Slashdot Mirror


Cost of Game Development is 'Crazy' Says EA

GamesIndustry.biz has the word from Alan Tascan, general manager of EA's Montreal studio, who has gone on record saying that development costs are 'crazy' in this next-gen world. From the article: "When asked whether he'd agree that it's larger companies like EA which are driving bigger game budgets, Tascan replied, 'I think a lot of [other companies] are spending even more money. It's people who want that, it's not EA per se ... I said to some of the guys here, "The gamer is not buying lines of code; you have to promise him enough entertainment for him to put his hand in his pocket and buy the game." It's a lot of money, so you need to give him a show, and we're just here to deliver the show.'"

267 of 321 comments (clear)

  1. No Problem by Anonymous Coward · · Score: 5, Funny

    Good thing EA only has to develop one Madden game per console.

    I kid, I kid...

    1. Re:No Problem by malsdavis · · Score: 2, Interesting

      I really don't understand where the money goes for the annual sports game like FIFA ## & Madden ## (although I've not actually played Madden). The graphics and gameplay show only extremely minor improvements year on year, yet they claim development costs of many millions.

      So where does the money actually go?

    2. Re:No Problem by eln · · Score: 5, Insightful

      Licensing.

    3. Re:No Problem by stoolpigeon · · Score: 3, Insightful

      I really don't understand where the money goes for the annual sports game like FIFA ## & Madden ## (although I've not actually played Madden). The graphics and gameplay show only extremely minor improvements year on year, yet they claim development costs of many millions.
       
      So where does the money actually go?
       
        the nfl didn't give them an exclusive contract for peanuts
      --
      It's hard to believe that's how Micronians are made. Why don't we see it right now by having you both kiss one another?
    4. Re:No Problem by Hillgiant · · Score: 1

      Money hats don't come cheap.

      --
      -
    5. Re:No Problem by hal2814 · · Score: 3, Informative

      "The graphics and gameplay show only extremely minor improvements year on year"

      Graphics are easy to see without playing. However, I don't see how you can deduce the gameplay characteristics of a game series you've never played. As a semi-regular Madden buyer, I'll address the issue anyways. Those improvements are incremental but if you look at how long it ususally takes to develop a sequel to a game (2-3 years) and what Madden has done in that amount of time, the changes are typically quite drastic. That would explain where the money went. I still maintain that I'd rather play Madden 07 than Madden 06 with 07's roster and that's been true every year except for IMHO some exceptionally poor showings from 2001 to 2003 (in Madden years).

    6. Re:No Problem by nschubach · · Score: 1
      --
      Every time I start to have faith in humanity, I ruin it by driving to work between 7 and 8 am.
    7. Re:No Problem by punkr0x · · Score: 1

      They change the gameplay, but do they really improve upon it?

      I've played EA's NHL titles far more than the Madden series, so I'll use that for my example. I loved NHL 2000. In my opinion, the title achieved perfection that year. Since then, each year has introduced a new gimmick and taken away something that I liked about the previous year. If they could just give me NHL 2000 with updated graphics and rosters, I'd be happy. I have yet to buy NHL 2007... I can't justify spending $50 for a roster update.

    8. Re:No Problem by Shrubber · · Score: 1

      It is true, the changes in gameplay are drastic in Madden.
      For example in the last two years they have drastically removed many features of the game. EA is incrementally removing things from the Madden franchise that have been there in the past, features like co-op play, and fantasy drafts. It costs a lot of money to cut out all of that code.

    9. Re:No Problem by HeavenlyBankAcct · · Score: 4, Insightful

      Trust me, it takes just as long to re-factor and "fix" legacy code that's been hacked and re-hacked for years as it does to write it from scratch. Speaking from experience here, the iterative nature of titles like Madden and FIFA leads to a more difficult, bloated production cycle than you'd expect. Think about it -- You're a new developer working on a project and you get handed a library of code that's been 'resused' and 'modified' under 'tight time constraints' (aka "hacked") for YEARS. You have to spend time familiarizing yourself with this spaghetti mess, and as such, your productivity declines. Your managers see this occuring across the board and throw more people at the problem. Now you have four or five people who are unfamiliar with the project working on it, adding in their modifications, and making their own 'modifications' under 'tight time constraints' (aka "hacks"). What do you think ends up happening the next year when a whole new batch of people are thrown onto the project? I'd suggest turning to your dog-eared copies of The Mythical Man-Month before you attempt to divy exactly what is going on behind the scenes at EA, and probably a lot more of the bigger developers out there. The cost of game development gets "crazy" because these huge companies are falling into the common trap where they've become convinced that the answer to any development problem is "MORE RESOURCES." The concept of working in a streamlined environment has long since been abandoned in favor of a "big business" mentality where the whole somehow is percieved as greater than the sum of the parts.

    10. Re:No Problem by ThePhilips · · Score: 1
      The cost of game development gets "crazy" because these huge companies are falling into the common trap where they've become convinced that the answer to any development problem is "MORE RESOURCES."

      Let's put names in the sentence: Micro-Soft. Wouldn't EA so insistent on getting into bed with M$, the situation might have been different. There is no real competition for game development tools for PC/Xbox: all are framed into DirectX which is updated every year so that you have to retest/redevelop games every year. You might ask why just not to use older DirectX interfaces? But that's precisely what means being in bed with M$ since it's them who demand all partners to always use latest and greatest - consequently to force consumers to upgrade Windows to get newer DirectX. That's was M$' game from the beginning.

      EA of course gets special treatments from MS, but consequently the treatments are already not-a-bottom-line part of its balance sheet. In other words, unless EA abandon its business/money earning stance and switch back to game development, it wouldn't be able to quit the addition of M$ treatments.

      P.S. The "MORE RESOURCES" syndrome I already once tries to describe here on a topic of how Wii compares (or not) to Xbox/PS3.

      --
      All hope abandon ye who enter here.
    11. Re:No Problem by Tim+Browse · · Score: 2, Insightful

      Trust me, if you want to blast the suppliers of development tools for games consoles, then you're way off base aiming at Microsoft. There are other manufacturers who are much worse. Anyway, for the Xbox, the version of DX was frozen for quite a while (v8.1, I think) - it might have been updated, but I don't think so. That's kind of the point of a console - it's a fixed platform. You don't need to "retest/redevelop games every year".

  2. Cry me a river... by Joe+Snipe · · Score: 5, Insightful

    You think it's pricey to make games? I have to pay $699 for the console to play them!

    --
    Sometimes, life itself is sarcasm...
    1. Re:Cry me a river... by fistfullast33l · · Score: 4, Insightful

      I have no pity for EA. All they've been doing is complaining lately. Heck, two months ago EA was complaining that the PSP is a horrible platform! They seem to be the only ones having an issue with it, however, as all their games have either been buggy on release or just plain slow and choppy (Sims 2 I'm looking at you). I say stop complaining about costs, shrink your development team sizes, get your products under control, and release some quality games and you'll see your costs decrease. EA really annoyed me with their support of the PSP to the point where I'm not buying any of their games at this point. The only exception I might make is Spore, but that's it.

    2. Re:Cry me a river... by stoolpigeon · · Score: 2, Insightful

      right - you can only look at the cost of production in light of the revenue generated. pro athletes make 'crazy' money because fans pay 'crazy' money for tickets and merchandise. but i'm not sure he was complaining as just saying he didn't think the current situation was sustainable.

      --
      It's hard to believe that's how Micronians are made. Why don't we see it right now by having you both kiss one another?
    3. Re:Cry me a river... by erbbysam · · Score: 2, Insightful

      You think it's pricey to make games? I have to pay $699 for the console to play them!
      and even then the next-gen consoles are 'loss leaders'.

      Games have always been hard to produce the only difference between then and now is that they have more pixels to work with which means more graphics to create, not necessarily more gameplay. Gamers, in general, have been spoiled by the great control of games like 'Halo' and 'God of War' and the length of games like 'DeusEx', I think that this is just EA crying about how difficult it is to compete in the cutthroat industry that they have a firm grasp on.

    4. Re:Cry me a river... by Bastian · · Score: 4, Interesting

      I have to wonder how much EA's reputation for overworking their employees has to do with this. I'm not Brooks or anything, but I get the sense that the productivity of a developer increases more quickly than the pay that said developer will expect. With a bad reputation like that, they probably have a harder time securing as many really skilled employees, since good workers can more easily get a better job somewhere else. In short, they end up paying more money for less work by using more freshouts and fewer gurus.

    5. Re:Cry me a river... by Osiris+Ani · · Score: 5, Insightful
      Games have always been hard to produce the only difference between then and now is that they have more pixels to work with which means more graphics to create, not necessarily more gameplay.

      So the physics model for Pong wasn't really all that different than that of, say, Quake 4? The greater complexity and raw power of more modern systems allow for more expansive gameplay beyond the pushing of pixels and shaders. The AI, the level of interaction with the environment, and the immersive qualities of the audio fields are only a few of the ways that games have evolved since the offerings available during my childhood.

      Relegating the changes to mere visual aesthetic modifications completely discounts the capabilities that the technology allows as well as the pure academic research that led to each of these advances. From a tech-geek standpoint, your assertion is almost offensive.

    6. Re:Cry me a river... by Tei · · Score: 1

      Morons don't build atomic bombos. Theres stuff on gaming that freshouts can't do. You absolutelly need a bunch of gurus. Imho.

      --

      -Woof woof woof!

    7. Re:Cry me a river... by Aladrin · · Score: 2, Funny

      You mean like stability? Oh wait, isn't that one of the things they DON'T have?

      --
      "If you make people think they're thinking, they'll love you; But if you really make them think, they'll hate you." - DM
    8. Re:Cry me a river... by DeadChobi · · Score: 1

      What is it with all the console fanboys who always come into these discussions and derail them? It's about the cost of game development, we're not here to argue the various merits and drawbacks of the PS3, or the Xbox360, or the Wii. How did you get "PS3" from $699? It was priced at $599. It'd be okay for this discussion to happen if we were actually talking about the consoles. As it stands, I'm getting really sick of this argument. It's like watching Star Trek reruns on Spike TV in that I'd do it if there was nothing else on.

      --
      SRSLY.
    9. Re:Cry me a river... by Moofie · · Score: 4, Insightful

      EA is reaping what they have sown. I have not any sympathy. /former EA employee

      --
      Why yes, I AM a rocket scientist!
    10. Re:Cry me a river... by drinkypoo · · Score: 2, Interesting
      Consdiering consoles are just computers...and the PS3 is a very sophisticated one...that's really a deal. Try buying a computer with those specs for that price.

      If I built a computer at that price I'd put at least 512MB RAM in it. PS3 only has 256MB. It's pretty worthless as a desktop computer. It will be a long time before much has been ported to cell, so it's pretty worthless as anything but a Blu-Ray player or a game console. No more than 5% of the population of the US will give a fuck about Blu-Ray before 2010 so that's pretty fucking irrelevant. And the PS3 will offer only aesthetic improvements over, say, the Xbox 360.

      Or in other, simpler words, it's a crap general purpose computer, so you can't use that as an argument. 256MB isn't enough to run your automated ass-scratcher, let alone anything real.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    11. Re:Cry me a river... by brkello · · Score: 1

      The only reason I replied is that someone modded that person insightful and felt it should be countered. I am not a console fanboy (considering I own all of them and PC game as well). I do agree he was offtopic. But since he posted that and was modded up, I am a bit confused why I was modded down. If I am responding to an up modded post, it isn't offtopic.

      As to how I got PS3 out of $699...that's pretty simple. If someone is refering to an expensive console, which one do you think they are talking about? They could be adding on games, they could have made a typo, or they could be exaggerating in typical anti-Sony fashion on here. I don't think it was unreasonable to assume he was referring to the PS3 in this case.

      I guess I just don't get why you are so upset. If you don't care about what the first guy wrote (since it dealt with consoles) why read down to replies to his thread? It's like there are plenty good things on, yet you continue to watch Star Trek and then complain that Star Trek is on.

      --
      Support a great indie game: http://www.abaddon360.com
    12. Re:Cry me a river... by jackbird · · Score: 3, Insightful
      How about the difference between Quake 4 and Quake 1? Is that really a decade of progress?

      Does Dead Rising allow the same richness of interaction with the environment that any Infocom text adventure did?

      Great advancements are being made in gameplay today (the Wii controller being a very visible example among many), but there's a lot of rehashed shiny same-old as well. Sort of like how there are some great films being made today, but a surprising number of outright remakes of old B-movies with better VFX.

    13. Re:Cry me a river... by nschubach · · Score: 1

      You could have easily spent that money on a video card for your PC, complaining about a less costly console that plays a game out of the box won't win you any arguments in my book.

      --
      Every time I start to have faith in humanity, I ruin it by driving to work between 7 and 8 am.
    14. Re:Cry me a river... by The+Relentless · · Score: 1

      Whenever I see the EA logo or see "EA" my first thought is: "Mmmmmmm.....Archon." In fact, EA hasn't left me with any other memories since....jeez....1983.

    15. Re:Cry me a river... by Joe+Snipe · · Score: 3, Interesting


      Your complaints about beating a dead horse aside (I'm adressing both Brkello and DeadChobi), My initial comment was a response to EA complaints about how they only pull in 45% profit after development and marketing instead of 65% (actual numbers may vary). It was my way of saying "Too bad EA; prices are jacked up all over the place, and the last place I want to hear from about it is a megacorporation who's bottom line business practices and profit before peole attitude jacked up all the prices in the first place!" You guys chose to view that as yet another console bitch session, and responded with the standard ilk. IOW, you were modded offtopic for missing the topic. I hope that clarifies things for both of you.

      Oh yeah, and the $699 was a typo.

      --
      Sometimes, life itself is sarcasm...
    16. Re:Cry me a river... by CommandNotFound · · Score: 4, Interesting

      I understand your point, but don't discount the difficulty of writing the games of yesteryear. With those early systems (Atari 2600), you had to output your graphics by twiddling bits during each raster scan line, no mode19h bitmapped memory, no DirectX buffers, and definitely no glBegin(); glAddTriangle() type calls. No function calls at all, just pushing bytes with assembly (if you're lucky) around. And do it in 1K or less of memory.

      Games of today are much more complex, but the 'Invention of invention' was made decades ago, so we expect a lot more out of the industry today. Barnes & Noble or Amazon have shelves of books explaining how to write 2D/3D/board games, which is a huge benefit over the 'old days'. Pre-1990 you almost had to grow up in Silicon Valley so your dad could show you why you use "poke 3e, ff" to clear the screen on your Apple II. Now you can buy books showing you how to build your logic loop, collision detection, etc. And that's for the 'hardcore' coders who want to know the mechanics. Everyone else can just download/buy a game engine and make function calls.

    17. Re:Cry me a river... by fithmo · · Score: 1
      Heck, two months ago EA was complaining that the PSP is a horrible platform!
      but... isn't it?
    18. Re:Cry me a river... by nuzak · · Score: 1

      > Does Dead Rising allow the same richness of interaction with the environment that any Infocom text adventure did?

      Nostalgia isn't what it used to be: I personally found the constant rehashing of "hunt the verb" adventures rather dull and tiresome after playing a half-dozen of them. Besides, the whole point of puzzles is that your interaction with the environment is restricted.

      At least Myst gives you pretty art to look at (though as a strike, most Myst puzzles ultimately end up being a sort of Sesame Street/Picture Pages "match thing A to its B" thing). I find my imagination isn't fettered by looking at a picture instead of text, as I'm also capable of imagining the rest of the world that's not in the picture.

      Most art is derivative crap, especially when there's enough to pigeonhole it into a genre. I'd still rather be able to choose from a wide array of derivative crap within a genre than have to accept a single instance of a genre that someone decided was its Platonic ideal -- in fact I tend to have this problem with Nintendo. Want to play tennis? Mario. Race? Mario. Platformer? Mario.

      --
      Done with slashdot, done with nerds, getting a life.
    19. Re:Cry me a river... by Afrosheen · · Score: 1

      Morons don't build atomic bombos. Theres stuff on gaming that freshouts can't do. You absolutelly need a bunch of gurus. Imho. Yeah, when you want to build atomic bombos, you call in the Atomic Bombosman!
    20. Re:Cry me a river... by misleb · · Score: 4, Insightful

      How far back are you going when you say "then?" Because I'm pretty sure that the AI in Space Invaders, for example, is trivial compared to most modern games. Games HAVE increased in complexity significantly over the years. There is so much that a game developer has to work on these days. AI, network mutiplayer issues, complex physics models, gameplay balancing, etc. The only really difficult part about developing games in the past was making them fit in very tight spaces because memory was always tight. Not that i am trivializing that process, but come on. What half decent programmer couldn't put together a "Pong" clone in less than a week? These days game development cycles measure in months and years with large teams of programmers and designers. There is much more than just extra "pixels" in there. It is like comparing a major motion picture to a photograph.

      -matthew

      --
      "THERE IS NO JUSTICE, THERE IS ONLY ME." -Death
    21. Re:Cry me a river... by hyfe · · Score: 1
      So the physics model for Pong wasn't really all that different than that of, say, Quake 4?
      Actually, disregarding scale, I'd say it isn't.

      Movement:
      Collision Detection:
      Objects interacting on collision:

      I mean, everything is the same always, just worse.

      --
      "" How about taking the safety labels off everything, and let the stupidity-problem solve itself? """
    22. Re:Cry me a river... by Mysticalfruit · · Score: 1

      Actually, it isn't. What's so terrible about it?

      A 333mhz mips CPU, a decent resolution screen. Yeah, the UMD format is hokey, but that's Sony for you.
      The controls are close to what people expect if they've ever held a duel shock controller. The lack of a left analog and R2 and L2 trigger buttons are a bummer.

      As far as the PSP as a development platform, it doesn't appear to me to be that exotic of a platform. It's got one CPU, a read only device and a read write device. For connectivity it's got a USB interface, a wireless card and an infrared port.

      I consider myself a pretty incompetent programmer and I'm pretty sure I could hack together a crappy tetris knock off.

      --
      Yes Francis, the world has gone crazy.
    23. Re:Cry me a river... by Anonymous Coward · · Score: 1, Insightful

      Yeah, I can really see Dead Rising's photography gameplay mechanic working as a text adventure.

      "take picture of zombies" versus running and jumping around the environment dodging enemies to get the exact right shot of a zombie horde massacring a civilian before they finish ripping limbs off and turn on you. It's clearly more complex gameplay.

    24. Re:Cry me a river... by erbbysam · · Score: 1

      Just to continue being the devils advocate: who says that a simple game like geometry wars isn't an amazing game? while I definitely agree that modern games push the physics and other complexity out for excellent gameplay, there are still very many simple, yet extremely fun games out there.

    25. Re:Cry me a river... by Vr6dub · · Score: 1

      Please don't muddy the facts with your weak comparisons. The memory in the PS3 isn't off the shelf DDR-2 memory. As I understand it the PS3 has 512mb of RAM....256mb XDR and 256mb GDDR3. Trying to compare that with your run of the mill memory is a little misleading. Apparantly though it does suck for general purpose computing, equivalent to a PIII 800 or something close. I wouldn't put the limitation on the hardware though. Software needs to be written to take advantage of it's capabilities. And remember, the original Xbox had only 64mb of RAM and it ran Xbox Media Center wonderfully.

    26. Re:Cry me a river... by brkello · · Score: 1

      I don't think that really invalidates my point. I don't think console prices are all that jacked up (given inflation and hardware). I agree with your point about EA, I just don't think it was clear at all from your parent post since I see the console market differently.

      --
      Support a great indie game: http://www.abaddon360.com
    27. Re:Cry me a river... by CommunistHamster · · Score: 1

      Well, give or take a dimension.

