    I wonder when my United Devices client (ud.com) is gonna add that project... It's currently working on smallpox and cancer...

    Should I change projects? Switch UD in favor of D2OL or what? And why? ;)

    --
    Any technology distinguishable from magic, is insufficiently advanced.
    1. Re:Good idea by rich_r · · Score: 2, Informative

      At risk of sounding ignorant, isn't smallpox well and truly beaten? (Apart from the lab samples?)

    2. Re:Good idea by DjMd · · Score: 1

      I think the reason for smallpox is the bio-terror angle...
      The Soviets maded a lot of weapons grade bugs (smallpox, and anthrax), not all of which is accounted for...

      Not that I think that someone will use it, but thats the reason for the smallpx thing. (they did anthrax earlier)

      --
      DJMD - The fourth man - Planetary
    3. Re:Good idea by BrokenHalo · · Score: 2, Interesting

      Let's not forget the US agencies who are also hanging on to samples. Quibbling over who had them first is silly, it's a chicken and egg issue.

  5. Who owns the results? by The+Original+Yama · · Score: 5, Insightful

    Who owns the results once they've been calculated? Who gets paid royalties when a drug is developed from this data? I'm not going to donate my CPU time if SARS sufferers have to pay royalties (either directly or indirectly) to GlaxoSmithcline or the US Government (which IMHO isn't any better than a multinational corporation) for their medication.

    Unless the results are released into the public domain or at least licensed under a BSD- or GPL-style license, I'm not touching it.

    1. Re:Who owns the results? by scalis · · Score: 5, Insightful

      Unless the results are released into the public domain or at least licensed under a BSD- or GPL-style license, I'm not touching it.

      Id love to download a client that support your open-results based medical lab developing a cure for SARS.
      Sine you dont have one and there is no one else to be found I see this as the second best thing.
      In my book, developing a cure that will make someone else money is better than developing no cure at all.
      Please provide a link and I will switch in a clockcycle.

      --

      True ravers don't need drugs
    2. Re:Who owns the results? by Oestergaard · · Score: 1

      So you know for a fact that the results will not be in the open and free for use?

      Can you please elaborate (or provide a link) - it would be great to know a little more about what they will actually do with the information.

      I completely share the views of Yama on this one - vaccines/cures for this kind of diseases would be nice to have, but we are not (yet) facing the end of civilization here... I would like to encourage other scientists and researchers to start a project where the work of the "public" will (rightfully, in my book) be made available to the public.

      As you state, there is no other project like this available right now. Well, if some research group out there is toying with the idea; you can have my cycles when you promise the results will be made available under reasonable terms (and with the grant money that I have seen flying around for questionable projects, I can't imagine it should be unreasonably hard to run a group on this project).

      I don't mind paying for medication at all. But I would mind paying royalties for medication that *I* discovered (or at least helped discover).

    3. Re:Who owns the results? by luisdom · · Score: 3, Insightful

      developing a cure that will make someone else money is better than developing no cure at all.

      No, it is not. If they apply for a patent and get it there won't be a cheap solution for the poor people.
      And I would be indirectly responsible for the death of that people, no matter how you apply the typical response of "Oh!, it's their government's fault not to provide its people the cure at the expense of 1/5 of their GDB"
      As additional information you can google for Manuel Patarroyo or the last events in south africa related to pharmacy corporations.

    4. Re:Who owns the results? by evvk · · Score: 1

      > In my book, developing a cure that will make someone else money is better than developing no cure at all.

      It is ok with me if they make money with it. It is not okay with me if they keep the results as secret or _especially_ if they patent them thereby forbidding everyone else from (possibly indepdendently) developing a similar cure. Patents are absolutely evil.

    5. Re:Who owns the results? by Anonymous Coward · · Score: 0

      Look at it this way. Without the distributed effort, the only cure that will developed will be by the people who apply the patents. Aside from the CDC and the WHO, large drug companies are the only organizations that have the labs necessary to find a cure.

      Even if the CDC does find a cure, they still need companies to make the drug, and that will inevitably lead to them getting distribution rights.

      So what you're basically saying here is that you don't want to be indirectly responsible for the death of SARS victims, but after knowing that there is a distributed effort out there to tackle this, you still refuse to participate. That's worse in my mind.

    6. Re:Who owns the results? by cybermace5 · · Score: 1

      So, would you rather have the cure available for some price, or do your level best to avoid helping find a cure?

      I guess with the latter, you can preserve your snobbish self-righteousness that you aren't helping a corporation who might need to offset some costs.

      Just tell yourself the world will thank you later.

      --
      ...
    7. Re:Who owns the results? by thogard · · Score: 1

      If your computer helps to produce the result and they make billions off the result, I'm sure at least one atty will be willing to help you collect some of that. Of course the drug compaines will have more better paid lawyers but if you helped to provide the IP and there isn't a contract, there will be issues.

      However I expect what is going on here is that they are looking for existing drugs that will work. They have the IP on those existing drugs.

      A program called Partek is used by other compaines to search for patterns that will show if existing drugs are related to other conditions.

    8. Re:Who owns the results? by Anonymous Coward · · Score: 0

      >or the US Government (which IMHO isn't any better than a multinational corporation) ? Since when do multinational corporations kill thousands of innocent people with bombs ?

    9. Re:Who owns the results? by darkmeridian · · Score: 1

      If there is a treatment, no matter how expensive, then at least some people can be cured. Perhaps the rich, perhaps the UN steps in and pays for it. Either way, many lives will be saved. What you are arguing is that these lives should not be saved because not everyone can be saved. This is wrong-headed. Does this mean that nobody should be using AIDS medication because the poor Africans cannot? That would be ridiculous. If we have an opportunity to save lives, we must. Perhaps the treatment might be cheap as hell. Until we try, we cannot know, so let science work before you inject politics into it.

      --
      A NYC lawyer blogs. http://www.chuangblog.com/
    10. Re:Who owns the results? by Anonymous Coward · · Score: 0

      Geee, that's exactly what they used to say about OSS in general and Linux, specifically. Can't argue with that, can ye ?

      So, all we need is a a biochemical Linus, hm ?

      Seems like the just sort of thing the UN / WHO / UNICEF could sponsor. Or help sponsor. Or Medicins Sans Frontieres and their clones. Or some guys that run around in Red Crosses making a nuisance of themselves to the military. Or Green Crescents. Or a supranational aggregate based on several government's Health Ministries / Services. Or all those religious orgs that already fund hospitals and public health campaigns and such.

      Or, how about the businesses around the world that are losing billions monthly ? Transport, tourism, hotels... every single town, city, and region that uses tourism to feed its burocracy, or help make ends meet ?

      Or the national "intelligence" services that routinely recruit dummies, er, I mean, tourists, as saps to do most of their shady work. 'Cos there are so many that its difficult for "counter-intelligence" (lol even harder) to keep tabs on all of them all of the time ?

      Besides, isn't a huge part of research already done on computers ? You just need small automated labs (kinda like automated amateur observatories) and lotsa geeks hacking away at results. Lab op time would be moderated by the owner. No need to work specifically with dangerous strains. Just their tame cousins. Kinda like studying cats to understand lions. Arguable, but doable.

      Or.... How about... *all of the above* ???

      So,
      Yep. Guess there is just *no way* an OSS style (OSHealthresearch? PharmaceuticalResearch ?) could be done. No sir. No siree. No way at all. That's right.

    11. Re:Who owns the results? by HanzoSan · · Score: 1



      You are fucking stupid, When you get Sars I'm going to laugh at you.

      --
      If you use Linux, please help development of Autopac
    12. Re:Who owns the results? by Anonymous Coward · · Score: 0

      So you would rather be indirectly responsible for the death of all SARS victims because you're afraid that someone will make money while you sit on your ass and post to Slashdot, as opposed to being indirectly responsible for the death of a subset of SARS victims by people who may or may not charge poor people for the cure?

    13. Re:Who owns the results? by mike3411 · · Score: 3, Informative

      Check out http://folding.stanford.edu/. They aren't researching SARS, but other, IMHO more important problems such as Altzheimer's, BSE (mad cow disease) and general protein research. Also, since it's run by a university, their data is public domain (although they'll probably take credit for your CPU cycles ;) ). Go fold!

      --
      Mod me down, and I will become more powerful than you can possibly imagine!
    14. Re:Who owns the results? by reidbold · · Score: 1

      Are you sure about that? Universities can still be government funded but withhold information from the public. I didn't see anything on their website addressing this. It's a noble cause but I won't help unless they explicitly state that results will be free to any and every nation.

      --
      -Reid
    15. Re:Who owns the results? by Anonymous Coward · · Score: 0

      http://folding.stanford.edu/faq.html#project.own states:

      Unlike other distributed computing projects, Folding@home is run by an academic institution (specifically the Pande Group, at Stanford University's Chemistry Department), which is a nonprofit institution dedicated to science research and education. We will not sell the data or make any money off of it.

      --
      Dreamweaver Website Templates

  6. Ain't there yet by ericwb · · Score: 5, Informative

    Unfortunately, finding a target binding site for a potential drug is years away from actually having a useful cure...

    1. Re:Ain't there yet by thrillseeker · · Score: 1
      finding a target binding site for a potential drug is years away from actually having a useful cure

      ...and it's even farther away if people don't assist by running such distributed-computing tasks

    2. Re:Ain't there yet by Muhammar · · Score: 4, Interesting

      Biologists have to find target. Produce the protein artificialy, study it and validate it (=conclusive evidence that blocking it will blocks the virus). Ten they have to develop a reliable high-throughput assay and huge collections of chemicals are screened to see if there is any decent inhibitor found. Chemists select the most reasonable candidates and start elaborating them (=derivatomania). Once they get very potent inhibitors, they do a lot of other optimisation - to get drug candidate that is cell-permeable cells, not metabolized/excreeted too fast, has low protein binding and good distribution, is not toxic and is preferably oraly available. At this point a lot of detailed biology research has to be done in animals, which is slow. Then there is study on healthy volunteers (subject of government aproval), then pilot clinic study just to see if they can get decent dosing in patients, then second large double-blind clinical study to see efficiency and the third phase even larger study to compare the drug with other therapies. Human trials are extremely costly.

      Pre-clinical development can take several years, as it was case with AIDS, clinical trials 4-6 years. It goes this fast only if there is a big profit potencial(to justify $400M cost of development), which so far there is not.

      Government now tests a collection of *all* known approved drugs (concidered reasonably safe) to see if any of them has any effect. If we get lucky on this - slim chances - it would cut the development time and the clinical testing too, since only 1-2 studies would be needed.

      --
      I doubt that we will ever figure out - and I suspect that even if we did figure out we couldn't do much about it
    3. Re:Ain't there yet by ericwb · · Score: 1

      Agreed. You have to start somewhere. And who knows, maybe serendipity can lend a helping hand and have us find out something useful while doing something that isn't really leading anywhere.

    4. Re:Ain't there yet by ericwb · · Score: 1

      That's the whole point. It may make you feel better to have this thing running in the background, and IMHO it's a Good Thing to be doing, but you don't want to expect things to go quickly from there.

      Moreover, interesting things may arise from the research that is done finding binding sites. That's why I still think it's a good idea to keep these things going.

      Plus, they actually do make you feel better! B^)

    5. Re:Ain't there yet by JohnFluxx · · Score: 1

      10 years? Oh wonderful.
      By my in-head calculations we have 1 year, going by currently trends of no. of deaths doubling each month.
      There's lots of points to swing it either way - not everyone infected dies, but it could mutate to be worse. As we get close to the 10's millions mark (just over half a year) society will start to collapse, causing the disease to spread faster ( I assume? ) but more doctors and more money will be spent on this.

  7. Wrong way. by DarkHelmet · · Score: 3, Insightful
    We're going at this all the wrong way...

    I know how to cure SARS.

    You give 8 of the most powerful businessmen in America SARS.

    In two months, there will be 3 or 4 different cures.

    --
    /^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
    1. Re:Wrong way. by obi-1-kenobi · · Score: 3, Funny

      Did he just threaten Steve Jobs! How Dare he!

      --
      "You win again Gravity!" -Futurama (Zapp)
    2. Re:Wrong way. by Anonymous Coward · · Score: 2, Funny

      Did he just threaten Steve Jobs! How Dare he!

      Well I don't know about Steve Jobs, but he just threatened Dubbya. Good on him!

    3. Re:Wrong way. by silentbozo · · Score: 4, Insightful

      Not quite. This only works for chronic diseases or conditions, where you give the people afflicted time to move their wealth and power into fixing their problem. SARS is a transient condition - a supercold if you will. Either you get it and die, or you get it and get better. Within a few weeks, you'll know either way - not enough time to bring personal resources to bear to find an actual cure, as opposed to boosting your personal immune system so you can fight the bug off by yourself. Once you're a survivor, you should have immunity, so that removes the immediate threat of re-infection, which then moves SARS to the bottom of your list of global concerns...

    4. Re:Wrong way. by Wrexen · · Score: 2, Funny

      The same way we cured the common cold! Oh, wait...

    5. Re:Wrong way. by SpinyNorman · · Score: 1

      That might have the effect of putting more money on it, but that doesn't mean there'll be a quick cure unless it's there to be easily found.

      Michal Milken got prostate cancer ... he put money into it ... where's the cure? How much money does it take?!

    6. Re:Wrong way. by Kim0 · · Score: 1

      If that were true, Michael Jackson would sponsor research on tissue regeneration.

    7. Re:Wrong way. by Anonymous Coward · · Score: 0

      No, SARS has mutated recently. Re-infections for all!

    8. Re:Wrong way. by Anonymous Coward · · Score: 0

      yes because SARS is apparently in the same family as the common cold, so we will be seeing regular mutations and reinfections, no doctor yet has said that survival ensures immunity

    9. Re:Wrong way. by tka · · Score: 1

      so we want the businessman's friends and family?

    10. Re:Wrong way. by Idarubicin · · Score: 2, Funny
      You give 8 of the most powerful businessmen in America SARS.

      Did he just threaten Steve Jobs! How Dare he!

      If you think Steve Jobs is one of the eight most powerful businessmen in America, then you've been reading Slashdot too long. Go outside and buy a newspaper. Now.

      Most of the most powerful businessmen are part of--or advising--the GWB cabinet.

      --
      ~Idarubicin
    11. Re:Wrong way. by Anonymous Coward · · Score: 0

      You mean like our cures for prostate cancer and heart disease?

      It must be tough always having The Man keepin' you down.

    12. Re:Wrong way. by Anonymous Coward · · Score: 0

      I dont believe this is correct.
      Why do people every year get a cold?Because its a mutating virus.Altough its the cold virus its never the same virus.
      The same happens to SARS.It mutates very fast and thats why its hard to find a vacine.

    13. Re:Wrong way. by AndroidCat · · Score: 1

      Any truth to the rumour that there's a sequence near the end that reads "477 UR B453-P41R5"? Mother Nature is a harsh h4x0r...

      --
      One line blog. I hear that they're called Twitters now.
    14. Re:Wrong way. by Anonymous Coward · · Score: 0
      Go outside and buy a newspaper.

      Outside? Oh...the big blue-ceiling room with the yellow light. We need to get the AC in there checked, and the pipes too. They leak. And the fluorescents need replacing...they go dim every so often. I don't like that place.

  8. Computational Modeling by gt384u · · Score: 5, Insightful

    How do all of you out there feel about contributing your computing cycles to the private sector? Previous iterations of this idea have been through nonprofit/university research institutions, but this new post seems to be private enterprise driven. As noble the goal D2OL is working towards is, i still feel odd about the whole idea. I pose the following question to the general Slashdot community: How do you feel about your computing cycles being used for the research and development of pharmaceuticals (or any other imaginable private sector application) and said company reaping tremendous profits from this show of goodwill?

    1. Re:Computational Modeling by shepd · · Score: 1

      >How do you feel about your computing cycles being used for the research and development of pharmaceuticals (or any other imaginable private sector application) and said company reaping tremendous profits from this show of goodwill?

      Perfectly fine.

      If nobody stepped up to the plate to do it for free up to now, what makes you think they ever would? This isn't exactly something that can be left on the backburner until it's done for free.