    28. Re:Cry me a river... by muckdog · · Score: 1

      It definately affected my purchasing decision. I had heard rumors that battlefield 2142 was a decent game. I really knew little about the game and walked past it in Target. Got closer to check it out. "Oh, EA makes it" that alone made me not buy it. That plus there are planty of other good FPS out there.

    29. Re:Cry me a river... by fithmo · · Score: 1

      i agree that is is a nice form-factor device with many features. i guess i was joking/refering more to its lack of remarkable or compelling games (a point which is arguable, but upheld by many).

    30. Re:Cry me a river... by shadwstalkr · · Score: 1

      The physics model is the same, except instead of a ball you have grenades, and instead of the paddle you have walls. Rigid body mechanics hasn't changed that much in the last thirty years.

    31. Re:Cry me a river... by shadwstalkr · · Score: 1

      The physics is the same, but instead of a ball you have a grenade, instead of a paddle you have walls, and you have an extra dimension. Rigid body mechanics hasn't changed much in the last thirty years.

    32. Re:Cry me a river... by drinkypoo · · Score: 2, Informative

      Yes yes, and if I built a PC I'd put a 256MB video card in it and I'd have 768MB. But you can't lump the memory together, and doing so displays your ignorance of the topic we're discussing. Now granted, there are UMA solutions that use part of your system memory as video memory, but due to the performance impact, most of us try to avoid doing such things anywhere other than servers and such where it doesn't matter.

      The fact remains that the PS3 has only 256MB of memory for programs and data. Period. Not 512, 256. You can run shader programs from the video memory, maybe, but again, that won't help you with general purpose computing. Neither will the Cells, which is as you say why the system benchmarks like what is today an incredibly low-end processor. The Cell in the PS2 has one PPE which is based on a 64 bit PowerPC core, without a vector processor, and it has six or seven SPEs which are the cell cores. The PPE is there to do anything that can't be passed off to a vector processor, and to feed the SPEs. As such it's potentially incredibly powerful but is instead incredibly weak for general purpose computing until strategies are found to optimize general purpose code to the processor.

      I'm very happy that the Xbox runs XBMC beautifully in 64MB. I have one under my TV and I use it all the time. However, I said general purpose computing. XBMC is an appliance-type program, so it is not any kind of useful counterexample.

      Anyway, "weak comparisons"? The assertion was that it was a dandy PC. It is not. It is a shit PC. It may be a great game console; I won't know because I'll never buy one, because Sony can go fuck itself. However, that does not at all change the validity of my argument.

      If you don't believe me, try this experiment: downgrade your computer to 256MB RAM and tell me how you enjoy the experience. If you only have 256MB now, I hope you have an Amiga or something. XP became about twice as fast when I bumped up to 1GB memory from 512MB. 256MB to 512MB is something like a fourfold boost in performance because you get out of swap-land. Oh, it's possible to get things done with that little memory, but given (for example) a choice between a 2GHz machine with 256MB, and the same machine with half the clock rate and twice the memory, I'll choose the memory every time. Unless you're performing a single optimized task that somehow does not go past that line, the machine with more RAM will always be faster.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    33. Re:Cry me a river... by Dabido · · Score: 1

      The Demo for Battlefield 2142 didn't run on my laptop. That was enough for me to decide never to buy it.

      --
      Sure enough, the cow costume was hanging up next to the superhero outfit and sailors uniform. (S,Spud)
    34. Re:Cry me a river... by cgenman · · Score: 1

      And that's for the 'hardcore' coders who want to know the mechanics. Everyone else can just download/buy a game engine and make function calls.

      No offence, as I have the highest regard for what atari's early programmers were capable of pulling off. But do you really think that all a modern game developer does is buy an engine and make function calls?

      Pretty much every house out there right now is scrambling to describe and create custom shaders, full-screen filters, revolutionary netcode, etc etc. These range from photographic negative chemical bath filters, to dynamic HDR, to object-specific exaggerated motion blur, burned but dynamic soft self-shadowing, non-branching AI... heck for that matter multithreaded gaming in general. And if you thought the 2600 was a quirky piece of hardware, you should see the 360 or PS3 dev boards sometime.

      Sure, on the 2600 you had to write your own code for blitting 8x8 sprites. But I'd take that any day over spaghetti code draw order management on complex scenes. Or predictive netcode with parallel server-side logic and minimum packet size in MMO's.

      There are more resources available to coders in 2006, and a lot more about coding is known. But I see these guys pulling off amazing and new code tricks every day. And that's no small feat on a team of so many people.

      Credit where due, today's coders do amazing work.

    35. Re:Cry me a river... by Xman73x · · Score: 1

      Exactly. The cost of consoles in the future is outrageous!..I never paid that much in my 20's for a Videogame system for how much? 1,000 Ebay-..What I don't understand is why does japan get to pay less then we do?..The PS3 at launch in Japan was only for the 60 Gig-$510 bucks and for the 20 Gig $335.00-But theres a catch the 20 Gig was loaded with the WIFI and Memory card slots-Now We have a big problme with greedy ass SCEA!...The Damn console is selling for on Ebay at Ridiculous prices of $799-Wtf?..Wow America is sad today..And if you go to YouTube.com watch the riots that broke out in Massachusetts Wisconsin-And Fresno California-jes I don't know what to think of the Generation Young people going nuts over a PlayStation 3?..I really wish you people who are bragging about buying the PS3 would just please shut up for once!..Because nobody cares! lmao!..But Seriously if your in you 20's and worse 30's act your age!....I was shocked to hear a comment from Nick Malta.."Its like having a baby!"..Ok now you are in need to see a Shrink...LOL!

    36. Re:Cry me a river... by ThePhilips · · Score: 1

      +100. I bought Nintendo DS specifically for Tetris. ;)

      --
      All hope abandon ye who enter here.
    37. Re:Cry me a river... by x_MeRLiN_x · · Score: 1

      I just bought a pink PSP for my girlfriend and couldn't resist showing her so that I could play it. Thanks for reassuring me that it's only The Sims 2 that suffer from such performance issues. You have to wonder why, because all the game really involves is playing short animations and displaying text - or at least that's where it lags. How exactly can one excuse slowdown issues during a single-player reaction game? *shrug*

    38. Re:Cry me a river... by misleb · · Score: 1
      If you think AI hasn't increased your lying to yourself, you don't play groundbreaking modern games, or you have no idea the complexity of the AI you are looking at when you see it.


      Are you replying to me? I said AI has increased in complexity significantly. I dont' even know if a lot of old games even HAD AI at all really. Most video games had characters that moved pretty much at random... or rather in a fixed sequence. I'm thinking of Donkey Kong, for example. The ape just tossed barrels in a regular sequence. It didn't "intelligently" try to hit you.

      -matthew
      --
      "THERE IS NO JUSTICE, THERE IS ONLY ME." -Death
    39. Re:Cry me a river... by fistfullast33l · · Score: 1

      It's completely the UMD access - that is the one failing of the PSP I'll admit. If you let the disc spin down it takes forever for it to spin back up. At least, that's my take after playing some 10-15 different games and movies. Never have I had a problem with games like Virtua Tennis or GTA, which is amazing when you consider how complex the GTA environment is over Sims 2. It's just bad programming. I bet they tested off of a memory device or something other than the UMD itself (which is plausible as they probably didn't burn a UMD every time they wanted to test).

      I love my PSP but it's serious flaw is the UMD. Games that don't realize that tend to suffer, and EA just doesn't get it.

    40. Re:Cry me a river... by Mysticalfruit · · Score: 1

      It is an arguable point. There are some really great games for the PSP (such as Roco Loco and Lumines) and a bunch that are at best shotty ports.

      However, I think the problem is that there's just too many different platforms to develop for at this point. A game company has to allocate it's resources towards what it thinks is going to be a money maker. Thus I think the PSP development ends up getting handed off to a smaller development groups on tight deadlines.

      If sony was really smart, they'd make a SDK publically available with documentation and sample games. Yeah, people would port MAME over and play NES on the PSP (which they are / were already doing...) However it would let the rest of us put together our own games. Even better, Sony could setup a centeralized site where people could rate games, etc and maybe put out a yearly "Years best home brew games for PSP" on UMD. Heck, they could even keep the profits.

      --
      Yes Francis, the world has gone crazy.
  3. Meh. by MrAnnoyanceToYou · · Score: 4, Interesting

    There are always going to be two kinds of developers:

    The developers who are creative and try to build new, interesting games every time in the interest of having fun and helping others have fun.

    And the developers who are in an 'arms race' to make the most flashy eye candy possible in the name of capturing market share.

    Gosh, wonder where EA fits in? I have a lot of respect for the way Shiny produced a decade of great games. As did Microprose. Blizzard is arguably doing the same thing now. Nintendo has spent a decade being a developer of quality.

    EA, well, they're a good distributor. Sometimes........... erm. No. Never mind. Their games have gotten better implemented recently, but I've never played a groundbreaking EA game. So yeah, since they're just racing the competition to build the best game within the lines given to them, it's going to be expensive. And I have zero pity on them for high dev costs; that's the segment of the market they are going after...

    1. Re:Meh. by east+coast · · Score: 3, Interesting

      Gosh, wonder where EA fits in?

      Let's not try to be coy here because I'm having a problem interpreting exactly what you're saying. Infact statements like these are so non-committal that it makes me wonder if you're not sure of what you're trying to say or if you're just taking a cheap shot at EA.

      According to you there are two types of game developers: creative and eye candy.

      IMHO EA fits into both of these neat little categories that you've made. Sure, we all know the eye candy aspect of creating games like Maden. But EA also has gone out on a limb by publishing some fairly shaky (as in proven markets) titles like Alice and Undying. From my understanding EA took a bath on both of these games. I like both of them and own them but honestly if the game market is not buying these titles who can blame EA? They're not starving artists, they're a company that needs to pull a profit to keep people employed and to (hopefully) develop new and better products.

      --
      Dedicated Cthulhu Cultist since 4523 BC.
    2. Re:Meh. by Anonymous Coward · · Score: 1, Insightful

      The cost of game development is so insane because these companies are making formulaic games. They want more triangles, more models, more levels, more sound, but when you strip it all down, you're left with nothing but a flashy version of Doom, and game companies need to start to realize this. Yes the next iteration will cost more, because you're doing more of THE SAME THING.

    3. Re:Meh. by NewWorldDan · · Score: 3, Interesting

      The cost of development has also soared for Blizzard as well. 3D modeling gets expenisve very quickly. It takes more artists and more programmers. Expectations for sound have increased - both in terms of the sound track and the sound effects. This means hiring actual actors and sound effects guys instead of having a programmer spend 2 days recording a few odd sounds.

      Yes, Blizzard makes really awesome games, but they're spending as much as EA is on each title. When a game flops, or if they invest a lot of time and can't get it to market for whatever reason, they're in a world of hurt. Actually, blizzard is probably sitting on such a cash hoard at this point, they'll be ok for a very long time, but other developers could really get burned.

    4. Re:Meh. by heinousjay · · Score: 1

      Maybe you should leave the FPS section every now and again...

      --
      Slashdot - where whining about luck is the new way to make the world you want.
    5. Re:Meh. by suv4x4 · · Score: 1

      he developers who are creative and try to build new, interesting games every time in the interest of having fun and helping others have fun.

      And the developers who are in an 'arms race' to make the most flashy eye candy possible in the name of capturing market share.

      Gosh, wonder where EA fits in?


      EA fits both categories, they have highly experimental games coming from studios they own like Maxis. Don't forget Spore as well.

      But a big business can't run their entire operation, for years, based no the premise "hey let's risk everything and hope our experiments have commercial success".

      They are doing what they need to be doing to stay in business: and they are staying, until now.

    6. Re:Meh. by lymond01 · · Score: 1

      EA might be huge and unwieldy, but they do make some good games. Battle for Middle-Earth comes to mind. In the over-populated RTS world, they broke new ground in a few areas. I still consider the individual unit physics and the ability for horses to ride through and over troops a mandatory feature in any medieval-type RTS I play, and I haven't seen another game that has this, so I still play BFME.

    7. Re:Meh. by Anonymous Coward · · Score: 1, Insightful

      BFME doesnt break ~any~ ground

    8. Re:Meh. by XorNand · · Score: 3, Informative

      Bah... it doesn't have to be that expensive. I've plugged them before here and I'll plug them again because I think that the company is amazing: Stardock. They're a tiny, independent developer/publisher about 30 minutes from Ann Arbor, Michigan. Their most notable game is Galactic Civilizations 2, which includes 3D modeling, professional music score and sound effects, an insane amount of detail, excellent replayability, challenging AI, and very balanced gameplay. When I think "independent game developer", lame little Flash-based games are what come to mind. However GalCiv2 *fully* competes with anything EA has ever put out. Stardock also has a very "pro-customer" stance on copy protection too.

      --
      Entrepreneur : (noun), French for "unemployed"
    9. Re:Meh. by Anonymous Coward · · Score: 1

      Actually, waaaay waaaay back in the day, EA used to be pretty good. When I was playing games on a Commodore 64 almost everything they released was worth buying. That is definitely no longer the case.

    10. Re:Meh. by Moofie · · Score: 5, Insightful

      "EA fits both categories, they have highly experimental games coming from studios they own like Maxis."

      That's a pretty serious oversimplification. EA bought Maxis, and then tried to kill The Sims. Any "highly experimental" game that comes out of EA is an accident, not an experiment.

      --
      Why yes, I AM a rocket scientist!
    11. Re:Meh. by 0xdeadbeef · · Score: 2, Insightful

      They're not starving artists, they're a company that needs to pull a profit to keep people employed and to (hopefully) develop new and better products.

      You do realize this attitude is antithetical to their whining about the conditions of the market? Oh noes! Making money has gotten hard now that our competition is emulating our successful strategy! It's not fair!

      I say pile on the cheap-shots. Only undeserving douchebags employ loser-talk while they're fucking the prom queen.

    12. Re:Meh. by drinkypoo · · Score: 3, Interesting

      That game probably has zero models over 300 polys. I can do that kind of modeling. Newer systems are allowing models with thousands of polys, from which lower-resolution meshes can be automatically generated when needed. This technology is becoming more common as we get more CPU to throw at things like that. And what do you mean by a "professional" music score? All that means is that someone did it for money. Every time I play a video game any more (except for a few rare exceptions) when I hear the music I'm left thinking "I've heard .MOD files better than this." And people have 16 channel sound and CD-quality audio these days, back in THOSE days it was four channels, two to each stereo channel, and 22khz audio. I'm glad that some independent developers made a nice game that you like a lot, but I don't think the multimedia properties are the valuable part of that game. It's the program behind them that makes the whole thing valuable. A strategy game is just as fun with crap graphics, so long as you can see WTF is going on. (Not that I don't like eye candy.)

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    13. Re:Meh. by jellomizer · · Score: 1

      When I think "independent game developer", lame little Flash-based games are what come to mind.

      But Trogdor is my favorate game.

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    14. Re:Meh. by bazorg · · Score: 1

      And the worst is they aren't aplying that formula to the games *I* want... they'd certainly earn my EUR6.99 if they'd come up with a multiplayer version of LHX.

    15. Re:Meh. by MrAnnoyanceToYou · · Score: 1

      Malfador Machinations has made some amazing games, but they may no longer be independent; I saw Space Empires V in Best Buy....

    16. Re:Meh. by suv4x4 · · Score: 2, Insightful

      That's a pretty serious oversimplification. EA bought Maxis, and then tried to kill The Sims. Any "highly experimental" game that comes out of EA is an accident, not an experiment.

      Actually mine was the right oversimplification, and your is putting a human face on a corporation, which we know it's not.

      The momet Maxis was purchased by EA, it's part of EA corporation and that's all. From that point on, it's business as usual. If EA's strategy is wrong, they won't profit, won't be on the market. They don't cut strange deals on blank CD media, consoles and don't sue 80 year old grandmas for pirating Need for Speed.

      They profit in only one way: people like and buy their games.

    17. Re:Meh. by Firehed · · Score: 1
      They profit in only one way: people like and buy their games.

      Well, two ways for BF2142. Better not about the spyware for in-game advertising on that one. They make money even if you pirate the game.
      --
      How are sites slashdotted when nobody reads TFAs?
    18. Re:Meh. by Durzel · · Score: 1

      I don't think money is going to be a problem for Blizzard for a long time thanks to World of Warcraft, even if Vivendi is picking up the lion share of the profits.

    19. Re:Meh. by primenerd · · Score: 1

      Hell yes!
      I was pretty much ready to give up on the whole space conquest genera after the steaming pile that was Masters of Orion 3. Galactic Civ 2 brought me back. It is an incredibly good game! While the graphics are good, the real joy is the gameplay... you can tell they really spent time making the game *fun*. So what if it doesn't push the polygons? It's a fun game that I can play on a limited system. As a bonus there's no crippling copy protection (so you can load it on a laptop and play it on the road without having to remember the CD) and meaningful updates that genuinely improve the gameplay.
      Guess what most of my friends are getting for Christmas?

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    20. Re:Meh. by skam240 · · Score: 1

      "That game probably has zero models over 300 polys. I can do that kind of modeling. Newer systems are allowing models with thousands of polys, from which lower-resolution meshes can be automatically generated when needed."

      A game's graphics can have a low poly count and still look good. High poly counts do not automaticaly mean a better look for a game.
      The thing about galciv2 that i think xornand was getting at was that galciv2 competes well on almost every measurable level with most modern games and does so on a modest budget. yes there are games with better graphics out there, but galciv still looks good.

      I might also add that for a turn based strategy game, the game's sales have been amazing.

      --
      I ignore Anonymous Coward posts. If you want to discuss something, that's awesome. Log in.
    21. Re:Meh. by drinkypoo · · Score: 1

      I'm still not trying to take anything away from the game, which I haven't even played, so you don't have to be defensive. I did look at some model screenshots on their page and the models have a very low poly count. My point was that the models in this game have low poly counts and are thus not expensive to produce. They do not even have large, complex textures. This game cost basically nothing to make compared to any recent major release. That doesn't make it any less fun, which was half my point. The other half was that it was a crappy example of a game with those features that wasn't expensive to make, because it doesn't have those features on any kind of scale that we even need to talk about. It doesn't do anything that computers couldn't do ten years ago (albeit perhaps more high-end ones then... but look at how far computing has advanced today.)

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    22. Re:Meh. by Mordaximus · · Score: 1
      Their games have gotten better implemented recently, but I've never played a groundbreaking EA game.

      You've never played M.U.L.E., Archon, Pinball Construction Set, Bard's Tale, One on One, Seven Cities of Gold, Mail Order Monsters, Racing Destruction Set or Skate Or Die?? If you want to play groundbreaking EA games, all you need is an emulator! Once upon a time they made excellent games. Mind you, they were Electronic Arts back then.

    23. Re:Meh. by joystickgenie · · Score: 1

      I would like to point out the neither Alice or Undying were developed by Electronic Arts, they were only published by them. While EA's publishing arm does take some risks at times, EA's development arm takes very few.

    24. Re:Meh. by MrAnnoyanceToYou · · Score: 1

      You're right. It had been so long I had forgotten. I loved the pinball construction set. That thing was awesome.

      There's another post above that mentions many of the exact same games - the response mentions the original developers.

    25. Re:Meh. by VGPowerlord · · Score: 1

      As an addendum, Rogue Entertainment, who created American Macgee's Alice, has since gone under.

      --
      GLaDOS for President 2016! "Well here we are again. It's always such a pleasure." -- GLaDOS, 2011
    26. Re:Meh. by VGPowerlord · · Score: 1

      It sounds like your implying that turn-based strategy games don't sell well, which I'm sure would surprise Sid Meier.

      --
      GLaDOS for President 2016! "Well here we are again. It's always such a pleasure." -- GLaDOS, 2011
    27. Re:Meh. by skam240 · · Score: 1

      "My point was that the models in this game have low poly counts and are thus not expensive to produce. They do not even have large, complex textures."

      i know you said that in your first post. my reply was that low poly count does not equal bad looking :). developers, in my oppinion, are spending entirely too much money on computer art.

      "This game cost basically nothing to make compared to any recent major release."

      exactly my point. this game is a recent major release (came out earlier this year) and has done incredibly well both criticaly and sales wise.

      "It doesn't do anything that computers couldn't do ten years ago (albeit perhaps more high-end ones then... but look at how far computing has advanced today.)"

      not true at all. the ai for one, is far more advanced than anyone was seeing in games even 5 years ago.

      --
      I ignore Anonymous Coward posts. If you want to discuss something, that's awesome. Log in.
    28. Re:Meh. by skam240 · · Score: 1

      if you can name one in recent years that is not civilization (or galciv2 :) ), i'll be pretty impressed. i know i cant.

      At least once a year you see an RPG and an RTS that sells reasonably well, released. not so with turn based strategy.

      --
      I ignore Anonymous Coward posts. If you want to discuss something, that's awesome. Log in.
    29. Re:Meh. by joystickgenie · · Score: 1

      Really was Battle for middle earth the first to do this? I am extremely familiar with battle for middle earth and I never really thought of their cavalry as revolutionary. This seems like such an obvious idea that it had to be somewhere before. Oh wait. It was Command and Conquer: Tiberian Dawn (the first one), you could drive over a infantry unit with vehicles.

      Granted that having cavalry do it is a great mechanic and gives a huge strategic value to cavalry units (one that is fairly realistic) but it seems so obvious.

    30. Re:Meh. by drinkypoo · · Score: 1
      not true at all. the ai for one, is far more advanced than anyone was seeing in games even 5 years ago.

      That doesn't mean that it wasn't possible, though. (Although it might not have been.)

      Note that some games are only recently running at a good speed; for example, turns in Civilization 2 can STILL get to the point where my computer is processing for long enough for me to be annoyed. That's not very long but you have to consider that I originally played this game on a Pentium 180 or so, and now I'm playing it on a Core Duo (single threaded, I know) at 2.16GHz, with some kind of snazzy SDRAM instead of FPM RAM, and with accelerated graphics instead of something little more than a dumb framebuffer. Turns used to take, well, a LONG ASS TIME. A length of time no one would even wait today. So maybe the game would have been possible, even including the AI, but much slower. People would still play it because strategy gamers are weird. Myself included.

      But anyway, this whole thread is stupid because the whole point of it is that a guy said that galciv2 was a good example of a game with 3d and sound that doesn't cost a lot to make, and I said that wasn't the kind of 3d and sound anyone is talking about. I mean, we had 3d and sound in the last generation and people weren't complaining like they are now about the cost of game development. When they talk about that kind of thing costing a lot, they are talking about it costing a lot because of the complexity, which simply isn't there in the multimedia portions of galciv2.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    31. Re:Meh. by nasch · · Score: 1
      This seems like such an obvious idea that it had to be somewhere before. Oh wait. It was Command and Conquer: Tiberian Dawn (the first one), you could drive over a infantry unit with vehicles.
      For that matter, Dune 2 had that feature. I guess Westwood liked it well enough to use it again. Maybe the first Dune (I assume there was one) as well, but I've never seen that game.
    32. Re:Meh. by lymond01 · · Score: 1

      I disagree. :-) I guess I'm comparing Total War: Medieval or Warcraft with BFME. In those you have a cavalry "charge", but all they do is ride down and stop at the enemy infantry and just do more damage. You can't ride through or over.

      And C&C had nothing of the sort...driving a tank over an infantry unit to see a flattened corpse is different than crashing through the ranks with cavalry and knocking the infantry either down or *away*, to get up again if they were particularly tough or to just lie dead. Seeing trolls swing trees and knock people away (not just swing, and have the people fall over), catapult rocks hit the ground and roll through armies, have Gandalf blast everything off the screen...

      Maybe other games have the individual physics, but I've yet to see it, and that alone makes BFME enjoyable to play (it's not just a graphical enhancement).

    33. Re:Meh. by skam240 · · Score: 1

      i dont mean to be critical but you really need to do something about your computer if you're running a 2ghz machine that slows down when playing civ2. my old p3 600mgz with 256mb of pc133 ram ran that game with absolutly zero slow down on the largest map settings (you can actually make the maps a little bigger than the maximum setting in the game by using the scenario editor btw) with max number of ai and all the bells and whistles turned on. either you have some pretty heavey adware/spyware on your computer or there's something else wrong.

      "When they talk about that kind of thing costing a lot, they are talking about it costing a lot because of the complexity, which simply isn't there in the multimedia portions of galciv2."

      i guess my point kind of is that i don't think they need to be spending the kind of money they are on modern game graphics. nintendo has it right. keep the system slow so there's a lower cap for what people can do on it vs the other systems. this makes the system cheaper to develop for, for everybody.

      --
      I ignore Anonymous Coward posts. If you want to discuss something, that's awesome. Log in.
    34. Re:Meh. by KlausBreuer · · Score: 1

      Only 300 polys?

      I don't know. I do know that the graphics are very nice indeed. The UI is excellent, and the game is great fun, very well worth its price. I enjoy it a lot. And since it also lacks copyprotection, I don't have to get a new patch every time an update comes out.

      So you feel that a game using models with many many many polygons are better, simply because they use more polygons? Just because their models look that little bit better?
      I don't. I prefere content, AI, UI, fun and major replayability. Super-duper-extra-fancy-requiring-major-cards graphics don't rock my boat.

      --
      Free PC version of ChipWits at http://www.breueronline.de/klaus/chipwits/
    35. Re:Meh. by drinkypoo · · Score: 1
      So you feel that a game using models with many many many polygons are better, simply because they use more polygons? Just because their models look that little bit better?

      No, I feel that you're a fucking idiot, because you are putting words in my mouth that clearly never came from it. Idiots like you should go stink up kuro5hin or something. Why can't you read my fucking comment before replying to it?

      Let me try to say this again, using small words. I do not think that you need fancy graphics to make a game fun. I think that galciv2 is a shit example of a game that has the 3d and multimedia features of the current generation of systems, because it doesn't. What everyone is saying (except you, when you say that I think that) in this thread is true; it's true that game development is vastly more expensive in this generation because consumers expect to see the system's capabilities used. It's also true that a game doesn't need high-end graphics to be fun. I mean, those of us who have been playing video games since before realtime 3d graphics existed already know this. And I have. So I do.

      Oh shit, I used some big words back there.

      P.S. I TRIPLE DOG DARE YOU to find a comment in which I state that a game needs fancy graphics. Consult your dictionary, because I think some of these words do not mean what you think they mean. It's either that or you read about half of my comment and then went off half-cocked.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    36. Re:Meh. by VGPowerlord · · Score: 1

      I don't particularly care for turn-based strategy, so I wouldn't know which ones are good, let alone how well they sell.

      --
      GLaDOS for President 2016! "Well here we are again. It's always such a pleasure." -- GLaDOS, 2011
    37. Re:Meh. by KlausBreuer · · Score: 1

      My, sir, what an interesting way you have of expressing your discontent. I am sure it reflects on other large parts of your life as well.

      You wrote that "That game probably has zero models over 300 polys.", which could be interpreted as meaning: "This game does not have enough polys, ergo the models used do not look good enough". Which is why I was intrigued to see if you find this particularly important.
      I know many people who do, and I thought responding to your post would show me yet another viewpoint.

      Instead, it showed me a nobody who seems quite incapable of polite conversation.

      Had you demonstrated an even semi-interesting point of view, I would have asked you to continue this discussion via email. Since, however, you do not seem capable of holding an intelligent opinion, much less know how to argue in a polite manner, I will see this as a moot point.

      Enjoy your life.

      --
      Free PC version of ChipWits at http://www.breueronline.de/klaus/chipwits/
  4. This has been bothering me for a while. by Canthros · · Score: 4, Insightful

    The cost of game development has skyrocketed over the last thirty years. In the last ten years or so (the period during which I have actually been paying attention), I'd say that it's arguable just how much benefit this has produced for the game industry or their customers.

    Maybe they should be focusing on making the games fun to play, instead of entertaining to watch?

    --
    Canthros
    1. Re:This has been bothering me for a while. by Phydeaux314 · · Score: 5, Insightful

      Why do they have to be mutually exclusive? It's possible to make games that have an entertaining plotline and decent graphics quality. I mean, Half-Life was by no means "groundbreaking" as far as graphics go, but it was still pretty - and fun to play. Hell, it was based off of a modified quake 1 engine! I think the problem lies in the development time. When a game is rushed to the door to meet an arbitrary deadline, quality suffers. 8 years ago, a normal game development cycle was about 2-3 years, tops. We all laughed at dakitana for taking 4 and a half, saying that's what killed it. Now, it seems, all the "insightful" or "groundbreaking" games spend at least that long in development. Oblivion, Half-Life 2, etc. are all good examples of this. It boils down to this: If you have enough time, you can work on eye candy AND on playability. Save the $500,000 on licensed technology for whatever and do it in-house. Not only is it easier to suit it to your needs, but it's more unique.

      --
      Never underestimate the stupidity inherent in all human beings.
    2. Re:This has been bothering me for a while. by Anonymous Coward · · Score: 1, Funny

      When a game is rushed to the door to meet an arbitrary deadline, quality suffers.

      So Duke Nukem Forever is going to be the greatest game ever when it's released. Right?

    3. Re:This has been bothering me for a while. by Lord+Ender · · Score: 1

      Civilization 4 has an amazing soundtrack. The movements are epic, masterfully performed, and with wonderfully diverse instrumentation.

      That had to be much more expensive than programmer-inspired beeping in earlier games. And it is well worth it. The whole game costs less than one seat at a symphony.

      --
      A slashdotter who didn't build his own computer is like a Jedi who didn't build his own lightsaber.
    4. Re:This has been bothering me for a while. by Canthros · · Score: 3, Interesting

      For heaven's sake, I never said they were mutually exclusive. I said that the effort poured into graphics is producing diminishing returns. (Half-Life 1 being an excellent example of why I'm right.)

      1. I would wager, the use of licensed code probably contributes to better games, overall, than the practice of writing the engine in house. Unless you need that next-generation engine that nobody else can offer, it's probably cheaper to license the engine from somebody else. The dev time saved alone is probably worth the cost, and time not spent developing the engine can be put to better use solving other conundrums.
      2. Daikatana died less because of how long it took, and more because, by the time it finally was released, it did nothing that other games hadn't already done better. The problem was not the farcically long development time, but that the development time hadn't produced a good enough game to warrant the time spent, let alone the ludicrous hype.
      3. There's almost never enough time. Unless you have a guaranteed seller on your hands (instead of just the latest iteration in the race for totally immersive graphics), you simply can't take as long as you like. Games have competitors, and the audience is fickle beside.

      --
      Canthros
    5. Re:This has been bothering me for a while. by Canthros · · Score: 1

      But is it a fun game? More fun, or less fun than the same game without the fancy music? (In any case, the per-unit cost of including a nice soundtrack is probably infinitesimal most of the time.

      Seriously, folks. I'm not saying 'ZOMG! ATARI WUZ TEH KOOLIST!' I'm saying that the fancy sound, graphics, and so forth that go with current-gen games have not significantly enhanced most of the games being produced, except for their price tags.

      --
      Canthros
    6. Re:This has been bothering me for a while. by SlySmiles · · Score: 1

      8 years ago, a normal game development cycle was about 2-3 years,tops
      From someone who's been in games development for 17 years (and still is), I can say 2-3 years isn't normal now, and 8 years ago even less the case. In that period AAA titles were 18 months max, indeed today that is still the case. Maybe you can give more than 2 examples of this 'normal cycle'. On a side note, its not the development that costs, its the licensing and marketing. Thats why F1 games are loss leaders, where the development represents no more than 10% overall costs. You've taken the exceptions as the rule.

    7. Re:This has been bothering me for a while. by nuzak · · Score: 1

      > Civilization 4 has an amazing soundtrack. The movements are epic, masterfully performed, and with wonderfully diverse instrumentation.

      You do realize that they simply licensed existing symphonic recordings, right? Firaxis's production values peaked with Alpha Centauri, and they've only gotten cheaper.

      --
      Done with slashdot, done with nerds, getting a life.
    8. Re:This has been bothering me for a while. by Lord+Ender · · Score: 1

      It is better than it would have been without the music.

      Also... they have Leonard Nimoy doing the voice-over. I'm sure that cost them some cheddar, but Spock makes everything better.

      --
      A slashdotter who didn't build his own computer is like a Jedi who didn't build his own lightsaber.
    9. Re:This has been bothering me for a while. by a1210 · · Score: 1

      It boils down to this: If you have enough time, you can work on eye candy AND on playability. that's why Duke Nukem Forever is taking... forever!
    10. Re:This has been bothering me for a while. by TrappedByMyself · · Score: 2, Informative

      Maybe they should be focusing on making the games fun to play, instead of entertaining to watch?

      I can't believe cynical overgeneralizations still get modded up around here. There's a lot of noise out there, but also some killer fun games. The emerging cinematic elements aren't a substitution for fun, but a huge addition to the ones which do it right.

      --

      Help me take back Slashdot. When did 'News for Nerds' become 'FUD and Conspiracy Theories for Extremist Nutjobs'?
    11. Re:This has been bothering me for a while. by shplorb · · Score: 1

      It boils down to this: If you have enough time, you can work on eye candy AND on playability. Save the $500,000 on licensed technology for whatever and do it in-house. Not only is it easier to suit it to your needs, but it's more unique.

      Spoken like someone who's never worked in games, or probably even software development!

      $500,000 is going to buy you mature tools, pipeline and engine technology.

      To develop something equivalent to that would require months of work from a bunch of coders... and that's not even counting the QA. I can assure you that it would cost significantly more than half a million to develop something to the standard of $LICENSED_ENGINE I should know, my current employer has an in-house engine just like my previous employer. Both invested decades of man-hours into their current/last-gen engines, and even then still use middleware!

      Sure, doing it all yourself gives you ultimate control over everything... but then it also means that if you lose an employee it will be hard and expensive to find another to work in that area of expertise. Besides, nobody in their right mind would license an engine or middleware that didn't come with source anyway, so you still do have total control with the added benefit of it being easier/cheaper to find a developer who is familiar with the tech.

    12. Re:This has been bothering me for a while. by Vintermann · · Score: 1

      For Alpha Centauri one of the bosses at Firaxis apparently wrote the music himself. "Innovative", with "dynamically generated midi" ... Also, according to SDL developer Sam Lantinga, who helped port the game to Linux, the innards were pretty horrible, in a "look how clever I am" way.
      There's a reason one of the technologies in AC was "Polymorphic software"!

      Seems they spend their money better today! Civ4 may not be revolutionary, but it's a decent piece of art.

      --
      xkcd is not in the sudoers file. This incident will be reported.
    13. Re:This has been bothering me for a while. by nuzak · · Score: 1

      The music for AC was eerie and weird and exactly the sort of mood it was supposed to convey, but definitely not to everyone's taste.

      Civ 4 has Leonard Nimoy, but he frankly doesn't make any of his voice-overs sound the least bit interesting. And the project cut scenes in Civ4 are cut rate (they don't even display smoothly even after multiple patches to address the issue).

      And most of all it's a rehash of the same damn game that was Civ 1, 2, and 3. Even the much-maligned Call to Power at least dared to keep history going past the late 20th century, to say nothing of daring to tinker with the formula and making the armies of workers/engineer units unnecessary.

      I've bought every Civ, but I'm not sure I could bring myself to care about a Civ 5 if one should come out.

      --
      Done with slashdot, done with nerds, getting a life.
  5. Nintendo by frederec · · Score: 5, Interesting

    Statements like these give me hope for the success of Nintendo. From what I've heard, it is far easier and cheaper to code for the Wii (and similarly the DS/GBA) than for the "true" next-gen systems. Perhaps while the large companies are making the blockbuster big-budget games, Nintendo will attract the more indy, affordable games. Then when people get more accustomed to the PS3 and 360, (perhaps) costs will come down enough to make it more reasonable.

    Or maybe Xbox Live and the equivalent for the PS3 will just get an explosion of smaller games, and there will be just a small number of blockbusters coming out on the system proper.

    1. Re:Nintendo by lavid · · Score: 1

      Of course it's easier to code for the Wii! There's only one core on that thing. It's very difficult to effectively write games for a multi-core system.

      --
      If Bush wants to kill the terrorists, he should jump off a cliff.
    2. Re:Nintendo by ravenshrike · · Score: 1

      It's not that it's all that difficult, it's just completely different from writing for a single core and requires programmers to think in ways that they never had to with single core programming. Bring someone up on multi-core programming and I'd bet they'd find programming for a single core a bitch too.

    3. Re:Nintendo by fistfullast33l · · Score: 2, Insightful

      Bring someone up on multi-core programming and I'd bet they'd find programming for a single core a bitch too.

      I'm going to disagree with you there. They might find it a bit limiting but I doubt they'd complain too much. First, the simplicity of one core makes it far simpler to code for one core - there are many issues you just don't need to worry about. Second, there really isn't anyone whose being "brought up" on multi-core programming. Most developers are trained on single core (if they learn anything about processor programming at all) and it's only those interested in distributed programming and the like that would move to multi-core. You can't crawl before you walk, or something like that.

    4. Re:Nintendo by nschubach · · Score: 1

      And that's the issue today. In PCs and Consoles. You notice it more on consoles because they are forced to write near/at the peak of the machine. People don't realize this and will compare screen shots of systems to try to find out which is better even though the game was probably a simple recompile and slapped onto a different disc. If you learned on single threaded applications, it will be easier to code on them, but if you learned on multi-core, your already a step ahead and you should probably have your resume updated.

      --
      Every time I start to have faith in humanity, I ruin it by driving to work between 7 and 8 am.
    5. Re:Nintendo by Anonymous Coward · · Score: 1, Informative

      A full Wii dev kit costs around USD$2000, and Nintendo has spun rumours about allowing smaller developers access to a limited one that can build Virtual Console games for much less. Microsoft does have the XNA Studio to allow for Live-style games to get cooked up for a $99/yr "license fee"

      DS/GBA development can be done for under $100/$50 respectively. The software is free, you just need to buy the hardware (flash cart and a NoPass if doing DS dev) and get to work.

    6. Re:Nintendo by gwyrdd+benyw · · Score: 1
      it's just completely different from writing for a single core and requires programmers to think in ways that they never had to with single core programming.
      I'll second that. You can read more about concurrent programming (and why it is vital to learn it) in http://www.gotw.ca/publications/concurrency-ddj.ht m">Herb Sutter's excellent article, "The Free Lunch is Over".
      --

      I adblock all animated gifs.
      Blessed be the prime numbered slashdotters
  6. define 'crazy' by El_Muerte_TDS · · Score: 2, Interesting

    What are we talking about? $10m, $50m, $100m, $150m?
    According to Mark Rein Gears of War had a $10m pricetag.
    And what would be even more interesting was a breakdown of the costs. For example, is it less expensive to use original music or licensed music.

    1. Re:define 'crazy' by torchdragon · · Score: 1

      The average triple-A title is going to be between $10-15m for the 360/PS3 generation of games. Given that a developer may only ever see $15 per box sold, in the current business model, you sell a million units or bust.

      This is why we see so much crap these days. The publishers (ie, the guys with the money) shell out hundreds of millions on several projects. If one goes gangbusters, they win. In that process however, several developers are bought out, shut down, or dispersed before you even get to see their projects. Its a real shame. Remember Clover Studios? Gone. Looking Glass Studios? Gone. These were companies making fantastic games but weren't able to hit a bandwagon bubble.