      Small-scale philanthropy doesn't always provide results. But large-scale distributed philanthropy usually does (witness the many orgs that do a great deal of good based on the small donations of just a few).

      Perhaps a quote: If I have seen further it is by standing on the shoulders of giants. -- Sir Isaac Newton

      --
      If you could be told what you can see or read, then it follows that you could be told what to say or think - BoC
    2. Re:Computational Modeling by inode_buddha · · Score: 1

      I feel odd about giving cpu time to private enterprise, since most of my workstations are a tad "high-end" (all SMP linux boxes with large RAM).

      OTOH, SARS was discovered in my town yesterday a mile or so away from me, and I'm wondering if that's just my normal "smoker's cough" in the AM. In other words, I'm more concerned about finding a cure than the business and politics of it.

      --
      C|N>K
    3. Re:Computational Modeling by aarondyck · · Score: 3, Interesting

      Sony has actually decided to adopt this model with the (eventually) upcoming Playstation 3. The idea is that users will leave their PS3 running all the time, game or no, and Sony will use the extra processing power to do whatever it is they do...spy on us or something. Of course, in order for this to work to their advantage we'll all have to use our PS3s to connect to the Net or some similar service. The only thing I hope is that Sony actually has an option to turn off processor sharing, just in case us hapless users don't want to support whatever cause it is that they are studying at the moment.

    4. Re:Computational Modeling by insecuritiez · · Score: 1

      I would like to see the evidence of this. The day Sony does this is the day I stop buying Sony.

    5. Re:Computational Modeling by liquidsin · · Score: 1

      witness the many orgs that do a great deal of good based on the small donations of just a few

      And the day I see the CEO of one of these charitable organizations driving around in a ferrari is the day I stop giving them money. The whole point of the parent post (I'm assuming) is that we could possibly be donating cpu cycles to this, and if a cure is found from our free labour, the drug gets patented and priced out of the range of the majority of the population. Would you still feel "Perfectly fine" if your mother died of S.A.R.S. and couldn't afford the cure, even though you helped find it?

      --
      do not read this line twice.
    6. Re:Computational Modeling by Eskarel · · Score: 1
      Well it sort of depends, I probably won't donate my processor power to SARS simply because SARS is as has been previously stated a supercold/flu virus, and has a relatively low level of infection/fatality when compared with other things. We had a massive killer flu during WWI which was spread all around by troops and troop transports and had a much higher fatality rate than SARS but after a year or so it just went away. Scientists have been saying for years that eventualy we're going to get another one of those things and we have. Therefor I think that this one is probably just a waste of time since even with distributed computing it's not likely to be solved before it solves itself.

      On the other hand, I did run the UD client for the cancer cure for a while(I had to stop because my fan/heatsink wasn't good enough and it was increasing my cpu temp by about 10 degrees Celcius which put me in the danger zone and caused problems. I've since replaced that equipment so I could run it again, just haven't gotten arount to it).

      My general feeling on this issue is that yes drug companies are going to continue to charge astronomical prices even though they're research costs have been subsidized by the people, and yes this is wrong(it's wrong for life saving drugs even when the costs are born entirely by the company), but it's better for people like my aunt(for whom it's now too late) to be alive and broke than to be dead. Not to mention that it can't possibly be more expensive than the chemo/radiation therapy cancer patients have to go through now.

      In general I think that my own political beliefs have to come after thoughts for people who are currently dying a horrible and painfully slow death.

    7. Re:Computational Modeling by shepd · · Score: 1

      >Would you still feel "Perfectly fine" if your mother died of S.A.R.S. and couldn't afford the cure, even though you helped find it?

      Considering the other option up to and including this point is no cure at all, yes.

      Better one person cured than none at all.

      Of course, you didn't expect that answer -- but I'm a libertarian at heart -- I'm not likely to put my emotions above the lives of others.

      Now, show me a charitable organization that's doing this, and I'll switch in a heartbeat. Till then, I'm going to download that client and try to help save some lives; even if I'm not the one making money from it.

      --
      If you could be told what you can see or read, then it follows that you could be told what to say or think - BoC
  9. let's DDOS SARS! by autopr0n · · Score: 0

    Let's all DDOS SARS.

    /Lame joke.

    --
    autopr0n is like, down and stuff.
    1. Re:let's DDOS SARS! by georgedorn · · Score: 1

      People got you wrong... they DDoSed D2OL

      --
      -- It's 5:30 am - do you know where your stack pointer is?
    2. Re:let's DDOS SARS! by Anonymous Coward · · Score: 0

      extremely lame.

    3. Re:let's DDOS SARS! by Klowner · · Score: 1

      Don't you mean..
      Distributed Denial of SARS

      Ok, fine, so it's an acronym within an acronym. *nix people love it, so you should too :)

  10. Will be the drug free?? by miceliux · · Score: 5, Insightful

    If they find the correct drug against SARS, will it be free? or will it be patented and only the rich countries will use it??

    1. Re:Will be the drug free?? by Mysticalfruit · · Score: 0, Troll

      Here's a counter question...

      If the rich countries populace contributes 95% of the CPU time to find the cure, who then is truely deserving of getting the cure?

      The "rich" countries who've invested trillions in infrastructure (of all kinds) including the money spent on the millions of PCs, plus the power necessary to run them.

      Or the poor as they say "Third World" who've sqandered their resources, have no infrastructure and demand huge ammounts of foreign aid (so it also can be squandered as well) Even if the cure was given to them wouldn't distribure it to the general populace. Instead they'd let their people die and blame the "rich" countries...

      I put the blame squarely on China's shoulders for SARS. If they had been initally honest about how many had been infected/killed by SARS, people who have taken it more seriously sooner.

      Now, with that all said, I asked that inital question as a devil's advocate stance.

      Personally, even though I live in one of those "rich" countries, a cure is a cure. Once found the information on how to synthesize it should be made freely available.

      --
      Yes Francis, the world has gone crazy.
    2. Re:Will be the drug free?? by Anonymous Coward · · Score: 0

      I'm so glad you have been modded to Troll. Your comments are reactionary and niave, except for the last paragraph.

    3. Re:Will be the drug free?? by m00nun1t · · Score: 2, Insightful

      I assume you volunteer your time and work in IT support for a lab full of volunteers working their butts of trying to find a cure for this and a zillion other diseases? No? You expect to be paid? So do they - and they can't get paid without patents. It's not always fair, but at least the drugs get developed this way and eventually become generic, better than a fair system with no drugs at all.

    4. Re:Will be the drug free?? by Anonymous Coward · · Score: 0

      It'll be damn near free to the drug company that spits out a few million dollars on a patent that the public helped bring to market and then they'll be a good american company and drive their company into bankruptcy, rip off the retirements of their workers, put millions out of work. Just kidding, what they'll do is continue to make it so expensive and continue to screw the american economy small business sector including the restraunt, hotel and other area's of the econmy by allowing huge profits on drug research that the public paid for.

      It should be no surprise to any investor that the drug makers are squeezing out the entire rest of the market, if they really wanted to do something about the small business econmy in the usa, it wouldn't be pushing your useless corporate paper by lowering taxes and increasing the incentives, it would be reform patent and IP law to lower the price and give the rest of the market a chance.

    5. Re:Will be the drug free?? by Anonymous Coward · · Score: 0

      dman right man, wrears my bong

    6. Re:Will be the drug free?? by Mysticalfruit · · Score: 1

      I'm so you responded in a reactionary way... well execpt for that last clause...

      I was merely asking a question for the sake of an argument... and I stated that at the bottom of the previous post...

      --
      Yes Francis, the world has gone crazy.
  11. waste of CPU cycles... by niker · · Score: 1

    by the time their server receives the first round of results from all the clients, SARS has been naturally erradicated.
    I'd say: keep up on the lookout for greys

    --
    Moderators: Don't agree? pray tell why.
    1. Re:waste of CPU cycles... by Anonymous Coward · · Score: 0

      Right, just like the common cold has been eraditcated.

      You just go on and keep looking for your aliens, Einstein.

  12. on a legal matter by thesilverbail · · Score: 4, Insightful

    Here's a question.. Suppose i download this thingummy and run it and jackpot, a miracle cure for SARS unrolls in front of my eyes. Do I have any sort of intellectual property rights over my discovery? And do I have the right to prevent the distributed software Im running from connecting back to the server and giving them the good news?
    Does this mean I might win the Nobel Prize???
    Not that I'm going to do anything like that. Just wondering if the guys behind the thing have thought through the legal issues.

    --
    I have found a truly wonderful proof of Fermat's Last Theorem, but unfortunately this sig is too small to contain it.
    1. Re:on a legal matter by ericwb · · Score: 3, Informative

      There won't be any Nobel prize to win in this case. There nothing innovative about trying to find a binding target for a potential drug on the nucleic acid or one of the preoteins of a virus. It would be like rewarding "brute force" as an intelligent way of breaking code. But frankly, I don't care if we get rid of this thing intelligently or not!

    2. Re:on a legal matter by Carrot007 · · Score: 1

      Exactly how would that be your discovery.

      It would be a lab cliaming right over something just because you discovered it there.

      All you are doing is donating CPU time, and your only reward is the knowledge of doing a good thing (unless a particular project decides to give you more as an incentive)

      Bah some people.

      --
      +----------------- | What is the question!
    3. Re:on a legal matter by tka · · Score: 0

      But if you prevent your client returning the results then after time the package will be sent to someone other than you. It wouldn't work because their data your crunching. I don't know if the results are yours until you return them but they can always crunch it again..

  13. Jews /dev/gaschamber by Anonymous Coward · · Score: -1, Flamebait

    Why is it so offensive to slag off jews? They are the source of almost everything evil in this world (the rest, surprisingly, is created by muslims). And that's Fact.

    1. Re:Jews /dev/gaschamber by Anonymous Coward · · Score: -1, Offtopic

      And why does Slashdot strip >'s from subjects? It really crimps my trolling style.

    2. Re:Jews /dev/gaschamber by WegianWarrior · · Score: 1

      It is offencive to 'slag off' anybody my cowardly friend, no matter their race or religion.
      As for the rest of your gab, thats just to far from reality to even bother commenting on.

      --
      Everything in the world is controlled by a small, evil group to which, unfortunately, no one you know belongs.
    3. Re:Jews /dev/gaschamber by Anonymous Coward · · Score: 0

      Baby Jesus was a Jew, and you just made him cry.

  14. Sounds intriguing, but... by Lurkingrue · · Score: 4, Interesting

    I'm not sure that this project (as it is now) will be all that useful. Alot of it appears to be hinging on generous speculation.

    I'm not a virologist, but as far as I remember, drug-directed approaches haven't been notably successful with attacking coronaviruses (ever hear that "medicine can't cure the common cold", anyone?) -- and to confuse things more, this one seems to be very atypical.

    Also, from what I know about the anti-virals that have shown some efficacy against these type of SS-RNA viruses, they've been directed at nucleic acids, not at product-proteins. Ribavirin, which was initially hoped to be the "magic bullet" to stop SARS is a nucleoside analogue (purine? I don't remember). I haven't heard of an effective intervention that disrupts the protein envelope or synthesis.

    Additionally, this group is assuming that the causitive agent of SARS has correctly been isolated and identified in the first place, which isn't certain by any means.

    Aiming computing power towards a worthy goal like this can't hurt, but I question how effective it really will be. I guess the computer-types can just tweak the parameters as the biomed-folks find out more on their end.

    1. Re:Sounds intriguing, but... by Anonymous Coward · · Score: 0

      I'm not a virologist, but as far as I remember, drug-directed approaches haven't been notably successful with attacking coronaviruses (ever hear that "medicine can't cure the common cold", anyone?) -- and to confuse things more, this one seems to be very atypical.
      Also, from what I know about the anti-virals that have shown some efficacy against these type of SS-RNA viruses, they've been directed at nucleic acids, not at product-proteins. Ribavirin, which was initially hoped to be the "magic bullet" to stop SARS is a nucleoside analogue (purine? I don't remember). I haven't heard of an effective intervention that disrupts the protein envelope or synthesis.


      There already is a cure for SARS, and it can be made in any hospital in the world for pennies.

      It's called Colloidal Silver, and is made by electrolysis of pure silver wire in distilled water. Contrary to the scare tactics of the FDA, it will not give you Agyria.

      Anyone who has tried it on a cut, and watched it heal the next day, or taken it at the first sign of a sore throat from a cold will tell you it works. It kills germs and viruses, and has little or no side effects.

      SARS has been a major topic on Mike Devour's Silver List, one of the oldest and most respected web journals on colloidal silver. You can see the threads here:

      http://escribe.com/health/thesilverlist/search.htm l?query=sars

      Unfortunately, it is very difficult to persuade doctors to consider trying this on their patients, even though the current treatment is ineffective and makes the patients very ill.

      There is a lot of hype on the web about colloidal silver and how to prepare it. But it is very simple to make, and it is truly the magic bullet everyone is looking for.

      But you won't believe it unless you see how it works for yourself. Give it a try. All it takes is three 9V batteries, some 0.999 fine silver wire, and ordinary distilled water.

      You might not end up with the best quality of colloidal silver, but it will work just fine.

      Good Health to All,

      Mike Monett

    2. Re:Sounds intriguing, but... by Queuetue · · Score: 1

      I suspect that most anyone would research this themselves before running some nine-volts in series and buying some siver wire, but this is as universally considered hookum as homeopathy, and in large enough doses, possibly dangerous.

      Research it for yourself, though - don't listen to random idiots on the internet (me or Mike the AC) about medical advice.

      (Keep your Carl Sagan Baloney Detector in hand, because there's plenty to detect!)

    3. Re:Sounds intriguing, but... by Meat+Blaster · · Score: 1

      Colloidal silver is a cure for having skin that isn't gray enough. You should recommend a yogurt enema and syrup of ipecac while you're at it.

    4. Re:Sounds intriguing, but... by cygnus · · Score: 1
      There already is a cure for SARS, and it can be made in any hospital in the world for pennies.

      It's called Colloidal Silver, and is made by electrolysis of pure silver wire in distilled water. Contrary to the scare tactics of the FDA, it will not give you Agyria.
      and i suppose pictures like these are FDA fakes, right?

      the day i trust some anonymous coward on slashdot for medical advice over the FDA... oh forget it.

      --
      Just raise the taxes on crack.
    5. Re:Sounds intriguing, but... by Anonymous Coward · · Score: 0

      There already is a cure for SARS, and it can be made in any hospital in the world for pennies.
      It's called Colloidal Silver, and is made by electrolysis of pure silver wire in distilled water. Contrary to the scare tactics of the FDA, it will not give you Agyria.


      You replied:

      and i suppose pictures like these are FDA fakes, right? [healthwatcher.net]

      You see many women wearing silver jewelry - do they turn grey? Of course not. Pure silver does not bind to human tissue. In fact, it is eliminated from the body with a half-life of 30 days.

      Silver can bind to tissue only when it is combined with other substances, such as nitrates or salts.

      Silver nitrate used to be put in the eyes newborn babies to prevent blindness. The doctors could easily see which infants had been treated. Their eyes turned black.

      Rosmary Jacob took a silver compound that binds to human tissue and produces Agyria. The label on the bottle warned this could happen:

      Keith L. Egli, in his article, Argyria: Consequences of using an antiquated medication, American Academy of Physician Assistants, May 2000, states that "The exact composition of the drops used by this patient (Rosemary Jacobs) is unknown. Both Strong Silver Protein and Mild Silver Protein Solutions, however, were recognized in the National Formulary before 1961. Directions for the use of both preparations read: "Antiseptic for application to mucous membranes. If for nose, hold head well back and instill 2 or 3 drops every 3 or 4 hours." In addition, this cautionary note was included: "Prolonged or continued use may result in permanent discoloration of the skin and mucous membranes."

      Reference:
      http://silverfacts.netfirms.com/pages/argyria.html

      A Senator became famous for turning grey after taking a silver product.

      He intended to make colloidal silver, but added ordinary salt to the solution. This produced silver chloride, which does bind to human tissue and produces Agyria.