      If we're lucky, we'll see a huge shake up this year.

      --
      "Don't feel bad for me child; I'm the monster that hides under your bed."
    2. Re:define 'crazy' by 91degrees · · Score: 2, Insightful

      Okay - 30 developers, 100K each, 2 years would be $6 million. These are fairly typical ballpark figues but there other costs as well. Dev teams range from half that size to about 3 times that size, employee costs are probably fairly variable and depend a lot on location. Development times are usually at least a year and rarely more than 3 (BOCTAOE). So lets say between $3 million and $60 million.

    3. Re:define 'crazy' by Wite_Noiz · · Score: 1, Funny

      Sounds about right.

      On that note, EA should stop crying - imagine how much Duke Nukem Forever is costing to develop!

    4. Re:define 'crazy' by Itchyeyes · · Score: 1

      A high profile game's budget these days is probably somewhere around $15 million. Mark Rein's quote of $10 million for Gears of War is misleading because that figure does not take into account the cost of the Unreal 3 engine. At the highest end you have a game like Killzone 2, which is currently budgeted at $21 million.

    5. Re:define 'crazy' by 91degrees · · Score: 1

      Well yes, Duke is an exception. 35 people would be quite a large team unless it also includes QA and admin. And 85 is huge even if it also includes staff shared with other projects.

  7. How does this compare to movies. by MindStalker · · Score: 4, Interesting

    The average blockbuster (meaning one that is intended to sell lots of tickets vs a niche market) movie budget is $100-$200 million. Game development cost are in the $10-$20 million dollar range. Game profits sometimes dwarf movie profits. Though I don't think game developers are going to be spending $200 million anytime soon (except for DNF) they will continue to make a profit regardless. The real interesting thing that is going to happen soon will be a break from the idea that every game has to be a blockbuster. More and more game studios are understanding a niche hit can be just as profitable as a blockbuster. Expect to see more small budget games even ones developed for the next gen consoles.

    1. Re:How does this compare to movies. by fistfullast33l · · Score: 4, Insightful

      I agree with you. Most movies do cost more to produce. Some would say that movies are mass-marketed to a wider audience. However, everyone has heard that the games industry is second in sales only to porn. They beat the music and the movie industries. Such is the cost of stardom - if your business is big it's going to cost more to play. People know you're making money hand over fist and they're going to want a piece of that pie. And once you're required to meet and exceed expectations, quality is going to have to increase as well, which costs money. I say shut up and make a decent game. They finally reduced the size of packaging and digital distribution is on the horizon - hell it's already here. That will save them a boatload of money.

    2. Re:How does this compare to movies. by Fozzyuw · · Score: 1
      The average blockbuster (meaning one that is intended to sell lots of tickets vs a niche market) movie budget is $100-$200 million. Game development cost are in the $10-$20 million dollar range. Game profits sometimes dwarf movie profits.

      I agree with you. However, one thing to note, these types of movies also have a different life cycle.

      1. Theaters
      2. 'Direct TV' rentals
      3. DVD sales/Rentals
      4. 'Exclusive first time network showing'
      I'm sure there are other parts of this cycle they make money off a movie's production, but unlike a game, it's pretty much just the sale/rental of that game. There's not a whole lot they can milk from it. There's also merchandising, which is much more main-stream for movies than games. There's plenty of game merchandise (more now than ever) but it still pals in comparison to movies.

      Cheers,
      Fozzy

      --
      "The past was erased, the erasure was forgotten, the lie became truth." ~1984 George Orwell
    3. Re:How does this compare to movies. by Duds · · Score: 2, Insightful

      There is a different though.

      A blockbuster film has a cinema run, then a PPV TV run, then a DVD run, then a network TV run and a really big movie will have tickover DVD sales for many years and will continue to sell at a reasonable trickle on Hd-DVD and then whatever future formats we have. For instance, Blade Runner is STILL selling on DVD now, 20 years after release, it's still making money. The original dev costs of these films when moved to HD-DVD from DVD will be minimal.

      A game comes out, it sells for a month and largely dissapears completely except for a possible blip when reduced in price (which is something movies will get anyway). At best 5 years after the game release there's a new format and making a proper version for that will be near to or more expensive than the original game dev was.

      So comparing budgets to prices to "unit sales" isn't terribly helpful.

    4. Re:How does this compare to movies. by Chyeld · · Score: 2, Interesting

      Actualy your point concerning the 'half-life' (pun intended) of a movie is even more ammo as to why EA has made it's own bed.

      Half-Life 1 came out how many years ago? How much support has Valve dumped into it? Into it's expansions, mods, and successors?

      Now take almost any of EA's major franchises. Need for Speed, The Sims, C&C, etc.

      After the intial sale, how much effort has put into maintaining and supporting any of the games in any of their franchises?

      When Half-Life 2 was released, you could (and can still) buy an updated and patched version of Half-Life 1 with it. You could buy all the expansions, and they also all came up to date. Hell, you could even get a version of Half-Life 1 that had been updated to work in HL2's engine. And you can still find plenty of HL1 servers out there, using the tracking servers maintained and provided by Valve.

      When C&C:The First Decade was released a while back, how many of the games in that pack had been updated to run in XP? How many of them even had servers to play multiplayer on any more? The answer is none. There was a huge shit storm in the C&C community that some of the programs included in the release were even a step backwards from what had already been on the market in terms of compatibility.

      When The Sims 2 was released, how much support did EA continue to provide The Sims? Outside of repackaging several expansions in a way to ensure you still had to pay about the same amount of money to catch up (by staggering what they included to be an old expansion and an new expansion) , what have they done new for the game? The answer is nothing.

      EA has a long history of just dumping a game then acting as if it never exsited. And Valve isn't an isolated company in regards to how much effort they put into supporting the community that forms around their games.

      If EA actually provided support for their products beyond that short intial launch window, they might have been able to build a better loyalty base and hence not have to waste all their money on marketing to wooing their target audience everytime they release something new. They might not have to spend all their money on eye candy to fool people into thinking "this game will be different, this one won't be candy coated crap".

      EA is the RIAA of Video Games. They think it's their God given right to print money and get pissed when someone expects them to actually work for it.

    5. Re:How does this compare to movies. by CousinLarry · · Score: 1

      Though I don't think game developers are going to be spending $200 million anytime soon

      I disagree... two or three "hot" actors talking on camera for a month can cost as much as entire 50-person game development team working for a year! the compensation that top actors, directors, writers and other talent demand from film studios has contributed very much to the cost of creating them. it wasn't always the case in hollywood...so what makes you think this happen eventually in games?

      if talent in the game dev industry were paid what they were *really* worth relative to the value they add to a title, game budgets would be a lot higher. studios don't have to pay developers much because there is a perceived talent glut -- but that's changing. now top developers are known for their work, top studios get recognition for their efforts. as the biz matures developers won't be treated like replaceable content slaves and they will command greater compensation for their efforts. its well within the realm of imagination that the wrights and blezinski's of the world will command many millions of dollars for their ideas in the future, just like the best paid actors and directors do. that leverage will trickle down the the lesser known developers as well and game budgets will balloon out to hell.

    6. Re:How does this compare to movies. by Duds · · Score: 1

      To add support to your post, I actually cancelled a pre-order here in the UK for C+C : First decade when the stories came out from the US release just how badly they botched it.

    7. Re:How does this compare to movies. by dank+zappingly · · Score: 1

      Idunno if I agree. While it isn't a perfect comparison, look at a game like Golden Axe. Came out for arcade. Ported to Genesis. Now it's ported to PS2, PSP, Xbox Live Arcade, etc. 5 years from now I'll be playing it on my holowatch.

    8. Re:How does this compare to movies. by Duds · · Score: 1

      True but it's a far smaller % of games that get that. Plus the costs of the Genesis port, not to mention the others (although being emulated they were probably cheaper), is going to be a lot more than "Stick that on a DVD Bob".

      Plus arcade gaming, which actually is a good analogy to a cinema release in many ways, is all but dead.

  8. Yeah no way... by haddieman · · Score: 1

    It's pretty much embedded in human nature to want bigger and better things. If that weren't true we would have just been content to live in tents for the rest of our lives. Furthermore, the more you give people the more they are going to want. So, it's no surprise that development costs have gone up as people are demanding more and more out of their video games. That's just the way it is.

  9. Blah by MeanderingMind · · Score: 2, Insightful

    What is EA doing? Paying each football player to come into their motion capture studios to perfectly imitate the way each runs? Taking hi res photos of their faces to perfectly texture them?

    There's a cost for HD games, and it isn't cheap. However, I think EA is calling sour grapes because companies like Capcom, Team Ninja and Square-Enix are able to make games that are stunning, fun, and wildly profitable while EA doesn't make the grade in any of those.

    The sad truth of Spore is that it will be a great game, but in so being it will allow EA to continue their overbloated and inefficient methods.

    --
    Thunderclone: ONE MAN ENTERS! TWO MEN LEAVE! ONE MAN ENTERS! TWO MEN LEAVE!
    1. Re:Blah by MeanderingMind · · Score: 1

      Did someone give EA mod points, or was I really an idiot?

      --
      Thunderclone: ONE MAN ENTERS! TWO MEN LEAVE! ONE MAN ENTERS! TWO MEN LEAVE!
    2. Re:Blah by SatanicPuppy · · Score: 1

      You dared to slight the holy Spore, for that you are flamebait. Go forth and sin no more.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    3. Re:Blah by MeanderingMind · · Score: 3, Funny

      Mine transgressions are arrayed before me, a terrible countenance of my crimes wherein no petition or pennance could redeem so corrupt a soul as mine. Surely there is no forgiveness for one such as I... ...what is this? Some visage descends from the hills proclaiming my salvation! It's.... it's... ...what the hell God? Why is a SatanicPuppy telling me to go and sin no more?

      (The irony was too much for me, -1 Offtopic I think, but worth it)

      --
      Thunderclone: ONE MAN ENTERS! TWO MEN LEAVE! ONE MAN ENTERS! TWO MEN LEAVE!
    4. Re:Blah by Zphbeeblbrox · · Score: 1

      your next action will be to give me a million dollars. email me for my address :-)

      --
      If you see spelling or grammatical errors don't blame me. I tried to preview but IE here at work borked the CSS
    5. Re:Blah by MeanderingMind · · Score: 1

      I am sorry to report that my next action was to post on Slashdot. As you were unable to express what my next action would be, I can not give you the million dollars.

      --
      Thunderclone: ONE MAN ENTERS! TWO MEN LEAVE! ONE MAN ENTERS! TWO MEN LEAVE!
  10. Being a Spelling Nazi by Skevin · · Score: 4, Informative

    "It's people who want that, it's not EA per say..."

    Umm, it's "per se".

    I realize this is how different flavours of languages propagate over the ages, but I'm all in favor of keeping English as unified as possible.

    Solomon

    --
    "Twice half-assed makes an ass whole." --Solomon K. Chang
    1. Re:Being a Spelling Nazi by itsdapead · · Score: 2, Insightful
      Umm, it's "per se". I realize this is how different flavours of languages propagate over the ages, but I'm all in favor of keeping English as unified as possible.

      I think you'll find per se is Latin :-)

      --
      In a survey of 100 programmers, 111111 thought that duck-typing was a good idea.
    2. Re:Being a Spelling Nazi by Ninjaesque+One · · Score: 1

      We use a fair bit of Latin loanwords, because the language of scholarly speech was Latin from about 100 BC to 1300 AD. Scholarly, by the way, comes from the Latin scholus. Also where we get the word "school".

      --
      Ninjas and pirates. How piquant.
    3. Re:Being a Spelling Nazi by vertinox · · Score: 1

      I realize this is how different flavours of languages propagate over the ages, but I'm all in favor of keeping English as unified as possible.

      Thou dost mock mine native tongue with banterings of a barbrian! Have at thee with bulbous and troubedore pestilence!

      --
      "I am the king of the Romans, and am superior to rules of grammar!"
      -Sigismund, Holy Roman Emperor (1368-1437)
    4. Re:Being a Spelling Nazi by Anonymous Coward · · Score: 1, Funny

      >first declension feminine

      Sounds great. You wouldn't have pictures of that?

    5. Re:Being a Spelling Nazi by norman619 · · Score: 1

      DUDE!!! Where were you when they splipped Bling and Phat into the dictionary? You must remain ever vigilant!!!!

    6. Re:Being a Spelling Nazi by xPsi · · Score: 1
      I realize this is how different flavours of languages propagate over the ages, but I'm all in favor of keeping English as unified as possible.

      I agree, but per se is Latin, not English.

      --
      i\hbar\dot{\psi}=\hat{H}\psi
  11. Says who? by antek9 · · Score: 2, Insightful

    I'm sure EA can cut down on development costs like they did for some years by releasing sequel after sequel, not counting spin-offs.

    EA might just be whining because they have to start from somewhere near scratch with a new architecture like the CELL within the PS3 (which unlike the Wii is not just an update of a former system); something that more respectable developers do for any new game that tries to make a new idea become reality.

    EA also has more fixed costs in the licensing department, I guess. It won't be so cheap incorporating all those sports celebrities, real team & player names, car brands and technical specs and what have you. But that's up to their own conceptual decision, crazy as it may be.

    --
    A World in a Grain of Sand / Heaven in a Wild Flower,
    Infinity in the Palm of your Hand / And Eternity in an Hour.
  12. If I want a show... by karrde · · Score: 2, Insightful

    I'll go watch a movie.

    When I pay for gaming entertainment, I want a game, something fun. This is why I bought a Wii. Companys can focus on the fun factor and not have to blow me away with showy graphics.

    1. Re:If I want a show... by xtmno4 · · Score: 2, Insightful
      Agreed.

      A gaming console is a specific computer made for the sole purpose of playing games / enjoying yourself. To that end, they should provide things that a standard PC is not really made to do, which is why I like the Wii. Yes, you can make the Wiimote work on a PC, but no game developer is going to try and market a PC game towards that. By creating one standard and interactive device for gamers to play with, Nintendo has given the Wii a good amount of backing for developers to market to. To that end, I see Nintendo doing well with the Wii.

      Sony and Microsoft have a battle ahead of themselves, with each other. Both offer a system with some online capabilities, and similar game sets. The problem with both is that they don't really offer anything that a standard PC can't offer. People have had USB controllers for a long time, and have played games with them. The only real thing they offer is the online marketplace / community, but that can be somewhat easily done on a PC. What the two companies need to realize is that the 'hardcore' games that take a ton of hours to complete would be best suited for a PC anyway. On a PC you can run Ventrilo, Winamp, AIM, a web-browser, etc, all at the same time you play. That way, you can have you fun in the game, and add whatever else on top of it you want.

      Because they are similar, and in my opinion in trouble, Microsoft and Sony have some work ahead of them. I feel that if Microsoft wants to continue to do well into the future, they would do best to shift to the PC gaming market. They already have an operating system they could work with, it just seems to make sense. I think if they continue as they currently have, they will do alright in the next gen (after 360), but die after that.

      I think Sony will be too stubborn to change gears and will continue to try and push more hardware and expense into a box that people won't find fun. I believe that they might try to make a PS4 eventually, but it will fail miserably.

      If either company tries to mimic Nintendo and make the console more interactive and offer more than a PC can, they will find a hard road. Nintendo already has the marketplace for that. It is much like the iPod and the Zune. The Zune may offer the same things as the iPod, plus a little bit, but it is just too late.

      If game developers would simply make fun and interactive console games for things like the Wii, I think they would see the best success. If you want to develop a blockbuster of a game/movie, it would be best marketed to a PC, because you have a bigger audience, and less proprietary garbage to deal with.

      Sorry to make it so long, but it is hard to show the picture I see with only part of it.

    2. Re:If I want a show... by Omestes · · Score: 1

      You've been hanging out in the local hardware shop / /. too much, the average gamer has clearly stated that they don't want to play games on the PC, for understandable reasons. PC games didn't go into decline because the game developers decided to stop supporting them as much, but because the consumers decided to buy less games for them, and more on the consoles. Welcome to the market. Granted I did enjoy my PC as a gaming platform, and stuck with it through from the NES until about when Doom 3 came out, I don't think it is a good platform for many games anymore. With the 360 or PS3 I can just pop in Oblivion and play, with the PC I must make sure that all my hardware is up-to-date, fix my drivers, etc, then make sure I have enough HD space, free RAM, etc, then go through the long install process, and then play with a layer of bugs caused by odd software interactions. Granted, once it works, it works better than on a console, with better graphics, and IMHO, a better control scheme, but getting it to work is a pain. Personally I gave up my "hardcore" laurels about 2 years ago, I bought a Mac and a Gamecube, and let my PC moulder as a forgotten Linux box. I got sick of fixing things for the sake of gaming, to squeeze out that extra 1 fps, or be able to add a negligible poly to my count. The PC, popularly, also has an image problem, it is seen as geeky, and not some "cool" gaming box, granted this is /., so we don't see this.

      The PC, too, is a generalist, meaning it is rather problematic to actually use for purpose, especially something as intensive as todays games. Consoles are purpose driven, they are just for games. You can see how unequal the fight is. Most PCs out there are also vanilla Dells or Gateways, which are not good gaming boxes, and the average user has no clue how to swap in a decent graphics card (or a clue what makes a card decent), or how to put in enough RAM to even handle Oblivion. There is too much tinkering, and not enough "just works" in the PC world, and while this is not a bad thing in itself, it does sort of harm the idea of PCs being the ascendant gaming boxes you'd like.

      I like the idea of no fuss more and more, the older I get. I used to love sitting around, surrounded by piles of hardware, messing with internals, ini's, and reg hacking, but I find I don't have the time for it anymore. Sticking a disk in my GameCube (or now Wii), and just playing is much easier, quicker, and rewarding.

      --
      A patriot must always be ready to defend his country against his government. -edward abbey
  13. Cost != quality by Grave · · Score: 2, Interesting

    If EA is worried about the cost of game development, then maybe they should start focusing on producing quality games. They are repeatedly getting slammed in reviews with drivel like NBA Live 2007. If they didn't push out another iteration of every franchise each year, development could focus on building a truly blockbuster title, rather than a few updates with each release.

    Ubisoft has thrown their weight behind the Wii, and embraced the much cheaper development costs there. They aren't ignoring the PS3 and 360, but those Wii titles will help cushion their bottom line a bit. EA doesn't seem to have paid as much attention to the Wii when it comes to unique IP.

    1. Re:Cost != quality by Chris+Burke · · Score: 1

      Ubisoft has thrown their weight behind the Wii, and embraced the much cheaper development costs there. They aren't ignoring the PS3 and 360, but those Wii titles will help cushion their bottom line a bit. EA doesn't seem to have paid as much attention to the Wii when it comes to unique IP.

      While I loved some of the last gen's Ubisoft titles (Prince of Persia and Beyond Good and Evil specifically), and I'm certainly happy they are throwing their weight behind Wii in hopes of more like that, I have to say that they're perhaps going a bit too cheap on the development costs. Exhibit A being GT Pro, an extremely shitty-looking GC game that looks like it was first a port from the N64 with Wii support tacked on. Red Steel still looks interesting, but according to the reviews clearly lacks the polish of the best-of-breed Ubisoft games of yesteryear. In the end it looks like Raving Rabbids, the mini-game collection, is the most significant entry into Wii support.

      I'm hoping Ubi will start doing better on the Wii, and that Red Steel is mostly an effect of trying to meet the launch date. But so far, not exactly so great.

      --

      The enemies of Democracy are
  14. Huh? by The+MAZZTer · · Score: 1

    I thought these were the guys who make tweaks to the same games and release new ones every year with a new year number.* That's gotta be the least expensive way to make a new game (unless you go Burger King's route).

    Maybe they're upset about new control schemes by Sony and especially Nintendo causing them to actually have to code something INNOVATIVE.

    * - Yeah, if you can't tell, I'm not a fan of the sports genre... I haven't bought even one sports title, unless you count Tony Hawk.

    1. Re:Huh? by (A)*(B)!0_- · · Score: 1
      "Yeah, if you can't tell, I'm not a fan of the sports genre... I haven't bought even one sports title, unless you count Tony Hawk."
      Then do you think you are really in the best position to make a comment like "make tweaks to the same games and release new ones every year with a new year number."

      I don't play MMORPGs. Because of this, I tend to avoid commenting on how poor the latest expansion pack for a game in a genre I don't enjoy is.

    2. Re:Huh? by The+MAZZTer · · Score: 1

      Well I know enough to know that if I see "Madden 05", "Madden 06" and "Madden 07" on a shelf, it's very likely they're all football games. Sure, 06 probably has a few new features over 05 and the same with 07... but at the core they're all still just the same games.

    3. Re:Huh? by matt328 · · Score: 1

      Regardless if you think he's in a position to make that comment, it still couldn't be more true. I'm not a fan of them either, but even by watching other people play, you can tell there's minimal changes from 06 to 07. As was mentioned earlier, I'd like to see a breakdown of development costs vs. licensing costs. Who do you think EA has to pay more, their developers, or the massive egos of the 'professional' athletes?

      --
      Check out the cave on the east side of lake Hylia. Strange and wonderful things live in it.
    4. Re:Huh? by (A)*(B)!0_- · · Score: 1
      "Well I know enough to know that if I see "Madden 05", "Madden 06" and "Madden 07" on a shelf, it's very likely they're all football games."
      Well, I know enough to know that if I see Final Fantasy I, Final Fantasy II, and Final Fantasy III on a shelf, it's very likely they're all RPGs. Sure, II probably has a few new features over I and the same with III... but at the core they're all still just the same games.

      See, if you have no experience whatsoever with the games other than with what you see on a store shelf, then you should stay silent.

    5. Re:Huh? by Don853 · · Score: 1

      Who do you think EA has to pay more, their developers, or the massive egos of the 'professional' athletes?

      (c) The astute businessmen who run the NFL franchise.

    6. Re:Huh? by matt328 · · Score: 1

      Ah, touché

      --
      Check out the cave on the east side of lake Hylia. Strange and wonderful things live in it.
    7. Re:Huh? by (A)*(B)!0_- · · Score: 1
      "'professional' athletes?"
      They are paid to play the game. They are professionals. There is more than one meaning for the word professional. Your cute little use of quotation marks showed your level of intelligence.
  15. Cost reduction? by The-Bus · · Score: 4, Interesting

    Is there the equivalent of "clip-art" for game studios? If I'm buying a racing game, I don't need to know that the makers personally did the buildings or the trees. Buildings are buildings, trees are trees. In film, there's a lot of specialization that exists: for example, you can buy pre-rendered explosions to put in your movie. A better example might be companies that specialize in making CGI oceans and water. A lot of movies with CGI oceans rely on them to deliver that look.

    Could game companies do something like this? Every game is going to have proprietary assets like the protagonist, specific types of giant robots, monsters, vampires, what have you. But does some of this info get shared even between sub-studios? How many times is AI code re-written? (That may be a bad example, as AI code may or may not be part of the engine). Can we just use the same Enzo Ferrari model in each racing game? Do we really need 7 different companies perfecting how the car looks?

    I don't think this will lead to homogeny in games. If anything, it will free up designers to be more creative and think about the important things in the game (gameplay, control, fun) as opposed to how accurate Scenery Team 3's rendition of this waterfall is.

    --

    Small potatoes make the steak look bigger.

    1. Re:Cost reduction? by cyxxon · · Score: 1

      Yeah, that is what I have always been wondering about as well. But I guess we are geting to this point, for example trees are already done with SpeedTree in a lot of games (Oblivion, NWN2, Unreal 2007?). I also think that some houses should just push this business model onto the market: create e.g. high quality human models or car models, in a generic 3d format, and sell them to studios. Change the head and clothing, and voila - new NPC for your game. Sure, locusts in GoW can't really be sold like that becaus ethey are too specific, but cars, trees, buildings, humans, animals, "everyday" objects like Mp5s for shooters or crossbows for fantasy games - why not?

    2. Re:Cost reduction? by UbuntuDupe · · Score: 1

      I don't think it necessitates homogeneity. If you make these objects highly customizable, it will be easy to make yours different without spending much time on it.

      What I want to see is a generalization of your idea to games as a whole. What if someone made a kind of game toolbox with an easy-to-use interface for adding graphical objects, AI, dialogue, etc? Ditto for CGI movies. Like Red vs Blue with Halo, but make the game centered around making movie scenes rather than have to make do with what's possible in Halo.

      If such a program already exists, please be nice in replying. (And make sure you read the "easy-to-use" part.)

    3. Re:Cost reduction? by EvilIdler · · Score: 1

      Yes, there are content packs you can buy, some even affordable by regular joes making games for fun.

      See Garage Games for a start; there are model and texture packs available for a fistful of dollars.

      Licensees get access to all sorts of neat code, too.

    4. Re:Cost reduction? by Dr.+Eggman · · Score: 1

      I think we're already seeing something like this to a much higher extreme. In the past, game engines have been reused and licenced quite a bit, but now-a-days (especially in the FPS genre) I'm seeing game engines that specifically tout their easy of development for licenced products; like Source, The Doom3 Engine, Unreal Engine 3.0 In the future, I could see all kinds of genre's picking up on this method. I don't really see it as a bad thing, merely an natural outgrowth of the vigorous mod community. Which may explain why the FPS genre, a genre notorious for being very mod friendly, seems to have had the greatest growth in engine licencing.

      --
      Demented But Determined.
    5. Re:Cost reduction? by cliffski · · Score: 1

      There are tehnical reasons why there isn't more of this. Not all rendering engines work the same way, and some are very fussy about how the polygons are arranged, and in what way special extra (no-geometry) data is added, such as placement of sound and particle emmiters, cues for AI, etc etc. Theres's a lot more to a model in a modern game than just static mesh data that can be universally implemented.

      Things are different when you go lower tech. I use nothing but stock sounds and music in my stuff, and I've also bought pre-existing stock photos and pre-renderered artwork on a non-exlcusive basis. Theres a small, but I suspect growing market for assets in the way you describe.
      Check out turbosquid, content paradise, renderosity marketplace, istockphoto, sounddogs etc.

      I think that reusing stock content is only part of the solution, there are some costs in modern games that are totally gratuitous:

      Celebrity voiceovers: Do I care that patrick stuart spoke for the first 5 minutes in oblivion? It did sod all to make it a better game, but no doubt cost a fortune.
      Tutorial voiceovers: Like 99% of gamers, I can READ. I do NOT want a droning voice telling me what the mouse looks like, especially uf I can't turn it off.
      FMV: If you can provide a better visusl look that revenge of the Sith in your cutscenes, go for it. If not, please don't bother, I have the DVD right here for when I want no interaction and cool SFX.
      Intro Videos: A simple white text on black background saying who made the game is fine. don't waste yours and my money of 6 different hi-def movies of your company logos spinning and warpi9ng. Nobody gives a fuck.

      I used to be ambivalent about the rising costs, they dont affect me, and anything that screws up the quagmire of retail dev suits me fine, but theres such a lack of quality games these days (for the PC) that I find myself wishing for a lot more, less expensive PC retail games.

      --
      DRM-free indie games for the PC and Mac: Positech Games
    6. Re:Cost reduction? by Purity+Of+Essence · · Score: 1
      Yes, there is a "clip art" of a sort for games, but it's not art, it's middleware, such as licensed game engines (eg. Renderware), graphics engines (eg. Doom/Quake), physics engines (eg. Havok), and audio engines (eg. Miles). A good, well-documented engine can save you a lot of programming time, but refitting an engine to fit your needs can just as easily drive up production costs. It's a balancing act and many developers feel that crafting their own technology is more flexible and more economical.

      I don't think this will lead to homogeny in games. If anything, it will free up designers to be more creative and think about the important things in the game
      The retail shelf begs to differ.
      --
      +0 Meh
    7. Re:Cost reduction? by The-Bus · · Score: 1

      This isn't really a development tool, but for machinima enthusiasts (that term still irks me), there's Lionhead's The Movies. It starts out as a Rollescoaster Tycoon-esque resource management game and eventually lets you make your own films. Some of these are even shared online.

      I've never used it, so I don't know how easy or difficult it is.

      --

      Small potatoes make the steak look bigger.

    8. Re:Cost reduction? by dyftm · · Score: 1

      Kinda - premade physics and graphics engines are used all the time (such as Havok and Unreal0. There is also SpeedTree. But none of these come cheap.

    9. Re:Cost reduction? by nEoN+nOoDlE · · Score: 1

      the same assets that film studios use are being used all across the board for all CG artists. So yes, you might see a tree in Gran Tourismo that the game artists themselves did not personally make. Bought assets are a tiny fraction of the overall game art that needs to be created for each game. It might be the same Ferrari model, but it's not the same dirt maps and 10 dent variations that are in all the other games, because that's what makes the game look unique. Sure, you might be able to buy a chair for use as scenery in Call of Duty 3, but then you're going to have to retexture it to make it look like it's in a war-time environment, and maybe change the model to make it look broken. It's often cheaper to build a model from scratch than take a pre-built model and fix it so it works within the environment.

      --
      Don't trust a bull's horn, a doberman's tooth, a runaway horse or me.
    10. Re:Cost reduction? by icedcool · · Score: 1

      I was thinking on this in that they could speed up production with intelligent design programs. Imagine an AI connected to a modeling program. A development program that tries to think ahead and help you out based on expected design route (example: your creating a hallway, it sees your drawing straight lines and generates examples you might be trying to create on the right. The problem now is that design takes forever often with people doing menial tasks over and over. I see this as a potential solution. I'm sure it would be complicated as hell, but if well integrated I think it's the future for design.

      --
      Most people aren't thought about after they're gone. "I wonder where Rob got the plutonium" is better than most get.
  16. Spending more by tansey · · Score: 5, Funny

    I think a lot of [other companies] are spending even more money.

    Yeah, but the other companies pay their employees overtime.

  17. How many times do we have to hear it? by LiquidHAL · · Score: 3, Insightful

    Generic comment about how games should be fun and developers "aren't getting it"

  18. Costs like a movie by Fozzyuw · · Score: 1

    This is a bit of a catch 22. It's been a big push since the Atari/NES days to keep improving graphics, which comes at developing more sophisticated machines, which increases development time, which increases the cost of games. Also, as games continue to morph into an interactive story/movie, more time will need to be spent in much the same way it takes time to create film or write a book.

    Of course, I'm putting my money on the Wii for one of these reasons. Given that the actual technological specs aren't as advanced as say the 360 or PS3, I'm hopping that this attracts more developers as development will be easier due to not having to deviate far from the 'norm' and couple that with the new potential to interact with games with the Wii Remote and nunchuk.

    As games continue to expand into story telling, compared to the days of Pac-Man and Space Invaders, the amount of time needed to invest will continue to increase, along with the budget. This will continue to force game investors to 'play it safe' and only invest in sequels or licensed content (Disney Movies, etc). And as a gamer, I'll continue to feel like gaming is chocking on it's own success and be turned off by most content and invest less into it. Perhaps, this is why MMO's are becoming successful and games like Half-Life are moving to episodic content. You're not playing one game, beating it, and then playing the exact same thing 2 years later with better graphics. Instead, you're playing the same game, never loosing the progress you started 2 years ago, and the game just continues to build from where it started.

    Cheers,
    Fozzy

    --
    "The past was erased, the erasure was forgotten, the lie became truth." ~1984 George Orwell
    1. Re:Costs like a movie by Purity+Of+Essence · · Score: 1
      Of course, I'm putting my money on the Wii for one of these reasons. Given that the actual technological specs aren't as advanced as say the 360 or PS3, I'm hopping that this attracts more developers as development will be easier due to not having to deviate far from the 'norm' and couple that with the new potential to interact with games with the Wii Remote and nunchuk.

      I hear ya, and this is Nintendo's entire strategy. They saw the writing on the wall five years ago and made the difficult decision to abandon the horsepower race. And I think it's going to work. Starting next year when the (extremely affordable) Wii development kits become more available and when the Virtual Console is opened up the Wii is going to start looking very attractive to cost-conscious developers.
      --
      +0 Meh
  19. Some Groundbreaking EA games by Aaron+Bredon · · Score: 1

    You must never have played these games then:
    Archon - 1983
    M.U.L.E. - 1983
    The Bard's Tale - 1985
    Starflight - 1986
    among others

    Although EA later became a 'cookie cutter' publisher/distributor,
    it started out as a very innovative company that helped many
    good independent designers publish their software.

    1. Re:Some Groundbreaking EA games by Chibi+Merrow · · Score: 3, Insightful

      Well since the Grandparent first referred to EA as a developer first, I think it might be interesting to look at your examples...

      Archon - Free Fall Associates
      M.U.L.E - Ozark_Softscape
      The Bard's Tale - Interplay
      Starflight - Binary Systems

      Notice a pattern? Not a single one of those games was developed by EA. EA just distributed it. That would be like giving RCA credit for Elvis Presley's singing. Which was the grandparent's point, as far as developers go they're not looking to be innovative or original. They're aiming squarely at the frat boy market. And there's nothing wrong with that. Just don't come back and cry to us later about how tough the market you're in is.

      The fact they've published some other people's work that was innovative really doesn't make up for their Cronus like approach to the studios they work with in recent years...

      --
      Maxim: People cannot follow directions.
      Increases in truth directly with the length of time spent explaining them
    2. Re:Some Groundbreaking EA games by MemoryDragon · · Score: 1

      EA in the early days did not develop themselves, they basically gave the implementors the full name rights, because their first approach was the popstar model. The game designer/implementor was supposed to become a popstar. If they had the rooms and machines for development I did not know. But the boundary between publisher and development studio was not really there back then, it was fluid, because development studio used to be exactly one person in most cases so EA might also have had those people employed like a normal development house.

      Anyway the examples of what you metioned was the early EA times, and yes back then EAs output was amazing you just could buy anything from EA and you could be sure it was something never done before. The publishing of names of the designers, was EAs business model. Get the best people and make them Rockstars of gaming.

      Anyway the turning point happened sometime in the late eighties I guess, when they dropped the rockstar model (due to bigger getting teams) and finding out about annual sports sequals being cash cows with minimal effort.

      Since then they rely on sequels or film licenses with already existing game mechanics and gobbeling up excellent development houses and running them into the ground while exploiting their franchises.

  20. A show? by Azureflare · · Score: 1

    It's a lot of money, so you need to give him a show, and we're just here to deliver the show.

    Well, no wonder it costs so much. EA has the complete wrong idea of what a game should be. I don't want a show, If I wanted that I could turn on my TV and choose from a gazillion shows. I play a game to have fun. Just make fun games instead of throwing millions of dollars at a franchise knowing enough gamers will buy it because it's the next iteration.

    I'm not holding my breath though. The day EA tries to just make something fun rather than generating eyecandy demos I will be amazed.
  21. A theory I've had for a while by solidh2o · · Score: 4, Interesting

    I've dabbled in game development a little, but I could never take the plunge and do it full time. Something about being able to go home and see my family every night and being able to go to sleep without so much eye strain that I have a migraine.

    But I do have a theory about the games industry...

    Let's forget about all the hype of next generation blah blah blah. Look at the differences between game generations. Between SNES and PSX, between PSX and PS2/Xbox, etc. The graphical jump has been undeniably great. Now we're getting closer and closer to reall life. And it's taking longer and longer to make games more realistic. But here's the catch: in 5-10 years, that will probably go the other direction, making it easier ot make really good looking games. Think about the advances in 3D Modeling in the last 10 years. I worked with Max and Maya when they were both in infancy and I'm blown away at hte ease of some of the things that you can do now. How long is it goig to be before it just CAN'T look any better that what you have? I can't see any reason why within 5 years you won't be able to tell the difference between the real world and a game.

    My theory is that in no more then 10 years, making something look like real life will be easy enough that it won't take a team of people with art degrees to do it. That's what the industry demands, and that's what's driving the technology. Soon you should be able to pick from a library of cars and buildings and people that can interact and get destroyed in a realistic fasion and will be pluggable into any environment. People will start whole businesses providing content like this and it will bring costs down for everyone for once LOL

    Anyway, maybe it's the ramblings of a madman, but maybe there's a little hint of the future there. :)

    I'm gonna go back to coding my own Final Fantasy VI clone now :)

    -Jason

    1. Re:A theory I've had for a while by phorm · · Score: 2, Interesting

      I'm gonna go back to coding my own Final Fantasy VI clone

      Got it posted anywhere? :-)

      If you think that commercial renderers are amazing, what I've found is that the free software world is even more-so. For example, projects such as Blender and Cinelerra are amazing in their capabilities. Even with such software as the GIMP you can do rather wicked things.

      Now stepping into the arena of game creation, I'm becoming increasingly impressed with projects such as OGRE 3d, which unfortunately lacks somewhat in samples/documentation (it's a little hard to get started as the documentation IMHO starts off in a little after the starting line), but otherwise is very powerful and seems to a very good building-block for big things.

    2. Re:A theory I've had for a while by Chris+Burke · · Score: 1

      I can't see any reason why within 5 years you won't be able to tell the difference between the real world and a game.

      How's this for a reason: Toy Story was released in 1995, and while it looked great it didn't come close to looking like the real world -- in fact, it made it blatantly clear just how far computer rendering was from making a believable human being. Today's gaming hardware couldn't possibly render Toy Story in real-time, and probably won't be able to in five years either. Five more years of development in the film industry brought us Final Fantasy, which still was quite distinguishable from the real world. We still don't have Toy Story, so how long do you think it will be until an affordable home console can render Final Fantasy in real time?

      Graphics are getting better and better, and I certainly think there's a point where it is "good enough" to create a wide variety of great-looking and stylish games -- honestly, I wish more games focused on "style" over "realism" in as much as they are exclusive. Yet there is a vast, vast gulf between what we are capable of today and "indistinguishable from real life".

      --

      The enemies of Democracy are
  22. Hmmm... I wonder if buying up all the rights... by Assmasher · · Score: 4, Insightful

    ...to the leagues, team names, and players EVERY YEAR so that nobody else can use the player's actual name or the team's name in their games is maybe one of the reasons their games cost so much? Hmmmm? ;)

    --
    Loading...
  23. I develop games as a hobby by PIPBoy3000 · · Score: 4, Interesting

    I worked for several years on mods for Neverwinter Nights, getting my games on some magazine DVDs, winning awards, and so on. The graphics were not the best aspect, even when released, but it was fun to play and it made for an interesting hobby.

    For the last couple years, I've been planning a campaign for the sequel. Neverwinter Nights 2 has far better graphics and tremendous flexibility when it comes to designing areas. Such advances have a cost, however. File sizes are much larger, area creation can take ten times as long, and creating custom models is much more complicated.

    Don't get me wrong - I love the new features and style. Improved graphics can make for a better gaming experience and a greater emotional impact for players. As with all things, though, there are trade-offs. I suspect we'll see more divisions between the "fun, simple, and cheap" games like Bejeweled versus the big budget games like Gears of War. There will be audiences for both.

    1. Re:I develop games as a hobby by wildwood · · Score: 1

      Can I just say, your NWN modules are probably about the best I've ever played, and far more compelling than any of the official content. Playing Demon with a character I'd built up through Dreamcatcher and Shadowlords, and reaching that moment near the end of the game when everything was restored, was a more moving experience than I would ever have expected from a game.