      However, you will not find his picture on the quackwatch site. Despite his experience, he still encourages people to take colloidal silver:

      Here's my standard response. I think it answers most of your questions. Don't stop what you're doing. Colloidal silver has been so completely researched that we know it is very safe. Many people don't see any difference in my skin. This news blast started because a reporter who saw me in a debate in Great Falls, Montana interviewed me and published a story with a doctored photo (made my face decidedly blue). The associated press picked the story up and put it all on the Internet.


      http://silverfacts.netfirms.com/pages/jones.html

      When you make colloidal silver, don't add anything to the distilled water, such as salt or sugar.
      Properly made, the only thing that is produced is pure silver in solution, which has strong antibacterial and antiviral properties. It cannot cause Agyria.

      the day i trust some anonymous coward on slashdot for medical advice over the FDA... oh forget it.

      You know how to use google. Do some digging and find out why the FDA and the pharmaceutical companies are against collidal silver. They are against it because it works, and the pharmaceutical companies would not make the huge profits they now make selling antibiotics.

      But they still have not found anything that is effective against viruses, such as SARS.

      Colloidal silver works, and kills viruses. People are dying because of the fud about Agyria, which cannot occur with pure colloidal silver.

      Best Regards,

      Mike Monett

    6. Re:Sounds intriguing, but... by Lurkingrue · · Score: 1

      Just curious, but what is the proposed mechanism of action for "colloidal silver" acting as an antimicrobial that doesn't affect human tissue?

      And, as for your comment about the FDA and the pharmaceutical companies being against its use, I hope you don't propose a conspiracy encompassing the entire medical community. I know that there are many, many, many doctors and researchers who would love for their to be an antiviral "magic bullet".

    7. Re:Sounds intriguing, but... by Anonymous Coward · · Score: 0
      Just curious, but what is the proposed mechanism of action for "colloidal silver" acting as an antimicrobial that doesn't affect human tissue?

      For bacteria, the current thinking is the silver acts as a catalyst that disrupts the cell metabolism and kills it. The silver is not counsumed in the process, and is free to to the same to other bacteria. Thus only a small amount is needed.

      I have no idea how the silver acts to kill viruses. But I can testify from my own repeated experience that it does so very effectively.

      And, as for your comment about the FDA and the pharmaceutical companies being against its use, I hope you don't propose a conspiracy encompassing the entire medical community. I know that there are many, many, many doctors and researchers who would love for their to be an antiviral "magic bullet".


      There is no question the FDA is against colloidal silver. However, they are unable to find a single case of colloidal silver having caused harm to anyone. The "Blue Senator" got Agyria not from colloidal silver, but from the silver chloride he produced when he added salt to his solution.

      Many doctors have published articles on the benefits of silver ions in killing bacteria and promoting healing. A bandaage called Silverlon is impregnated with pure silver and is used to treat severe burns. (Most burn victims die from infection due to the exposed flesh.) Silverlon has FDA approval.

      However, the doctors looking for the magic bullet have not had a chance to learn about colloidal silver. It only became public in 1996 when Mark Metcalf published "Banishing disease with three 9-volt batteries Part 1", http://business.fortunecity.com/ellrd/490/banish1. html and "Banishing disease with three 9-volt batteries Part 2", http://business.fortunecity.com/ellrd/490/banish2. html. This was followed by Peter Lindemann's article, "A Closer Look At Colloidal Silver", http://www.elixa.com/silver/lindmn.htm. So the doctors really do not know about it.

      But the pharmaceutical companies do, as well as the FDA. They realize the threat it represents to a huge and profitable business. So the FDA does everything it can to frighten people away from the idea of using colloidal silver by misrepresenting the problems with Agyria due to silver compounds.

      These compounds are not the same as colloidal silver, since nothing is used in the process except pure silver and distilled water.

      But the FDA wants you to believe differently. They are not telling the truth. And people are dying needlessly because of it.

      Best Regards,

      Mike Monett
    8. Re:Sounds intriguing, but... by Anonymous Coward · · Score: 0
      However, the doctors looking for the magic bullet have not had a chance to learn about colloidal silver. It only became public in 1996 when Mark Metcalf published "Banishing disease with three 9-volt batteries Part 1", http://business.fortunecity.com/ellrd/490/banish1. html [fortunecity.com] and "Banishing disease with three 9-volt batteries Part 2", http://business.fortunecity.com/ellrd/490/banish2. html [fortunecity.com]. This was followed by Peter Lindemann's article, "A Closer Look At Colloidal Silver", http://www.elixa.com/silver/lindmn.htm [elixa.com]. So the doctors really do not know about it.
      i cry bullshit. the original colloidal silver experiments were conducted before the invention of antibiotics. science has had over a half a century to mull over colloidal silver.

      unless you have any legit medical training, you might as well be a proponent for Miracle Dirt for all you know.

  15. Ok, let the jokes begin. by Erpo · · Score: 0, Redundant

    Let's all try to be funny and make some comment about how the slashdot effect DDoS has melted the distributed computing project's servers.

  16. it appears that the site is SARS-attacked... by middle · · Score: 1

    ...it coughs 'the operation timed-out' when i click on it !

    *** unix _is_ user-friendly.
    *** it just decides who his friends are.

  17. SARS: DIY by Anonymous Coward · · Score: 5, Informative

    Download the SARS genetic sequence here.

    1. Re:SARS: DIY by middle · · Score: 5, Funny

      does norton detect it?

    2. Re:SARS: DIY by Anonymous Coward · · Score: 1, Funny

      does norton detect it?

      Been there, done that, no Norton does not detect the SARS virus. Perhaps if they release NAV for Humans v1.0 :)

    3. Re:SARS: DIY by Anonymous Coward · · Score: 0

      bbbbbut, now SARS can be sent by mail!!!!
      aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa g

      ok, I stop

    4. Re:SARS: DIY by Anonymous Coward · · Score: 0

      Download the SARS genetic sequence here.


      Does anyone have a Makefile for this? GCC doesn't seem to compile the code out of the box...
    5. Re:SARS: DIY by SpinyNorman · · Score: 1

      One of the problems with SARS is that it mutates, and for this reason the detection test that they originally ccame up with has a lot of false negatives.

      Presumably there are some constraints on the mutation, but unless those are identified I'd have thought that any cure based on one genetic variant isn't necessarily going to be a whole lot of use. It's apparently mutating into more lethal varieties, and hence the death rate is climbing (from an initially reported 4% to a global average of 5%+ so far, but suspected to be closer to 10%).

    6. Re:SARS: DIY by Anonymous Coward · · Score: 0

      Download the SARS genetic sequence here.

      [...]
      GTACAGTGAATAATGCTAGGGAGAGCTGCCTATATGGAAGA GCCCTAATG
      TGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTT CT
      TAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAA

      This --------- ^^^
      is where god ran out of ideas

      (Stupid damn lameness filter! It's not yelling, its a DNA for chists sake!)

    7. Re:SARS: DIY by sean23007 · · Score: 1

      I wonder... if you emailed that to a congressman, would you be arrested as a terrorist?

      --

      Lack of eloquence does not denote lack of intelligence, though they often coincide.
    8. Re:SARS: DIY by Anonymous Coward · · Score: 0

      and just for the fun of it... does any linux program can show that data graphically ?

    9. Re:SARS: DIY by hughk · · Score: 1

      Um, that won't stay that way for long. The word is that there is a high genetic variance between the various strains of SARS.

      --
      See my journal, I write things there
  18. Distributed Computing is not attacking SARS... by switched4OSX · · Score: 1, Funny

    Sars is attacking distributed computing. Let the computing infidels bask in their illusion. Their infidel processors are committing suicide by the hundreds. I can assure you that those villains will recognize, will discover in appropriate time in the future how stupid they are and how they are pretending things which have never taken place. Muhammed Saeed al-Sahaf

  19. SARS Treatment by Anonymous Coward · · Score: 0

    Updated April 25 2003
    SARS outbreak;
    The fruit of the plant Morinda Citrifolia contains substances which are highly effective for treating this outbreak. Powder, juice and fresh fruit are all effective at any dosage level. It is not appropriate to take this substance as a preventative measure. All active cold viruses are treated effectively using this fruit which has been used for over 4 thousand years.(95%+). There is a wealth of information on the World Wide Web referring to this plant, with many suppliers.

    http://www.geocities.com/channelledhealing/Home. ht ml

  20. maybe i didn't look hard enough.... by bongobongo · · Score: 1

    ...but i didn't see the usual prominently-advertised guarantees of non-meddling on their site. where are the ol' reassurances about "we won't sell information about your mp3 collection to record labels" or whatever?

  21. slashdotted by Anonymous Coward · · Score: -1, Flamebait

    Great work fellow slashdotters, the link is now officially slashdotted. We have all efficiently hindered this approach to combat SARS. Doom awaits, sit back, relax, and grab a beer...

  22. But UD doesn't have a Linux Client by sneakybilly · · Score: 2, Informative

    I've heard you can run it under wine but can't be bothered messing with it.

    1. Re:But UD doesn't have a Linux Client by King_TJ · · Score: 1

      Yeah, no kidding! I find that extremely frustrating, because I have a Linux web server running 24 hours/7 days here at home, and it could easily be crunching some data for UD while it sits, mostly idle.

      Those of us, like myself, who have EasyNews subscriptions, like to use the UD client because it lets you earn gigs. of download credit for every X number of days of processing you do.

  23. Anyone got a mirror of the client? by sneakybilly · · Score: 1

    Anyone got a mirror of the client?

    1. Re:Anyone got a mirror of the client? by Anonymous Coward · · Score: -1, Flamebait

      Anyone got a mirror of your arse?

    2. Re:Anyone got a mirror of the client? by Anonymous Coward · · Score: 0

      The MacOS X client is available on BitTorrent.

    3. Re:Anyone got a mirror of the client? by smokeslikeapoet · · Score: 1

      Anyone that has downloaded the Linux client willing to BitTorrent the Linux client?

    4. Re:Anyone got a mirror of the client? by PaddyNu · · Score: 1

      Sure. Here it is.
      And since my outgoing bandwidth is limited, it would help if as many as possible could share this as soon as possible :)

    5. Re:Anyone got a mirror of the client? by PaddyNu · · Score: 1

      Unfortunately, I can't seem to connect to the torrentse.cx tracker (or maybe I just misunderstood something about creating a .torrent file), I just get timeouts when trying to connect to the tracker.

      Any help would be greatly appreciated.

    6. Re:Anyone got a mirror of the client? by PaddyNu · · Score: 1

      Let's try this instead...

    7. Re:Anyone got a mirror of the client? by Anonymous Coward · · Score: 0

      their own download servers seem to be recovering, and they have mirrors up.

  24. Interesting, but I'd rather see.. by Anonymous Coward · · Score: 0

    This done with something that actually is more deadly on a world-wide scale. AIDS, Cancer, Heart Disease, etc. SARS is just a pitiful cough compared to them. I like the concept of using computing time for medical advancement, but I think our energy would be better spent on other, better research. Damn the media for their knack of blowing things out of fucking porportion.

    And no, I know of no other distributed computing programs for other, more deadly diseases. But then, that's my point.

  25. I think this shows a need of.... by wastaz · · Score: 5, Funny

    This slashdotting of such a site shows the need of a new distributed computing project. I wish to propose that we all sit down and share our cpu cycles to prevent slashdotting. How about we call the project "SARS: Some people Are likely to Risk Slashdotting this project" (Ok, I know that was a lame attempt at a name, but try coming up with a better one instead of complaining :P )

    It would in essence work the way that we'd all put aside ~200k disk space and ~5k bandwidth for storing the most recently posted websites and files on our computers, then people could put together impromptu mirrors from this distributed project and behold! No more slashdottings of sites, articles and programs that one actually wants to read or download!

    So, who's with me on this trek into the land where no slashdotter has ever ventured before?
    Anyone?

    1. Re:I think this shows a need of.... by Anonymous Coward · · Score: 1, Insightful

      The freenet project may be of interest then...

    2. Re:I think this shows a need of.... by vasah20 · · Score: 1

      What about something like this?

      Whenever something about downloadable software is posted to /., why not wait until a .torrent is created then directing people to that .torrent? Granted, that might not eliminate the /. effect, but I'm sure I can't be the only one going to that site just to download the client.

      And hell, even /. editors wouldn't need to be in charge of that. If you can see into the "Mysterious Future", why not head over to the site, d/l the client, and setup a .torrent before the post goes live? Maybe the /. editors could allow subscribers to slightly modify future posts, by letting them post mirrors and what not for the sites/software?

      I dunno. Just a thought.

    3. Re:I think this shows a need of.... by Greg+W. · · Score: 1
      The freenet project may be of interest then...

      Yes, quite. Ian Clarke has tried to put together an automatic slashdot-story-Freenet-insertion script, but there are many issues here:

      • Most people aren't running Freenet nodes yet.
      • Freenet routing isn't even close to perfect yet; documents inserted into the network are not always retrievable at a reasonable HTL.
      • Insertion takes a while, and you can't publish the Freenet key of your mirror until you've finished the insertion. (Warning: this is a simplification!)
      • Whoever intends to insert the site into Freenet must first be able to retrieve a copy of it himself. The only reasonable way to ensure that this will happen would be for the story submitter to mirror it himself first, before submitting the story. I say this because the Slashdot editorial staff does not appear to be willing or able to perform this duty themselves. (In a perfect universe, the Slashdot crew would already be doing something like this.)
    4. Re:I think this shows a need of.... by Alsee · · Score: 1

      we'd all put aside ~200k disk space and ~5k bandwidth

      Yeah, and how long do you think it'll be before someone starts leeching a profit with porn banners? :D

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    5. Re:I think this shows a need of.... by bobbozzo · · Score: 1

      Sounds like a http proxy to access documents in freenet would be very helpful for slashdotted stories.

      And make it simple to use. The freenet interfaces I've seen aren't simple enough for such a use.

      --
      Nothing to see here; Move along.
  26. This may sound nasty, but ... by halftrack · · Score: 4, Insightful

    If you're already searcing for E.T. and not a cure for cancer, why would you search for a cure for SARS? SARS is scary because it's new not because it's a currently uncontrollable viral disease, we've got loads of them. HIV/AIDS, TB, the common cold. Somwhere between 80% and 95% recover quite nicely from SARS, IIRC 500,000 die each year of the flue, you don't see us jumping around over that.

    Disclaimier: I'm not saying SARS shouldn't be fought, all disease should, but let's all get some perspective.

    (To back some of this up with a _little_ more reliable resource found through Google, look here)

    --
    Look a monkey!
    1. Re:This may sound nasty, but ... by snitty · · Score: 2, Funny

      IIRC 500,000 die each year of the flue

      I had no idea there were so many chimney related deaths each year!

      --
      Modular Redundancy--Because 4 out of 5 Nodes agree
    2. Re:This may sound nasty, but ... by gm-7 · · Score: 1

      40 million or more people get the flu every year in the United States... maybe 20,000 die.

      Ok, so if 1 million people were to contract SARS 60,000(low est.) people die, because we were too busy trying to cure the flu. SARS spreads just as fast as any flu..

      How is that for some perspective?

      --
      Sig (appended to the end of comments you post, 120 chars)
    3. Re:This may sound nasty, but ... by bpd1069 · · Score: 2, Informative

      The fact that it is New is exactly why it is so dangerous. The population has almost Zero natural immunity to it. This can cause massive propagation of the virus and when it spreads through under-developed regions of the planet, it will be a plague.

      If we don't throw everything we can at it now, millions of people will die. It's just that simple.

      The illness has of yet been isolated to a few regions with moderately decent health care systems in place. Imagine a small town of 200 people infected with this disease. Weeks of lost productivity will not only cause immediate harm to those infected but the means of that town will loose the ability to support itself. Can you say famine?

      Personally I understand that new bugs come on the scene on a (on a big picture scale) frequent basis, and its natures way of population control and generating a healthier species. But if it were my daughter in a hospital bed, coughing and vomiting, I would want to know that I did everything possible to help, even if it were just a few idle clock cycles.