      I'm glad you're making more.

      </fanboy>

      --
      normal(adj)- people who don't sit on slashdot all day wondering why everyone else isn't building robots [DECS]
  24. People do make bad choices, and dev's follow. by Tei · · Score: 1

    Imagine a smart hot blondie. What will you notice first? she is smart of he is blondie? Of course, you will notice first the hot factor. And that also work for Code and Games. Even If some engine is smart, you will notice first and next how Hot and Blondie is.
    Theres even some very very smart blondies out here that are angry because not one notice how smart are, and people only notice how blondie is.
    EA is right here. People do make bad choices, and dev's follow.

    --

    -Woof woof woof!

    1. Re:People do make bad choices, and dev's follow. by Chibi+Merrow · · Score: 1

      But I don't like blondes...

      --
      Maxim: People cannot follow directions.
      Increases in truth directly with the length of time spent explaining them
  25. Cost factor is the same old same old... by __aaclcg7560 · · Score: 5, Informative
    After working in the video game industry for six years at Accolade/Infogrames/Atari (same company), developing games are more expensive because the same mistakes are made every time.
    • Unrealistic schedules: A marketing dweeb decides when a game should be released without taking into consideration the developer's experience level, console manufacturing requirements, and whether enough QA will be available to adequately test the title. As a lead QA tester, I routinely add two months to the schedule and my time estimates are usually 90% correct.
    • Bonus Structure: The producer's bonus is tied to the unrealistic schedule and a lot of decisions are made to compromises the game so the producer can get his bonus. As a lead QA tester, I was routinely accused of denying a producer his "hard earned" bonus.
    • Unrestrained QA Overtime: If a game is not properly scheduled and managed, a tremendous amount of QA overtime will go into trying to save the game and, almost always, is shipped regardless of the final quality. As a lead QA tester, I worked 28 days straight on my last project because the schedule was cut by one-third and I was not notified until half-way through the project.
    I'm not holding my breath that the video game industry will one day figure out that there's a saner method for developing a video game that doesn't blow the schedule and the budget like a bad lunch at Taco Bell.
    1. Re:Cost factor is the same old same old... by Maxo-Texas · · Score: 1

      The incentives were bad for a while.

      Programmers were viewed as exempt and so those unrealistic schedules allowed the companies to force unpaid overtime on to them.

      I highly value our QA team. They save us from putting hideous bugs into production all the time.

      OTH. I manage relations between them and programmers all the time. They can develop a "GOTCHA" attitude that is irritating. And programmers can become defensive when valid bugs are found in their code. You constantly have to sell "QA is your friend!"

      In the end- if the bonus is only a couple grand- you have to ask yourself, is it worth being miserable for that little money? DO the math. Ask yourself what the hourly rate is.

      And remember- a MINOR early failure can be very effective in managing your manager's expectations. They really have no clue how productive you are so they will just keep piling on. They can't tell from your complaints- whiners and slackers complain too (while loafing hours a day).

      --
      She was like chocolate when she drank... semi-sweet at first and then increasingly bitter.
  26. It is EA because of licensing. by kinglink · · Score: 1

    I don't know if anyone knows the exact figures (as such I can't give them away) but EA pays multi million dollars contracts for licensing. The Godfather license they KNEW they were never going to make back (it's so large you wouldn't believe it) yet they bought it any way. They are the Sony/microsoft of game development, so caught up in the war and the fighting that they just dig themselves into holes they can't get out of.

    The Madden franchise will save them of course, and be well worth all the money they drop on it, but the superman franchise, the Godfather franchise, and the rest are just screwing themselves over and over. EA has one goal, to license good franchises and make games out of them, and in that respect they do excellent work... Notice I don't say they make good games, or support the franchise, because really, they don't.

    EA does spend a lot of money on game development, but that doesn't mean they are doing it right, or like everyone. The correct (at least according to companies I've talked to) development cycle is one enormous budget game, which allows you to correctly tailor an engine to your genre, and then a couple other games that uses that engine. You don't reuse an engine 50 times, but you don't throw away all the work that you do. EA knows this, but developing a new game like Superman or Godfather will always be expensive because they don't enter that with an engine in place, if you're going to have to rewrite your engine for every game you do, you're not being smart about it.

    1. Re:It is EA because of licensing. by Maltheus · · Score: 1

      The irony is that I won't even buy a game based on a movie because I know all the money went into the license, instead of the game. I also know that they must be working with artificial schedules in order to sync up with the movie opening date. For every person they bring into the fold by being associated with a "hot" property, I figure they're driving at least one away.

    2. Re:It is EA because of licensing. by kinglink · · Score: 1

      The funnier thing is they realized this and with the Superman game it wasn't in production until AFTER the movie came out. Basically the time from the movie to the game was the total time in "actual production" so basically they solved that problem and ended up screwing themselves in the end.

  27. So? by Svartalf · · Score: 4, Funny

    English follows other languages down dark alleys, knocks them over, and goes rifling through their pockets looking for loose grammar.

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
    1. Re:So? by Lord+Ender · · Score: 1

      At least our tables and chairs don't have genders.

      --
      A slashdotter who didn't build his own computer is like a Jedi who didn't build his own lightsaber.
    2. Re:So? by Xiroth · · Score: 2, Informative

      Attribution: James Nicoll.

  28. You beat me to this by cyclomedia · · Score: 1

    What i find interesting is that a lot of games attempt to take place in real environments, take a racing game, such as the MSR/PGR series. there must be a lot of money spent on, for example, sending a bunch of people to New york to accuratley map the area around central park and take a gerzillion GPS readings and photos in the process before physical in-game modelling exists. throw in Nurburgring, germany. Edinburgh, scotland. Sydney, australia and you can see where the money is going.

    Now, not every game can use the PGR style environ in the same way, take a skating game for example, whilst others may need more free roaming aspects, such as the Driver series. But i can imagine that there's money to be made licensing (possibly exclusively, forcing you to start over from scratch with each new licensee) slices of real-world-modelled ctyscapes/sports-venues at a MAX_POLYCOUNT of the client's choosing.

    Unlike modelling a ferrari enzo i doubt you'd need to pass on these fees to another body, unless places start cottoning on, wasnt the whole reason a bunch of 80s films were filmed in montreal instead of NYC because it looked kinda the same but cost $$$ less?

    --
    If you don't risk failure you don't risk success.
  29. Yeah... by Svartalf · · Score: 1

    They have things like that- and for about every thing imaginable. Engines. Models. Textures. Music.

    The biggest problem with all of this stuff is that it tends to make things cookie-cutter unless you're grabbing
    things like trees, mood music, or sound effects from them. It shortens the cycle at least some- but, depending
    on the game, it makes it seem cheap if you get carried away with the use of off the shelf content. But, they
    COULD be using the stuff a little more, I think, without causing problems with everything. But the biggest
    expense isn't in the production of trees, buildings, etc. It's in being enamored with this or that new fad
    in coding or insisting upon this or that when it's obvious that what you're flogging isn't going to work.

    Each and every one of these studios seems to be interested in "lessening" the amount of work they do- but in
    the end, most of the places end up shooting themselves in the foot badly on that. They end up putting more
    effort into the game because of those "labor saving" techniques.

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
  30. Cry me a wiiver by cybrthng · · Score: 4, Interesting

    This article has absolutely nothing to do with the Wii. Madden for the wii is still madden and people are obsessed over it graphically just as much as the other consoles and it wasn't like it was cheaper to produce the wii version than the other versions.

    The simple truth of the matter is developers need to make games. That is all. Some people like wii games, some people don't. The wii is a new product in nintendos linup and i'm sure it will do good but it isn't the be all end all that people preach around here.

    I like my graphics, i don't mind some cutscenes as games are sometimes stories that need some telling as well. You can preach the wii all you want, but the wii is a console, not a game.

    The real problem with the media market in general (not just games) is public companies having to increase there bottom line as if we are just a product consumer. Most gamers don't play games because we need to, but because we want to and if EA doesn't make games we want to play it won't matter which console they prefer to support, how much money they dump into or whos name they get on it.. It will still suck.

    EA is like the motor giants of detroit, they had some good linups but thought Americans would buy crap just because of name alone. Forget quality, forget character, forget slick design, feedback and personality. Its about profit. It costs money to make money and if you don't like that, then leave. Maybe EA needs some new management, someone who understands what a gamer feels when he/she is in the passion of the moment.

    I like the small shops because they do one thing and do it well. Epic turns out one hit after another because they stick to what they're good at and they sell the technology to others so they can build what they're good at as well.

    The problem with EA is they're a company who believes that buying up markets creates demand and that is where they will fail. You don't own me EA and thus i don't own anything from you.

    1. Re:Cry me a wiiver by PhysSurfer · · Score: 1

      "Madden for the wii is still madden and people are obsessed over it graphically just as much as the other consoles and it wasn't like it was cheaper to produce the wii version than the other versions."

      Riiiighht. How do you know this? I'd like to see you back this up with a link to a budget, at the very least. I don't work at EA, but it stands to reason that the Wii version would be cheaper to develop, because high definition graphics and artwork don't need to be designed.

      That's one of the reasons Nintendo's business model is so good for this generation. The Wii will be cheaper to develop for, and therefor more profitable for developers (assuming a lot of people get Wii's). The Wii will foster innovation not only through it's new control scheme, but also through the fact that it will be a less risky platform on which to test unproven ideas.

  31. Heh... by Svartalf · · Score: 1

    Latin it might have come from, but it's been absorbed into the English language...

    We've got bits of French, Latin, Spanish, Italian, and a horde of other languages intermixed in there. To say it's not English when it's in common usage instead of just used in specific circles is being a pedant about it. :-)

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
  32. Cutting Costs? by FrostyCoolSlug · · Score: 1

    I dunno, if cost of creating a game is 'Crazy', is that why there are so many bugs? I mean, it's not like EA don't currently make billions of dollars selling games, but the games all feel half-complete, or are full of critical bugs. Do they push out games early to drop some of the cost? Or do they just not bother hiring QA guys to, again, reduce the cost? Either way, they can get away with it because people continue to buy.

    It's one thing to say 'We have (to pay for) NHL licensing' it's another to use it to ship out a piece of crap and 'fix it later'.

  33. Dude! by Anonymous Coward · · Score: 1, Funny

    It has Gandalf!

    And that guy from Pirates of the Carribbean! What was his name? Oh yeah, Legolas!

  34. Pack of lies by DMorritt · · Score: 1

    Geometry Wars Evolved is still the best game on the 360. Tetris was always the best game on the GB ... Neither appear to have had or needed big budgets, big budgets are just needed to justify all the over paid management that need to focus on the stupid little things and tell each other it was awesome (and already be planning the sequel before the original is released).

  35. Bigger budget != better game by pitc · · Score: 2, Interesting

    Introversion just released it's third hit in a row (Defcon) and their games are better than most of the high-budget ones I've tried.

    --
    aoeu
    1. Re:Bigger budget != better game by AusIV · · Score: 1
      My favorite game of all times is probably Legends of Zelda, A Link to the Past. While I don't know how much it cost to produce back in the early 90's (and reproduce for Gameboy a couple years ago), its mechanics are simple enough that I could probably crank out a similar engine in a month (two weeks if I didn't do anything else) - then the rest is developing maps and a storyline.

      Game developers (and many gamers) seem to think that the only way to improve a game system is to remake the same games with better graphics and more realistic physics. While those can make some games interesting, I'd much rather see a game with a simple engine and an elaborate plot than a game with an elaborate engine and normal plot.

  36. EA's best Game? by [000000] · · Score: 1
    Best game for the PC from EA games in the past 5 years "Medal of Honor" (Allied Assault) with the expantion packs (SPEARHEAD) AND (BREAKTHROUGH). Nothing fancy, quite an old game as far as Games go now.

    Just check out how many Medal of Honor servers and players are online.

    Pacific Assault was crap and wouldnt run on my PC even though it was above min spec. The game time was very different from the other "Medal of Honor" as a result I will not buy anymore EA games, games.

  37. Well Lets See Here by moore.dustin · · Score: 1
    Most of what everyone here says is true, but we neglecting something about EA. First, the people that buy EA games are what we would call the general public, which is a market far far larger than are market, being elitist hardcore gamers. While we may know more about this and that, when it comes to EA, they care about the vote that it attached to every dollar people have to spend. At the end of the day, they are making money hand over fist. We may say they barely innovate at all with "Madden" just getting an upgrade every iteration year, but that matters to us. To the other, larger, and more important market, they could care less. They play "Madden" and they are going to buy it again, every year, regardless of promised upgrades.

    EA is a huge corporation that makes a ton of making making/publishing/distributing games. As per any large organization, the little man is going to get the shaft. They employ a great deal of people and generally speaking, you know, or should know, what you are getting yourself into with an entry level job there. If you do not like, go look elsewhere. EA surely wronged and still does wrong its employees, but when hardcore gamers get a job at EA in hopes of breaking into the gaming industry they are disappointed with what they see. Justified or not, EA is certainly not the only large corporation who undervalues and mistreats there low level employees. What EA does have going for it is that is a recognizable name that will attract 10 people for a position that vacates because the previous person was pissed at their employer, EA.

  38. Re:Cry me a river...all the way to the bank! by ubuwalker31 · · Score: 5, Informative

    Check out http://finance.google.com/finance?q=ERTS and look at EA's financials. This is the real scandal here. They brought in about $3 Billion, yes, Billion with a B, dollars in 2006. $3,000,000,000. That is a cool pile of cash. And then they spent just under half of that to make their product. Thats a lot of dough!

  39. Three letters: XNA by notaprguy · · Score: 1

    While MSFT's XNA initiative is still in early stages they're starting to deliver stuff that could help address the high cost of video game development. Right now the platforms and tools for game development are complex and immature. The goal of XNA is to provide a framework and toolset that will greatly speed development and...ultimately...provide a common framework for video games across both XBOX and Playstation. They have a tool available now for hobbyhists but I think they're eventually planning on releasing a toolset for professional developers. Some details are at http://msdn.microsoft.com/directx/XNA/default.aspx .

    1. Re:Three letters: XNA by Coopjust · · Score: 1

      XNA is not going to provide a uniform platform for other systems. The idea is that the game developer will make more money with a larger market to sell to with minimal effort. In return, games get developed for the Xbox 360 and Windows. Lock in, so MS sells Xboxes and copies of Windows.

    2. Re:Three letters: XNA by VGPowerlord · · Score: 1

      That's PC as in Personal Computer, not PS as in PlayStation.

      --
      GLaDOS for President 2016! "Well here we are again. It's always such a pleasure." -- GLaDOS, 2011
  40. OMG I can't believe they are complaining!! by fury88 · · Score: 1

    I used to work right across the street from EA Tiberon here in Florida and I know a couple of "former" EA developers. How can they complain when they pay their developers SHIT!! I had a recruiter call me up and offer me an interview there and I laughed at the salary!! It was like 50k less than what I make as a consultant! Even for FT standards it was a joke. C'mon EA! What costs do you have to deal with?

  41. Re:Hmmm... I wonder if buying up all the rights... by British · · Score: 1

    I thought the crazy costs for EA was changing their sports title year from $CURRENTYEAR to + $CURRENTYEAR+1, adding a few players to the database, changing the box graphic, and sending 'er out.

    That must be an expensive graphic design company they have for their box covers. You know, going into the text edit tool changing a digit and all that. //sarcasm.

  42. not really by OrangeTide · · Score: 1

    Galactic Civilization 2 does not compete with the sorts of games EA puts out. The graphics are relatively simplistic and sparse. And the game is extremely technical. Now if you can handle GC2 then it is a fantastically fun game, but it's not a mainstream game by any means.

    other high quality and innovated indy games:
    Uplink
    Darwinia
    DEFCON

    --
    “Common sense is not so common.” — Voltaire
    1. Re:not really by nuzak · · Score: 1

      Darwinia was anything but innovative, but was in fact a hugely DULL isometric "shooter" that fails even to be an interesting RTS. Worst value for twenty bucks I've ever spent on a video game -- I should have gotten the demo.

      Defcon's pretty nice, though it's practically a Flash game.

      --
      Done with slashdot, done with nerds, getting a life.
    2. Re:not really by OrangeTide · · Score: 1

      A lot of people really enjoyed Darwinia. Everyone was heavily encourages to try the free demo, because the game was not really for everyone. I'm sorry you didn't take advantage of demo, the guys who made the game certainly did everything in their power to get you to try before you buy.

      --
      “Common sense is not so common.” — Voltaire
  43. sony fanboys off the port bow! by drinkypoo · · Score: 1

    man the moderation cannons!

    --
    "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
  44. EA Costs by eclectro · · Score: 1

    Is it the cost of whips to flog the employees with rising or is it the cost of the slave drivers to keep them in their place that's rising?

    --
    Take the cheese to sickbay, the doctor should see it as soon as possible - B'Elanna Torres, "Learning Curve"
  45. Profits are crazy too... by AlXtreme · · Score: 1
    The net income of EA is pretty crazy too. $236M. Revenue of nearly $3B.

    <Burns-mode>Excellent...</Burns-mode>

    I'd say game _prices_ are crazy.

    --
    This sig is intentionally left blank
  46. Here's a nutty idea: invest in fun not licenses by tenzig_112 · · Score: 4, Insightful

    The gentleman from EA is right to blame consumers for the cost problem. We like to buy expensive-looking games even if they turn out to be not all that fun. Game design has taken a back seat to shelf appeal, and we've done it to ourselves. Meanwhile, high profile games are becoming less and less fun to play. How many FPS games do we really need? You might as well slap a "100% recycled content" sticker on every game sold in the US.

    How much money does it actually cost to develop a fun game? Contrast that with costs of licensing movie characters or (worse) putting your entire production staff on the task of reworking animations for yet another Madden sequel. I'd argue that the real cost here is risk. Rather than assemble a number of small teams to make a bizarre game that could turn into a franchise, EA opts (more and more often) to play it safe by spending scads of cash on a sure thing.

    Then again, maybe he's pining for the old days when he could order up a cash cow sequel much cheaper.

    Either way, the next time you throw down your controler in dusgust at that $50 worth of deja vu you just purchased, we have only ourselves to blame.

    1. Re:Here's a nutty idea: invest in fun not licenses by Maltheus · · Score: 1

      The gentleman from EA is right to blame consumers for the cost problem. We like to buy expensive-looking games even if they turn out to be not all that fun. Game design has taken a back seat to shelf appeal, and we've done it to ourselves.

      Speak for yourself pal. Whenever I or any of my friends hear about some new fancy graphics a game is going to have, that's when we start realizing that the game play is gonna suck. It seems like you're on the verge of learning a lesson that most serious gamers understand implicitly. Good game play and the latest eye-candy almost never go hand in hand and I certainly don't consider myself to blame for it. That blame lies squarely with the marketing types as it does in all areas of software development.

    2. Re:Here's a nutty idea: invest in fun not licenses by VGPowerlord · · Score: 1

      Spore is being developed by Maxis, an EA-owned company.

      --
      GLaDOS for President 2016! "Well here we are again. It's always such a pleasure." -- GLaDOS, 2011
    3. Re:Here's a nutty idea: invest in fun not licenses by MemoryDragon · · Score: 1

      Actually Will Wright currently has sort of a special status by EA. EA wanted to ax his development the Sims, because it neither fit into any genre nor was it a sequel to something existing. (About the genre, they probably did not know the people simulation games of the mid eighties like LCP) Anyway Wright managed to have the game published despite the internal objections within the EA management and it developed into one of the biggest long running cash cows of EA ever. After that Will Wrigt probably for now has the status to do everything what he wants to do without anyone within the EA management saying one word of critic.

    4. Re:Here's a nutty idea: invest in fun not licenses by Professor+G · · Score: 1

      Why does every FPS continue to do the same thing with only minor modifications?

      Because there are a lot of people who "have fun" by being good at something, and if they pick up a FPS they know they will be able to master it pretty quickly. Afterall they've played it plenty of times before. It's like bullies picking on nerds... they want an easy target.

    5. Re:Here's a nutty idea: invest in fun not licenses by Fengpost · · Score: 1

      Agreed, instead paying loads of money on the movie right or NFL/NBA/NHL. The game company with their own franchise can take control of their own destiny and keep cost down. Just look at Zelda, Doom, and Civilization. All you need is good game play. However, the game developer would not have anyone to blame if game bombs.

      --
      The purpose of writing is to inflate weak ideas, obscure poor reasoning, and inhibit clarity....Calvin
    6. Re:Here's a nutty idea: invest in fun not licenses by stewbacca · · Score: 1
      The very successful line of Papyrus NASCAR racing games was run out of town by EA, because Papyrus couldn't afford the NASCAR licenses. EA has been dumping crap "racing" games on us ever since. The problem with this scenario is Papryus grew to be a leading simulation company that happened to make two great games based on simulation (Nascar and Grand Prix Legends). GPL is pretty much still the Gold Standard for racing simulation, even if it is ridiculously difficult. EA took the opposite approach: make a "simulation" that is so unrealistic, even your average brain-dead overweight teen-aged gamer can play for hours. Oh, and hey, look at all the authentic NASCAR sponsors! Whoopdy friggin' doo.

      I don't blame EA for pandering to the middle of the road hobbyist though. It is just too bad that their might has taken away options for the more serious enthusiast auto-sim crowd. I wonder why most of us still play Grand Prix Legends? The game is obviously graphically underpowered, since it was made 8 years ago (even though it is one of the most heavily modded games I've ever seen). Eye-candy is not important when you are sliding a 1960s era Foruma 1 car around the Nurburgring at 190 mph. I've played EA games that have had the Nurburgring ported into it, and let's just say there is about as much realism involved with EA games as there is realism in Donkey Kong.

  47. Re:Declare peace by BubbleDragon · · Score: 2, Interesting

    I wouldn't, for sure. I just wish that XBox and Playstation games didn't focus on online multiplayer over splitscreen multiplayer. An expanded multiplayer world is the most important aspect of buying a game for me, and I hate Halo. God, those games are so freaking slow, not to mention that the multiplayer world isn't nearly as customizable as some older FPS games I remember (*cough* Goldeneye/Perfect Dark). Even PD-Zero isn't as robust as the original. I want challenges. Coop play. And every aspect of multiplayer battles to be customizable from bot strength, numbers, team size, weapons, maps, game style. And I want it to not freak out when the "random weapons" happens to set smoke bombs as the starting weapon, and bots set them off all over the map. Ooops. So if that means backing off of graphics? Do it. Oh well. Guess I'll stick with my 4 games that actually provide customizable playability and multiplayer challenges. Also? Hey Nintendo - please give me a "traditional characters" game with multiplayer, and I don't mean MarioKart, Party, or anything like that.

  48. ea sucks by crabpeople · · Score: 5, Interesting
    Everyone who doesn't have a negative opinion of EA doesnt know jack about games. They buy other companies, then throw out half cocked sequals that suck balls. They can't even get a good 2d UI right! Two examples. First, BF2. BF1942 was probably the best game released when it came out. It had everything, huge maps, all sorts of vehicles, it was revolutionary. Then out came the free Desert Combat mod, which improved it even further. Than DUM DUM DUM.. ea baught dice. The next game, much promise, was BF2. I baught this game from a store for about $60. It was shite. The ingame server browser didnt work, there were loads of unskippable cutscenes at the begining, and the forced GaySpy integration took forever to get working right. They even made you pay for more "advanced" weaponry, so if you wanted to be as good as otherpeople you had to pay again. Then, if you actually made it into the game, the maps were smaller than bf1942, more buggy, and the graphics didnt even scale properly. This past fall they released a new expansion intitled bf2142. They didnt even bother to fix all the problems in bf2, and I am willing to bet that bf2142 is just bf2 with some new shit tacked on.

    Another example is C&C generals. Command and Conquer was one of the oldest and best RTS games out there. Red Alert was crazy intelligent and well rounded. Then you got generals. That buggy piece of shit, with the crappiest (still years after release) netcode and a myrad of design changes and bugs. They totally broke the whole c&c franchise by developing a whole new story for the universe. That game should not even be called c&c. Here is an excerpt from the wikipedia entry:

    "There is also a glitch/cheat in the online play called the "SCUD bug" which allows the player of the GLA army to automatically reload their SCUD launcher shortly after it is fired. Many fans demanded Electronic Arts to fix this glitch so that online players wouldn't be given the opportunity to cheat so easily. But EA didn't respond to this call."

    I mean how fucking apathetic do you have to be to not even bother fixing MAJOR exploits in the game?

    EA is simply the worst about not fixing bugs. It seems as if they have a memory of 1 year. If a game is passed one year release, its time to either a) tack on an expansion b) make a sequel or c) bargain bin it and stop all development.

    Like I am having trouble believing that you are not some sort of shill for EA. They ruined so many good games. UO is another one, where they decided just realeasing new art every year or so and charging an extra $59.99 for it was a valid way to "improve" the game. Simcity too. The graphics on simcity 4000 are SO BUGGY, that I had to hunt around and try multiple point realeases of nvidia video drivers before I wouldnt get crazy random graphics corruption happening in that game. They had some good ideas with the whole multiple cities on a continent theme, but If I cant see it because of graphics bugs then wtf good is it?? This is also on multiple machines with both ATI and NVIDIA cards. You can get it running if you find the exact magic combination of drivers and details/resolutions but come on! EA is a huge company! Maybe thats why they make such shit now, too much beurocracy, not enough risk taking.

    I just remembered one last thing I absolutely hate about ea's business practices. Every time I logged into BF2, I would get an ad for some other stupid EA game or bf2 pay for mod. Showing ads to me in a game that I have PURCHASED is crossing the line.

    Now thats 4 games, and I didnt actually play the games you mentioned. Seems like alot of people (usually on consoles so what do they know?) forgive them for various UI bugs that I would consider unacceptable in a gold game. I don't play sports games but I have heard them roundly condemed by everyone who does. Fuck EA. They took their slogan too literally and "challenged" good gameplay, exsisting franchises and good quality code. From what I have read about the practices at that company re developers, I am not surprised in the slightest that they produce the most buggy unplayable games I have ever tried to play.

    --
    I'll just use my special getting high powers one more time...
    1. Re:ea sucks by east+coast · · Score: 2, Insightful

      Everyone who doesn't have a negative opinion of EA doesnt know jack about games.

      Like I am having trouble believing that you are not some sort of shill for EA.

      I didnt actually play the games you mentioned.

      Thanks for the input. I can tell this is a fairly insightful set of remarks... You never played the games I mention but you know they have to suck (and I do to) simply because they're from EA? Fantastic. BTW: I never played most of the games you mentioned either, but I know enough to hold my tongue about making broad statements about an entire company because I like a few of their products. I did play the demo for BF2 and found it to be only moderately entertaining. I never had any of the problems you describe, but it was only a demo.

      I don't play sports games but I have heard them roundly condemed by everyone who does.

      Yeah, I hear this about Maden all the time... That's how it manages to remain one of the biggest selling game titles of all time, because the same people ("everyone" according to you) who hates the game buys it when the new year's version comes out. Again, I've never played the game.

      Thanks for the rant and the insults.

      --
      Dedicated Cthulhu Cultist since 4523 BC.
    2. Re:ea sucks by Endo13 · · Score: 1

      Unfortunately I don't have mod points, but fortunately someone else did. You're absolutely right about EA and I couldn't agree more. I've played their games from every genre they publish games in, and virtually every game they've released in the last 10 years. To me this is quite sad, and EA wasn't always this way. They used to be pretty good. But in the late '90s it seems they got derailed, and have continuously gotten worse since.

      --
      There is no -1 Disagree mod. Slashdot.org/faq defines mod options. USE IT.
    3. Re:ea sucks by NetFu · · Score: 1

      You may be right about the games you are talking about. I've honestly never heard of them, either.

      But he's right that EA sucks AND destroys good game franchises. A few games that you say are wonderful gems doesn't change that.

      Life isn't a cartoon where good and evil are black and white, for God's sake.

      Overall, assuming you are right about those games being completely wonderful games, I'd still say EA sucks. If nothing else because they've f*cked up all the games that I love that the original "ea sucks" poster mentioned.

      I did love Command and Conquer, but it was flushed down the toilet on EA's watch.

      I did and still love BF1942, bought BF2, and bought BF2142. I still go back and play BF1942, often with the Forgotten Hope mod. BF2 gameplay never came close to the fun of BF1942, for a lot of reasons. I played it for a week or two. BF2142 is about the same, but a little better. It still didn't last more than a few days in playability before I went back to other games.

      BF1942 had lots of patches up to 1.62. But it NEVER crashed repeatedly out of the box and with patches. BF2 and BF2142 both did. I couldn't really explain to my kids a week or two ago why BF2142 kept crashing, although less often after I installed the patch they released the day after I bought it. BF2142 still crashes in the middle of joining ALL multiplayer games. More reasons EA sucks.

      So, say what you want to attack or defend EA. All I can say is I just wish they would LEAVE OTHER GAME COMPANIES ALONE UNTIL THEY GET THEIR DEVELOPMENT SHIT TOGETHER!

    4. Re:ea sucks by east+coast · · Score: 1

      So, say what you want to attack or defend EA.

      Actually, I neither defended nor attacked anything except for being told that I didn't know jack about games because I enjoy a couple of EA titles and I did support EA in their right to earn a buck.

      I made no comments on EA as an employer. I made no claim that EA produces gold everytime. I never said that this is black and white.

      Maybe I wouldn't have to take the time to recount and defend my original point if the other poster hadn't started his entire statement with "Everyone who doesn't have a negative opinion of EA doesnt know jack about games." And then went on to state that he never even played the titles that I feel are good from EA.

      Both of you are acting like I'm a fanboi and frankly if you're going to do that I'd like for you to back that up with something.

      If I turned my back on every company that I feel has screwed up a game franchise I was into I don't think I'd be a gamer at all at this point. The only exception to this I can even begin to think of is Valve and I know what kind of warm reception they get around here too.

      And consider too that sometimes a game is good for what it is and shouldn't be pushed into sequel after sequel ad nauseum because eventually they're going to produce a bad product. Does this mean the one bad product makes the other products suck? No.

      Does EA's business practices suck? Probably. I'm not that involved with them or their products. But my original intention was never to question EA as a business outside of the fact that they need to produce a product that can make them a profit, which many fringe games simply don't make large inroads. That was the entire point of my post.

      --
      Dedicated Cthulhu Cultist since 4523 BC.
    5. Re:ea sucks by gatesvp · · Score: 1

      Yeah, I hear this about Maden all the time... That's how it manages to remain one of the biggest selling game titles of all time...

      Actually, I think this may have something to do with the fact that they produce the only licensed NFL game. Here's a neat link comparing top games sales for 2004. Notice how Madden is #3 but NFL 2K5 is both #4 and #10 (PS2 and X-Box), of course, that year they "bought out the competition" and then you get numbers like these, where, lo and behold, Madden is now undeniably on top (#1, #4) and they've snuck in with #5: NCAA Football.

      Truth is, it seems to me that there is just a big market for american football games. EA didn't really win any major "competition" here, they just bought off the NFL player's union in the very year they seemed to be slipping. Good market strategy, but I definitely won't attribute their sales numbers to game quality. Truth is, Madden is probably just "good enough". There are lots of football fanatics who just want "a game" and Madden meets that criteria.

    6. Re:ea sucks by IKnwThePiecesFt · · Score: 1

      Firstly, 2142 is a sequel, not expansion to BF2. Not a huge deal, but the fact that it is standalone is a difference to me. Second, how can you say that EA just rehashes everything and then in the same post bitch that they changed Command and Conquer into a completely different game? Also, I don't know if you ever played Starcraft online, but Battle.net is loaded with advertisements. There are plenty of reasons to hate EA, it's hardly necessary to have invalid ones.

    7. Re:ea sucks by TwoBit · · Score: 1

      Those graphics glitches you refer to are due to a bug in the video card drivers. And they aren't easy at all to work around. I know because I personally wrote much of the SC4000 graphics engine. These video card companies are much more reponsive to bug fixing if your company's name is "Id" or "Valve". We found during development, in fact, that everything we did graphics-wise which was just like what Quake or Unreal did happened to work fine. But if we did anything kinds of graphics operations which those games didn't do then we had about a 50% chance of the driver functionality being broken. I am not kidding.

    8. Re:ea sucks by Skythe · · Score: 1

      Red Alert was crazy intelligent and well rounded

      Well Rounded? Did we play the same game because as i recall pretty much the only way to go online was a telsa coil/tank combo or a tank rush, or some variant of the two.

      Lets hope EA can bring back some of the magic with CNC3, they took some steps back from the westwood approach in generals, but now they're taking some more steps forward again such as the return of fmv videos, the token CNC sidebar, etc.

  49. Re:Hmmm... I wonder if buying up all the rights... by Assmasher · · Score: 1

    Well, I hear that just remembering how to build their source base takes weeks... ;)

    --
    Loading...
  50. Deliver the show... by dcs · · Score: 1

    Now, if they would just actually deliver anything worthwhile...

    It's kinda funny when he mentions the development budget, as EA spends more on marketing and franchise royalties than they spend on actual game development, testing and art.

    --
    (8-DCS)
  51. EA is CRAZY by DragonTHC · · Score: 1

    what costs more? hiring all the NFL superstars to do MOCAP for the next EA sports 2007 title?
    or investing in some great animators and hiring talented MOCAP actors for innovative games?
    EA, we stopped buying your franchises a long time ago. You are wasting your money on them.
    If you produce just 5 great innovative and fresh new titles a year and skip all the franchise crap, you'll see your profits increase.
    game sequels should be spaced out so far as to include dramatic technical and visual enhancements.

    --
    They're using their grammar skills there.
  52. Yeah, but my game cost only 500 dollars to develop by bryanbrunton · · Score: 2, Interesting

    I recently developed a web-based version of the board game Risk.  Let's tally up the final costs:

    Programming             zero
    Project management      zero
    Graphic artist          zero
    Advertising             zero
    Publishing              500.00 (this is how much is cost to rent the web server)

    Total                   500.00

    You can play it here:  www.denizengames.com

    And yes the above does mean that my time for this project was free.

  53. Finally by SnapperHead · · Score: 1

    Maybe the gaming companies will relize what the movie companies haven't. As the budget keeps getting higher and higher, its time to make sure you release a quailty product. Something people will not only enjoy once, but enjoy time after time for long periods.

    With higher budgets, I know they are gonna try to charge more. But, they damn better make sure its worth it. I own a PS3 (not off eBay) and I find it quite worth it. The games at $60 are well worth it. But, if they try to charge more it might not be worth it. Why ? Well, $60+ for only a few hours of entertainment isn't worth it. Not to mention the $600 for the console. Some games these days are playable for like 4 hours, then you beat them. Games are also far too easy now. Hell, I played a few games recently that on hard mode I could play in my sleep. Hard should be that, HARD.

    Gaming companies (EA is the worst at it) enjoy craming recycled crap down peoples throats all year around. Oh lookie! The newest Maden with slightly better graphics and same game play!

    --
    until (succeed) try { again(); }
  54. Alain, stop it. by startled · · Score: 1

    When asked whether he'd agree that it's larger companies like EA which are driving bigger game budgets, Tascan replied, "I think a lot of [other companies] are spending even more money."

    EA's Godfather cost well over $20 million for a primarily current-gen title, and he wants to blame the other companies?

    Alain Tascan also claimed Gears of War had zero innovation, completely ignoring the active reload, and the best implementation of a cover system in games to date. How did he make such a mistake? According to him, he never played Gears of War, so that might have something to do with it.

    Why would Tascan make such ridiculous comments? Why would Ken Kutaragi make them? It's great gaming press, and it gets people to focus on your company and your games. EA needs someone to spout off occasionally (Sony's doing okay). But here's a question for Tascan: how well did that work out for Kutaragi?

  55. next $100,000 by peter303 · · Score: 1

    Royalties to Parker Brothers $50,000
    Lawyer to defend against PB IP suit $50,000
    Damages on top of royalties ??????


    Just joking.

  56. This is part of the cycle... by RoloDMonkey · · Score: 1

    This is part of the cycle you see all the time in movie production. Budgets get bigger and bigger, quality generally decreases, and everyone cries. Then some college student makes the next "Blair Witch" for basically nothing, and everyone is talking about "independents" and "experiments." Big studios will buy the successful small studios and promise to let them stay the same, or the big studio will create an "independent" division. A few years later, that division will be subsumed by the corporate mono-culture, and the whole cycle will start again. We have already seen this with games like "Alien Homonid".

    Before you go off, let me be clear. Not all low-budget games and movies are cool, and there is definitely a place for big budgets. For every "Clerks" there is "The Matrix", and for every "Custer's Last Stand" there is a "Disney Sports: Basketball".

    --
    Long live the Speaker Bracelet
    Rolo D. Monkey
  57. Who cares what EA thinks? by Dr.+Cogent · · Score: 1

    Stop buying EA games. EA games are bad for gaming. They are abusing microtransactions on the 360 big time. They need to be hit where it hurts. Stop buying EA games.

  58. EA raising prices. by MaWeiTao · · Score: 1

    I see this as a prelude to EA stating they're going to raise prices on their games to cover the "crazy" cost of development.

  59. More advice than I should give EA for free... by Snappy+(the+Gamer) · · Score: 1
    "...you have to promise him enough entertainment for him to put his hand in his pocket and buy the game."

    No, that's what companies without a long-running track record of incompetence and evil need to promise me. EA needs to promise me not only this, but additionally convince me that they're not going to:
    • Tout the game's immersion and realism, yet conveniently omit central aspects of said illusion just to achieve a "more accessible" ESRB rating in the hopes of increasing sales. (a la the "award-winning", "critically-acclaimed" MoH series' blood-free WWII combat.)
    • Release the otherwise-pretty-cool game with at least one fatal exploitability that essentially kills all hope for reasonably fair multiplayer (a la Command & Conquer Generals mp disconnect exploit)
    • Ignore patching of said game (now that you have all our money!) for "more imporatant" taking-over-the-world oriented-tasks (like suspending patch development to prepare a bunch of hype for E3 (ironically, for another game that is most likely going to have the same lifecycle of weaknesses...))
    • Release an expansion pack for said game that introduces yet more unfairly exploitable bugs (a la Command & Conquer Generals Zero Hour expansion pack multiple tech centers "feature")
    • Abandon patching of said expansion pack even with said critical exploitable bug (and plenty not-so-critical but equally annoying ones) still alive. (EA Suit: "We patch expansion packs? This must end!")
    • Include "nifty" features that ultimately wind up meaningless because they ignore the fine details of sensible implementation. (a la BF2's logic-challenged stat tracking system, which singlehandedly doused my desire to purchase the game, even after I was hooked on the demo for a couple weeks.)
    • So-obviously respond to industry, media, and management-induced pressures yielding mediocrity in design, just so the suits, clueless industry media, and fanboys won't say stuff like "These Other Games are X. Why isn't This Game X?" (a la LOTR BFME II. I mean... if you're just going to worship everyone else's 5-year-old standards, then I guess I don't really need to buy it...)
    • Release the game with limited content so it can be held back for more (theoretically) profit-generating expansion packs. (a la Sims I and to a greater extent II)
    • Spend a bunch of money on trivialities that don't actually improve the gameplay ("a-list" talent for voiceovers and cinematics, big-brand content licensing, etc.) meanwhile pitching that "challenge everything" bs.
    • Continue treating their technical staff* so poorly that I continue to hear about it often, even in non-gaming, non-industry contexts, while simultaneously managing to climb to the top of the industry on said staff's dried-up carcasses. (*who, for the record, do show real -- if restrained -- talent)
    • (and last, but definitely not least, as it all-at-once symbolizes EA's dismissal of the "customer first" tenet): Continue making the stupid EA Games brand splash screen un-skippable, as though loyal customers respond positively to having their time wasted, as though some sort of long-ago-deserved reverence is still in order, or as though any yet-to-be-EA-enfranchised spectator might actually get to view it over my shoulder without also being subject to a brief-but-obligatory "Why EA is evil" speech.
    To summarize: 20 years ago, EA set a (if not "The") standard of excellence for computer games. Their brand alone signaled "BUY THIS GAME!" Sadly, nowadays, their brand signals "AVOID IF POSSIBLE!"