      --
      --
    4. Re:This may sound nasty, but ... by cygnus · · Score: 1
      SARS is scary because it's new not because it's a currently uncontrollable viral disease, we've got loads of them. HIV/AIDS, TB, the common cold.
      • i can avoid AIDS by wearing a condom or only having sex with one person who is not infected. ergo, it's controllable.
      • tuberculosis is caused by a bacteria, not a virus.
      • the common cold has a nice benefit: it's non-lethal.
      if you want to start comparing this to other diseases, try smallpox, plague and the spanish flu.
      --
      Just raise the taxes on crack.
    5. Re:This may sound nasty, but ... by Idarubicin · · Score: 2, Insightful
      SARS is scary because it's new not because it's a currently uncontrollable viral disease, we've got loads of them. HIV/AIDS, TB, the common cold.

      I'm going to set aside the common cold because it doesn't kill people. HIV does now face a massive and directed effort to study the virus and associated illness. There are probably a lot of people in public health who wish we'd jumped on that one a lot sooner.

      Tuberculosis is bacterial, but that's not particularly important to the point at hand. A vaccine that provides partial protection (50 to 80% protection) exists and is used in parts of the world where TB is most common. TB can be treated by a mixture of antibiotics and other drugs. The full course runs six months to a year, and failure to follow the treatment regimen can lead to drug resistant forms of the bacterium.

      There is a little less public hype around TB because is spreads much more slowly. It is possible to carry the bacterium for years without symptoms and without spreading the disease to others. Last year I was working in the research wing of a hospital where a case of TB was discovered among the staff. There was an intelligent, coordinated, and very thorough response by public health officials and the hospital's own infection control staff. TB skin tests were administered to all research staff, and chest x-rays taken where indicated.

      My point is that TB is a known quantity--we know how to detect it, how to treat it, and how to control it. With a new disease like SARS, we don't have all that information, so in good conscience we must err on the side of caution.

      Somwhere between 80% and 95% recover quite nicely from SARS, IIRC 500,000 die each year of the flue, you don't see us jumping around over that.

      You're saying that a fatality rate of 5-20% is nothing to worry about? Influenza typically kills about 0.1% of those infected, mostly among the elderly or immune compromised. The Spanish flu in 1918-1919 killed approximately 500,000 in the United States. The average annual death toll is closer to 20,000, and that number is falling because of wider adoption of annual flu vaccines. If SARS infected 5% of the U.S. population (the Spanish flu reached 5-10% of the population) it would kill more than two million people. If we can get preventive measures off the ground now that contain and ultimately eliminate the disease in the next couple of months, that's great. If we don't contain the disease, I want to have other strategies waiting in the wings.

      --
      ~Idarubicin
  27. Is there a cure for... by Anonymous Coward · · Score: 3, Funny

    media hype?

    1. Re:Is there a cure for... by outsider007 · · Score: 1

      if there could be one good thing to come of this hype it should be ridding us of the custom of shaking hands. Really, when someone you don't know sticks out his hand for you to shake it, he might as well be asking you to lick his armpit.

      but if you don't you look like a weirdo. what happens when you show up for a job interview and the guy sticks out his hand, its like: 'sorry, I'd shake your hand but I left my level 4 biocontainment suit at home.'

      guess who doesn't get the job?

      --
      If you mod me down the terrorists will have won
    2. Re:Is there a cure for... by TheLink · · Score: 1

      Switch to the Thai style greeting - hands both together like in prayer at chest level, slight bow, no body contact.

      Seems respectful enough.

      --
  28. Fear me! by LocalHero · · Score: 0, Offtopic

    Now everybody fears me!!!

    Sa"e"rs :)

    1. Re:Fear me! by LocalHero · · Score: 1

      Sorry. Forgot to sign /Alexander Saers

  29. More useful? by Lord+Prox · · Score: 2, Funny

    Looks more usefull then finding the odd alien out there :P

    Now if they could come up with a Distributed Computing Project to help with a socially dibilitating disease affecting millions of geeks and /.ers called CIC.

    Chronic Invoulntary Celebacy.

    1. Re:More useful? by Anonymous Coward · · Score: 0

      The Greeks had a simple solution to that problem.

  30. Angst hype. by Krapangor · · Score: 3, Insightful

    There are much more dangerous illnesses than SARS which affect much more people. There are 2000 people sick with SARS but 40 million with AIDS. And the death rates for AIDS is 100 % percent. The numbers for cancer are even higher (not the death rates).
    This seems to be rather a angst-hyped PR champain instead of real science. The problems we have now are elsewhere.

    --
    Owner of a Mensa membership card.
    1. Re:Angst hype. by gm-7 · · Score: 1

      AIDS and cancer do not spread like the flu...

      --
      Sig (appended to the end of comments you post, 120 chars)
    2. Re:Angst hype. by Anonymous Coward · · Score: 0

      You don't have mych choise about SARS (just like the common cold), but for the most part, you *choose* to get AIDS.

      That's a pretty big difference.

    3. Re:Angst hype. by Anonymous Coward · · Score: 2, Insightful

      I can avoid getting AIDS, because I A) know what transmits HIV / AIDS, and B) how I can avoid AIDS.

      I can't avoid getting SARS because I A) don't know how SARS is transmitted and B) Even knowing that, I cannot easily avoid getting it if I'm in an infected area.

      I'm tired of people throwing around the 40 million number. 40 million people with AIDS, over the course of almost two decades, with a ten year incubation period. It sucks, it needs a cure, but it's had twenty years for a cure to be found. Tackle SARS, then we can get back to tackling AIDS.

      SARS is spreading, and spreading pretty quickly, especially in Hong Kong, where most of my family lives now. The masks are not hype. The quarantines are not hype. They quarantined an entire apartment block, and the hospitals, and people are *still* getting sick at the same rate. The death rate is rising from the initial estimates of 4% to 8%, and it'll continue to rise as hospital resources get strained. And that's within a two week incubation period, not a ten year one.

      We need to tackle this now. Then we can get back to the other diseases. The silver lining? Maybe SARS will wake people up to the fact and get more people working towards other cures as well, like AIDS.

    4. Re:Angst hype. by SpinyNorman · · Score: 1

      The scary thing about SARS is that unlike cancer it's contagious, and unlike AIDS there's not much you can do to avoid getting it.

      It's too early yet to be really alarmed about it (unless you live in China or Hong Kong), but history has shown that flu epidemics are nothign to be blase about.... The Spanish flu in 1918 killed ~30,000,000 people worldwide, 675,000 in the US alone (at a time when the US population was ~100M).

    5. Re:Angst hype. by FunkyChild · · Score: 1

      The death rate for living is 100%, too :)

    6. Re:Angst hype. by Anonymous Coward · · Score: 0

      And the death rates for AIDS is 100 %

      Bullshit.

    7. Re:Angst hype. by Anonymous Coward · · Score: 0

      Want to use your comp to help fight AIDS instead of SARS? Fine.

      Fight AIDS@Home

    8. Re:Angst hype. by breon.halling · · Score: 1

      You obviously don't live in Toronto! ;)

      --
      "Yeah, well, Dracula called and he's coming over tonight for you and I said okay."
    9. Re:Angst hype. by aminorex · · Score: 1

      AIDS is also 99.99% preventable. SARS is
      exceedingly difficult to prevent, and considerably
      more contagious. Regression fitting the case
      curve of SARS, I see that by 25 May, there should
      be roughly 10,000 cases. By 26 August, there
      should be roughly 100,000 cases. By the end of
      the year, the number should be in the millions.

      The Spanish Influenza of 1916-1918 killed roughly
      20,000,000 people, with a mortality rate of only
      1%. SARS has a mortality rate of roughly 10%.
      Given the larger global population today, we can
      conclude that the potential death count for SARS
      over the course of 3 years is roughly 600,000,000
      people.

      That's a prediction about future events which is
      rationally derived from historical data regarding
      similar past diseases and from current epidemiology
      of the SARS infection. It's not "angst hype".
      600,000,000 is a worst case, but it is also the
      case which appears to be playing out today, as
      we speak. Hopefully, innovative treatment and
      public health policy can dramatically
      reduce the actual mortality of the disease. Hiding
      your head in the sand cannot.

      --
      -I like my women like I like my tea: green-
    10. Re:Angst hype. by Chester+K · · Score: 1

      And the death rates for AIDS is 100 % percent.

      The death rates for people who drink water is also 100%. Every person that has consumed water will die.

      --

      NO CARRIER
    11. Re:Angst hype. by Anonymous Coward · · Score: 0

      The problems we have now are elsewhere.

      I've heard people complain that more money is put into researching AIDS than heart disease, even though heart disease affects more people. I think the difference here is the same: rate of infection.

      Sure, more people may have heart problems, but there are diet and exercise solutions to prevent them. Also, if someone has a heart attack, it's not going to spread.

      Sure, more people may have AIDS, but there are treatments that show some promise. Also, we know to promote safe sex, and to have doctors, nurses and paramedics to take body substance isolation procedures.

      So far, not many people are infected with SARS, but it is spread much easier and we don't have a treatment for it yet. Millions could get infected very rapidly, which is no longer likely with AIDS.

    12. Re:Angst hype. by xmnemonic · · Score: 1

      Actually, in the U.S. the death rate for AIDS in 1999 was 8%. The global death rate of AIDS so far is about 30% (according to NOVA).

    13. Re:Angst hype. by Anonymous Coward · · Score: 0
      And the death rates for AIDS is 100 %

      I think someone forgot to tell Magic Johnson that

  31. Pffffttt SARS - BFD by jafiwam · · Score: 0, Flamebait

    Oooo... 300 people dead! That is SO SCARY.

    For you risk-adverse people that are concerned about it, here are some magic tidbits that will GREATLY REDUCE your risk of dying. Unlike worrying about getting SARS or then dying from it...

    1) Wear your seat belt.
    2) Don't drink and drive or ride with someone who does.
    3) Watch where you step when traversing stairs.
    4) Never clean a loaded firearm.

    I bet you can come up with others.

    The point being, SARS has some unusual tendancies that make it worth watching; however it still much less important than daily-risk management done sensibly.

    My CPUs will continue searching for E.T.I. thank you. Call me when 100,000 have died.

  32. SARS, AIDS and the good of all of us... by brahms3 · · Score: 2, Insightful

    I'd be inclined to think about this one. Just a related matter. If you look at the spread of HIV around the world, the rate is slower and the powers that be may be less inclined to 1) fund research for cures or vaccines, and 2) probably more importantly less inclined to distribute treatment around the world because it has less chance of affecting them. In short, it may be something like: lets cure the world before this highly infectious disease becomes a problem for us. HIV is much more manageable, we'll let those countries take care of it themselves. If a cure for SARS is found, needless to say several things will happen: -the drugs will be made cheaply available -they will be distributed more quickly than ever before -ALL countries and all classes/races/religions will get them -the drug companies may not be able to swing a patent and expensive license manufacturig rights. How about doing this for AIDS in Africa and other areas where HIV is rife. There is no doubt it will affect everybody. It is just a little further down the road. As tragic as it is, SARS is something that will I hope break the barriers between nations (just like a funeral is the best way to get a family together). There is nothing for individual nations to play for with a visibly threatening global problem like SARS. It is just a damn shame that HIV and the environment get a back seat because those in authority refuse to see further than the tips of their noses (or election campaigns.)

  33. probably not likely by Trepidity · · Score: 1

    It's hard to say for sure, but SARS simply doesn't seem that deadly. With worse hygiene and containment certainly far more people would be infected, but it's unlikely such a huge percentage of them would die. Currently fatality rates are in the 2-4% range. Even if that'd double to 4-8% without modern medical care, that's still not near 40% (and that's not even necessarily the case; a lot of people that have recovered just recovered on their own, similarly to how you recover from a cold, not due to wonders of medical care).

    1. Re:probably not likely by Dionysus · · Score: 4, Informative

      I saw a report yesterday, either BBC or CNN, that WHO now believes the fatality rate of SARS will be about 10-15%. Much higher than previously believed (this was after China went public with their info)

      --
      Je ne parle pas francais.
    2. Re:probably not likely by MillionthMonkey · · Score: 4, Informative

      It's hard to say for sure, but SARS simply doesn't seem that deadly. With worse hygiene and containment certainly far more people would be infected, but it's unlikely such a huge percentage of them would die. Currently fatality rates are in the 2-4% range. Even if that'd double to 4-8% without modern medical care, that's still not near 40%

      The Spanish Flu of 1918-1919 had a mortality rate of about 4% which is similar to what we're seeing with SARS. It infected a fifth of the world's population. The U.S. was one of the countries least devastated by the pandemic. But even here 20,000,000 Americans came down with the flu, with 850,000 deaths resulting. Which means that flu killed more Americans than died in all the wars of the twentieth century.

      Like SARS, this one originated in China as well. It started as a virus passed from birds to pigs. (They know because in 1997 someone exhumed the body of a soldier who died of it in 1918 and sequenced some of the virus from his lungs.)

    3. Re:probably not likely by Anonymous Coward · · Score: 0

      Here is how influenza A and B generally work.

      In China, rice paddies are worked over by ducks. Ducks, of course, poop in the water.

      They also fertilize the paddies with pig manure. They grow a lot of pigs, and pig manure works well for rice.

      Both pigs and ducks are hosts for influenza virus strains.

      One year we get the duck->pig->human version, the next we get the pig->duck->human version.

      Wasn't it a couple of years ago that virologists feared a particularly nasty strain of asian influenza coming about, which consequently saw a rather Brithish reaction and many, many ducks were killed to "break the chain" (it was a pig->duck->human strain)? I do remember seeing stories on CNN about it.

    4. Re:probably not likely by MillionthMonkey · · Score: 2, Interesting

      I read that an exotic open-air animal market in Guangzhou, China is being investigated by WHO as possibly having something to do with the origin of the illness. (That story taught me a new word I didn't even know- zoonosis. It sounds like a good name for a band.)

      Which isn't too hard to believe. Anyone who has watched any Nature episode on an endangered animal species has seen the part at the end that goes like this:

      Unfortunately, the future of the [insert weird species here] is far from certain, because it is considered a delicacy in certain Asian countries.

      (There's also a less common variant of the Nature show ending, where the species is an aphrodisiac and not a delicacy.)

      Basically, the issue is that in Guangzhou, China there is a famous wet market where dozens of different animal species are for sale- rodents, birds, alligators, cats, badgers, dogs, porcupines, pigs, snakes, turtles, and other delicacies. They come from all over the world. They aren't frozen and packed or anything like that- they're running and fluttering around in their cages when you pick them out. Some of them have chewed their limbs off in attempts to escape traps. They are either butchered on the spot or you take them home still alive and kill them yourself. The emphasis is on freshness.

      Of course this grossed out the tourists, not to mention the people who make Nature documentaries. So the Chinese authorities (in typical fashion) cracked down on the market two years ago by forcing it to move out of sight of foreigners. It was moved from an outdoor park setting into an enclosed building two years ago. WHO thinks the move to an indoor setting would have made the risk of zoonosis worse.

      The first known SARS patient got sick in November. He lived 12 miles away, but had been in Guangzhou and received treatment there.

    5. Re:probably not likely by SensiMillia · · Score: 1

      With worse hygiene and containment certainly far more people would be infected

      Have you ever been in Bejing?
      Not all people live like us Europeans/Americans... People in the suburbs of Chinese cities live with whole family's in a 6 m^2 room.
      During the day, most of these people live on the street, they cook and eat in the terrible smog of Bejing and Shangaii.

    6. Re:probably not likely by instarx · · Score: 1
      I question your 4% fatality rate. The fatality rate in Toronto is 10%. That is one of the mysteries about SARS - its fatality rate appears to be greater in western environments with state of the art medical systems than in places like Vietnam.

      Another issue is that it doesn't seem to be attenuating. Normally infections attentuate and become less serious as they pass from host to host. A tertiary infection is almost always muuch less severe that primary infection. This does not seem to be hapening with SARS.

      Finally, how can you possibly say that an illness transmitted as easily as the flu with a 4 to 12% fatality rate di=oesn't seem that deadly. Remember, the cases we have seen so far are in healthy people travelling on business and healthy medical personnel. A 4-12% fatality rate among that population will increase dramaticaly when the young and elderly start to be infected.

    7. Re:probably not likely by MillionthMonkey · · Score: 1

      I question your 4% fatality rate. The fatality rate in Toronto is 10%.

      Interesting. Well, then, that bolsters my point.

      A tertiary infection is almost always muuch less severe that primary infection. This does not seem to be hapening with SARS.

      Or AIDS, or most other infectious diseases I've heard of for that matter. Are you sure that's correct?

      Finally, how can you possibly say that an illness transmitted as easily as the flu with a 4 to 12% fatality rate di=oesn't seem that deadly.

      I didn't say that at all. The guy I was replying to said it, and I quoted him in italics. I think you replied to the wrong post.

      Remember, the cases we have seen so far are in healthy people travelling on business and healthy medical personnel. A 4-12% fatality rate among that population will increase dramaticaly when the young and elderly start to be infected.

      This might not be the case. I don't know about SARS, but viruses don't always automatically target children and the elderly. In the 1918-1919 flu pandemic, people aged 20-40 were disproportionately affected. (Which is why WWI soldiers were such effective carriers- the Armistice Day celebrations in 1918 were a public health disaster because everyone gathered to watch a parade of infected soldiers just back from Europe.) Strangely enough, the young and elderly seemed to be relatively immune.

    8. Re:probably not likely by instarx · · Score: 1
      Or AIDS, or most other infectious diseases I've heard of for that matter. Are you sure that's correct?

      Yes, I am sure, or at least that's what they taught us in the biohazard and microbiology courses in grad school. You left out my parenthetical "(but not all)".

      Sorry I didn't see the italics - you are right I incorrectly attributed that statement to you - sorry.

      Actually viruses don't "target" anyone. Thinking that way imparts them with a purpose they don't have. They have hosts. I think you are reaching too far when you argue that the old and young will not be more adversely effected if they acquire SARS.

      I frankly have not heard your stats that 20-40 year olds were preferentially infected in 1914. If true, perhaps greater total number of fatailities among that demographic had something to do with WWI and the military camps that put hundreds of thousands of 20-40 year olds in close proximity to each other. I suspect that you have interpreted the gross fatality numbers and come up with the incorrect conclusion that the fatality RATE was higher for 20-40 year olds when it was just total number killed that was higher. It would be very hard to convice me that 1000 20 year olds infected with Spanish Flu would have a higher mortality rate than 1000 infected 70 year olds. I would bet a lot that the mortality RATE was higher among the old and the young in 1914.

    9. Re:probably not likely by dreadstar · · Score: 1

      Here is a good synopsis of the SARS situation.

      --
      [In the deep dark forest of Hyrule...]
    10. Re:probably not likely by Anonymous Coward · · Score: 0

      sorry, at least a million americans died in the world wars.

    11. Re:probably not likely by MillionthMonkey · · Score: 1

      > sorry, at least a million americans died in the world wars.

      From enemy fire or is that all deaths including disease?

    12. Re:probably not likely by bobbozzo · · Score: 1
      people aged 20-40 were disproportionately affected. (Which is why WWI soldiers were such effective carriers- the Armistice Day celebrations in 1918 were a public health disaster because everyone gathered to watch a parade of infected soldiers just back from Europe.)

      Maybe all the infected soldiers were kissing a lot of 20-40 year old women!

      --
      Nothing to see here; Move along.
  34. Wow... by black666 · · Score: 1

    ..another project that lets our CPUs work for simulating atomic explosions ...

    Oh wait..you mean you didn't know that and thought you were searching for aliens/cure/dna samples/... ?

  35. Not really by autopr0n · · Score: 3, Insightful

    You know how easy it is to catch a cold right? Well, SARS is like that, a cold. It's easy to catch. There's a damn good reason for all this hype. No one talked about SARS in china for months until it went totally out of control and people didn't realize that they should be taking basic precautions.

    SARS would have absolutely no problem killing the same numbers of people if it managed to get 'free' of the quarantines and stuff

    Also, Michael Mooor is a dumbass, and he has his math backwards. The more scared we are, the less we consume. SARS is death to tourism and the like in Asia, and it makes people stay home to avoid it.

    9/11 certanly didn't boost the economy.

    --
    autopr0n is like, down and stuff.
    1. Re:Not really by Anonymous Coward · · Score: 0

      People just aren't travelling. It's just a possible cultural change. Technology shall accompany it, in case it happens.

      VR and sterile home-fab could bloom, if this thing keeps on. Bandwidth. Bigger, sensurroundier, snappier displays and "sense delivery". Sterilizing appliances and booths. Sterile food. Sterile entertainment (oh, sorry, already here). Etc.

      It would be realy funny if people start going around covered head-to-toe, with sealed goggles and triple-facemasks. Maybe discreet air-filtering systems...

      In fact, everyone might start looking like cyber-bedouins. Hmmm. Guess who'll have patent rights on *that" look. ?! :)

    2. Re:Not really by Some+Dumbass... · · Score: 1

      Also, Michael Mooor is a dumbass, and he has his math backwards. The more scared we are, the less we consume.

      On the other hand, I hear that duct tape sales have been doing well...

    3. Re:Not really by ChadN · · Score: 1

      I think the "Fear Consumption Model" quote is a mistatement by the poster of what Michael Moore talked about in Bowling For Columbine, not something he has said or espoused. Obviously fear can be a detriment to the economy as a whole (in fact, it has a "chilling" effect on many types of consumption.)

      In his movie, Michael talks about the media habit fo playing upon peoples fears, and how some people DO benefit from the results of people's (often irrational) fears. But I don't think he claims the whole economy is based on "fear", or that fear helps the entire economy as a whole.

      NOTE - I'm not passing judgement on Michael's movie or works in this statement, that is a separate issue. But I think it fair to not misrepresent one side of an argument (as I believe the original poster did, by passing off their assessment as Michael's).

      --
      "It's overkill, of course. But you can never have too much overkill." - Anonymous Slashdot Coward
    4. Re:Not really by aarondyck · · Score: 1

      Unfortunately, it would seem that you missed the point of that comment. Anyone that has paid any amount of attention to the movie would realise that it is not the views of Michael Moore I was trying to express, but those of Marilyn Manson, as is shown in an interview in the movie. That interview, more than anything else in the documentary, has stuck to me. In fact, I am considering writing a thesis for my Economics degree to display the truths of the fear-consumption model. I am aware that it works both ways (i.e. the more we consume some things, the less others), but as a whole it is a true model with a few exceptions--just like there are exceptions to every law in economics. As an econ major I have thought about the theory and the practice of this concept and have found it to be without any more fault than some of the other economic principles I cover in classes.

    5. Re:Not really by ChadN · · Score: 1

      The comment *I* responded to had attributed the "Fear Consumption Model", as you call it, to Michael Moore, so I corrected him. Had *you* been more careful, I may not have needed to respond to people you took the wrong meaning from your words. Not everyone has seen the movie, and thus wouldn't know what Marilyn Manson said or didn't say in it.

      --
      "It's overkill, of course. But you can never have too much overkill." - Anonymous Slashdot Coward
    6. Re:Not really by aarondyck · · Score: 1

      Thank you for clarifiying that for me. In the future, I will try to ensure that all references are transparent, so as not to confuse anyone.

    7. Re:Not really by ChadN · · Score: 1

      How about you just ensure that you not respond with insult to people who are trying to be of some help to you.

      --
      "It's overkill, of course. But you can never have too much overkill." - Anonymous Slashdot Coward
    8. Re:Not really by aarondyck · · Score: 1

      I take personal offence to that comment. I was not trying to slight anyone, I was merely expressing my point. I had misunderstood what you had said, and I apologize for that. You, however, accuse me of insulting you when I certainly did not intend to. If you feel slighted, I apologize, but only to the extent that I misunderstood what you had meant. I think it is incredibly rude to start calling names in a public forum.

    9. Re:Not really by ChadN · · Score: 1

      I'm NOT calling you names; no 'names' were said. I simply accused you of being insulting in your responses. That is because, by my judgement, your responses (in this thread) seemed to have a strong sarcastic tone to them, and thus seemed insincere.

      However, if that was indeed not your intention, then I apologise myself for my escalating hostility. It seems from this last message that you ARE sincere about not intending to be insulting, so I thank you very much for taking the time to clarify that.

      My main source of misunderstanding (I think) was that rather than responding to "autopr0n" about his misunderstanding your post, you replied to my response to him (not you). And in doing so, I read the wrong tone into your messages.

      So, again, thanks for clarifying.

      --
      "It's overkill, of course. But you can never have too much overkill." - Anonymous Slashdot Coward
    10. Re:Not really by sckeener · · Score: 1

      9/11 certanly didn't boost the economy

      I guess it depends on what sector of the economy you are in. I'd say security and defense got a major shot in the arm.

      --
      "Only one thing, is impossible for god: to find any sense in any copyright law on the planet." Mark Twain
  36. Story link is laggy by Anonymous Coward · · Score: 5, Insightful
    With the `slashdotting` in full effect I thought I should repost the content here.

    Scientists at CDC and other laboratories have detected a previously unrecognized coronavirus in patients with SARS. While the new coronavirus is still the leading hypothesis for the cause of SARS, other viruses are still under investigation as potential causes.

    Coronaviruses are a group of viruses that have a halo or crown-like (corona) appearance when viewed under a microscope. These viruses are a common cause of mild to moderate upper-respiratory illness in humans and are associated with respiratory, gastrointestinal, liver and neurologic disease in animals. Coronaviruses can survive in the environment for as long as three hours.

    SARS is a respiratory illness that has recently been reported in Asia, North America, and Europe. The illness usually begins with a fever (measured temperature greater than 100.4F [>38.0C]). The fever is sometimes associated with chills or other symptoms, including headache, general feeling of discomfort, and body aches. Some people also experience mild respiratory symptoms at the outset.

    After 2 to 7 days, SARS patients may develop a dry, nonproductive cough that might be accompanied by or progress to the point where insufficient oxygen is getting to the blood. In 10% to 20% of cases, patients will require mechanical ventilation.

    The principal way SARS appears to be spread is through droplet transmission; namely, when someone sick with SARS coughs or sneezes droplets into the air and someone else breathes them in. It is possible that SARS can be transmitted more broadly through the air or from objects that have become contaminated.

    TARGET - SARS Target 1

    The new virus diverges by 50-60% from the three known groups of coronavirus. Because of the variation between coronovirus, scientists working with D2OL have selected a coronavirus protein target that has high conservation between human and animal strains. Three dimensional structure is actually more resistant to change than primary "sequence", and hence "SARS Target 1" is expected to have the same functionality and active site across all strains, and potentially allow for selection of compounds with broad activity against all coronovirus strains.

    Several treatment regimens have been used for patients with SARS, but there is insufficient information at this time to determine if they have had a beneficial effect.

    D2OL's target is also believed to be critical in the life cycle of the Coronovirus and drugs selected against it our expected to be viralcydal.

    With your help we are testing compounds that are readily available, and credible "hits" can be tested in cell and animal models of the disease to confirm potential utility in man.
    1. Re:Story link is laggy by Madcapjack · · Score: 1
      With the `slashdotting` in full effect I thought I should repost the content here.

      I'd like to mod this one up for thoughtfulness. since we know about the slashdot effect, instead of posting the first crack, we should repost the article (or at least a summary of it if any of you care about copyright).

  37. +1 Insightful and/or Funny by Neuropol · · Score: 0

    [N-to-tha-T thing]

  38. early overreaction is good by Alomex · · Score: 4, Insightful

    When it comes to diseases, early overreaction is good. At an early stage there is little information about exactly how dangerous this particular disease might turn out to be. At the same time, containing the disease at this stage is easy. All you might need to do is quarantine half a dozen people.

    Of course, as the disease progresses and the actual severity of the epidemic is assessed, we can update our procedures to make it less or more stringent as the need might be.

    This is the same reason why firemen overreact to fire alarms by the way. It is so much easier to contain a fire in the first three-five minutes that is worth driving recklessly to the scene of the fire, even though 95% of the time they turn out to be false alarms.

  39. Lots of bad *potential* by mghiggins · · Score: 1

    There are much more dangerous illnesses than SARS which affect much more people.

    The issue with SARS isn't how many people are currently sick - it's how many *could* be sick. In the 20s a flu epidemic swept through Europe, killing 2MM people. Sounds like a lot... but it only had a 2.5% fatality rate. The problem was that everyone caught it.

    Same deal with SARS. Relatively low fatality rate (4-6%, maybe as high as 10%), so it doesn't kill people before they spread it (which is easy to do, it seems), but high enough that it can do some damage if a lot of people catch it.

    Hopefully the world community has reacted fast enough with quarantines, etc, to stamp it out... but if it starts spreading freely in the wild, a lot of people's lives are in danger.

    --
    All opinions expressed herein are not my own; I haven't had free will since last year when aliens ate my brain.
  40. Re:Pffffttt SARS - BFD by Anonymous Coward · · Score: 1, Insightful

    I take it you don't live in Hong Kong or China then? I'll go tell my family in Hong Kong that you think they have more chance of getting into a car crash than getting SARS. I'm sure that'll make them feel MUCH better.

  41. Except that by CausticWindow · · Score: 1

    the people who die from influenza are old and weak. SARS kills healthy young people, like you and me.

    --
    How small a thought it takes to fill a whole life
    1. Re:Except that by Idarubicin · · Score: 1
      the people who die from influenza are old and weak. SARS kills healthy young people, like you and me.

      Actually, in areas with access to modern medical care (Toronto, for example) most fatalities are limited to individuals who are elderly, have other conditions, or are immune compromised. Out of twenty deaths in Canada, only two were healthy individuals under fifty.

      --
      ~Idarubicin
  42. Another distributed project by Anonymous Coward · · Score: 0

    "Slashdot has added a D2OL Target to it's distributed DOS project"

    Hah, that was easy! Next, please

  43. How do you know by CausticWindow · · Score: 4, Interesting

    that all these distributed projects are actually doing what they're supposed to?

    Would you notice it if my long-lasting-no-results-yet-but-soon-for-sure distributed project for an AIDS vaccine were actually a rendering farm for animated kiddie porn movies?

    --
    How small a thought it takes to fill a whole life
    1. Re:How do you know by bobbozzo · · Score: 1

      Well, you could see how much bandwidth it was using.

      Rendering: moderate (wireframes) to large (textures) input, large (bitmaps) output.

      Most dist projects have small output, and usually not a lot of input (although Seti's input blocks are fairly large).

      --
      Nothing to see here; Move along.
  44. Re:Pffffttt SARS - BFD by Daniel+Dvorkin · · Score: 4, Insightful
    Call me when 100,000 have died.
    Um ... yeah. If you wait 'til 100,000 have died, that means millions have the disease. Odds are good that one of them is a co-worker, friend, or member of your family. Do you really want to get to that point?

    The way the world is reacting to SARS is much like the way it would have reacted to the 1918-1919 flu, if we'd had the public health infrastructure then that we do now. And that reaction would have saved millions of lives ...

    ... and there would have been people like you sitting around bitching about how this flu thing was nothing compared to other risks (especially since WW1 was going on when the epidemic started) and what a waste of time it all was.
    --
    The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
  45. IN SOVIET CHINA... by (TrollCore)Dessimat0 · · Score: 0

    SARS attacks YOU!

    TrollKore
    irc.freedomirc.net
    #trollkore

  46. Re:Pffffttt SARS - BFD by Vorge · · Score: 3, Insightful

    Ever did the math ?

    In an average year, 10 to 20 percent of the people get infected with some form of influenza. There are different strains, so for arguments sake lets say 0.5% of the people gets infected with the SARS virus (very conservative estimate).

    Based on the current deaths, approximately 3-4% of the people who get infected, actually dies. (experts are actually arguing that this number may be higher).
    On a population of 6 billion, that is approximately 900,000 people.(or to put it in a US perspective 75,000 people)

    Normal influenza kills mostly the weak and old. SARS does not. So far it has killed a lot of nurses and doctors.
    Something to think about before making a decision on whether or not to participate.

  47. Redundancy... by BrokenHalo · · Score: 0
    Might be more useful, but it won't solve one problem:

    What benighted fool came up with "Severe Acute Respiratory Syndrome"? Severe and acute mean the same thing.

    OK, I might be being pedantic, but I expect better of people we're supposed to be able to trust with our health.

    1. Re:Redundancy... by Le+Marteau · · Score: 3, Informative

      What benighted fool came up with "Severe Acute Respiratory Syndrome"? Severe and acute mean the same thing.

      Not in that context. In the medical community, when a disease is categorized as 'acute' it means the disease has a rapid onset and becomes a problem quickly, as opposed to a 'chronic' disease, which implies a long duration.

      --
      Mod down people who tell people how to mod in their sigs
    2. Re:Redundancy... by Anonymous Coward · · Score: 1, Informative

      No, it`s not.

      Acute= Having a rapid onset and following a short but severe course: acute disease.
      Afflicted by a disease exhibiting a rapid onset followed by a short, severe course: acute patients.

      Severe=Causing great discomfort, damage, or distress: a severe pain; a severe storm.
      Very dangerous or harmful; grave or grievous: severe mental illness.

      sorry but you are not even pedantic.

    3. Re:Redundancy... by Kwiik · · Score: 1

      Or on the other hand, maybe they were avoiding naming a disease ARS. Some beings might actually want that. I can hear it now, geek teenagers lonely in need of lovin all over the world: "I'm going to go get me some ARS today! Cya later!"

      --
      Vehicle Stars used car search is my current project
    4. Re:Redundancy... by instarx · · Score: 1
      What benighted fool came up with "Severe Acute Respiratory Syndrome"? Severe and acute mean the same thing.

      You really shouldn't call people fools and then make foolish statements such as "acute and severe mean the same thing". Severe means just that - a severe ilness. Chronic means it is a long-term illness while acute means it happens quickly. As in Severe Acute Respiratory Syndrome. An illness described as Severe Chronic Respiratory Syndrome would be very different, but both would be severe.

      Luckily we don't have to depend on _you_ for anything.

    5. Re:Redundancy... by hesiod · · Score: 1

      > Luckily we don't have to depend on _you_ for anything.

      Oh no!!! I depend on him to change my Depends! whatever shall I do!?!?!?!?

  48. Drug ip must be sacrosanct by Pi-Zero+Meson · · Score: 2, Interesting

    You can argue patents all you want but in order for the pharmaceutical industry to function the intellectual property right of drug research companies most be sacrosanct. Billions of dollars are spent every year on pharmaceutical research and if the is no return on investment then there won't be billions of dollars to spend next year. I realize that there are government grants but that is not were most of the money to fund research comes from most if it comes from the money made from the previous successful drug. I know it sounds cruel to say you can't make this drug because you can't afford the patent rights but its better then having there be no drug research at all.

  49. We need a vaccine not a drug... by Anonymous Coward · · Score: 0

    You don't need a drug that matches this virus to treat it, you need a vaccine to prevent it in the first place. The Influenza drugs like Tamiflu and Relenza only came out 3-4 years ago and the vaccine is still the best weapon we have against it.

    1. Re:We need a vaccine not a drug... by Muhammar · · Score: 1

      Yes, you are right. That is the only good way to stop the spreading. And vaccine can be available in maybe half year.

      --
      I doubt that we will ever figure out - and I suspect that even if we did figure out we couldn't do much about it
  50. Bioinfo view by Kaz+Riprock · · Score: 2, Interesting


    Just so you all know, this is about as fruitful as SETI, so don't go giving up on that just because this "sounds" like it'll be more important or yield a more relevant result. It won't. I work on this type of protein modelling and drug-protein interaction research. The state of the art is that anything produced by your client is going to be at best a wild guess at what the protein looks like or what interactions the drug will make with the protein.

    The "scoring" that your results are based on is just how nice the energy is of the final folded protein. This is flawed in a couple of ways, first it means that we need to know nearly everything about protein folding energetics and calculate it with a tidy formula (not yet...but we're getting there) and it means that the folds chosen by the algorithm to test for these energies are all the possible folds (last best guess is that we only know about 80% of all folds)...and then if you're going to try to use this for docking a drug molecule...you open a whole new can of drug-protein interaction knowledge necessary.

    SETI actually has a better scoring method for finding a "hit" and while the result (hey, look radio from space) isn't as tangible as killing a virus...I'd say stick with the SETI or try and break the XBox number....or find some more prime numbers. At this point, distributed protein folding/docking isn't just fishing in the dark, it's fishing in the dark in Death Valley.

    --
    Mordor...a magical, mythical land where women are more rare than dragons--but where every man would rather find a dragon
  51. OK, so YOU fund the R&D... by caveat · · Score: 3, Insightful

    ...last I heard, the development of a new drug costs billions of dollars. Now, it's all fine and dandy to get on your moral high horse and say that "no cure is better than an expensive cure", but at the end of the day, the money to create the drugs has to come from somewhere. So if you really believe what you're saying, I see one option - see if a VC or banker will float you a loan based on the premise that "I won't be paying you back the $1,378,422,596.83 it took to research and design the drug because it just isn't important, don't you see that poor people need these drugs more than you need your money back?" If you do find somebody who'll do that, let me know, I could use some free money too..

    Not that pharmcos won't do some pretty low things, but really, with the expenses we're talking about, basic economics can explain a whole lot of it.

    --

    Facts do not cease to exist because they are ignored. - Aldous Huxley
    1. Re:OK, so YOU fund the R&D... by layyze · · Score: 3, Interesting

      What if governments payed for the research? Finding treatments and preventions for diseases seems like it would be in the best interest of a nation. Alas, helping people does not seem to be on the agenda of many governments or the pharm. co.'s.
      It does cost the companies a lot of money to make the new drugs, but they easily make that money back and then some through defending patents that keep the price of the drug artificially high, even after the research is payed off. Pharmcos are a two sided coin: on one side they help people through tough times, on the other side they make money off of people's pain.

      --
      -dr. layyze f. tooth PhD
  52. Fixing AIDS we can do by Heisenbug · · Score: 2, Insightful

    UNAIDS sez if we (the world) spend $10 billion a year for 20 years, it will steadily decrease the number of infections. Right now, we're spending more like $1.2 billion a year, and AIDS is going crazy all over the world. Are we not spending that money because of a focus on SARS? No. We're not spending it because the countries who would be paying $5-6 billion of that are not the ones with 40% infection rates, so they simply don't care. SARS doesn't really affect that.

    On the other hand, if you read a history of the AIDS outbreak in the US, you'll find that people wish there had been a much stronger response right from the start. If we had reacted to AIDS the way we reacted to SARS, that $10 billion/year wouldn't be necessary right now -- and most of those 40 million people wouldn't have the disease.

    1. Re:Fixing AIDS we can do by Anonymous Coward · · Score: 0

      AIDS is easy to prevent. Don't engage in unsafe acts of sex. How hard is that?

  53. The cure for AIDS is simple by dsanfte · · Score: 0, Flamebait

    Test everyone for AIDS, and throw them into a biohazard incinerator if they test positive.

    You don't have to cure the disease, you just have to sterilize anyone that has it.

    --
    occultae nullus est respectus musicae - originally a Greek proverb
    1. Re:The cure for AIDS is simple by Anonymous Coward · · Score: 0

      so true... but we support the ill wasting presious time and resorces, instead of culling the herd and moving on.

    2. Re:The cure for AIDS is simple by Anonymous Coward · · Score: 0

      Welcome to the Brave New World.

  54. Re: SARS vs. AIDS by King_TJ · · Score: 1

    There is a difference though. AIDS is largely spread by infected individuals performing unsafe practices that lead to infecting others.

    In a number of cases, people with AIDS are known to have been consciously trying their best to infect as many others as possible, in some sort of misguided retaliation for getting the disease.

    You're not going to be innocently standing by someone infected with the AIDS virus and catch it from them.

    While I do believe it's important to continue with AIDS research, I also can see how there would be a more pressing desire to find a quick cure for a disease that people are catching simply by breathing it in.

  55. SARS in Toronto, Canada by roman_mir · · Score: 3, Informative

    World Health Organization issued a travel advisory
    (another article
    on Yahoo.)

    To be honest with you, I have not taken the TTC (subways or buses) for a long time now so I do not know if there are many people wearing masks there, but on the streets I have only seen two people in the last month actually wearing surgical masks. On the radio (CFRB 1010) there was a discussion of a baseball game from where shots were broadcasted widely displaying a person wearing a mask, with headlines like "In Toronto, Fear Strikes Out ". The host from the radio was on that game and he only saw one (1) person wearing a mask out of thousands of people there. The camera-man concentrated his attention on that person.

    Have you seen the shots from Baghdad, where supposedly thousands of Iraqi people were cheering while the US Marines took down Saddams statue? Later in the news they actually showed wide shots of that scene, and it became clear there were only a handfull of people in the area.

    This is the same tactics used by the news crews for the single purpose of maintaining attention of millions of people on something that is not that newsworthy but something that can be blown out of the proportions and something that will boost news channels' ratings.

    I live in Toronto and I swear to you there is no uncontrolably spread disease here, the offices are not closing, the restaurants and hotels are not closing business is as usual, people are not staying home out of fear but there are a few thousand people on quarantine, most of which will never show any symptoms.

    Since last week there was no new cases of SARS in Toronto and the only deaths that occured (19 I think) can be attributed to SARS striking on the older people with some other health problems.

    The only thing that WHO achieved was creating massive desinformation and boosting cnn and bbc audiences for the past month and costing Toronto travel industry hundreds of millions of dollars in damage. Really, last year, about 2000 people died in Toronto from flue, but we did not hear about this on cnn.

    There are over 5000000 people in Toronto area and there are about 200 people that have SARS, that is 1/50000 of 1 percent. 19 of the sick people died. So far this means about 10% mortality rate for a disease that is statistically so rare, that anyone will have better chances of been killed by a lightning bolt than getting it. Hell, there are more chances of been violently murdered somewhere in Texas than getting SARS in Toronto. Maybe WHO should post a travel advisory about that.

    1. Re:SARS in Toronto, Canada by Curtman · · Score: 1

      Would you believe there have been many cancellations for events in Winnipeg and apparantly Calgary because of this? There has not been one case of SARS seen here. It takes a full day to get to Toronto by car from here. Is there this level of paranoia about visiting Detroit? I'm honestly curious. We have two things we commonly have to explain to our southern neighbours:

      1) No, I don't live in an igloo
      2) No, I don't know Bob in Toronto

      Hysteria is fun isn't it?

    2. Re:SARS in Toronto, Canada by gm-7 · · Score: 1

      Does anyone want to go to Detroit?!

      --
      Sig (appended to the end of comments you post, 120 chars)
    3. Re:SARS in Toronto, Canada by Curtman · · Score: 1

      Hah.. I was really expecting a 'Does anybody want to go to Winnipeg?'.

  56. Beijing closes public spaces over SARS by vosbert · · Score: 1

    SARS is getting to be a big deal. CNN Beijing SARS link

  57. no, there would have been no complaining by ColGraff · · Score: 1

    The US secretary of health at the time, if memory serves, commented that the 1918-1919 had the potential to end civilization. Further, it ended up killing more people than the Great War. If it could have been contained with drastic measures, no one would have complained.

    --
    I'm the stranger...posting to /.
    1. Re:no, there would have been no complaining by Daniel+Dvorkin · · Score: 1

      I think you're missing my point. If an early and effective response had contained it -- what we're trying to do with SARS right now -- people like the poster I was responding to would have been sitting there bitching about how everyone was overreacting, because they wouldn't have realized how serious the threat actually was.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
  58. Ebola is pretty hard to catch by The+Tyro · · Score: 4, Informative

    Ebola usually requires some kind of bodily fluid/tissues swap with an infected person.

    There's also a reason why "hemorrhagic fever" bugs like Ebola tend to burn themselves out... they are extraordinarily lethal, and quickly kill their host; Ebola has a 90% mortality (compared to 6-12% for SARS). When a virus is too hard on its host, it lessens the opportunity to spread itself.

    AIDS is a good example of a successful high-mortality bug... but you can stay alive and asymptomatic for so very long, that spread is virtually assured if you are uncautious.

    SARS looks so much like the common cold, that even experienced clinicians have difficulty differentiating it from other bugs. That is, of course, until it's too late. SARS could be a real problem... significant mortality rate, easy to spread, poorly understood, and, like West Nile, NO treatment (well, some advocate treating West Nile with interferons... but the side effects of those drugs are terribly unpleasant; the treatment is almost worse than the disease).

    It's nice that they're taking this thing seriously; any money spent on containment is probably well-spent indeed. If they can determine that this bug has no animal reservoir, it could even be eradicated. Till then, public panic serves no one, but public caution is NOT a bad thing.

    --
    Even if a man chops off your hand with a sword, you still have two nice, sharp bones to stick in his eyes.
    1. Re:Ebola is pretty hard to catch by Vagary · · Score: 1

      Oh sure, Ebola doesn't scare you now. But just wait until the Russians genetically engineer an airborne strain of the Marburg virus and terrorists unleash it on Seattle!

  59. Testbed for bioterrorism by Anonymous Coward · · Score: 0

    Possibly. Maybe this is a trial to see how the world would cope, and the real virus is coming in a few months? Kind of scary if you think about the fact we can't cure this crap, think about the % of us curing a super virus. Kills instantly. Or how about a modified aids virus that spreads through the air.. weeeeeee~

  60. /.ers should lead fight against SARS by trex44 · · Score: 3, Funny

    /.ers should be at the forefront in the fight againts SARS for their best interest. It's a known fact that a lot of /.ers are afflicted with SARS (Severe Absence of Romance and Sex).

    Oh, you're talking of another kind of SARS.OK, nothing anymore important here. Move on. :)

    --
    "I'll have a witty .sig next time, promise." :)
  61. you're underestimating it by Firehawk · · Score: 2, Interesting

    SARS has a mortality rate of more than 10% so far in Singapore.

    In the past century, there has not been any other infectious disease that has spread so fast and consumed medical and political resources of affected countries so fast.

    Just because your country has not been significantly affected (so far) does not mean that this is a minor problem.

    It's still early in the progression of SARS. If there are no good public health measures to limit the spread of SARS, it's entirely conceivable that the entire world would be infected by 2005. Even assuming that the mortality sticks at 10% or so, that's a heck of a lot of dead people.

    1. Re:you're underestimating it by kcelery · · Score: 1

      No disease would take down the planes so fast. Cathay Pacific has cut down half the flights from Hong Kong. Unprecedented.

  62. The US Way by Anonymous Coward · · Score: 0

    Or, how about "Making A Deal!" ?
    You "donate" your computing power and, if and when you need the medication, you get it at a price you can actually pay for.

    Sure.

    It would work.

    Just like health insurance does. ;)

    And, if that worked, a *trend* could be started.

    Eventually, you would start living partly off "credits", obtained from cedeing your mips to diverse service and product providers.

    And *then* government would surely butt in, and start comandeering your mips for "relevant public objectives" (or other similar blather). And politicians could start making campaign promises to reduce "mips-tax" (they wouldn't call it a tax, of course), or propose flat-rate "mips-participation", or "progressive-scale", or...

    Well, so.

    Just relax and enjoy, folks !

  63. You're one of them ! Eeeek ! by Anonymous Coward · · Score: 0


    This probably won't go away. It's a new very virulent species of cold that probably will mutate every which way. The most successful strains would reinfect humanity year after year after...

    You are counselling people to abstain from contributing to the fight against this possible extended "plague" cycle.

    Possibilities are that :

    A) You have been abducted and brainwashed into collaborating and conspiring with humanity's demise. (horror!)

    B) You voted for the "arsenic-based ecological support", in one of the last polls. (Thats ok, I guess.) :)

  64. Why should we help? by Anonymous Coward · · Score: 0

    If SARS gets a foot hold in India and China it could be just the thing that stops offshore outsourcing.

  65. IT could go higher by HanzoSan · · Score: 1



    The virus may mutate and become more fatal, dont be surprised to see it go up to 20 percent, or even 30 percent.

    --
    If you use Linux, please help development of Autopac
    1. Re:IT could go higher by instarx · · Score: 1

      You have absolutely no evidence or basis for saying that this will happen. This is wild useless unfounded speculation of the type that starts damaging rumors of a "mutated super-SARS". Be responsible for God's sake.

  66. So? Who cares, at least we will be alive. by HanzoSan · · Score: 1



    Why do you care about the poor people? Care about yourself first.

    I'd rather see the third world die than die myself. Consider the fact that its run this software or risk having no cure at all, you need to shut up.

    --
    If you use Linux, please help development of Autopac
    1. Re:So? Who cares, at least we will be alive. by luisdom · · Score: 1

      I'd rather see the third world die than die myself.
      You are already seeing it.
      And I don't need to shut up for what I consdier to be an injustice even if I benefit for that injustice.

      Because when they went for the for the jews you didn't stand up because you were not a jew.

    2. Re:So? Who cares, at least we will be alive. by SensiMillia · · Score: 1

      Why, oh why does 70% of the world hate America?

    3. Re:So? Who cares, at least we will be alive. by metalslinger · · Score: 1

      Jealousy...

      --
      /. Heroics - 99.999%
    4. Re:So? Who cares, at least we will be alive. by buswolley · · Score: 1

      you are a very evil man. By the way I am poor you insensitive clod. Oh yeh and you will die. eventually.

      --

      A Good Troll is better than a Bad Human.

  67. China's Homegrown Population Control by Anonymous Coward · · Score: 0

    I think the thing most people are missing is the source of this virus.

    It began in China months ago, and the only reason China admitted knowledge of the disease and reported it to WHO is that it got out of China and into the news. With a 20% mortality rate in an overpopulated country trying to deal with moving 200 million people for a power plant project, its possible that SARS was developed and launched as a biological attack on China's own people to reduce population without mass graves and slaughter (ala Eastern Europe). This way China looks like an unfortunate victim of a disease instead of a genocidal communist.
    Watch. This will be the source of China's own bioresearch program. Japan had its bio-labs in China during WW2 and used bio-warfare on the Chinese, and China took back posession of those labs and noone outside China made sure that the information and diseases were destroyed.
    China is not just a terrorist nation and a rogue superpower, it is also harboring WMDs.
    And not just nuclear.

  68. This can be done faster by HanzoSan · · Score: 1



    Although it wouldnt be legal, Im sure governments like China are running tests on prisoners right now.

    --
    If you use Linux, please help development of Autopac
  69. Where the hell is the bastard Bill Gates? by HanzoSan · · Score: 1



    Why doesnt Bill Gates cure Sars? What the hell is he doing right now? Oh wait hes busy spreading Windows.

    --
    If you use Linux, please help development of Autopac
  70. Top 5 Reasons the SARS virus is with us forever by Mex · · Score: 1, Informative

    (This is from http://www.reenhead.com/comments.php?93238396 )

    "It is not clear yet whether the SARS virus will be similar to corona virus in these respects, but it is highly likely.

    So, the top 5 reasons SARS is here with us forever.

    1. The corona virus envelope lacks immunogenicity. On average you get sick with corona virus every 2-4 years, but there are only two types of virus, hence 80% of infections represent re-infections with a type you have already fought off. So, the immune response to corona virus is not permanent like those for chicken-pox or measles (which are only near permanent, you can get reactivations and the vaccines wear off over a decade or so).
    2. It is a cold, colds spread via small particles of aerosolized spit or mucus from sneezing, coughing, breathing etc. The spread is unlikely to be contained considering this.
    3. It also represents a fusion with some kind of animal virus, making an animal reservoir highly likely, although so far it only appears to infect humans.
    4. A vaccine could conceivably be developed, but because the coronavirus is typically resistant to normal immune responses illicited by the viral envelope or whatever your body targets, it is likely we will have to use a much more experimental type of vaccine. Such as plasmid vaccines which express a chosen protein from the virus, or a vaccine that infuses a particularly wierd epitope of the virus that is not mutable, and your body doesn't ordinarily recognize.
    5. Finally, it is unlikely we will resolve this anytime soon because our government, and the government of China have not taken this seriously. The CDC took it seriously, and I'm sure in a decade we'll here about how they fought the administration for more attention, money, manpower etc., but it was denied just like with HIV. The second this was detected we should have taken far more drastic measures. Now the fatality rate approaches 10%, and the virus even kills young healthy people.

    So, we're screwed. Just sit back and wait for the people to start dropping like flies.
    Dr. Strangelove 04/25/03 05:56pm"

  71. Why is "boxen" such a common typo for "boxes"? by LazloToth · · Score: 1



    Is it a geek thing?

    --


    It's only funny until someone gets hurt. Then, it's hilarious.
    1. Re:Why is "boxen" such a common typo for "boxes"? by Anonymous Coward · · Score: 0

      The plural of 'ox' is 'oxen'.

      Therefore the plural of 'box' should be 'boxen'.

      Yes, it's a geek thing :)

    2. Re:Why is "boxen" such a common typo for "boxes"? by elitman · · Score: 1

      It's analogous the plural used by the hacker community for DEC's Vax computers: Vaxen.

  72. Your stats are wrong! 15% death rate from Sars. by HanzoSan · · Score: 2, Insightful



    Sometimes this goes as high as 20% in places like Hong Kong, in Canada its around 15%, the 5% are fake government figures.

    SARS mortality rate/Death Rate

    why dont you read what some actual doctors are saying. Also take into account that SARS is mutating constantly, which means its becoming more deadly everyday, the death rate is rising due to this mutation, as the virus gets smarter it learns how to more efficiently destroy our immune system.

    Do your research begore you come up with some numbers.

    --
    If you use Linux, please help development of Autopac
  73. SARS mutates. by HanzoSan · · Score: 1



    The flu is always going to be the flu, its not getting stronger.

    SARS as it spreads becomes STRONGER. Meaning the more immune systems it kills, the better it becomes at killing.

    This is what scares me, the rate jumped up from around 5 percent to 15 percent in a matter of weeks, 15 percent in CANADA of all places, where they have some of the best hospitals in the world.

    15 percent of 1 million is 150,000 people, but according to estimates, a billion people can be infected by the end of the year.

    1 Billion in 12 monthS

    Theres only 6 billion people on this earth. If 1 billion people are infected with a 15 percent chance of dying (this is assuming SARS doesnt mutate and become more deadly), 15 percent of 1 billion?! What is that? 150 million? Thats as bad as the plague.

    --
    If you use Linux, please help development of Autopac
  74. Where did you get this information? by HanzoSan · · Score: 1



    From my research doctors say SARS kills 15 percent of everyone of all AGES.

    SARS is not the common cold, it destroys your lungs, people with asthma, people who have weak lungs, people who smoke, people who live in smog filled cities, these people have weaker lungs and can die from SARS no matter the age.

    So unless you are a marathon runner with great lungs you will most likely be one of those 15 percent. Also the virus mutates, the more it learns about how our immune systems work, the more vulnerable we become, so even you can survive it while its killing at a rate of 15%, when it mutates again it might kill at 25%, and then when it mutates again it might go up to 40%, so eventually over a period of years it could reach a 90% death rate or higher, so this disease is no joke, the Flu does not mutate like this.

    --
    If you use Linux, please help development of Autopac
    1. Re:Where did you get this information? by Idarubicin · · Score: 1
      From my research doctors say SARS kills 15 percent of everyone of all AGES.

      My statements are based on the figures for Canada only. I live near Toronto and I do health-related research, so I have been following the development of SARS moderately closely.

      My information is from recent news conferences held by public health officials. I don't have a link to breakdowns by age, but here is a link to an article (CanWest News and Associated Press, April 27) stating (my italics),

      Officials were unable to say if he had underlying medical problems, unlike a 44-year-old York Region man who earlier became the first middle-aged, otherwise healthy Canadian to die of SARS.

      The World Health Organization indicates that as of April 26, there were 142 cases of SARS in Canada, associated with 18 deaths.

      Further, the WHO placed the global case-fatality rate at 4%. They state that

      In the Canadian outbreak, the higher case-fatality ratio appears to be linked to the older age of the patients, who frequently have underlying chronic disease.

      Also the virus mutates, the more it learns about how our immune systems work, the more vulnerable we become, so even you can survive it while its killing at a rate of 15%, when it mutates again it might kill at 25%, and then when it mutates again it might go up to 40%, so eventually over a period of years it could reach a 90% death rate or higher, so this disease is no joke, the Flu does not mutate like this.

      Er. No. The virus doesn't benefit from killing its host, or even crippling it rapidly. A virus isn't a malevolent being, bent on cold-blooded murder. Its evolution will be guided by whatever mutations allow it to make more copies of itself. It is just as likely to mutate into something that just gives you a bad case of the sniffles, so you can keep going to work and give copies of it to all your coworkers.

      Finally, influenza does mutate like this. That's why a new flu vaccine comes out every year--the protein coat of the flu virus changes from year to year, and health officials have to try and hit a moving target. If there is a new and unexpected mutation, we could face a Spanish flu type epidemic very easily. Fortunately, SARS actually isn't bad practice for this type of situation, so that health officials will be ready for the next flu epidemic. See a new disease? Stomp on it. Hard. That's how to handle it. This disease is certainly no joke--but it doesn't warrant panic.

      --
      ~Idarubicin
    2. Re:Where did you get this information? by fcw · · Score: 1
      So unless you are a marathon runner with great lungs you will most likely be one of those 15 percent.

      I think you'll find that, on average, you have about a fifteen per cent chance of being in that fifteen per cent. Definitely not most likely.

  75. AIDS is not airborn! by HanzoSan · · Score: 1



    Look if I could cough on you and you get AIDs, yes I'd agree we need to focus on AIDs, but AIDs isnt spreading through the air.

    SARS is like AIRBORN AIDS, you get it and you have a 15 percent chance of dying. Theres no cure, the virus is becoming better at kicking our asses as it mutates, and you want us to sit here and let it go from a 15 percent success rate in killing us to around 50%? Then fight it?

    --
    If you use Linux, please help development of Autopac
  76. if it's proprietary stay away from it by Anonymous Coward · · Score: 0

    This program churns up cpu cycles like it is a distributed p2p encryption cracking program, ie.. doesn't it make sense for the government to export it's resources to a huge network of computers and convince the ppl that they are helping to solve some medical need? I'm skeptical of this program, ecspecially if it's closed source

  77. Death rare is 15% now. by HanzoSan · · Score: 1



    You people keep forgetting this virus mutates, the death rate started low, but now its at 15 percent in Canada, and almost 20 percent in Hong Kong.

    --
    If you use Linux, please help development of Autopac
  78. aids anyone? by ciroknight · · Score: 1

    Well, this seems kinda stupid, but if we can do it for sars, why not aids!? I mean come on, its more widespread than any of us wants to know, and if we can stop sars in its tracks, why not?

    --
    "Victory means exit strategy, and it's important for the President to explain to us what the exit strategy is." G.W.Bush
  79. The dangers of a middle-road virus. by KFury · · Score: 1

    I've stayed out of this thread because I believe people are doing a good job of identifying the ways that SARS is a bigger threat than some would like to think, but this post is stupid.

    "The flu is always going to be the flu, its not getting stronger."

    The flu changes every year. Some years it's mild, and other years it's particularly deadly, killing literally millions of people. In any given year there are 2-3 different strains of flu and virologists use contagion models to distribute the vaccine for the most likely 'dominant strain'.

    "SARS as it spreads becomes STRONGER. Meaning the more immune systems it kills, the better it becomes at killing"

    This is sensationalistic rubbish. What kind of evidence do you have for this? SARS isn't a DnD character. It's a virus.

    As for the spread factor, there's one crucial number that nobody knows, and that's what percent of the population has a natural immunity to the disease. Nobody has a guess as to that number until there are many more documented infections, and that number is vital to understanding how the virus will spread.

    Also pivotal to any model is an understanding of SARS's 'superspreader' model, where some patients manage to infect dozens of people in a very short time, while others won't infect anyone. 'superspreaders' have been seen from the beginnings of this virus, and aren't more prevalent now than they were then, so this doesn't indicate any sort of 'mutation' or strengthening.

    We have a strong sense of security because we haven't had a 'middle-ground' virus since smallpox. AIDS spreads too slowly to be perceived as a single-year pandemic, and Hanta and Ebola kill so fast that they burn themselves out before thy spread too far.

    basically, we're going to have to learn fear the hard way.

    1. Re:The dangers of a middle-road virus. by HanzoSan · · Score: 1



      Its a brand new disease, no one has natural immunity.

      Its not the flu, the flu is somethinng we know and mutates at a much slower rate. Theres already 6 mutations of SARs.

      --
      If you use Linux, please help development of Autopac
    2. Re:The dangers of a middle-road virus. by KFury · · Score: 1

      A lot of people have natural immunity to brand new diseases. That's why it's called natural immunity. If they got the immunity from having had the disease, they have what's called acquired immunity.

      For many diseases there are people who, no matter how many times they're exposed, will not become ill with that disease. That's what natural immunity means.

      As for 'there are already 6 mutations of SARS', can you back that up with a link? At first glance there are a few doctors who are speculating that it might be undergoing its first mutation, as some SARS patients are exhibiting intestinal problems as well as respiratory, but 6 distinctly different strains? Please cut down on the FUD, or back it up.

  80. Re:Your stats are wrong! by Anonymous Coward · · Score: 0

    I'd like to point out that Canada's SARS is pretty much confined to hospitals. No new case outside of a hospital for 2-3 weeks now. There has only been 1 person who was classified as healthy die. The death rate is high in Canada because it is primarily hitting sick people and the elderly who where already in the hospitals.

  81. Man made drugs by gumbysworld · · Score: 0

    Man made drugs will never be able to keep up with viruses like that until we get back to using nature aginst nature.

    Problem is a project like this does help but it olny helps the drug companies in the end.

    And if that site can not handel a slashdot post, what are the servers gonna do when a million people a min want to send or get a new packet.

    SETI blows cause of this and only works so well cause so many have dropped out of the program since it got big.

  82. Re:Pffffttt SARS - BFD by outsider007 · · Score: 1

    5) Don't try to pick up chinese girls you meet at the airport.

    --
    If you mod me down the terrorists will have won
  83. This is an easy decision for me by The+Tyro · · Score: 5, Insightful

    I work in Emergency Services, and have already had to deal with TWO suspected cases of SARS. Speaking as a physician, I'll donate my computing cycles, absolutely. The sooner a treatment is brought out, the better.

    Here's how I feel about it: I hate having someone come into my ER when I have nothing to offer them. I feel a powerful ethical and professional obligation to take care of people, and do whatever I can for them. I do my best for each and every single patient I see, even if it's somebody who has been through maximal surgery/chemo for their cancer, and has literally reached the end of what medical science can do for them. For such folks, sometimes all I can do is hold their hand and offer a little reassurance, but at least it's SOMETHING. I hate having someone die right in front of me, and being powerless to prevent it. Call it a God complex if you want... I call it wanting to be able to help people. Having people die, and having nothing to say and no way to say it... well, that bothers me, call me crazy.

    I don't particularly mind not having a cure for the common cold... a cold is an annoyance, nothing more. I very much DISLIKE not having a treatment for a lethal condition.

    I personally don't care who develops the cure... Pharmcos are often painted as evil opportunists that prey on the illnesses of others... I disagree. I like Pharmcos, because they keep my arsenal full, which makes me MUCH more effective at my job. I don't accept Hawaii trips from them, but I'll accept lunch and a couple of pens if they're going to give me some clinically useful information (and hell, I have to write with something). I resent the AMA (I am NOT a member, BTW, for this reason and others) preaching to me about the "unethical behavior" of having dealings with drug reps. Do they really think I'm going to sell out my ethics, my oaths, and my patients because somebody took me to dinner?? I'm sorry, but that's a fucking insult.

    I prescribe what I want, within the standard of care, regardless of what drug reps say. I always use cheap if I can, expensive if cheap won't work... but I like the fact that Pharmcos give me tools to take better care of patients.

    The sooner a cure for SARS shows up, the happier I'll be.

    --
    Even if a man chops off your hand with a sword, you still have two nice, sharp bones to stick in his eyes.
    1. Re:This is an easy decision for me by g4dget · · Score: 1
      I personally don't care who develops the cure... Pharmcos are often painted as evil opportunists that prey on the illnesses of others... I disagree. I like Pharmcos, because they keep my arsenal full, which makes me MUCH more effective at my job.

      If pharmaceutical companies aren't efficient at developing cures, we end up wasting lots of money, and as a result, fewer diseases get cured.

      And pharmaceutical companies aren't efficient. Given how drugs are paid for right now, we end up paying much more in the long run than if we just funded drug development publicly (it gets even more inefficient because a large fraction of medical research is funded publicly anyway). Worse, pharmaceutical companies allocate funds to profitable drugs, not drugs that are most important from a public health perspective.

  84. panhandling by calx · · Score: -1

    Why was this labelled "Troll"? Because it's the truth? Why should countries that are successful, that have the technology and knowledge, be the ones who take care of the poor countries?

    Really, what is the basis for assuming that the rich owe the poor anything, especially when they have no realation to them? Apparently, some people believe that it is immoral to not care if some poor, helpless person in some unknown foreign country dies. The cheerleaders of "saving the children of the world", are teeming with ambiguous morality. Why should those who succeed suffer so that those who fail prosper? How does that make sense? What circumstances make taking away something from a person right? Because they are rich and therefore will suffer less? You'd have to be pretty "niave" to think that.

    If poor countries want to earn their keep, they can always be test subjects. :)

    I'm so American, only caring about myself!

    Oooh, how heartless!

  85. Confusion about containment by alienmole · · Score: 2, Informative
    Your post demonstrates the exact misunderstanding about SARS and containment of infectious disease that has led to the current unwarranted hysteria.

    The point about SARS is not how many people it has killed relative to something like your example of murders in Texas. Murders in Texas are not particularly contagious.

    The purpose of WHO's advisories is to limit the spread of a contagious disease. It's not really targeted at individuals to tell them that they may be in danger if they go to Toronto - the point is to stop the spread of the disease. However, the disease is ultimately spread by individuals, and to stop it spreading, you ultimately need to prevent individuals from acting as vectors for the disease. That means issuing advisories telling them not to travel to certain regions, and it means quarantining people who may be infected, even though you know that most of them are not.

    Unfortunately, individuals aren't very good at recognizing and respecting risks to a global population, and they tend to want to personalize it - which leads to the faulty logic that since the SARS risk to an individual travelling to Toronto is low, it is therefore OK to travel to Toronto.

    This is a little like saying that since my personal taxes are small relative to my country's total tax revenues, that I don't need to pay them. The point is that disease containment, like taxes, only works if everyone complies.

    BTW, the truth about Toronto specifically, as I understand it, is that its quarantine practices originally weren't up to scratch, and it allowed e.g. exposed health care workers to wander freely amongst the population - attending church, for example. It's at least partially these lapses in containment procedure that have led Toronto to have one of the largest SARS-infected populations on the planet, which is why it was slapped with a WHO warning. The warning is the result of Toronto's health care system and government not originally taking the problem seriously enough.

    1. Re:Confusion about containment by Anonymous Coward · · Score: 0
      Murders in Texas are not particularly contagious.

      9 out of 10 anti-gun nuts disagree

  86. misprint by Anonymous Coward · · Score: 0

    I think me meant the glue

  87. I don't think so by dsanfte · · Score: 1
    And that reaction would have saved millions of lives ...


    Bullshit. We'd have billions of otherwise healthy people who'd be susceptible of dying to a flu-like disease, because their parents were never screened for immunity.

    Death is a part of life. Death is a part of evolution and natural selection, and viral disease is a part of this process. It preys on those who are vulnerable, leaving (mostly) the strong.

    I wonder, if we can so casually and objectively observe the role disease plays in maintaining plant and animal populations, why the hell are we so blind to the role it plays in human ones?
    --
    occultae nullus est respectus musicae - originally a Greek proverb
    1. Re:I don't think so by Daniel+Dvorkin · · Score: 1

      Because we've decided that human life is more valuable than other kinds of life. You may disagree with that decision if you want, but it's pretty obviously one with which the vast majority of people agree. (And other species would probably make the same decision if they could.)

      I wonder, would you so casually and objectively observe the role disease plays in maintaining human populations if you or someone you love were dying from a preventable disease? I kind of doubt it.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    2. Re:I don't think so by dsanfte · · Score: 1
      I wonder, would you so casually and objectively observe the role disease plays in maintaining human populations if you or someone you love were dying from a preventable disease? I kind of doubt it.


      Everybody dies, man. It's inevitable. It's a part of life. Why are you so skeptical of any point of view that doesn't view death as a tragedy?
      --
      occultae nullus est respectus musicae - originally a Greek proverb
  88. Any mirrors out there? by Darkdude · · Score: 1

    I would like to help but I can't download the client. Is there a mirror somewhere of clients?

    1. Re:Any mirrors out there? by Anonymous Coward · · Score: 1, Informative

      i wget'd it to a sf account before downloading from there, so there's an unofficial mirror at http://sealsystem.sf.net/bgp/ until i get around to deleting it.

  89. Re:Death rate is 15% now. by Anonymous Coward · · Score: 0

    You keep posting that this virus mutates, grows stronger, more evil, more intelligent etc. (Okay, not those words exactly, but that is what I've gotten from your posts) I think you've watched a little to much Star Trek and are believing the psuedo-biological science that is in the show.

    Viruses mutate, yes. But they do not activally mutate to a stronger version (it is just as likely that any mutation will do no harm to the virus, kill the virus (Yea, I know viruses aren't alive, how about make the virus inert), or make the virus weaker, as it is to make it stronger), nor do they learn. If they did, the world would have been dead a long time ago.

    The death rates are higher then first reported simply because there is now more data to work with. The first data sets were incomplete and the conclusions were wrong, or it was deliberatly understated so as to not cause a panic. It could be that the 20% figure is now over inflated, to stress concerns. It could be that the true fatality rate is going to be the same as it was for Europe during the plague (66% or thereabouts, if I remember my history correctly).

    The point is, whatever the final number turns out to be, that is probably what it was like all along, we just didn't have enough information in the begining to make an accurate estimate, and not because we have been infected with an virus with an intelligence.

  90. Folding @ Home by s-orbital · · Score: 1, Redundant

    Checkout
    http://folding.stanford.edu/

    This is a distributed computing project to study protein folds for things like Alzheimer's, BSE, and parkinsons, which are caused by misfolded proteins.

    They have clients for Linux, MacOS, and Windows. It can run as a console only, or as a screensaver. (Both at lowest priority)

    --
    Patent: from Latin patere, to be open
  91. Not exactly by Rob+Simpson · · Score: 1
    Cold can be caused by one of ~200 strains from several virus families, including rhinovirus (~50%), coronaviruses (15-20%), parainfluenza viruses, respiratory syncytial viruses, adenoviruses, etc.

    Parainfluenza is a paramyxoviridae, but not the main cold virus.

  92. SARS is here to stay... by Fulg0re- · · Score: 1

    I live in Toronto, and know first hand what sorts of SARS precautions the city and the province is taking. Take for example, the University of Toronto. They have put in place a number of SARS precautions, including not letting 3rd and 4th year medical students attend clinical rotations. In fact, I know a handful of people, both directly and indirecty who are in quarantine.

    Now even if we quarantine the entire population, my suspicions and academic knowhow seem to suggest that SARS is here to stay. In fact, a number of my professors have mentioned that fact. The virus does not seem to be as virulent as the media is making it out to be, which therefore means that it has a good chance ot sticking around, aka: trade-off hypothesis.

    Remember, evolution is constantly occuring, and SARS is a perfect example of evolution taking place. It may not be be a perfect fit of the 'species' definition, but it sure seems close!

    "Nothing in biology makes sense except in the light of evolution."

  93. Repressive proteins by xmnemonic · · Score: 1

    What about a repressive protein, which blocks the operating cells?

  94. Ooohh...does it make you feel all goody two shoes? by exp(pi*sqrt(163)) · · Score: 1
    I've replaced SETI@Home at least temporarily on all of my Boxen
    Like it's going to make a difference. Number crunching does not find drugs. Yes, there are some people in the biotech industry who like to make a noise and get funding for their hare-brained projects. But simulating a bunch of molecules doesn't find drugs. People in labs testing finds drugs. We're a long way from simulations that work and it's far to early in the development of the technology to be wasting millions of CPU hours on it.
    --
    Doesn't it make you feel good to know that our freedoms are protected by politicans, lawyers and journalists.
  95. X-box Microtroll? by hughk · · Score: 1

    This sounds a little too like a troll to promote PlayStation alternatives like the X-box. Sony would be monumentally stupid to try this one. The main point is that a distributed client must go online from time to time. For a lot of reasons, people don't like it when their boxes starting connecting all by themselves.

    --
    See my journal, I write things there
    1. Re:X-box Microtroll? by aarondyck · · Score: 1

      I would just like to go on record saying that I have only ever owned Sony consoles (Aside from back in the day, before Sony was in the market), and I intend to buy a PS3 when they come out, simply because Sony does the best job of the console makers (IMO). I was only passing on the information I had garnered from my many discussions with people on the subject. I would put up a link to press releases, etc., but I'm currently at work and am unable to access many sites due to company policy. I still support Sony, I own a PS1 and a PS2, as well as several sfotware titles. I have no reason to promote other products, and I have gone on record at times saying that I would never pay money for an X-Box, although I wouldn't mind tinkering with one, should it come my way.

    2. Re:X-box Microtroll? by hughk · · Score: 1

      My apologies. I wasn't suggesting that you were Microtrolling as I agree other sites have put something up about this. However, I do feel that this seems a little like a marketing-lead disinformation rumor. Sony would be very stupid to blow the favourable view that the PS has in the gaming/hacking community by doing this.

      --
      See my journal, I write things there
    3. Re:X-box Microtroll? by aarondyck · · Score: 1

      Check out This link for more info on the PS3 Distributed processing model...it was the best I could find on short notice.

  96. direct links for people to mirror by DHR · · Score: 1
  97. Re:Pffffttt SARS - BFD by Anonymous Coward · · Score: 0

    There's nothing to worry about. All us slashdot types are confined to sitting in front of a computer all day with no social interaction or going out.

  98. Yeah, millions... by jotaeleemeese · · Score: 1

    .... that guy, the frenchman, Louis Pasteur, surely needed billions.

    What was the name of his multinational corporation? Memory fails me.

    --
    IANAL but write like a drunk one.
  99. That is good to say ... by jotaeleemeese · · Score: 1

    .... when you have the prospects to afford the drugs.

    If people in rich countries are happy with a mechanism to make science to benefit only the wealthiest of the wealthiest I seriously question the values that move people in those countries.

    --
    IANAL but write like a drunk one.
  100. Don't be idiotic. by jotaeleemeese · · Score: 1

    If they use a common. shared resource (people's CPU cycles) why should they be entitled to an exclusive patent?

    If they want exclusive rights to something then they better buy their own computers.

    --
    IANAL but write like a drunk one.
  101. Statistics.... by jotaeleemeese · · Score: 1

    Think about this: 1 is 50% of 2.

    I hope that is enough for you tyo understand that before any menaingful statistical analysis you need numbers big enough that stablish trends.

    The most accurate trend would be to add all cases and all deaths and calculate percentages.

    I did this last Saturday and the mortality rate was 6%.

    --
    IANAL but write like a drunk one.
  102. another mirror by Anonymous Coward · · Score: 0

    http://www.powerweb.net/sars/

    some of the staff at powerweb wanted to be /.ed, but never do anything cool enough to get it, so this should be a good minor /.ing that will help them see they are not ready.

    it currently has only the windows installer, i'm currently working on getting the mac installer, and then i'll grab the linux and sol.

  103. windows version mirrored here... by braddeicide · · Score: 1

    http://sealsystem.sourceforge.net/bgp/installDDOL. exe

    (linux version didn't work for me, debian and java DONT mix)

    if you get linux filename, run it through http://www.filemirrors.com to find its mirror

  104. Fight AIDS@Home by superyooser · · Score: 1
    Parents, teach your children @home:
    • Sexual activity is reserved for marriage.
    • Marriage is one man and one woman bound in a divine covenant.
    • Marriage is for life.
    100% FREE, 100% effective.

    Adherence to regimen required for success. No computer necessary.

  105. in answer to the question by buswolley · · Score: 1

    From the forum of d2OL,
    I have been doing my best to find out some information about this for you all and here is what I have found out. First off is some information about what differentiates our project from others out there and secondly there is information about specifically what we are doing with our SARS results.

    Our program is different from all others in that we use real candidate molecules that anyone can either get for free from the NCI or order from chemical suppliers. We also are unique in that we "Publish" in real time on the web site the best hits, so anyone can use the results. They have the results at the same time we do. This is in the spirit of the "Bermuda" convention that was adopted by those working on the human genome to share results as soon as you have them so anyone any where in the world could build on them and use them to help people. We operate in that spirit, recognizing that we all have to work together, like open source software, to make the biggest difference, and that there are over 10,000 labs that have the skills necessary to take our results and test them. This sure beats just us doing it.

    In addition we are working with select groups to test the best candidates. Specifically in the case of SARS we are working with Professor Tian Xu of Yale University and researches in china's leading university, Fudan University, who have agreed to test our most promising results DIRECTLY on SARS virus that have been taken from REAL patients with the disease. The beginning stages of these tests are will be done in dishes of human cells with the SARS virus to see if our best candidates kill the virus.

    Ken

    --

    A Good Troll is better than a Bad Human.

    1. Re:in answer to the question by buswolley · · Score: 1

      So you tell me slashdotters what this means, as I cannot read as well in my old age.

      --

      A Good Troll is better than a Bad Human.

  106. Good Buisness Model by CharlieO · · Score: 1

    The only thing I hope is that Sony actually has an option to turn off processor sharing, just in case us hapless users don't want to support whatever cause it is that they are studying at the moment

    Of course 'hapless consumers' actually buying the hardware from Sony, and buying software licensed by Sony isn't going to help fund Sony's R&D at all - I mean who would run a buisness like that? I'd expect that hardware to just sit on the shelf there being boycotted by all those consumers.

    But if Sony provided the net connection for free - would that be a good buisness model?

    The main objection I see to distributed computing is people not being compensated in some way for providing thier resources.

    If company X provides me with a net connection for nothing to use for what I want, in return for using my hardware for something useful while I'm asleep - then I don't see anything inherently wrong with that principle, I think in fact its great.

    Sure if it happens I'd like to know what I'm helping out with, but that doesn't invalidate the idea.

    It might even be a great idea for ISPs - have the option of reducing your bandwidth bills by allwoing the ISP to pool your spare clock cycles for commercial work.

  107. Distributed Computing service by hashwolf · · Score: 1

    Few days ago I was thinking if it would be possible to have a service (UDP?) that one could use for distribited processing. The idea is that of a protocol that permits one to upload chunks of data and the operations you want done on the data..... and after processing the service returns the result. Part of the protocol would be advertising the service to those who need it (after setting appropriate premissions/rules) One could also allocate different precentages(during different times of the day etc.) of idle processing power to different distributed computing tasks. I have seen at least three DIFFERENT x@home programs..... if we're going to do some serious distributed computing it's about time there is a standard. I am not tech enough to propose such a thing myself to the world(e.g. RFC) so I'm just dropping off the idea.

    --
    - "They misunderestimated me."
  108. Partly, but... by Thuktun · · Score: 1

    You can vaccinate against Smallpox, but the existing vaccination is somewhat more risky than some would like. They may be looking for a less risky vaccination. Also, it would be worthwhile having a TREATMENT in case someone who wasn't vaccinated caught it.

  109. Find-a-Drug by Anonymous Coward · · Score: 0

    Find-a-Drug is pleased to announce the start of its Respiratory Disease project which focuses on diseases that affect the lungs. The first target is Severe Acute Respiratory Syndrome (SARS) and subsequent ones may include Tuberculosis (TB) and Chronic Bronchitis. more Is this different? Better?