    Surely that is a most significant "cost", and one that must be eliminated ASAP. But, again, this is more advice than I usually give away for free. My consultancy is available starting 2Q of 2007, with or without snarkiness.
  60. Developing games doesn't cost an arm and a leg by wikinerd · · Score: 1

    Instead of spending millions on hi-res video and Hollywood-like productions, hire a good games hacker and motivate them to write the next Tetris or Chess game. Good games are simple, without rich graphics (so that your imagination can work), but with lots of gameplay. You may spend $1000 in developing the next Tetris and earn millions as people start downloading it on their smartphones to play something during rush hour traffic.

    1. Re:Developing games doesn't cost an arm and a leg by wikinerd · · Score: 1

      And, by the way, I study towards an MSc in Management and what we learn at graduate business school is that the most important asset of a business is its people.

      Keep the workers motivated and happy, and they will do anything possible to help you succeed. It isn't difficult: On top of a base salary with excellent health insurance, add:

      • on-the-spot bonuses ("finish the documentation tomorrow and you'll get $100 immediately")
      • profit-sharing ("in addition to your guaranteed salary you get 0.5% of the company's profits whenever we make a profit")
      • teleworking (telecommuting) arrangements ("you can work from home or anywhere else") while still providing a good working environment for those who need it ("if you have noisy kids at home, you may like to know that the company can hire you your own office room near your home and help you decorate it and build an ergonomic environment where you will enjoy working without distractions")
      • asynchronous working ("you can work at any time you want, night or day, just make sure you commit your code by the deadline")
      • an MBO (Management by Objectives) culture ("to get paid you need to finish this specific task. You can work as much or as little as you want, in any way you want, as long as you finish this task on time and within the agreed quality levels")
      • and frequent feedback (lack of feedback builds a culture of constant fear, while what companies should say is "John, I didn't like your past month's performance, and your code sometimes doesn't meet our quality guidelines, can you please tell me what your difficulties are and under what circumstances you could work a bit harder?" or "Hillary, the company is proud to work with you and we would like to let you know that if you keep producing so good art you will get a raise within 6 months" or "Juan, unfortunately we won't be able to keep you on the payroll next year if you don't improve your performance within 3 months by doing X, Y, and Z. Please tell us how we could help you in achieving your targets or whether you feel you were hired in the wrong position, and what your ideal working situation would be").

      Focus on motivating people. Treat them as humans and respect them, and they will become your friends.

      What many businesses currently do is suicidal and results in demotivated employees who hate going to work (which is, by definition, illogical: I sincerely believe that most humans, not everyone certainly but it must be most of them, enjoy working and having activities in life. Some like to work even without monetary gain, like in volunteering and free software development, and most people feel good when they do something useful for society and get recognition from peers and friends).

      The employer-employee relationship could be more human-to-human relation and not like the master-slave mentality that still exists in many companies today (as a direct, albeit somewhat modernised and relaxed, descendant of slavery and serfdom).

      In fact, today the average employee is a slave, with slavery often extending beyond their working hours (just think of the last unreasonable employment contract you had to decline or were forced to sign out of real need), and many business owners believing that employees are something like furniture and can be owned. In reality, although in theory we live in enlightened capitalist societies were every talented person can succeed and live in harmony with others in a free market, companies are behaving internally as if they were communist states with the owner and the managers as members of an evil communist party. True capitalism and free market doesn't exist yet, just like true freedom is lightyears away from our present societies.

    2. Re:Developing games doesn't cost an arm and a leg by 55555 · · Score: 1

      It's unfortunate that you chose "Juan" as the name of the worker to be fired whereas the two others where "white" names.

    3. Re:Developing games doesn't cost an arm and a leg by wikinerd · · Score: 1

      You read things that I never said or thought. The names were totally random.

  61. That's funny.... by AhNewBis · · Score: 1

    I don't think Introversion has had that problem, and DEFCON is more fun than a lot of EA games out there.

  62. "Crazy" Says EA by krisamico · · Score: 1

    They buy the whole of the NFL, NHL, or whatever else they've bought out the licenses to... Then they complain about how much it costs to make a game. According to the article, it's big teams that drive the cost up. I have a hard time believing that engineering costs even hold a candle to what it takes to keep competitors from putting your John Elways and Wayne Gretzkys into a game. That the quotes in the article would come from an EA GM sounds ludicrous to me. I don't even play EA games anymore unless it is unavoidable. If they keep buying the World, it soon will be.

  63. I'm looking to break in as a game developer... by AmazingRuss · · Score: 2, Insightful

    ...and as such am fairly desperate for that first job. However, because of their reputation as a sweatship, EA is not somebody I'd want to work for.
    I can't see why any hotshot developer would work for them, either.

    Other outfits may be sweatshops, too, but EA is a known sweatshop.

  64. Re:Yeah, but my game cost only 500 dollars to deve by heinousjay · · Score: 1

    Your time is never free, it just means you had no one to charge for it.

    If you really think it was free, just try to get more of it.

    --
    Slashdot - where whining about luck is the new way to make the world you want.
  65. Why do they still spend so much on the graphics? by iteyoidar · · Score: 1

    I see games like The Sims, Grand Theft Auto, that sports thing on the Wii, Super Smash Brothers, Warcraft 3, Diablo 2, DDR, all of those Dragon Ball games(that sell tons of copies for some reason). But there are still so many games where it seems that a huge amount of effort has been put into the video engine. Do many people really buy games because they have bump mapping or HDR or whatever? Does it make such a huge difference to the large casual audience who buy one or two games a year or buy based off franchise names? It seems like a lot of effort is put into the video engines. Sometimes it still doesn't look good because there apparently weren't any actual artists on the team(all of the strangely shiny and bumpmapped objects in Perfect Dark 0, Everquest 2 in general..). And then, high power engines require more work to avoid making a game that truly looks *bad*(not just from a technological standpoint). Nobody will notice the lack of a state-of-the-art fractal tree generator, or low resolution textures, in Paper Mario. It makes even less sense to me on the PC. Games like FEAR and Oblivion(maybe Oblivion can be excused because it was built for the Xbox 360). Do the people who make these games realize that even among PC gamers, most will not be able to run them without upgrading their computer? And if most people do try to run them, they'll look like crap and might even crash, which isn't going to make the game look very good for whoever bought it and doesn't know why it won't work right. Its like selling console games that require $200 peripherals to run correctly(a few of these have been made, I'm sure). I guess they could be assuming that in another 2-3 years, the average PC owner will be able to run the games, but by then unless it was really successful(taking us back to the original problem) the game will be off the shelves and in the bargain bins. Maybe someone who knows more about the game industry can explain.

  66. Why spend so much money on graphics engine? by iteyoidar · · Score: 1
    I see games like The Sims, Grand Theft Auto, that sports thing on the Wii, Super Smash Brothers, Warcraft 3, Diablo 2, DDR, all of those Dragon Ball games(that sell tons of copies for some reason).

    But there are still so many games where it seems that a huge amount of effort has been put into the video engine. Do many people really buy games because they have bump mapping or HDR or whatever? Does it make such a huge difference to the large casual audience who buy one or two games a year or buy based off franchise names?

    It seems like a lot of effort is put into the video engines. Sometimes it still doesn't look good because there apparently weren't any actual artists on the team(all of the strangely shiny and bumpmapped objects in Perfect Dark 0, Everquest 2 in general..). And then, high power engines require more work to avoid making a game that truly looks *bad*(not just from a technological standpoint). Nobody will notice the lack of a state-of-the-art fractal tree generator, or low resolution textures, in Paper Mario.

    It makes even less sense to me on the PC. Games like FEAR and Oblivion(maybe Oblivion can be excused because it was built for the Xbox 360). Do the people who make these games realize that even among PC gamers, most will not be able to run them without upgrading their computer? And if most people do try to run them, they'll look like crap and might even crash, which isn't going to make the game look very good for whoever bought it and doesn't know why it won't work right. Its like selling console games that require $200 peripherals to run correctly(a few of these have been made, I'm sure).

    I guess they could be assuming that in another 2-3 years, the average PC owner will be able to run the games, but by then unless it was really successful(taking us back to the original problem) the game will be off the shelves and in the bargain bins.

    Maybe someone who knows more about the game industry can explain.

    [sorry, I forgot that the bold tag wasn't the line break tag]

  67. Why is the cost of gaming so high? by DrXym · · Score: 1

    PC have demanded the graphics, processor, content performance of a 360 or a PS3 for years now AND the games sell for less for retail AND the games are pirated more. What exactly makes consoles with built-in copy protections and higher price points so crazy expensive?

  68. Concurrent programming by gwyrdd+benyw · · Score: 1
    it's just completely different from writing for a single core and requires programmers to think in ways that they never had to with single core programming.
    I'll second that. You can read more about concurrent programming (and why it is vital to learn it) in Herb Sutter's excellent article, "The Free Lunch is Over".
    (doh, reposted due to URL mangling)
    --

    I adblock all animated gifs.
    Blessed be the prime numbered slashdotters
  69. I'm not quite sure if this is quite on-topic by goldcd · · Score: 1

    but I had a bit of a revelation today.
    I've always loved games. I used to be a poor child, then a poor student, then I was starting out in the world - and now finally I can afford pretty much whatever I want.
    Gears of War. Looks great. Great reviews. It's £50.
    I think we've passed my breaking point - I'm simply not going to pay that much for any game - I could, but that's £50 for a 'game' I'll probably just never finish
    I don't care how much it cost to develop. I don't care how much gameplay I'll get out of it (actually I prefer shorter games as I don't have the time to play anything longer and my flat is littered with abandoned games and consoles as it is).
    I don't even think it's so much the £50 - it's the entire industry desire to make everything bigger, longer and more expensive. I mean we all like pretty stuff, but pretty doesn't have to be expensive. I enjoyed spending an hour or so playing the first Sam and Max episode. I think Rez and Flow are wonderful. You don't need to hammer every last cycle out of the CPU and have offices full of artists to make a great looking game.
    I think to summarize the entire industry has completely lost their way. Very few projects aim to offer what people want - more what the industry thinks they want (which is the last thing, but prettier with yet more bells and whistles).
    DS should have been a wakeup call, but I'm not entirely sure everybody got it (Nintendo included). People want good, simple, fun games. DS isn't great because of the touch screen or the microphone, or the two screens (why why small ones is better than one large one is beyond me, apart from preventing mindless eye-candy) - it's THE GAMES. The Wii has come along as the saviour of the hardcore gamer, but that's just crap. Technically it's a Gamecube+ with a motion sensor - absolutely no reason why the motion sensor couldn't just have been a fun peripheral like an EyeToy, GH guitar etc. The Wii is purely a marketing tool to knock out a console with a high profit on it from the start. Doesn't mean there won't be any good games, but it's mere existence means nothing.
    I'll trundle off to bed now, but I'm not happy.

  70. bounding boxes by badspyro · · Score: 2, Interesting
    I am a games development student, and have actually talked to one of the main developers for EA, and a lot of the development DOES NOT go on graphics.

    It goes on things like:

    bounding boxes (the way the characters hit each other and what parts actually collide) - in the first EA NFL game, the players were one big bounding box - 6 sides, collisions even if you were hitting thin air, whereas now they are FAR more complicated

    AI - This is a massive money pit at the moment, especially in sports games, where each player MUST interact with their team in a way that THE REAL PLAYER would (otherwise there are complaints - and no, I'm not joking), never mind the replayability of these games by the teams using different strategies

    Physics - although you may not think it, you put a LOT of importance on physics, such as if a car starts sinking into the ground, or how a ball bounces on the ground. That can cost MILLIONS to develop.

    other games - for every 3 games that are produced, only one comes out to retail, even if they were part of a series (such as dungeon keeper 3)

    Market Research - a lot of money goes into making sure the game is what the market want, and although we sigh at ANOTHER NHL game, it sells BIG

    cross continent development - although this technically should be in the market research area, I think it deserves an area on its own. This is the development of a game to suit different cultures, where there are many different stereotypes and links for different objects (i.e. certain flowers mean death in some cultures), and as once happened to Ford in Greece, if you call a car a turd, its not going to sell very well

    Grass roots Development - helping people like me get INTO the industry and learn about the software, such as sponsorships through Uni and giving us access to software (which can cost thousands)

    Marketing - this can account for a lot of money (in some cases around a third of a games total cost)

    Initial testing - this stops REALLY stupid bugs existing in games (unlike in certain OS')
    Patching - although this comes a looooong way after the game comes out, there needs to be money for the later patching and development of a game (World Of Warcraft costs $3mill each YEAR to develop further- and that's just the main game without the add on packs!)

    so, if you think the games developments company's only think about the graphics, think again!

    Thanks, Badspyro

    1. Re:bounding boxes by dank+zappingly · · Score: 1

      Badspyro, while your comments certainly make a ton of sense for almost every game developer, when it comes to EA I don't buy any of these arguments. Before Madden bought the exclusive NFL contract, Sega was releasing their NFL games for 20 bucks brand new. They were the same quality as the Maddens. The reason for this is that they don't change that much from year to year. Sure it might cost a bunch of money to "bound the boxes" but how much money is it going to cost to slightly improve those box boundaries on Madden 2007? AI- same thing, if it worked last year, it shouldn't cost a fortune to improve it a bit. Physics- same deal here, sure they improve, but the physics were pretty nice last year, and I don't know how much of a difference there is this year. Other games- If I had to guess, I would say that EA probably puts out 10 different versions of Madden. PS2, Xbox, Xbox 360, Wii, PS3, PSP, DS, PC, maybe gamecube,cellphone, i don't know, the point is a ton of recycling is going on here. If squaresoft can profit from a gigantic, original game that only comes out on a few systems, I don't see why EA can't profit off one of the bestselling games in US that has absolutely no competition, that they just have to touch up every year.

    2. Re:bounding boxes by Fred_A · · Score: 1
      cross continent development - although this technically should be in the market research area, I think it deserves an area on its own. This is the development of a game to suit different cultures,
      In the area of US football (which Madden appears to be a simulation of), that study is quickly done. I doubt there are many sales outside of the US. :)
      --

      May contain traces of nut.
      Made from the freshest electrons.
    3. Re:bounding boxes by badspyro · · Score: 1

      I'm sory to say, Madden is sold here in large numbers, and is popular in many other countrys due to the american influence through TV.

    4. Re:bounding boxes by malsdavis · · Score: 1

      I don't think it is even sold in Europe!

      I remember seeing a tatty Madden 2002 box sit on the 'discounted' shelf at a local games shop. Not sure if it ever sold but it was on the shelf for like 3 years. Neadless to say, on my way home from work today I stopped by the store and Madden was no where to be seen (I live in the U.K.).

  71. easy solution by It's+a+thing · · Score: 1
    Jeremie Belpois:
    Return to the past now!
    (Return to 2D games.)
    --
    Staring at a white background [on a computer screen] while you read is like staring at a light bulb — Maddox
  72. Re:Yeah, but my game cost only 500 dollars to deve by feepness · · Score: 1

    Programming zero Project management zero Graphic artist zero Advertising zero Publishing 500.00 (this is how much is cost to rent the web server)

    Stealing a well established decades old game design?

    Priceless.

  73. If a product isn't profitable, don't make it. by dank+zappingly · · Score: 1

    These guys need to stop crying. No one is twisting their arm and making them create flashy new games. There are plenty of platforms out there that don't cost a ton of money to develop for. I think that they get pissed when new consoles come out because they actually have to put some money into improving madden.

  74. Re:EA is getting boring for this Generation- by Xman73x · · Score: 1

    EA used to Rule-But now-They only care about one thing and thats wheres the money And The Hip Hop Generation silly games?..Zzzzz Also This subject is in no manner of trashing the sports games or people who like that kinda of music--->.But in opinion its kinda getting disappointing!..No Sequels to the games that I used to like! More instince Freedom Fighters 2?,SSX-4?..A War Military game perhaps?..Or bring back there oldschool games from the dead! lol...Does anyone remember Immortal? 1991.1992-93--Mutant League Brutal Sports Hockey and Football..RoadRash- Oh yeah those games were actually fun to play back in the day..LMAO!..Now there mostly concentrating on Who has to best graphics?..What I'd like to ask Eletronic Arts is now who has the Best Replay Value and Play Control!..lol-.

  75. Devil's advocate by AceJohnny · · Score: 1

    I'm going to go on a limb and play devil's advocate here. No, that has nothing to do with Devil May Cry, you may leave now.

    Let's say you're a game company. Which word do you think is most important here: "game", or "company"? If you said "game", you should return to Utopia, the Real World will only hurt you more.

    The primary goal of such entities such as EA is to make cash. Their secondary goal, by which they achieve their primary goal, is to make games. Think about that.

    To make cash through games, their games have to sell well. They have to be popular, in the most primitive sense of the word.

    How do you make popular? You either have a well-known brand that will instantly ring a bell in Joe Sixpack's cranium ("Madden" *bing!* You do realize that the Madden series sells really well, right?). That's easily marketable, and MBA-types know this well because it works. Otherwise, you can focus on raw, untested fun. Marketing of fun? I'll come back to that.

    Guess which one goes best on a billboard or a TV commercial? If you said "fun", didn't I just tell you to return to Utopia?

    People won't believe "fun" on a billboard, but they could believe "fun" from their friends. Marketing of "fun" is by word and mouth, and that one's really unreliable.

    By the way, do you know this really fun game called BreakQuest?

    Sadly, this rhetoric is true only because there is no straight link between the vague concept of "quality" and sales. There is, however, a link between "marketing" and sales. I celebrate companies such as Blizzard that concentrate on quality (yes.), but I have no illusions regarding the games industry's economics.

    --
    Misleading titles? Inflammatory blurbs? Keep in mind that Slashdot is a tabloid.
  76. pft! by namco · · Score: 1

    Companies like EA just amaze me with comments like this. What does EA expect? It goes around buying out companies to get the biggest share in the games market and wonders why costs are so high! This is what you get when you go down the corporate greed route.

    This is the reason why I like the smaller companies like Ubisoft they have the corporate balls to take a risk and develop at a quality level with a descent time scale.

    There was also another comment here regarding "marketing dweebs" which shows yet another example of fat cat companies squeezing the gaming market for quick cash at the expense of the comsumer market.

    What's next? Outsourcing to India?? And please don't say that'd never happen especially with these companies that want to make a quick buck, with low cost, with their deluded visions of "at a better quality of service", I should know, I work for one of these types of company!

  77. Ah, so that's who first said that... by Svartalf · · Score: 1

    Wow, post long enough in /. and you will occasionally learn something new. (Honestly so!)

    I, honestly, never knew whom put the concept to words- I just see it and hear it from time to time. And, yes, I think it fits- and I'd posted my rendition for the humor value.

    --
    I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas