Has Free Software Saved Any Schools?
morcego asks: "I think
everyone remembers the case of PCs
for Kids, the Australian group that donates computers for the
poor children, when Microsoft asked them lots of money for the software
on the computers they donated. I am trying to convince schools to start
using free software, and I have heard arguments like 'all free software
initiatives in public schools around the world have failed.' I know this
is not true, but I need cases to show them. So, do you know of any school
(public or not), or other educational institution that has been saved from
paying large amounts of money (and closing its doors) by free
software?" For those interested in this topic, you'll probably
want to read up on the latest salvo in the Microsoft
private
antitrust settlement. It sounds like education, and Open Source, may
now have an official relationship, and things are now getting kicked
into high gear. While it's good to hear about the "SchoolForge" coalition
(no relation to SourceForge or
NewsForge), what educational resources
are currently available to schools from the Open Source arena?
the school district has a nack for wasting money on dumb stuff. Especially Micro$haft products.
schools that have a lot of money to pay an overpriced, uncommunicative geek for stuff they could have done themselves.
It's used in Albion, WI. Redhat on older Gateway hardware. It sits right along side of the Win95 and Mac boxen. I'm pretty sure they're going to be installing it on the rest of the x86 boxen.
--- Think of it as evolution in action ---
In Soviet Russia you dant have to put up with these crappy jokes
How about "source code"?
you should check out OpenSourceSchools. it's a great site that focuses on Open Source in the education system
"The ones who dont do anything are always the ones who try to pull you down" -- Henry Rollins
I think it would be interesting to hear what schools in other countries have done about this. Not because I doubt that American schools have done it, but because it would show how universal an Open Source solution could be.
Wealth is the product of man's capacity to think. -Ayn Rand
One thing working in your favor, ironicly enough, is Windows Product Activation. The more difficult it is to use bootleg commercial software, the easier it is to see the value of free stuff.
A couple guys I know of started an organization called the OSEF, or Open Source Education Foundation. They basically assemble machines and networks from spare parts, go out to a school and install the gear, free of charge. I know of at least one school they've helped, in downtown Tucson. About a dozen machines remotely administrated from a central server in the back room. Google for them, you might find a link or two.
Bowie J. Poag
Think about it for a second. There are three elements of the equation here: Hardware, Software, and Operations. If we are talking about computers to be used by a school, then first you have to have the boxes, then you have to have something to run on the boxes, and then you have to have somebody who knows how to make it all work. Of the three, the last is probably the biggest expense, and certainly the one that you aren't going to get for free. Even if its just a tech savvy teacher who maintains the things, its going to take a lot of his time to do so... time taken away from his primary job of teaching the kids. QED, it has a cost.
We're using RedHat 7.1 to host webpages here, which has saved quite a bit against the cost of a copy of W2k Pro. Also, if we weren't running Linux, our aging IBM server (60 MHZ, 64 MB of ram) would need to be replaced.
In addition to that, we use Linux in our Cisco networking academies classroom because we can't get any of the software we would need under NT (no doubt it exists, but it would be hard to find, possibly expensive, and likely non-standard). We can use the free FTP, TFTP, and HTTP servers on paticularly ancient PCs(one of our more powerful machines is a 75 Mhz machine with two gigs of SCSI drive!) without the hassles of running Windows (windows will now reboot...).
There was a plan a few years ago to turn the ancient machines on the network into X clients, for which they would be quick, but they are now sluggish W2K machines.
It's been a long time.
I work as a pc/network technician in a school district with about 3000 students in Texas. Basically all of our pc's run the standard with 98/office 2000. I have however convinced my boss to let me put up a slackware server that we use for hosting a few of our web pages and may start doing some routing for our district. Anyway, I have wanted to try to get something like this going on here, but everyone is so stuck to using -only- office 2k that they would refuse to switch to an open source alternative. If anyone has any suggestions on what I could do to maybe get things going here, please let me know. I would love to get away from paying outrageous win/office license fees.
Here at Westminster College, Salt Lake City Utah, we have a dozen-or-so-computer lab where every computer is running linux. I'm not quite sure, but I'm pretty sure that it is also the only non-classroom computer lab on campus. No there are not any classes that teach/use linux, but there is a horde of geeks that are every bit as useful as the teachers.
><));>
the University of Sofia is using Linux as the primary operating system in most of the computer rooms to teach students Operating Systems and to handle the internal info. they also use NT workstations for Java and C/C++ education (for C they use Borland C/C++ 3.5 but i really think they must move on to GCC)
so, it looks like this:
-Linux for advanced students and general management
-NT for beginners
I didn't look at all the results, but there appear to be at least two specific cases in the top three...
Stuyvesant uses Linux for their shell machines, mail servers, web proxies and DNS servers. They also use Linux for a majorityof their lab computers. Many desktops still use Windows, but until office comes out for Linux, things will probably stay that way.
-sirket
This article on OpenSourceSchools.org relates how Australia's Northern Territory has just completed an installation of state- wide network infrastructure in all schools that is based on Linux LAN servers and makes wide use of open source software. I was very impressed with their accomplishment. They use SquirrelMail (PHP) for the mail, and the network infrastructure is Linux. The desktops are all Win 98 but they do include StarOffice as the productivity app so would save some more cash there.
My experience over the last 3 months of OpenSourceSchools.org is that while a complete takeover of Linux in schools is unlikely, there are many places where costly licensing can be replaces with OS equivalents to great savings.
At DTU (Danish Techical University) we run several different kinds of operating systems, but mostly solaris. We also have a linux databar and a small windows databar. By running solaris we can easilly install free programs made for linux and other unix clones. The largest databar runs solaris and has about 400 dumb terminals. Everything works fine! I should mention the we do buy commercial software when it's needed, but most of the software is free. Hope that's enough success for you :)
several case studdies
sik
This movement is gaining ground. Here's a ton of sites:
Start with Why Use Open Source Software In Schools to answer your (and your superior's!) questions. Note that Microsoft is trying to keep a stranglehold on this and their salesmen are playing dirty; but we as free software activists have one thing they can not have: integrity. Teach the truth about Open Source, explain that this is the true American way, show how we need to use it in education to teach kids the right way to do things (and to share with neighbors) to make a productive world, and we'll go at it. Academia can't afford to lose itself in proprietary software; as this site explains, with free software we've got a chance for a blossoming in academia.
The K12 Linux in Schools Project
A good example is St. John's School in the UK (attention, USA education boards!)
Open Source and Education tells you how to do it, what you need to know.
Linux in Higher Education: Open Source, Open Minds, Social Justice is an important article in Linux Journal about this.
K12 Linux Terminal Server Project for Schools is just one of the things you can do.
K-12 Linux, another good site about this.
A good technical primer on Linux in Education
If you use free software in schools you will also need free documentation and training materials. Here is a list of the best of it.
(Pls mod this up guys, I'm posting anon...)
However, I think it would be wrong to try to foist Free Software upon unwitting schools before they knew what they were getting into. There is a very important reason that Linux has stayed at about .25% of desktop market share: it makes a crappy end-user desktop. Sure, you can use it on your network servers for Samba and mail and the like, but I would hesitate to train children on a system that will be ultimately useless to them when they get out into a world dominated by Microsoft software. Because, like it or not, high school is, for most, valuable job training before they leave high school and enter the work force, be that as secretaries using MS Office or accountants using Excel, etc. When you teach them to use software that is completely irrelevant outside of school, you are crippling them for life as they have to retrain themselves on all the applications that school had taught them in order to use something as commonplace as Office.
Not to mention the numerous administration headaches that would result from your everyday highschool computer teacher trying to figure out Linux, let alone teach it. I personally could not imagine my glorified typing teacher in high school comprehending file permissions, much less understanding something as arcane as TeX or vi.
All in all, its probably a better idea to stick with something like Macs which have a proven track record in education as well as most of the common office applications that can be found on Windows computers as well. Free Software has its place, but it certainly isn't on the desktop.
Is your company running tools written by ma
We've installed Linux to save us money. We're involved in a charity program that sends computers to developing countries (called C4W), and we usually install Windows. To set up a Windows OS that would run on the latest batch of them would require that we purchase XP for each of them then buy a license to downgrade XP to 98 (they were too old to run XP). Instead, one of our resident Linux experts installed Debian on all of them. I don't know how it turned out for the recipient, but it saved us a lot of money.
Where? Moose Jaw, Saskatchewan, Canada.
For those of you who don't know MJ is a city of about 30,000. My girlfriend's little sister (gr 3. I think), needed to write a letter one day when she was over visiting. I said I don't have Office, but I have staroffice which is pretty much the same. "Don't worry that is what we are learning in school". I was shocked and thrilled.
I am 99% sure that they were using a windows version of StarOffice, but it is still free.
~S
Reality Check:
Have any of you actually had to work in a lab full of "Easy to use" windows machines. And the people couldn't figure that out.
Just imagine how difficult it would be if they were all linux/BSD/whatever.
Here's why i'm jilted by this:
About 2 weeks ago I had to argue with a girl for about 1/2 hour that should couldn't print her report on the Solaris machine she was trying to use in our lab. Then she went to the windows machine and still couldn't figure it out.
If this does happen (open sourced schools) I REALLY feel bad for the admins. May god have mercy on their souls.
One of the arguments (which I consider fallacious) against Macs in the schools is that kids need to be prepared for the "real world," one that involves a Microsoft OS and Microsoft applications. As Linux has yet to be embraced on the desktop to a great extent in the business world (still largely relegated to server duties), does Open Source hinder their abilities to function in the business world? Furthermore, are the support people in these schools equipped to deal with the support issues of a new platform? Linux may indeed be easier to support than its windows counterpart, but without the appropriate training (which is always hard to come by when delaing with public school funding) it may be difficult.
Ideally, schools would shift their software budget to a training budget to bring their support gurus up to speed. And the children would gain a comfort level with technology, though not necessarily the technology they will be using in the real world. Unfortunately, I have more questions than answers here.
I'd be interested in hearing a reasoned response to my questions. Dogmatic zealots need not apply.
Do not taunt Happy Fun Ball(TM)
This is the wrong question. The right question is why computers in school.
Learning is universial, not applied. You need to learn to reading writing, and arithmatic. There is no need for comptuers in that. Sure there are some good computer programs to help there, and typing is a skill that needs to be learned, but computers are the implimentation detail, not the meat. Until you have something to do with the comptuer there is no point in having one. Young kids need to learn to write things out by hand.
Yes computers are important to the world today, but comptuers change fast. when I first started with computers wordStar was the big program in industry. In High school they braged that we were learning the latest word processor that industry is using, wordPerfect 5.1 for dos. And at the time it was the biggest, but today everyone is using Word 2000, and looking at an upgrade to that. Teach the kids to think with whatever tool is avaiable, and you will be fine, but teach them that the tool currently in vogue is the only one to use and you do them a disservice.
Yes I know industry has a lot of obsolete, but fast enough comptuers they would love to donate to any charity that will take them, but that doesn't mean you have to take them. A computer is a means to many good ends, but do not allow a computer to become the end itself.
As many have said you need the boxes, software, and a person to run it. It would be best to have a person seperate from the faculity to run it, BUT who? Considering the schools don't have enough money to pay the teachers right how can they pay one Linux Tech enough to keep the system running?
This SIG pulled due to lack of funding. (This damn war is costing too much!)
It took me a while to figure out what this article is talking about. When the author says "free software" what he means is _not_ the same free as the FSF. He actually means "getting commercial software for free" and not "free software like Linux." The problem with this whole thesis is that I just can't imagine that it's particularly true of Linux writers, because the amount of money you save by getting a free copy of RedHat or Mandrake is pretty trivial, since you can just download them for free off the net.
However, in the world of non-free software, where "review copies" of software can cost hundreds or thousands of dollars, it gets a lot more tricky. I have had plenty of personal experience with people (myself included!) who want to write reviews of product X in order to get a free copy. And that can definitely influence what you write...
"I'm not joking. I'm really running for President." - Pat Robertson
$6.21 is the number of the beast before sales tax. Meh.
Has free software saved Christmas? It could be just like a bad sitcom (wait, maybe that jolly old bearded UNIX hacker really WAS Santa Claus). I'm not making much sense I guess, but the way the story title was phrased it made me think of bad Christmas specials. Come on, SAVED schools? Aren't we getting delusions of grandeur here?
You wouldn't expect your teachers to work for free, but you expect highly skilled software developers to give their work away. Think again, my friend.
How about setting up a Linux box as a VNC server at some of the schools. The Windows VNC client is free and works great. Combine that with some educational material on the basics of what's good about open source software and what's not so good about Microsoft, and you're off to the races.
I just wanted to let you know that Kabul Elementary school, which operates out of my neighbor Mustaffa's barn, has been running the new version of ISLAMIX. ISLAMIX is a revolutionary open-source operating system which Mustaffa and I developed recently for our Commodore computers. The kids at Kabul Elementary think ISLAMIX is the greatest thing since sliced camel! We will have a website soon with more information about ISLAMIX and it's many features (including Beowolf clustering in order to download and play movies from the Internet.) We are also working on porting the Katzbot to ISLAMIX, but we've not had any luck getting things to compile. It seems that our copy of endlessramblings.h may have been corrupted during the modem transfer. -Junis from Afghanistan
Let us please remember that the Free software initiative started in a school. Specifically, the GNU movement at MIT. Granted, it's not a public school, but it still is an educational institution nonetheless.
The stunning success of the GNU movement is just one more reason why more public schools should educate themselves and make use of its many advantages.
We were gonna have to shell out MAD DOLLARS ($$$) for windows XP until me and my friends found a L33T 0-DAY KRAK for it on IRC!!!
Now the entire library network is running XP Server!!!
Free software r0x0rs!!!
- A.P.
"Remember when the U.S. had a drug problem, and then we declared a War On Drugs, and now you can't buy drugs anymore?"
The success of our web server allowed us to push for a perl/apache/linux-based attendance system that let us get rid of scan-tron sheets to be filled in every morning. Now, our teachers open up their web browsers in the morning, log in, and they check off their absent students 1st period. In the afternoon, they can check who was here and who wasn't, and it saves us about a ream of paper per day, since we don't have to print out attendance bulletins any more. Most of the work for the attendance program was done by one of my students who was learning perl on the fly.
I also teach a class for A+ and Network+ certifications, but we cover Linux both semesters (especially when we do network security in Network+). I'm hoping that next semester, we'll be able to use Linux as the primary desktop OS for most of the networking stuff, but we'll have to see what happens.
There are two major problems, in my opinion: businesses want students who are proficient with Windows and Office, and schools don't have the resources to hire people who are competent Linux admins. If the demand for Linux users starts going up, then maybe the number of computers running Linux in schools will increase, but for now, it's probably limited to servers.
One funny tidbit - earlier this school year, Code Red and Nimda running on local districts' NT/2000 IIS web servers took down the WAN access for most of the schools in Southwest Ohio. Seems that the servers weren't patched or maintained as well as they should have been. Web servers running Apache, of course, didn't have this problem.
First they ignore you, then they laugh at you, then they fight you, then you win. -Ghandi
First they ignore you, then they laugh at you, then they fight you, then you win. -- Gandhi
It seems nobody has mentioned www.seul.org, the section education. There is a lot of software and some (for you valuable) testimonies.
Wait until next summer when Open Office hits 1.0 and then show how they can do everything in it that they have been doing in MS Office, including file compatibility.
is available for german schools produced by the
Open Web School.
It consists of lessons produced by pupils for pupils.
I keep hearing about how Windows is so easy to use, but moments ago I showed someone (Again!) how to drag and drop a file. She's be at this job since before 1995 when the computers were installed; some people you're never gonna reach.
But I'm not seeing an old Slackware, install-by-tarballs machine running a monochrome
monitor being installed into school desktops; anyone trying that should be shot, and allowed to admin windows for a living.
I use Redhat and Ximian here. I don't have time to put on my programmer-hat every time I install something, and the RPMs cover my ass so I don't crash libraries or something, and keep in mind I can install them from the comfort of my own desk instead of walking the halls to get to the Windows box.
And Ximian is a big help, too; their latest offerings are at least as good as Microsoft for the things that matter (Spreadsheets, Word Processing, etc) and get better every month. If you haven't tried them, now's the time to start watching; they've done a superb job.
And as for learning....how'd these people ever migrate off of WfW? And then to Win98...then to 2000? It's not the exact same thing, and that's rather the *point* isn't it?
--- For a good time mail uce@ftc.gov
OSEF has a great article from a feature story the Arizona Daily Star ran on them. URL below, but here's some quickie quotes from the story....
i zkids.html
"As such, they're entirely unimpressed that Corbett is among a mere handful of primary schools around the world with a computer network that runs Linux, the flagship of the fashionable free software movement. They probably can't appreciate the amount of money the school is saving, or the thousands of hours that Linux devotee Harry McGregor has donated to transform a collection of PCs past their prime into a Net-connected laboratory that's ahead of its time."
"A lab similar to Corbett's could cost the district $100,000 or more if it were set up with new computers and commercial software. Instead, the school spent just $12,000 to convert its donated PCs into a Linux network that offers similar access to the Net and educational programs. Moreover, Corbett's pupils will gain experience with an operating system that's becoming more popular every day."
http://www.osef.orgarticles_and_letters/azstar/wh
Probably saved more souls than schools.
sine puella vita suget
Does anyone know what the support costs will be once this school runs into the inevitable problems imposed by either poor configuration by hobbyists or the need to scale? What if they need more email accounts or something? While these problems would be easily dealt with on a Windows-based network (I think even your average high school computer teacher could handle it, or, barring that, a couple of MCSEs, who are a dime a dozen these days), it has been proven that there is a chronic shortage of people who are Linux-competent. This mostly stems from the fact that Linux is much less common than Windows in today's business world, so naturally there is a labor shortage. Any causal student of economics knows that a shortage in labor leads to skyrocketing salaries and consulting fees when it comes time to fix problems, money that a school district simply can't spend on expensive tech support.
Really, when it comes down to it, you have to look at the total cost of ownership associated with installing a certain platform at a school. While the initial cost of a Windows site license may be high, it is a lot cheaper to maintain overall due to the abundance of people who can fix problems for a relatively low fee. Compare this with Linux, where whole companies base their business plans on providing support for an arcane system that can often suffer failures. In the end, perhaps these evangelization efforts would be better spent on coding software that makes Linux more user-friendly and less of a hobbyist's toy.
Is your company running tools written by ma
My school district currently uses a mixed Microsoft/Linux environment. Until last week, our primary www server was Linux. However my boss got grumpy and decided to switch it to Win2k+IIS w/FP Extensions, so that he could update it easier via Frontpage (I'm gagging too). However, within 30 minutes of him installing Win2k and IIS, it got Nimdaed. Nice job! Right now, we have: A secondary Linux www server, for PHP/MySQL things. A SMTP/IMAP/webmail server in Linux. This is one area where Linux paid off. MS wanted thousands for Exchange, Win2k with the necessary hardware. Old machine (We don't have a ton of users) + Linux + exim + uwimap + Apache/PHP/MySQL = total new costs of $0. We are also implementing a Linux firewall to segment the network into DMZs (Something thats never been done, because as with most projects it is "Lets get it done and up as fast as possible". sigh.)
- Nothing is true, everything is permitted
Dude, you *do* know that the "B" in "BSD" is a rather famous public school?
My high school offers programming classes, but we do all our programming on windows machines. I don't know why we don't switch over to linux and GNU, it being free and all. It seems like it would all be a better learning experience if we could easily see the source for more complex programs. My friends and I have setup a Slackware box, but the school system doesn't know yet and we don't plan to tell them. Last time we did, the next day we came to school and the power cord, monitor, keyboard, mouse and network cords were all gone. They thought it was a "virus" ;-)
It's a legitimate question to ask it any schools have been closed by Free Software also.
Has the increased cost of using unsupported or difficult to maintain free software forced any schools to find it impossible or difficult to keep their systems running?
I was involved in a project to donate computers to a middile school in the mountains.
We had computers donated from Goodwill and managed to get our university microsoft rep to donate Windows.
Or first thought was to use Linux, but the schools ruled it out since none of the teachers
would have been able to use it.
We did manage to get them Office 2000, though, and
I thank the people at Microsoft that helped us with that.
Moral of the story though -- many schools are too afraid to learn new things, and that prevents free (and often better) software from taking hold.
Linux developers do need to develop a more integrated desktop. Should there be a "X-with-training-wheels" we'd see a lot more Linux users!
www.riverdale.k12.or.us/linux/ good linux info there also
"I drank what?" - Socrates
My father teaches CS at a small private school, and while they're not by any means struggling financially - they are somewhat apprehensive about Microsoft's new fervor for license enforcement.
They're seriously considering a move from their current student lab environment (Win 9x with Novell Netware) to a Linux thin client environment - what would basically be X terms. This has huge resource allocation advantages and because it's open source - the licensing restrictions are few if any.
This could literally save them millions over the next few years (The hardware life cycle for thin clients is considerable longer, and new server hardware, while expensive, is cheaper than buying several hundred new desktops every few years - not to mention say $100 dollars per system savings against XP Pro licenses)
That millions could keep them afloat in thin times, or could mean that they can provide scholarships to needy students.
See related: K12 Linux Project
\Drew National Data Director, John Edwards for President
Reasonably nice troll. Not bad for a novice.
You blew it by going over the top in the last paragraph and using the H word.
but, why put it in schools.
The Pros:
1. Expense is cut drastically
2. Open source benefits some with early exposure to alternate OSs and software to potential future code writters and sales people
The Cons:
1. MS is the mainstream... if you teach a child a radically different system than from what they will face a few years down the road, either in terms of software or the core OS, they are unprepared for college and/or the working world they are supposed to enter into. Seriously, how much of the world is open source in business? Not nearly as much as MS or even Mac (or both), not even close. These kids need realistic education.
2. Support. How many open source gurus are going to work in education for the low pay offered. How many current education IT employees and teachers actually know open source software and OSs. Not nearly enough.
3. Variance from what is at home. There are compatibility issues with files, and an overall difference (as stated above) between the mainstream and the niche in use, and most home users are NOT open source (and won't be for quite a while if ever given the fratricidal nature of the open source "movement")
Sure, the savings could translate into more money for teachers, but do you honestly think that is how it would work. Politics will ensure that the money saved is either spent on salaries for administration or cut from the budget since it no longer is needed. Teachers wouldn't see a dime.
see here
War is necrophilia.
We had done this exact same project some years before, and we had managed to replace Windows 98 with Linux on the school's network. We had convinced the administrapo that the network would be secure from viruses like ILOVEYOU and that there would be no software licenses. Everything went well -- for the first three days. Then the support issues started trickling in.
.kwd files. However, KOffice would completely mangle the document once it was saved in HTML, making it virtually unreadable. I don't know if this was a bug in KOffice, but it sure raised a lot of hell.
/bin, /opt, stuff like that. Some were also angry because their Windows programs wouldn't work.
We decided to use KOffice for our standard office suite, and HTML would be the file format standard in which to save in for interopability with the remaining Windows segments of the network -- after all, I didn't see Office 2K have a converter for
Remember the GNOME Usability studies that Sun did? Remember how confused the participants were?
Take that and multiply it by 100, and you have what our school experienced. We had training for the teachers in order to prepare to this switch to Linux, but many of them were confused when confronted with folders like
We scrapped the entire idea after three weeks, and reverted the entire network back to a Windows-based solution. While Linux is a great server OS, its desktop solution leaves something to be desired, and I would not recommend replacing what works for the school.
I know of one school in particular, the school my boss sends her kid to, that has benefited tremendously. My boss is a Microsoft devotee and has scoffed at the Free Software movement, until she went to a school meeting and realized the computer lab that was donated (just the systems and OS nothing else) wasn't up and running yet. The reason was the school didn't have the money for Microsoft Office.
Long story short, she told me, I pointed her to StarOffice and a few other apps that are readily available. It wasn't a difficult sell, because it was the difference between getting use out of the computers or just teaching Windows. The school wouldn't have 'collapsed' without the free software and they would have gotten the money for the applications next year, but now they can use that money to implement a replacement program for the systems they already have.
All of this goes back to the fact that there is a bias against Free licenses on software. My boss always considered them to be amateurish, less reliable, than the NAME BRAND software. Not anymore.
This is not the way to build a lasting empire.
In my first year of college there were 25 Windows computers and one Linux server in our laboratory. :)
After I became the admin I started converting the teachers and students to Linux.
In the beginning it was hard but after they learned to read/send mail with Pine they became curious...
So when I finished college there were 26 Linux computers and everybody was happy using them
Linux is schools is a great idea.
The local newspaper here in Springfield, IL ran an article a year or two ago about some hight school students (Springfield High School) who networked the schools computer lab to a Linux server so students could have a place to store their stuff without having to bring floppy disks. I don't know if it's still around, but the students did it all themselver including building the server and installing all of the software. The teacher that was in charge of the lab was impressed mostly because he didn't know anything about Linux and networking.
Realistically though, free software has made a huge impact. I think the most obvious exmaple to me is the use of GCC in college classes. Hundreds of colleges use it that otherwise might not be able to teach courses behind computers. (note: you don't need a computer to teach C or C++ or to learn it, plenty of people have done it that way, I think it's a bit more enjoyable with a computer though) Compilers on multiuser UNIX systems are traditionally very expensive, as are site licenses to compilers under Windows.
I also think that there is a behind the scenes factor that has always been very hard to measure with linux. I know that my old school district, Boulder Valley Public Schools, has several Linux machines in various capacities. A couple are used as lan servers in some schools, a couple are used as firewalls and proxys and email and web servers. I'm certain that some act as bridges and routers. That's stuff that makes their life easier, serves a purpose and it's really hard to measure. Off the shelf firewalls can cost thousands of dollars. I have no idea how much it costs to buy the hardware, software and then hire someone to build you an exchange server for email or setup an email server with something non-linux.
As for teaching software and that kind of thing, I think it's still in the infancy.
Who is moderating this discussion? Interesting????? The poster is a well known troll responsible for hundreds of posts with nerly identical FUD. It's obvious that whoever moderated this post up to interesting hasn't been paying much attention.
Why do we need open source in schools? Just because most technical people us it, (mostly because they don't like M$) doesn't mean students need to as well. I wouldn't take anything over my Unix machine for development work, but how many students in a high school are going to be engineers? For the casual/word processing PC user, Linux might as well not even exist. Besides, can you imagine the support nightmare that would be created by putting Open Source in schools? What are they going to do? Hire on a System Administrator that gets paid as much as the principal? I don't know any SysAdmin's that make as little as teachers do. This even applies to colleges. At Penn State we could have used open source software for CSE purposes, but that only accounts for a handful of students. Try telling the entire college of education or business that they need to start using Redhat!
Many kids will either own computers or work with them daily after high school. Some may want to go on to work in an explicitly computer-oriented career, which however doesn't require much specific post-secondary education (hardware repair in a small shop, for instance). To the same degree as auto-mechanics (and probably far more than say, wood shop), computer education in secondary schools is a valuable addition to the curriculum.
For primary education, heavily computer-centric instruction may be overkill. But at the high school level good arguments can be made for it.
Of course, it won't be too useful to students who just want their school to subsidize their bong-building activities, but that's what metal shop is for.
You are obviously flawed in your cluelessness.
Plese put a gun to your head and pull. You will be doing us all a fovor.
Ummm... replace "Linux" with "Windows" and "FreeBSD" with "Linux"... and that sounds like a Microsoft press release.
*scary* - is this the way that Linux is moving?
I think they use a couple of different Linux distros. I know they use Mandrake for desktops, but maybe other distros for limited server ops.
That doesn't mean they are exclusively Linux, though. It's only a small piece.
Escpecially within large pools of computers like you have in schools or universities, Linux is far superior.
Having an consistent way to get the system centrally configured and maintained may not be impossible with windows, but it is a pain in the ass.
For an good admin, linux boxes are much easier to maintain and to keep stable and running.
And for the DAUs: People cannot use windows, either. When they are used to, they may protest. But I never saw any DAU, that could use Linux less easier than Windows.
We're "in bed" with Microsoft or something; they won't stop sending us loads of their latest software. All the computers run Win2000, with the lastest versions of VisualBasic, Office, etc. all installed. Under the MS Academic License, we can essentially install any Microsoft product on as many computers as we want; they can also give out software. My friend brought home .NET... (It screwed up his computer and he had to do a complete re-install...)
Anyway... Even with what's essentially infinite access to anything we want, we're looking at switching some servers over to Linux. Even though we keep up with all the security patches for our servers, they're constantly getting infected with worms/virii. The whole network came down one day - because a large file was being moved off of the file server. The constant headaches from this crap has caused him to give a serious look at Linux, at least our webserver is likely going to migrate to Linux soon. Maybe the fileserver/mail server will follow suit...?
So, in conclusion... Linux hasn't saved my school, but Windows does nothing but constantly screw us over. So I guess I'm answering your question from the opposite side...?
________________________________________________
suwain_2
I'm _nearly_ speechless; but this IS /. after all so here's my piece:
I have heard arguments like 'all free software initiatives in public schools around the world have failed.' I know this is not true, but I need cases to show them.
Is that really their concern or just the excuse they use to avoid having to actually deliver on the promise of "education"?
My first rebuttal would question the validity of such an attitude. If that "lemming" attitude were valid then the horse-n-buggy would never have been replaced by the automobile because it requires a "non-standard" fuel to run amd previous attempts at the internal combustion engine were pooly implemented.
They should really be asking the questions "is it feasible for our organization to do this?" with "how much would it cost versus how much could we save for reinvenstment back into the system?"..
BTW: I applaud your effort to deliver hard fact to dispell their fud. An analysis of the actual numbers should demonstrate that the savings from using *free* versus proprietary equals out even taking into account the added expense of a sys admin specific to *nix. Additionally not being beholden to the schedules and monetary coffers of companies like MS should be priceless from the standpoint of an educational organization.
(Why is this modded up? This is flamebait, and a stupid response at that.)
Why computer in school? That's like saying "why chemistry in school", or "when are we ever going to use computers". Computers are everywhere. I can understand if the software becomes obsolete, but it's still should be required to learn about computers.
Even if WordPerfect isn't the hot thing anymore, it was good that you learned it. From it, you learned typing, mice, how a GUI works, and other basics about word processing. So what if the "hot keys" are different in Word 2000?
Also, if you load these machines with an alternative OS like Linux, then they'll know Windows is not the only tool out there. And isn't that what you want?
Zodiac Survey
Ok, this is slightly offtopic, but...
From my experience school's interest is computers works like this:
Business - Teaching the MS way
Math - Making the churn of math easier, like graphing equations and solving systems of equations
Science - Reports, reading lab equipment, and calculations
English - Typing papers, internet for research
History - Typing papers, internet for research
Art - Using Photoshop (preferably on Macs)
CS (if they have one) - teaching whatever C++ compiler the teacher is most familiar with
Sorry if I've left some out, but you get the point. Since we've already had the discussion on how easy Linux is to a newbie, I'm more interested in what free software/OSes would fullfill each departments needs (kudos if you can satisfy business!). And remember, you're dealing with uninterested kids, so the software pretty much has to be point & click.
Kurdt
I'm not anti-social. Just pro-technology.
Yes. With one exception. The difference in quality between *BSD & Linux is greater than the difference in quality between Linux and Windows.
> Yes, the "B" refers to the University of California - Berkley, and the "SD" refers to the University of California - San Diego.
[Spewing my drink here - that was hilarious!]
BSD == Berkeley Software Distribution. UCSD, my alma mater, had no part in this.
"Score:1, Interesting"? Score:-1, Troll, more like it. What's with the moderators today?
You'll have better luck looking at schools in Europe, especially Germany, France, and the U.K. The U.S. public school system moves about as quickly as a lowered Honda Civic in an off-road rally race; and, in my experience, most public school IS/IT administrators know less about computers than John Ashcroft does about electron field dynamics. This is why few high schools have local area networks or decent internet access, and why fewer still have classes in things as simple as programming in Basic.
Since U.S. schools aren't adeqately funded by the government, they gobble up as much of the private-sector "technology money" as they can possibly gorge themselves on; a signifigant chunk of which comes in the form of discounted licenses for Microsoft software. Kind of ironic that the school still has to buy the computers to run the software (and keep them updated); but I guess by reducing their profit margin from 99.998% to 98%, Microsoft has done their part. Those computers have to be upgraded pretty regularly, of course, and some of the money for that comes from "less worthwhile" programs -- like English, Art, Music, and History.
We are raising a generation of Americans that won't know the difference between a verb and a posessive pronoun, but they'll be able to use the Word grammar-checker, so it all works out in the end, right?
These, among other reasons, are why the U.S. imports its computer engineers from Europe and southeast Asia.
By contrast, European schools don't get the same deep discounts, and the foreign-language support in Windows is pretty horrible (although W2K has made some signifigant improvements in this area). European schools (at least in the three countries mentioned above) are supported wholly by the state, and as such don't require outside funding. This means that, for the most part, the software and hardware are chosen to fit the needs of the instructors and students, rather than to fit the discounts, freebies, and funding-with-strings requirements assigned by the technology companies.
This is why you'll find SuSE, Mandrake, and Debian pretty heavily used in many European schools (and thus, businesses).
But that's just my opinion; I could be wrong.
--
I Hit the Karma Cap, and All I Got Was This Lousy
My company provides IT support to a small-medium sized K-12 school district. They have 5 NT servers, and approximatly 250 workstations running Windows2000/Office2000. I can see no scenario where it would make sense to move them to a free software platform (Linux). MS academic software is not that expensive to start with, so there's not much money to be saved here (approx $50 for Win2k and $50 for Office per station.) Most of the software used by the district would not run under Linux anyway. Aside from the webmail app and their web based library system nearly everything else they use is written for Windows. They couldn't run any of their current educational software packages, including those provided by the state! I love Linux and see that it has a place on the server, embedded in devices and running on hobbiests' machines. However considering the realities of IT today, it just doesn't make sense to roll out Linux on the desktops of organizations either commercial or educational.
One of the Universities here in North Carolina has a big Computer Science program that actively participates in advancing Linux (great project). NC State University also has their own Linux distro based on RedHat...I believe all of the engineering students use their Linux distro, but the rest of the students still use Windows.
So, we arrived at a compromise: although I wanted a straight FreeBSD shop, we settled for Linux on the desktops and FreeBSD on the servers, provided that the Linux USB support and stability improved. We still use the 2.2 kernel series with backported USB support, and are running FreeBSD 4.0-STABLE on all of the servers (which, by the way, have not been rebooted since they were installed).
When the numbers came in, we found that we were able to afford 20 extra computer systems (!) by not paying the Microsoft tax. Also, we were able to hire a sysadmin very cheap who works remotely (he has been banned from the school grounds), and found in our analysis that we would have needed to pay about three times as much to get the MCSEs that it would have taken to keep an NT shop running smoothly.
So, the school board wins and the kids win with Open Source. That is the way it should be.
freebsd guy
I can see plenty of problems with implementing Linux in schools, especially when I think about how it would go in my local district.
1. All the teachers know Windows. My bet is that even many of the computer teachers do not know Linux well enough to run it in their labs. They can't teach it if they don't know it and teacher training could be expensive and take a lot of what's probably considered unnecessary time.
2. They would have a lot harder teaching a completely new OS AND classes on how to use the programs than to just teach the programs. You'd probably have to have a intro to Linux class before you could ever teach whichever programs you choose to use - and that's another issue in itself.
3. Students probably have Windows at home. Would they have problems with converting documents between systems? Say you create your report in Word at home, could your bring it school and use it there?
4. The local tech support and computer stores would not be able to help them if something went wrong. 99% of the techs around here don't know anything about anything other than Windows. Who would know enough about Linux to help them??
5. The students would learn programs and OSes that would different with what they would have when they go to college, go to work, etc. Since there are very few offices and colleges using entirely Linux, they would be at a disadvantage right away.
Of course there are a lot of plusses too, but these negatives sprang to mind right away. Of course they are all refutable. I think that the schools would choose easy and expensive over difficult and cheap any day. If they didn't have a choice and were nearly out of money, my guess is they would let the computers sit/
Most people would die sooner than think; in fact, they do.
It's kind of funny how SourceForge and NewsForge were linked to... But the site that I've never even HEARD of before was completely omitted.
SCHOOLFORGE
In reading some of the case studies on this, it looks like the biggest use for Linux is in two realms:
1) Servers - file sharing, web servers, e-mail, etc
2) Making old machines useful again
A lot of schools have old 486's and Pentium lying around which are pretty much useless as a Windows desktop, but set these systems up as X-terminals and throw a sub $1000 server behind it, and suddenly they are rejuvenated. This also has the benefit of making the management of these systems much easier.
I know I've seen a number of initatives where some politician gets the bright idea that the secret to making schools better is to buy a lot of hardware. This usually helps for a little while, but then in 3 or 4 years the hardware becomes nearly useless and nobody's throwing more money at it. By going with Linux, it seems like they can extend the value of that initial investment a lot further and thus save hugely in the long run.
This sig has been temporarily disconnected or is no longer in service
So you say software to schools should be free, eh? I happen to agree with you, but this topic reminded me about this BusinessWeek article in which the author, Charles Haddad, criticizes Microsoft for its plans to donate $1,000,000,000 to 12,500 poor schools in the U.S, saying that the only reason they are doing it is because they want to take over and control the education market.
It seems like MS will get criticized for making schools pay for software, yet they also get criticized for donating software.
(Automatic -1 for not being anti-Microsoft)
I Heart Sorting Networks
But let's say you have 200 systems, with a mean time between failures of 56,000 hours each.
That's one failure every 12 days, more or less.
Looks like your grasp of statistics is about as good as your grasp of systems administration.
Hi,
Fazekas is a K-12 public school in Hungary equipped with a network of one gateway, 5 servers and about 100 workstations in classrooms, offices and labs.
The servers are all Linux (SuSE 7.3), the clients are dual-boot Linux and window$, but students access their unix home directories from windown as well. Of course, everyone starts off using windown, because that's what they know, but after one or two semesters many begin to discover Linux.
The network started off as a 2-server 12-workstations government-grant, but it has been so successful that the school got the rest of the equipment as a reward from the city council as the most successful secondary-level IT education institute. We've been using Linux as our server platform from the very first day. Now, we have about 1000 users, and a constant network load around 80% BOTH WAYS!
The webpages are Hungarian only. Sorry about that!
Maybe Katz will do a write-up of your interesting story.
Help fight continental drift.
www.wentzville.k12.mo.us, hosted on SuSE 7.3 running apache.
We setup their email, we also setup DHCP, NAT, and a firewall.
We're going to replace all of their existing novell junk with linux.
They will save a ton of money over the years with the new setup (vs paying novell licensing fees).
They are very happy with it as well.
The man who trades freedom for security does not deserve nor will he ever receive either. - Benjamin Franklin
The high school I went to (a private school in Maryland) adopted Linux about four years ago, but for use as a network server. They had it in a closet, hooked up to an array of six 56K modems. The modems were load-balanced together to provide a pseudo-broadband connection MacGuyver would have been proud of.
They saved a lot of money with Linux, but probably lost it all again due to the contractor the clueless Admin used to cobble it together. GAH.
(Side note: A few friends and I offered to do the networking and Linux admin for them, but our FREE proposal was turned down due to "security concerns." Of course, later, we rebooted the Linux box into single-user mode and added ourselves a root account, but that's another story)
Justin
"Why would God give us a waist if we wasn't supposed to rest our pants on it?" - Rev. Roy McDaniels
I am a brazilian Computer Science student. Don't
know very much about schools, but I can tell about
universities.
Government here in Brazil do not care very much
with the public Universities, so they're always
short of money. Federal University of Parana,
where I study, is one of these. Years ago the
Computer Science laboratory used Windows on most
machines. Besides the blue-screens and security
problems, Microsoft made some obscure legal
actions that implied in heavy charges. These
became just too heavy to pay as the computers --
mostly Pentium 100-150, even 486's -- became
too weak to run newer versions of Windows and it
software.
Then, we installed Debian GNU/Linux on all machines.
With a few expensive X-servers, all the other
machines are now X-terminals (many of them
diskless), thus saving those old computers.
Debian give us all the software we need to study,
and is far more fast, stable and secure than the
old Windows "solutions". And it's all free.
I believe there are more cases like this in other
brazilian public Universities. A little research
will help.
Federal University of Parana is at
http://www.ufpr.br
Computer Science department at
http://www.inf.ufpr.br
Prof. Marcos Castilho, the person you should send
e-mail about our experience with Debian:
marcos@inf.ufpr.br
Good point, instruction is expensive.
A good source of boxes is from recycling machines that can't run windows anymore.
Sorry, maintaining a good machine requires less time than patching for viruses every day.
Here in Hong Kong there's a similar project(in Chinese) like ' PCs for Kids'. At first I thought it's doomed, until I know Microsoft is involved.
Well Microsoft does not alway mean to charity - especially when a shiny Microsoft logo is behind it.
Many GNU tools have been ported to many other OSes including MS Windows.
There are a host of free software applications available for many OSes including MS Windows.
This, not to mention that, Linux distributions have achieved the point where most previously 'complexe' administration tasks are now done inside friendly GUI applications.
GNU's Not Unix is an acronym with a meaning that seems sadly forgotten in some of these discussions.
I personally think that teaching teenagers why they should be concerned about their intellectual heritage and about free software an important proposition regardless of what OS they are running.
Do not spread "09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0" over the internet, thank you.
i'm nothing but a cunt tease. fuck you
I work for a government central IT agency. A couple years ago, there was a requirement for a shared infrastructure between all of the K-12 schools in our jurisdiction.
We came up with what we thought was a really great Linux solution based on K-12 Admin.
After submitting our proposal to the education types, they were all for it.
A few weeks later, Apple sent some slick marketing representatives to talk to our clients and much to our disbelief, the schools bought into it. Today, they are running an expensive, proprietary Macintosh solution, and I find it grimly amusing that it isn't meeting their expectations.
I guess what my point is, is that teachers have a similar attitude to other highly paid professionals like lawyers or doctors. They think they always know best. To them, if you're not an educator, you're an idiot. This makes it difficult to sell them on anything that doesn't have strong marketing hype, flashing colors and smooth talking sales reps. The unfortunate thing is, in most educational environments, these are the people who have the final say as to what products are used.
In my experience as an admin, the busywork involved in proving the right to use software is a major resource sink.
For example: CA has *terrible* product activation routines that take longer to complete (if successful- not at all a given) than the installation itself. They are also spam vectors.
Checkpoint firewall products are also a PITA. Long strings to enter, confusing docs regarding which license keys to enter where (fear upgrades), topped by a buggy compliance routine that somehow confuses ip addresses behind the firewall, so it comes to believe you are out of compliance and pegs the cpu with multpile license violation log messages/second. Piss on them. There is really nothing significant they offer but heartburn.
http://www.mandrakebizcases.com/
Look in Education heading for some high school and university cases. Good luck.
DigitalOx
I have a friend that teaches in a local high school with whom I've discussed the merits of free software, and how it could be used in his school. There are several reasons this isn't going to happen at his school soon, or possibly ever. First of all, and most importantly, it is explicitly against school-board policy. Installation of any unauthorized software on computers under the school-boards juristiction is forbidden. ONLY Windows and other commercial software packages for which they have paid large licensing fees, will be considered authorized. The school board (and most teachers) don't understand the whole free software concept, and stick tenaciously to the idea that 'free software' is another expression for 'pirated software'.
Secondly, most teachers are almost completely computer illiterate. They can barely manage the 'Window's devil they know'. They recoil in fear and dig in their heels at the first suggestion of anything different.
All I can say to anyone wanting to employ free software in our schools as both a money saver and a teaching aid is good luck! It would be easier to get Playboy sold in the cafeteria....
The problem is that when someone in the education system goes to CompUSA or their local Mom and Pop computer store, they don't get someone who will set them up with that sort of thing.
So here is what you need to do: volunteer your time. Set up that computer network for your school, especially those of you with children in it.
You can also help the school with find good deals on businesses wanting to get rid of equipment ... those old PII 233's that they don't want to use anymore can be a big tax writeoff for them, and would work fine as a diskless workstation.
But the problem is that most school teachers don't have much of a clue in the realm of computers. They don't know how to make a dozen half-broken computers into a lab. So volunteer your time and help them get set up!
-- Erich
Slashdot reader since 1997
I know that the computer and mathematical dep. of SDU (Southern Danish University) uses only Linux. In the start of a new year the new students are all given a course in how to work with it - and apprently it works and saves the university a lot of money.
I myself have many times tried to 'convert' my local high school but there's always one barrier - the teachers don't know enough about it and the computer teachers don't want to convert because they are use to Windows.
So, you're trying to convince schools to start using free software. Why, exactly?
What educational objective are you trying to achieve? How will free software bring you closer to this objective? Which free software in particular? How will this benefit the average student?
Who will train the faculty? Who will support the installations? Will this cost money? What are the advantages to the institution, aside from the lower initial cost?
These are the kinds of questions that any responsible educator should ask, and you have to be prepared with good answers if you expect to make any progress. If you don't have those answers, then maybe you need to rethink your goals. Free software may, in fact, be the solution, or part of the solution. But you can't start from that assumption and expect others to leap on your bandwagon without a second thought. Except on Slashdot, of course.
If the logic that whomever dominates the education market will by default dominate the rest of the OS market were true... Macs would rule the world.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
Our district (K-12) uses open-source and free software fairly extensively. In the past year, we have:
:(
-- moved all web and e-mail servers from NT to RedHat Linux 6.2
-- put in FreeBSD 4.x-based firewalls in all the high schools and admin buildings
-- replaced the IBM NetVista Proxy Server software running on NT with proxy servers running RH 6.2, Squid, DansGuardian, and the like
-- implemented a very successful pilot of the Linux Terminal Server Project thin-clients in two elementary school labs (one school only uses Windows on administration desktops)
-- promoted StarOffice 5.2 as an alternative to MS Office, on both Windows and Linux
-- most IT desktops run either FreeBSD, RH Linux, or both
Currently, all servers in the district run either FreeBSD, Linux, or NetWare. There are no NT servers left in the district.
Most computer labs run Windows 95/98, a couple 2000, and one or two are still running 3.1. Some are now running Linux, with more planned for next year.
The goal is to have all elementary school labs running Linux, all servers to be running FreeBSD or Linux, and all high school Internet access to be policed by Unix servers.
Working quite well for us. Saved $30,000 is licensing fees so far (that's for the IBM software), enough to hire another tech if needed. Should see greater savings as time goes on. Also were able to purchase 200+ lower-end PCs for the elem labs as opposed to just 30 high end machines -- that's close to 30 labs for the price of one -- as the elem labs will be running Unix.
The interesting thing here is that the teachers and principals are behind this 100%, and are clamoring to get their labs set up. It's too bad there are only 5 techs for 50+ schools.
The Networked Writing Environment would probably exist without free (freedom or beer) software, but the applications available to students would be very limited. We have 150 seats in five classrooms, using thin clients (SunRays, NCDs, etc) with Solaris servers.
If we spent only $100 per seat on software, that would be $15K -- and I bet replacing StarOffice, The Gimp, our HTML editor, tkMOO-lite, exmh, Xplore, and other applications would cost a lot more than that. Not to mention that Solaris is free (beer) for educational use.
I'm sure there are also cost savings from using the client/server model instead of 150 workstations. We have two system administrators and one half-time graduate student, and a few hangers-on like me who poke stuff around when time allows. :)
The NWE has been around since 1995. With education budget cuts in Florida reaching into the hundreds of millions this year, and maybe more next year, I don't see the Solaris/free software setup being replaced with a non-free model anytime soon.
cbd
DO college's count, becuase here at The Cooper union most of the stuff we run is Win95 and Red Hat Linux. Mostly becuase this school does not charge tution, does it see the value in running Free software like Linux. They've made it work rather well. and espcially since all the computers are at least 5 years old.
Sun is Warm, Grass is Green
Why should we even bother with computers in the classroom until students get into high school? I live in Southern Louisiana and know for a fact that the elementary schools in my area have faster computers than my personal computer at home.
The majority of the computers that are in classroom in the high schools out here are not used regularly because the teachers either don't know how to use the software or they are intimidated by the technology at hand. I believe that the high school out here has two computer labs running 733+ Mhz computers where people browse the internet and do research through online databases. All of those PC's run Windows 98 and Netscape Navigator connected through a Novell gateway. Personally I believe that thin clients running linux/netscape/X would be a better deal.
How many people would notice the difference anyway? IF they have reports to type as well why not through StarOffice in the mix too. The schoolboard contracts all of their networking and maintenace jobs. The IT staff on hand is clueless about the most basic Windows options as I have had discussions with them before in the past.
It isnt that people are too ignorant to use computers, they just are intimidated by the technology.
There's more than just kernel source as a teaching resource. The shell scripts that are part of any distribution can be used as examples of basic programming concepts; likely with better results.
"Remember, any tool can be the right tool." -- Red Green
When I was in high school, my school had 6 or so labs of Windows 98 boxen. In especially the writing lab, during any given 90 minute class period there would be at least 5 or 6 BSOD's. There had to be a semi-admin in each room, plus one overworked guy over the whole school. I recall hearing numerous discussions about threats from the SPA to shut down the school's computers if they couldn't produce a license for each computer, etc. Viruses were a major problem as well. They had some insane security system set up using Novell Netware, and because Windows 9x is inherently r00ted the moment you install it, there are bound to be places they missed (and there were, trust me -- I know). There were many a day when my buddies and I would play Starcraft instead of work, simply because we could. In a Linux system, you need a third of the people, and they can administer each computer from a remote location. Most of the school's admin's time was spent running from one end of the maze-like structure to the other. Tools like ssh, and even basic UNIX security principles (with a more granular system such as SELinux even better) would've saved a lot of time and money. Even though a Linux admin costs more money usually, they need fewer of them.
A solution to the problem with music today
I don't know about you guys, but I'm able to check out MS products (including visual studio + MSDN) for free from my library. I can also purchase MS OS's / Office for 10 bucks at my university bookstore. It's all legitimate and obviously quite cheap. If they're going to offer it at such affordable prices, why wouldn't I take them up on it? Linux may be free, but most of the US population doesn't know how to use it. It's going to take awhile before it becomes common place in K-12 when a lot of teachers and parents don't know how to support their students /children. Most of the places around here (Ohio) still use Macs (and very old macs at that) in the schools even! As far as usability goes, Linux isn't very intuitive and not very usable (IMO), and it would take a great deal more time to teach than a mac / windows system. Why don't you spend the time that you would otherwise spend teaching the students how to use Linux and spend it educating the children on core subjects? The quality of education in a lot of places around the US is highly lacking.
How about we focus on a better education before we go throwing linux at students.
Do you chat your mother with those fingers?
Since these web stations won't allow these activities, and web browsers are fairly standard, you run less of a risk of confusing the average student than with a computer lab full of Slackware machines. This is a good way of introducing students to the web, and would require less administrative overhead since users can't do anything but execute programs ("I deleted all those 'dot' files in my directory. Is that bad?").
--All your stolen base are belong to Rickey Henderson
We run a dual pentium pro 200 with slackware 8.0 to act as a dhcp server and ghost image server. dhcp in Linux is defintley better than M$. My school in FL we have a full time sys admin and a team of 12 students to administer all the computers.
... of Analysis and Communications.
For certain mathematical and statistical problems, computers give people a means (not an end) to learn methods of analysis far too time consuming to perform by hand. Likewise, computers give people a means of communication not possible in their absense.
Having computers in schools allows students to develop an understanding of where, when, and how to use these iterative methods. This falls under 'rithmetic.
Like all sciences, computer science has its own language. Knowledge of the English language is usually not enough if you want to read a white paper. This falls under reading.
To contribute to the science of computer science, one must know this language well enough to compose in it. This falls under writing
By your argument, physics, biology, and chemistry are also unnecessary components of the cirriculum.
Why not use Apache with frontpage extensions? That way you get to use your PHP/mysql, and your boss gets to use Frontpage to update his pages.. everyone goes home happy.
The Government of Rio Grande do Sul, a state of brazil, is using Free Software in 5 public schools as a experimental project. It will reach 2.220 public schools until june, 2002.The government will save about U$ 16 million using Linux and StarOffice. You can see more details on http://www.redeescolarlivre.rs.gov.br/. Unfortunaly you must speak portuguese to understand. :-)
It needs to be remembered that the majority of HS students are not technically savvy. Imagine you are a member of the cheerleading squad, you want to write a report and check your hotmail account, are you going to care about the cost of the underlying software? No, you want the MS Word doc you wrote on your Daddys laptop to open (and save) correctly, you want the floppy or zip disk you brought from home to mount (of course you wouldn't know what mounting a disk is). You want the internet browser to function correctly and you want to be able to view the latest flash content at MTV.com. Any system in an education market would have to be configured to be totally transparent to the end user. Remember the end user does not care how cheap or easily configured the software is.
On a side note, since the majority of schools use and continue to buy Apple... wouldn't there come a point where OSX is prevalent enough that ported open-source software would make sense?
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
"The point of education is not to prepare little business people. And besides, I think that you underestimate peoples intelligence when you suggest that just because the learn KDE or Star Office that they're not going to be able to figure out Win XP or Microsoft Office. Come on. It's a damn GUI. They're basically the same thing. I don't buy this argument at all."
Wrong! Well, right and wrong. The current primary education system is supposed to educate K-8 students on the primary and basic language, math, writting, communication, and science skills... it's prep-school for High School. HS is supposed to give students more advanced concepts, hone their abilty to think freely and with clarity (nominally from multiple perspectives), and prepare them for adult life. This INCLUDES working and living in society (which are intertwined). By extension, they are being prepared to enter the working world, society. This preperation also transfers to College, which is more of the same.
Alternately, it is indeed just pure preperation for entering the working economy. It depends on your view point. I prefer the second, given how poor the majority of educators and education administrators are, the lack of funds, the malaise in education technologies and methods, and the government pentant for steering people down the middle and away from controversy or independent thought.
Additionally, the MAJORITY of people surely can figure out a GUI to some degree (though most far less than IT pros and support people would want them too). However, most people are resistant to serious change, and there are serious and distinct differences between the XP/Win/NT GUIs and Linux GUIs (especially the less popular and geeky linux GUIs). Small, minor, subtle change over the years is easy for most people, and MS has excelled at this in their GUI designs... note that XP is probably the single most radical divergence or change in the GUI in 7 years... big changes are not so easy and most people cannot adapt or refuse to adapt... it's in our nature, for good or bad.
"I just convinced the Psychology Dept at UCLA to install GIMP on 20 or so machines running OSX in a lab rather than Photoshop for every one. This saved the dept around $7000 with one change, and for what students do with photoshop the GIMP does exaclty the same. "
You are not seriously suggesting that GIMP is the same or even close to equal to Photoshop are you? Granted, alot of students probably would not need the advanced features of PS, nor do they want to learn them... but what about the students who need advanced features or want to expand their knowledge and learn them... you just screwed them. Just an observation... I HATE GIMP, free or not... it is so often misconstrued as a competitor for PS, when in fact it is not even in the same ball park.
Perhaps teachers SHOULD know a bit more about file permissions. If they did, they'd have a much better understanding, which could be taught to the students, if often only by example. More people understanding file permissions (whether under Win or Lin or whatever) will generally be more knowledgeable about at least BASIC security issues, and will be more prepared to deal with viruses and worms in the future (which will surely never completely die).
creation science book
It works, it's fast, it's free, we like it.
I worked for a couple years as a student intern at Michigan State University working for the SCNC project.
It takes FreeBSD as the server OS and the programmers hack it up a little and also create custom web interfaces to do admin stuff that normally would be done by a unix admin.
I don't know if it saved any schools, but has brought the internet, samba, news, email, and many other internet services to more than 100 different Michigan schools. Link provided to the SCNC website below. The project was also taken over to Africa and is serving some schools over there too.
SCNC Website and history
Two public schools in Manhattan use linux.
The Beacon School and http://www.beaconschool.org, as well as Stuyvesant, http://www.stuy.edu
Both have developed simple software tools using open source licenses.
lambda = h/p
http://olinux.uol.com.br/news/open_news.phl?id=575 9
http://www.efunda.com/math/reliability/reliability .cfm
But the real issue here is deducing something about a group of units, based on one unit's MBTF. Some discussion towards the bottom of this doc: http://www.hardwaregroup.com/faq/gen_mtbf.htm
This could be the initiative that is required to bring Open Source OS's to the enduser desktop. I remember back in the school days of wanting whatever computer was in the school system. Then you know how it works (or are taught) and moving files and programs back and for is simple. You already have a network of friends who will have the same thing too. I remember first wanting an Apple cause that's what we used at school, and I got an Apple. Then later IBM's with MS products were used (in highschool) so when it was time to get a new computer .. you guessed it .. IBM based machine with MS on it.
.doc files from work. Little johnny would be asking for a PC with linux on it pretty soon...
So as it would work out, the child would get into Linux (pick any distro) and StarOffice, and what ever other software at school then want the same thing at home too. They would teach mom and dad how to use StarOffice to work on thier
Only problem is kids love games.. and who's still got the best gamming platform.. Microsoft.. damn them..
In many cases the poorer students will not encounter computers at home. If they don't encounter them at school, we will be very effectively leveraging the digial divide into a more serious socio-economic problem. And I don't think that is what this country's about. At least not intentionally.
I'm trying to teach myself to set people on fire with my mind... Is it hot in here?
Here in Norway there is an organisation called SkoleLinux working for deployment of Linux in schools. It's currently working on an easy installer and proper translations of Office-products. It just recently got an 200.000 NOK in funding from the Education and Research department.
=-kiOwA-> EOF
There's a story on the Mandrake website about a California school that has replaced their entire (very large) IT department, as well as other parts of the school with computers running Mandrake. They still use macs for most of the student work, but are slowly switching those too.
My other sig is funny!
...has several Linux boxen up in different schools (one primary, one junior high). While the clients run Windows and MacOS, the fileservers and other backend systems are Linux boxen; thanks to Samba and Netatalk, they can share files to both sets of clients simultaniously, and they require very little maintenance (I do volunteer work when they go down -- it's been about a year since I touched one of them, though a few months less than that I wrote a trivial python script recompressing all students' GIFs into JPEGs for one teacher adminning the labs).
Not by doing work, homework, tests, paperwork, all that will teach them is how to complete a task in a timely fashion.
You teach a kid to think, by having discussions, having the kid write about the discussions and share their thoughts in debates. Having kids research on their own independently and gain knowledge, and then form their own conclusions.
If you use Linux, please help development of Autopac
They got fucking owned.
So what does that make a spirit made of corrupted astroturf?
"Hardly used" will not fetch you a better price for your brain.
if schools can save money using free software (linux or not) then it's good!!!
the whole idea that people can't switch between gui is just wrong
schools should just teach you the basics of using a spreadsheet program wether it's Gnumeric or Excel you just have to click on the little printer and there you go it's printing.
and the formulas to feed your spreadsheets are what really matters, teach a kid to understand that and he'll be ready for Gnumeric 5,star office 22,or MS office 2006
now maybe there's also a fault in our educational systems in that we learn to only be proactive in a specific environment, instead of learning the basic logic of something!!!
by the time they get out of school, students are not expected to be power users of any piece of software anyway, how many kids do you know learnt how Win98 works just from using it in school???
i could teach anybody how to use KDE, as long as they know they need to click here to
connect to the internet, here to launch a browser, even my granny!!!
at home i'm teaching my flatmate how to play a little with linux, just the basic things, and he's doing well, he prefers black box and windowmaker as window managers and the gnome if he needs a desktop
the result, he knows just as much as one should know about the internet by the time one gets out of school!!
windows or linux really doesn't matter, it's the logic that counts!!
if the sites slashdot links to get slashdoted, how come slashdot itself never gets slashdoted??
We have been successful in installing three Linux labs (approx 35 computers per lab) with Open Source software using the computers as thin clients (see LTSP.org). The system has been received very well by students and teachers. We were even able to give 486SXs with as little as 12Megs ram internet access - these systems are now in the classroom. We have approx. 10 schools scheduled for conversion to Linux by the end of 2002 with the goal of having all our elementary schools (60+) switched over in three. It's always an uphill battle but I feel we're fighting "the good fight". When they(Microsoft & others) tell you every open source initiative has failed tell them otherwise. I equate Microsoft with the movie "The Matrix" in which everyone goes on with their everyday lives while only a small liberated few no the truth. Our Linux Labs have worked better than anything Windows has ever given us for a cost that can't be beat.
John Cuzzola
jcuzzola@sd73.bc.ca
1383-9th Avenue
System Analyst/Programmer
Kamloops, BC V2C 3X7
School District #73
Phone: (250) 374-0679
Plenty of me too comments, but here is another.
Carey College in Panmure .nz, is using a Linux server on a 386/25 using recycled hardware. Their web site is hosted on Apache and uses a PostgreSQL backend.
Desktops were Windows 95, and I think there may have been some Windows 3.11 too. (There was also OS/2 at one time, but that was replaced with Linux.)
But that was when I was there - a couple of years back. I don't know what the story is now. I heard rumours of thin clients and application servers but haven't really kept up with it.
Last I knew, Grand Valley State University, in MI,USA used a number of Linux distributions in it's classroom environments; including Debian, Red Hat and Mandrake.
Granted, when I witnessed this it was in 300 and 400 level classes. However, it was the entire development/workstation environment.
Whoops, another Mentally Ill post.
There is school I installed Linux at.
It was running Novel and about 20 stations.
Now the linux station is a Domain Controller for the 20 Windows pc (soon to change ( -:)
There have been almost 0 problems.
1. Printing color photo's could be better..(settings CUPS)
2. Printing had to be updated do to a glitch (easy over internet via Mandrake update)
3. Novel (one program) runs via Novel server emulator (mars) but then the desktops want to use the novel protocol for everything but I don't want them to just that one program. Samba for the rest. I think this is just a setting as well per station.
Otherwise the principle commented that I am there so much less than the Novel guys.
And the teacher confirs that she wishes she did this ealier.
Thanks for the topic.
Al
nutile@ureach.com
I am not a CheckPoint fan, but I have never seen their license routine cause problems. CheckPoint identifies every IP Address behind the firewall, whether they use the Internet or not, as a client IP. The reason is, as far as CheckPoint is concerned, any IP addrsss behind the firewall is an IP address being protected by the firewall. In that sense they are correct.
As far as processor power required to print those messages, well a) it is not a significant use of processor power and b) if you are not in comliance, why should the product operate at its most efficient? Many companies would shut down the software if it were not in compliance, or perhaps refuse to protect more IP Addresses than you have license for. CheckPoint does not and they deserve credit for that.
-sirket
m00.
I've heard this argument more than once, and here's how I always respond:
"Yeah, I guess you're right. That WordPerfect for DOS training I got in high school [class of '97] is really paying off in the business world now."
There's no point in trying to teach applications, because even if the one prevalent today is the one used when you graduate, it will still be totally different. Schools should be teaching general computer knowledge and UI paradigms -- give kids the tools to figure it out on their own. Teaching Word and Excel should be kept to one-week night classes and "...For Dummies" books; it has no place in the education system.
If it ain't broke, you need more software.
Springfield High, in Springfield Illinois./ in dex.html
They have a student organization, Students for Integrations of Technology and Education (SITE),
and have established the first high school chapter of the AITP. Everything has been done with donated hardware/software/linux, by the students.Check it out:
http://www.shs.springfield.k12.il.us/clubs/site
Interesting thin client solution running linux on even old 486 computers.
The implementing companys press release is here: http://www.codefactory.se/news/?1+1.
Many elementary schools today are very dependent on software built for Windows / Mac OS. Packages like Accelerated Reader (a quizzing program with tests on every book imaginable), JumpStart edutainment software, Mavis Beacon Teaches Typing, WinSchool / MacSchool administration software, and a slew of other titles don't run well, if at all, under Linux.
... yet.
I would love to move our school to Linux on desktops, but I cannot afford the loss of some very valuable software titles, nor the cost of training teachers on a new platform.
Until Linux gets a good, free windows emulator (i.e. when WINE meets its promise), or until these titles can be ported or replicated for Linux, there are too many sacrifices required for some schools to move to Linux. For schools that do not have any software yet, Linux may be a good choice, but for others the tradeoffs just do not seem to be worth it
If your machine got hit with Nimda that soon, you were obviously installing it after Nimda started going around. Since it was already going around, you should have known about it and taken necessaray precausions (eg: installing the OS with the network cable unplugged, only plugging it in to download and install patches AFTER IIS and Indexing Service have been disabled). If you (or whoever did the install) didn't think enough in advance to keep and properly install a machine securely, it's your fault. Linux won't save you if you're not bright enough to think ahead.
-Steve
So he knows this isn't true, but now he needs us to tell him why? God exists, and yet only God can prove it?
We're setting up a wireless backbone using cisco equipment (so not the most cheapest alternative, but afaik the most configureable) and linux based web/mail/groupware/whatever servers...
No license-fees here. Only one Box of (SuSe) Linux.
I am the system administrator for a moderatly sized private elementry school. When I started, the school had very few computing resources at it's 2 campuses. After making a list of what I wanted to accompish in 2 years, I added up the costs and found that they it would be beyod my budget to buy new workstations and build a dedicated server all based on commercial software.
Here's what I've been able to create for the school:
1 workstation for every 4 children
So when a class is in the library there is 1 student per computer. They all run win98.
I am working towards 1 laptop for each teacher
So far there is 2, they are wirelessly 802.11b connected to the network.
A dedicated Red Hat 7.2 server
Squid proxy, web page filtering and monitoring Squirrel Mail IMAP web based e-mail, samba, LDAP student/teacher contact and vital information, a MySQL powered bookmark database, Apache Web server, and a digital picture gallery.
Everything on the server is open source and works flawlessly. All of this would have cost a fortune to buy and maintain on a NT server.
I am very interested in what software other people are running if they are doing the same thing that I am. Reply to this comment or e-mail me with what you run, I'd love to share tips.
rejected (19) accepted (0)
Is there a psychological term related to getting your stories rejected on slashdot?
In Nortway, a group of programers have started making a linux distr for schools. It's called skolelinux (school-linux). The distro is (offcourse) free, and is now in a very early beta stadium. Also, many schools in Norway use Linux. All these projects have worked out fine. They usually use a really good computer as a server, and 486's as thin clients. check http://www.skolelinux.no if you know Norwegian :p
Sig e godt =)
I have six years experience teaching Advanced Placement Computer Science in a public high school.
To introduce a non-MS OS, you will have to sell it to your computer science/Cisco/A+ teachers first. Those teachers are always hurting for extra dept cash for materials, and not having to be Microsoft's bitch for NT Server and Workstation licences would be wonderful. Just take an inservice day to do a Mandrake install on those select group of teachers, and you got the ball rolling. High school Cisco training programs require FTP servers, webservers, and other client/server software to make the labs interesting.
Knowing how my business computer teachers operate, it would be a cold day in hell before they adopt Linux. They would not only have to learn a new OS, but also rewrite every one of their 32438430 dittos.
There's also no textbooks or handouts for teaching at a high school level of Linux or Linux apps. Compare this with the phenominal amount of offerings for teaching MS software.
"Free" software is in use here and there. I've not heard of any schools who were "saved" by its use, but I do know several schools who managed to save quite a chunk of money by moving some of their server functionality to Linux and FreeBSD servers.
Coming from the perspective of someone who developers student/school management systems, there are two competing factors at work as far as getting open source solutions implemented in the schools:
1) Microsoft's prices have risen drastically (and Oracle/Sun/IBM prices have never been particularly cheap), and this is forcing schools, districts and states to consider options that they might not otherwise consider.
2) Perceptions prevent the adoption of open source solutions. Microsoft is trusted, no matter what their "tech" reputation may be, and support is infinitely easier to acquire. Oracle/Sun solutions are hellishly expensive, but they have a certain reputation for speed and stability. IBM solutions tend to waver between these two "poles". Facts being what they are, most of the open source/free software solutions do not have anything approaching the "trust" that schools are willing to place in these.
I have seen some larger districts flatly refuse to accept a Linux or FreeBSD implementation of the web server (just the web server, mind you), even though this would have saved them 20-30 grand.
Management systems being absolutely critical to the schools, they simply are not willing to take a chance that "you get what you pay for" is not always true.
And, of course, any company developing apps for schools has to accept the fact that it is very much easier to acquire (or replace) experienced developers and administrators in the non-OSS world.
Things change, of course.
No. All that giving kids Micro$oft programs will accomplish will be to tie them to this corporate giant, making them more slaves of this opressive orginization. /rant on
Is this what schools really want? And will this really do anything to correct Micro$oft's antitrust tendencies? NO! If anything, it will make things worse. /rant off
TANSTAAFI: There Ain't No Such Thing As A Free iPod.
There is another organisation in Australia called computer bank http://www.computerbank.org.au that provides PC's and computer training for disadvantage groups
They use a open source solution involving Linux so that licencing issues that effected PC for Kids do not trouble them.
Using Linux on file servers and web servers is almost always a clear win for schools. Most computers in schools aren't file servers or web servers; they are desktops for students to complete assignments and do research.
Unfortunately, Free desktop environments like GNOME and KDE are much more resource intensive than Windows. For schools with middle aged hardware, running these environments is not an option. In this case, there is a clear cost win for Windows.
Luckily, it will all change with Windows XP (or should that be Windows PX for PentiumX required).
Even Slashdot wants to hide some things
Hi!
The scene: "Public Comment" time at a school board meeting. The previous speaker, a senior citizen, has spoken at length about the burden of school taxes on the elderly in the community. He has particularly emphasized his opposition to the blatantly gold-plated technology proposals in the school budget (including the 4--count 'em, 4! PDAs for the district IT staff). Then the school board's self-designated Taxpayer Advocate clears his throat, and says, "Y'know, I was talking to our IT director at work the other day, and we're getting rid of a bunch of computers. Some are 486s, but a lot are Pentiums--we could provide a lot of those machines to the district at little or no cost....
...And another dumb IT decision is in the offing. Lots of people want to donate their downstreamed equipment to the schools. Sometimes they genuinely think they're doing good: most of the time they're trying to claim a tax credit for the contribution, and will "suggest" valuations for each machine that they drop off. All too often those donations cost the district actual cash--because you have to pay a HazMat hauler to take the monitors these days.
Linux and other free (as in beer) software may well have a place in education. There is a very powerful argument, for instance, for creating an Office-type suite with extensive classroom management tools. Given that school environments can be extraordinarily hostile (think of the kinds of behavior that occurs in a middle school classroom if the teacher steps out into the hall) there is a persuasive argument to be made for a robust platform like (ahem) FreeBSD.
But. Please please please do not even think of saddling the poor, overworked techs at your local school district with your worn-out, leftover, good-for-nothing junk. You are doing them no favors, you are doing no good to the district, and you are probably preventing adoption of a well-thought-through technology plan by "donating" your scrap equipment.
Computers in schools
I'm on the Technology Committee of the Nazareth (Pa.) Area School District. We've played out that scenario at the top of this post several times. We have had several area companies offer to donate their scrap to us. We have had several board members get positively indignant that we have spurned those offers. We did spurn those offers, and if I have any say in the matter we will continue to spurn those offers--here's why.
This is a hostile environment
Suppose your employer decides to install a new computer system. And suppose a computer-phobic customer service rep decides that he doesn't want to use the new system. Your employer has a simple remedy: fire the CSR. Doesn't work that way in American schools: if you want the teacher to use a computer, you have to persuade her/him.
This is a hostile environment #2
Teachers (no surprise, right?) don't want to look stupid in front of their students. But the kids are substantially more adept with computers than the teachers--so the teachers have a built-in ambivalence (at best) about computers.
So we have to persuade teachers to use a device that potentially can humiliate them in front of their students. How?
From hard-won experience, the district IT staff has to offer absolutely bullet-proof reliability. They have to be able to guarantee--and deliver on that guarantee--that the computers will be there, working flawlessly, whenever the teacher wants. No reboots, no network hassles, no video driver conflicts (elementary teachers probably use more video games than CmdrTaco), no need to get an MSCE in order to teach 3rd grade. In other words, the district IT staff has to provide Service Level Agreement-style functionality.
But...
do you think this means that anybody is willing to pay for a district IT staff? Funny boy--the school board will fund an extra assistant to the wrestling program in a heartbeat, but they won't spend a dime for a part-time LAN geek unless you do some major politicking. So what IT staff you have (4100 students, 450 employees, 7 buildings over 80 square miles, 3.5 IT staff) have to make do with what they have.
Which means...
They have to standardize, standardize, standardize. Every elementary classroom has to have the same video cards; every machine has to have the same network adapter; every machine in the high school has to have the same monitor. They have to develop a formalized bug-tracking system to identify recurring problems, and they have to take a systemic view of the entire IT picture in order to maintain 100% uptime. Because if they provide less than 100% uptime the teachers will stop using the system, and the parents will start calling the school board. And so forth....
So please...
Don't "do the kids a favor" and ship them junk. If you want to make a meaningful donation, call the school district and ask if you can give them the money to buy another one of their reference desktops. If they're running Windows, hold your nose and buy Windows. If they're running a bunch of out-of-date kiddie games, hold your nose and buy the out-of-date kiddie games. Do not make their lives miserable by sending them leftovers, or by going out to Circuit City and buying a $399 special. (God save the IT staff from the enthusiasm of the PTA.)
If you want to champion Open Source in the schools
Don't go preaching Linux as religion. Get involved, go to meetings, be prepared to make a reasonable case, and be prepared to argue for a complete replacement of the entire district IT infrastructure. And be prepared for war from the elementary teachers and the PTA: elementary school software runs on Windows, period. If you want to replace it, you'd best have a bunch of kids games tested and ready to go.
Bottom line:
Computers are crucial to education in the 21st century. I teach in a graduate program, and I'm constantly amazed at the number of MBA students with only the faintest glimmer of understanding about computers and technology. But the route to learning about computers and technology is not with leftover junk--it is with a carefully-developed, meticulously-managed, (and yes, sometimes rigidly enforced) IT plan that promises a "100% school time up time" service level, and delivers it. If the users can trust that the computers will be there, they will learn. If they can't trust the computers, they will learn to hate them.
GNU skole is a project, working to bring free software (GNU/Linux) into elementary school in Denmark. Run by admins for admins.
They do an effort to get educational software translated into Danish, and they're writing guides to other admins wanting to integrate free software in their school network.
What the hell is it with you people and computers in schools ? How RIDICULOUS CAN WE BE ?! There is no worst waste of a computer -- and that includes throwing one in the garbage heap. At least if you throw it in the heap there is a chance a trash collector, or junk scavanger will find it and use it. If you put a computer in a school it will collect dust, occasionally increase the school's electric bill, and get a couple kids in trouble for bringing up some hot pornographic images--THAT IS ALL. There is absolutely no sense in having computers in schools. And anyone who believes that there is has NO SENSE IN THEM. Do you fuckers even realize that those who go into education are the consistent bottom of the barrel, lowest SAT, the people who SHOULDN'T HAVE GONE TO COLLEGE BUT DID ? You think they're going to want their students, or at least the 90% who are smarter than them, showing them up ? Hell no. These are the kids that made FUN OF THEM, they remember back when they were in school, and they arn't about to going using a computer in the classroom and being the fools again.
SO PISS THE FUCK OFF
And quit spreading your Linux propaganda. Why do you want normal people to use it ? Aren't you happy being part of something that is for YOU and YOUR TYPE, but is notably incompatible with the majority of intellectually inferior, technologically unsavvy computer users ?
Disclaimer: My wife is a teacher and I would benefit economically if they were paid more money.
I find it sad that some say "teachers are paid too little" when quoted this price or that, but never seem to be able to put a dollar value on teaching labor themselves.
It irritates me because I think if someone is going to complain about a problem, they should at least offer solution to it (even an imperfect one). If they don't, it doesn't even matter whether they fully understand the problem or not, they are simply 'stirring the pot'.
...yellow number five, yellow number five, yellow number five...
I don't know about anyone else, but when the last couple years I was in college, Microsoft software was free to all university students. Office, Win2k, XP, 98, 98SE, FrontPage, Visual Studio... pretty much everything. Using open source only saves on the tip of the glacier. It isn't the operating system that costs money. It's the specific applications that people use in each major. I know my department was paying $16,000 per license for Synopsis. And there are approx 70 people take that class at any given from semester to semester. That's more than half a million just to use one program for one class.
SEUL.ORG has some educational experiences that they have been gathering up. I am also working on starting one in SouthEast Michigan. I also know of a few others in this area that have gone well. Contact me for more information if you need to.
The problem is many school systems rely on Attendance/Grading/seating/management applications that are very, very costly. The vast majority of these platforms only run on a Windows Platform. I do computer support work for a number of schools around omaha nebraska, the one thing you see in common with them right now is they all run a Novell Server, they all run Groupwise, and they all run windows 2k/9x workstations.. Why do they all run the same type of file servers/workstations? Because the vendor of their core applications tells them to. Plain and simple.
I am in the process of organizing a charitable project that will be fueled by donations that will benefit both underprivileged children and the Open Source community at large.
/. is my firs posting when we go live with our endeavor.
Official release date for the project is Jan. 1st 2002, and will hopefully work, not on saving the schools, but on empowering the next generations of kids, and teach them to excel in an Open Source / Free Software environment, regardless of their social class.
The project will first start as a Canadian charity (that's where I am), but hopes to gain volunteers throughout, who will directly benefit their own locality.
I'll make sure
When you actually explain this to teachers and principals in concrete terms, they are receptive. On the other hand, if you're being interviewed by the IT people, you're probably screwed (unless they already have seen the light).
Thomas Jefferson is a magnet school in Northern Virginia; its students are often quite extraordinary.
- David A. Wheeler (see my Secure Programming HOWTO)
I know schools in Eastern Europe use loads of free software, esp. Linux but not only. Lookup the Soros Foundation and you will see. I know this because I used it for like 4 years high school + 6 years college and master = 10 years.
I attend Wayland High School in MA. Our computer lab consists of a bunch of iMacs and G3-All-in-ones. This year we also acquired a bunch (15/20 maybe) iBooks and Airport Base Stations. A teacher can sign out the iBook station for his or her class to use for a period. Supposedly, they all really like it (the labs can be crazy to run a class in).
Earlier this year, however, I was involved in a Computer Graphics independent study. I was writing my software to run on OpenGL/X11 in LinuxPPC. I tried to get the computer people to even let me install Linux on a single computer, but there was no such luck. Her major point that she used against Linux was that our school has over 900 software programs that run on MacOS and she couldn't justify losing even one computer that could run them.
I think this is something Linux users forget. Linux office apps are OK, but school isn't all about Office. Sure, Linux can handle word processing, web browsing, etc. But how many "Mario Teaches Typing", "Interactive Physics", "Electric Field Hockey", "Geometric Golfer", "Geometry Sketchpad", "Green Globs and Math Equations" (to name a few of the ones I've used in various classes) are there for Linux? Sure, Linux can take care of all the work, but how much learning can it provide?
Maybe some company could take on writing a bunch of educational apps open-source, and then make a profit on binary CDs, etc.
-Toad
--
- It ain't easy, being green.
I went to some sort of festival in the town of Penguin, Tasmania (part of Australia) a couple of years ago. There were a lot of displays, and I went looking for someone with computers to hassle them about using Linux. The only display I found was a small christian (primary) school .
Guess what! They were using Linux! Had a nice chat with the guy, who said they were using it to save money, and it was working out well.
I don't remember who they were, but it wouldn't be tough to find out. (Tasmania has less than 500,000 people, and Penguin is small even by Tasmanian standards).
A local Linux company, IDEAL Technologies, helped a local private school set up a Linux-based infrastructure, and provided training to the school. The company mentions it on the Community Involvement page of their web-site. The school also has a web-site running with contact info. It might be useful to contact them for more details.
When I was in Junior High School, my computer lab taught us how to use word processing software on the most common PC available: the Apple IIe - I don't even remember what software we used. In high school, we had a lab full of really popular TRS-80 Model IIIs with WordStar or somesuch. In college, we had a huge computer lab chock full of IBM PS/2 workstations with the spiffy new 3.5" disks, and I took a [required, but lame] course on popular business software. We learned how to use the industry-leading WordPerfect and Quattro packages, and some dBase clone for a database. It was imoprtant to learn those packages, because that's what industry was using, and we wanted to be ready for the 'real world'. :^/
Guess what? The world doesn't stand still. A kid in Junior high today who learns to use MS Word because that's what his mommy uses at work will probably find that knowledge irrelevant in 2010, when he graduates from college. At least the typing skills will probably transfer.
So I don't wory too much about these kids learning to use StarOffice while the 'real' world uses MS Office. A wordprocessor is a wordprocessor is a wordprocessor, and everytime the world forces them to "upgrade" to a new one, they'll adapt, learn the new keystroke combination for bolding text and creating bullet lists, and then move on with their lives.
In the meantime, our schools are desperately short on cash; we would be far better off spending the money that would have gone to Micro$oft for their overpriced office suite on things that will still matter 10 years from now, like rasing salaries to attract smarter teachers, or hiring more teachers to reduce classrom sizes, or ... [insert your favorite expensive school reform idea here]
the open source education foundation is probably the most successful foundation at putting open source software in schools. Our co-founder, Harry McGregor, is a keynote at this year's LinuxWorld. I highly recomend looking at our site, and/or contacting us if you are interested.
osef.org
As someone who uses only free software at home, and the network administrator for a medium-sized (~500 kids aged 11-16, ~50 staff) high school, I'm very keen to push free software in there wherever possible/appropriate. I've got kids, teachers, my boss, the head teacher and even some of the bureaucracy beyond the head all very interested with the philosophy behind it all, and very impressed with the demos.
But the fact remains: the kids have to use Microsoft. They have to use Microsoft Windows, Microsoft Office, and Microsoft Internet Explorer. All I can do is implement free software around all that (i.e. by making available alternatives, such as OpenOffice) and try and educate as many people as I can; until that changes, it simply isn't a possibility. The people are there (at least in our circles, where we *are* those people) and are all very willing and capable to implement free software in schools, but until we get the right people to make some changes, most of us are stuck with Microsoft.
try http://www.schoolforge.net/
I am involved with a school division which uses Win, Mac, Linux and UNIX OSes and tries to use free (as in speech or beer) ware as much as possible.
After all the talk re the Microsoft/DOJ agreement with M$ setting itself up for increased profits using the poorest school systems in the country to do it and after Red Hat and various open source orgs have had a chance at counter proposing, here's another modest prop0$al related to the topic:
Public schools should only be using free (as in beer) software for instructional purposes where the product is released into the general marketplace. --OSs and application software. Schools have been willing assistants of private enterprise in advertizing the goods the kids will be buying at a future date. And we love to spend large chunks of our budgets to do this! What other industry has such a cohort of willing salespeople pushing product on a captive audience?
Public education is often criticised as having a prime focus on creating good consumers. We do that in spades when it comes to software use.
The ethics and legalities are at opposite poles. Ethically we should be exposing kids to all sorts of appropriate tools with an eye on the social and economic impact of what we do. We do exactly the opposite. Typically we get Windows onto a machine get Office and a few multimedia 'educational applications' and sell that to our community as being a complete solution. Ethically we should be doing something very different --rather than being front-line salespeople for Bill or Steve.
And legally we have to pay for the honor of being big business's flunkies! We have to pay a per-student or per-station license for most products from the private sector. As the useful life of hardware increases (ie using old machines as terminals on 'hot' servers as in the Linux Terminal Server Project) and the new boxes get cheaper -- as the ratio computers:people approaches 1:1 the system fails having to transfer huge amounts of capital to Redmond or Silicon Valley.
So schools should not be allowed to buy any general purpose commercial software and vendors should not be allowed to sell this stuff into public education!
That would leave budgets to buy 'real' instructional and administrative applications designed for the educational market and encourage development of needed software instead of the large amount of 'edutainment' ware targeted primarily at the home market.
So what are some of the free offerings we use:
Linux - all file services (netatalk samba, nfs) and all infrastructure services mail, web, DNS www proxying/filtering, nis
Linux user applications: Star Office, GIMP, Netscape, Opera. Logo & Python in Computer Science (the games that go with K and Gnome)
Under Solaris: Netscape and Star Office on terminal (SunRay) servers as well as web proxying
Your mistakes are so obvious.
/bin, /opt and stuff like that. You can't just dump a default distro setup onto their screens and expect them to "figure it out." You need to put icons on the desktop for each application that they need. Office apps, gradebook, web browser, email, maybe a teaching program or two. Thats it! You need to treat the classroom systems more like kiosks than a sysadmin/programmer training ground.
First, did you test moving koffice files to msoffice before you rolled it out? Doesn't sound like it.
Second, teachers are angry that their windows programs didn't work? Did you ever think to ask the teachers what they need before you "upgraded" them? If you have functional equivilants, I don't see the problem. This falls into 2 categories. Programs that they need and must be there (determined from your requirements analysis), and unnecessary fluff that they shouldn't be running at "work" anyways. Seems simple to me.
Third, why do the teachers even *see*
If you can't think like an end user then I'm not surprised it failed.
Brian
I'm not surprised to see you don't really understand the purpose of a teacher, and that your teachers are, in general, crap.
First, my qualifications. I spent the better part of 25 years with an elementary school teacher at least 5 hours daily. (That is, 7 days a week, 365 days a year) and he tended to try to teach me a lot, being as he was my father.
A teacher's purpose, first and foremost in life, is to let the students excel.
It does not matter one single little bit if your students are better, smarter, and quicker than you. As long as you can guide them in a positive direction, you are a successful teacher.
The best teachers I've ever had in my life knew about 1/100th as much as me about computers, math, English, or art. It was obvious my computer teachers would never think about computers outside the classroom, whereas I have been a full-on computer geek since 10 years old.
But you know what? IT JUST DIDN'T MATTER, because when they realised that I had obvious talent in these 4 little areas, they pointed out sources where I could learn more. They gave me guidance, much like a good art critic gives guidance on brilliant pieces of art that they themselves could never actually CREATE.
Your schools, and all schools, should accept every single piece of scrap hardware it can get its hands on. And every single copy of Windows and Linux it can get (for free).
And here's how the class should be run. Since the teacher obviously couldn't install Windows or Linux or anything, the teacher can print out the READMEs and the Windows docs, and give them to the students.
All the computers in the classroom are, you guessed it, BLANK. They have formatted, empty hard drives.
The students would install Windows on this machine, Linux on that machine. Oh! That machine has no CDROM, so the students would create net boot floppies and install Linux via HTTPd.
You think this is too tough for students? BULLS**T. I learned enough about installing Linux that I could do it on my own, using no outside guidance, in about the length of time of a single-semester course. Give the students a year to go from blank computers to a basic, functional Win2K, Mandrake, Debian, and Redhat.
Second year course can be configuring X servers, development environments, make, configure, word processors, spreadsheets, email, etc.
A lot of you probably don't have faith that students are as smart as I propose. You probably think what I propose is simply impossible, that no such course could possibly work.
For such doubters, it's time to do your research. One name. John Taylor Gatto. Google is your friend.
Go to it.
fifth sigma, inc.
We were in compliance. We had 75 hosts, total, and 100 licenses. It incorrectly identified IP addresses, and it's not really my problem to figure out why. It's the vendor's problem not to cripple the product without reason.
And the license logger was in fact pegging the cpu. You are simply wrong about this. It did in fact hamper the performance of the firewall and the only thing they could have done worse was permit unexamined traffic through.
I am now talking to the city council's eduction department about getting major deployments of linux city wide (Manchester in the UK)
We are widely acknowlaged as the most advanced in terms of computer and network use in the city, and one of the most advanced in the UK and the headtecher says that "This would not have been posible without linux it has saved me money"
People who are interested in this sort of thing please contact me we are more than happy to act as a referance site for linux and open source in schools.
Mandrake maintains an area of their site about successful business cases. Here's a link to their education section:o p= newindex&catid=26
:-)
http://www.mandrakebizcases.com/categories.php?
One of the schools (K-12) provides "Internet connections for our students. In fact, we are our own ISP with a OC3 backbone connection to the net. We handle dialup Internet services, email, FTP, student web sites, company web site, web-based calendars and databases, video-conferencing, as well as web office suites, for approximately 7000 students."
Hope this helps.
The idea here is not to teach kids a particular OS or software that happens to be the latest fad in computers. What is needed is to teach the kids the theory of how a computer works. This is how I learned... When I was first starting school (1982!) we had back then the top of the line Apple II computers - that we had to learn how to load with a cassette tape! To this day, the concept of "loading an application into memory" has not changed - be it with tapes, floppy disks, cd-roms, etc. The same goes for the concept of a "file" - A file is a file is a file, be it on an Apple II, a PC, a Linux box, or even a Kaypro II - and at a young age (6) - I was able to understand the concept of a word processor file being different than a, say, database file.
My 5th grade teacher had a great way of teaching us how computers worked - that is - the theory of how they worked - by having us use different applications such as AppleWorks, Bank Street Writer, and AppleWriter, we were able to understand the concept of using a "word processor" and able to deal with the concept of saving a file, printing, etc... rather than simply knowing that "to get a paper copy of what you are doing, press Open-Apple-P" By being introduced to the concepts of what we were doing rather than being trained to be button-pushers, we learned a lot more about computers. This trend has reversed itself in recent years though. Now, students are forced to do things "one way" on the computer - only use one brand of word processor, etc. Any student that shows the least bit of problem-solving ability or interest in what's going on other than what the teachers "want" you to see is immediately declared a "hacker" (in a bad sense)... one person my sister (who is still in high school) told me about got suspended for HAVING WINDOWS PRINT TO THE PRINTER OTHER THAN THE DEFAULT PRINTER - that is, to say the student wanted to print whatever was on the screen to a different printer than the one that was set up as the default.
Why is this? Kids should be encouraged to understand the concept of what "networking" provides, rather than hiding the innards of the operating system from students.
Or are today's schools merely trying to educate kids to be more compliant with laws such as the DMCA?
-Rick
Hello ... ?
;-)
I thought School is about education.
At least, here in Germany it is (or was, last time
I went to school some years ago).
"Valuable Training" ?
So, your "High School" in USA is basically a state-funded training-academy for "The Industry" ?
Geez - and I thought You were against too much
state-influence and subsidies
cheers,
Rainer
Windows 2000 - from the guys who brought us edlin
my scenario is from a university.
we are giving literacy programs to faculty/staff to beef up their knowledge in computer apps. majority of the them have 0 IQ in computers and it is actually difficult for us to even pursuade them to use computers for their own benefit. i am not sure if teaching them linux at start may have a good or bad reaction based on userability of it. we may have lots of time giving our support to do small functions compared to windows where it is point and click.
is there any real math that really says that using linux will indeed save you? meaning if you have 2000 faculty/staff to train all of them to linux and then providing support compared to train all of them to windows then buying software then providing support? **assume these people do not know anything about computers and all computers will be brand new so do not include the savings from not upgrading**
is there any study made how a user will be able to absorb concepts and functionality of linux with windows? this will more or less determine the support and training costs.
we are buying microsoft products here and there are numerous ways of licensing available. it is just finding the right combination in order for you to save money. there are certain options which we can get around 50% of the academic license price (this is legal.)
microsoft is less than half of the story. we buy more expensive programs like avid express, adobe photoshop, premiere, illustrator, pagemaker/indesign, macromedia flash, director, dreamweaver, authorware, autodesk autocad, 3dstudiomax, retas pro, and other engineering/graphics design software. is there any opensource alternative to all of these? i think windows is cheap compared to the others. office will be used in the office and it will not be that much compared to the ones used in the classrooms.
we are also doing some outsourcing of certain programs and we are looking at companies some with background in opensource and linux. even though the software may be free, the development is not and i think it is almost comparable to the development in visual basic (where it is rather easy to create programs.)
your feedback will greatly be appreciated.
Live your life each day as if it was your last.
Some geeks are large and psychotic.. like me.. and I have one programmer friend that is almost as tall and along with being a great programmer teaches Kung Fu classes. Sometimes when you hit a nerd they turn around and knock you on your ass and then delete your bank account and disconnect your phone service. In my last year of high-school there were two of us exceptionally scary geeks and for once the geeks in the school were shoving jocks out of their way. Protection for your own is a great thing.
I would like to note two examples of linux use in schools: first my former senior secondary.
:)
We had a single mail + web server. I was running Debian GNU/Linux.
Now, I was running on the hardware (and actually still is) that was too old for the Windows workstations. I think the one now in use is P120 with 96 MB ram (more ram was added and a larger hard drive was installed when we made it a server, but otherwise it was just an outdated workstation).
The was some problems, but none of them took too much time to fix. Worst case was when both hard drives broke (physically, nobody actually knows why). Ever tried to get a Windows web + mail server running in one day ? I haven't, but a whole new linux system was installed in three days.
Got old web pages and mail boxes back using alternative ext2 superblocks and heavy use of e2fsck. At least most of it.
There has been but one problem since the installation about 2 years ago. It was a APM problem with the mainboard. Fixing that no reboot (apart from power outages) has been done.
And with almost zero adminstration.
Voluntary administration by hobbyist students.
I think somebody updated Apache at some point but
that was more like "let's update to get this fancy thing" than from need.
Another example is my university (Helsinki University of Technology). About half of the workstations are running some kind of Unix. To my knowledge most of the servers are running some kind of Unix. And you have several "stupid terminals" around the school to connect to the shell servers.
Debian Linux is what atleast some of the newest computers are running. As there are hundreds of computers using Free OS really makes a difference.
Of university I can't tell much more as I'm just a first year student, but many people prefer using UNIX terminals/workstations to do simple tasks like reading mail etc because they work faster and are more stable. Many people with not much experience with computers actually find learning to use unix more easy than learing to use Windows. Futher they find that with UNIX computers they can actually specify what they want to do rather than hoping windows to do what it wants
The dual OS sceme (actually multi as there are also atleast SUN's and IBM's unix workstations too) works fine. By using Linux they probably cut down the UNIX expences even more than they could cut down expences by turning all windows machines into Linux machines.
Software should be free as in speech, but if we also get some free beer, all the better.
I think, perhaps, that you misunderstand how CheckPoint works. Are you taking into account printers and other devices on your network with IP addresses? These all count towards the host limit. Were you swapping IP addresses frequently and perhaps not giving the license manager time to timeout old addresses? Did you have rogue laptops that you are not counting?
/etc/system, the box is probably not configured for optimal performance.
The only thing that CheckPoint does, which bothers me is that a single host with multiple IP addresses count as multiple hosts in the license manager. To me, CheckPoint should be protecting hosts and not IP's.
As far as the license manager goes, I think you are simple wrong about this, or perhaps have a seriously under-powered system. Have you actually tuned the system for CheckPoint? Are you running on Solaris? IPSO? NT? Does the system have enough memory? There are a number of system performance tuning documents for Firewall-1 which are available from CheckPoint's web site. You may want to look into these. If you are running Firewall-1 on Solaris, and have not made changes to
-sirket
I've just set up an old, donated PC box at a church I work for (as a volunteer) to be a firewall - they have recieved a sizable donation to be used as a computer lab by the community kids who attend the Homework Help Club and other such services (at which I also tutor).
This is a fairly decent machine (pentium 233, 32M RAM) - more than enough functionality to be a firewall (IPChains/IPTables, BIND, SQUID, DHCPD). My question now is, are there any programs that can utilize the remaining time effectively?
I would love to have the following features, if at all possible:
- access to GNU compilers (free) over the network. Editor tasks run on (windows) clients and just compiliation and execution takes place on firewall box. Possible? Or should I look into CGYWIN?
- access to Linux proper. X servers for windows (for free, and open source) anybody? Telnet's the *easy* part.
- easy re-imaging of all client systems. Should I look at samba for this or does anybody have better sugguestions?
Any other help appreciated! Thank you in advance!
--_Knots
Anarchy$ dd if=/dev/random of=~/.signature bs=120 count=1
Hi!
Thanks for taking the time to write. However, I'm not sure we're communicating. You have described a splendid concept for a computer-oriented program for older students. You suggest that you could have done all of what you propose at age 10 (start from fdisked machines, a stack of CDs, and a pile of printed README documents). You seem to suggest that since you could have done this, anybody could have done this. And you seem to think that spending an entire year doing this would be beneficial.
Alas, the Pennsylvania Department of Education would probably disagree. They would vastly prefer if the district's 10-year-olds were engaged in other pedagogical pursuits: reading, writing, 'rithmetic, sex education, drug-awareness education, enviro/political behavior modification, etc.
Please forgive the sarcasm, but please also understand that the focus of computers in classrooms is not to make computer techs out of the 6th graders. The point is to use the computers to learn academic subjects. We don't want students, or teachers, to ever have to think about partitioning a hard drive or re-compiling the OS kernel. We want them to think about using e-mail to collaborate with an "email pal" across the world; or to use NetMeeting or Groove to collaborate with students in other district buildings. The computer is not the raison d'etre--it is the tool.
Don't feed the troll people, are you stupid? HE"S A TROOL! A TROLL!!!!
http://www.riverdale.k12.or.us/linux/k12ltsp.html
for starters. Plus the linux terminal project.
ALot of the software for the school desktops are like games. If we could get these educational games to run via Wine or Transgaming then i think the linux desktop would be a possibility.
Of course the natural progress will be better apps for linux like tux typing, but for now?
Anyone want to help?
Alfred Nutile
nutile@ureachc.com
http://co-op.web9k.com/tfe/
Free software ideologically works well in schools. It can be inexpensive to impliment and once you've got a good set-up going you're pretty much set unless you need to do like some major overhaul of something. Linux and FreeBSD are just a bit more robust than Windows and have enough software available for them to teach people the computer concepts they need. It's better to teach them concepts anyhow, the OS underneath doesn't matter much if you teach them the difference between ASCII and binary files, that it means when something is executable, and the basic tenents of word processing. They don't need high school to teach them highly technical skills, thats what they pay to go to college or trade school for. Trying to make the high school responsible for producing workplace ready people overextends their already meager funds.
However the bad thing about Free software is the lack of an educational infrastructure. Linux works well if you wanna use a computer to teach people about computers but what happens when you want to teach people about literature or history? Responses to that question including the word "internet" will be ignored. Why? When you're looking for something specific most of the internet is just complete cruft. Although there are some good sites you can use it sucks trying to them for educational purposes at times. It'd suck to have a page up on the projector and then have some x10 popup dominate the screen. It's far too distracting for trying to teach somebody something. Using the web as a info reference is tricky because if they don't know anything about what they're researching they'll grab a bunch of "facts" from Joe's House of History and turn it in not having learned anything. I think a free OS would be a good idea for schools if you could build a curriculum and not have the OS holding you up. Computers are information tools, not an end unto themselves. If you're going to deploy a free solution to your problem make sure it fills ALL of the requirements, not just be less expensive than Microsoft.
I'm a loner Dottie, a Rebel.
The servers provide file and print through Samba, authenticated web and ftp proxies via squid and the potential of an email address for every member of the school system, all tied together through an LDAP directory (provided by OpenLDAP).
The desktop PCs are, as I said, Windows boxes but the office suite provided is Sun's StarOffice 5.2 (presumably to be upgraded to 6 when it is finalised).
Check out www.latis.net.au for more info.
Here is a pointer to an article about a swedish high school using Linux and old PCs as thin clients.
The article is in swedish, but I expect you to be able to read it and get the general meaning by using googles translation services. The headline says "Old computer gets new life in school project".
There is a project going on!
http://www.riverdale.k12.or.us/linux/
Wolf
Where ever you go, There you are
I dunno if this relates to anything but i attend a high school in kelowna, BC canada and i LOVE LINUX. I am constantly giving presentations to kids and teachers that are interested in linux and what it can do. my highschool alone has at least 150 computers in it with many labs, unfortunatly all windoze crap. i once had a convo with the head network admin. of the school district and asked him if linux would ever make it in anyway to our school's (as servers or workstations) and he told me that linux,in his opinion, would never make it to the school system. I figured that he either had no experience with linux what so ever or that he was just too afraid to change. I personally would really like to see linux used in schools more but i am convinced that it would take somthing HUGe just to get the network admins/school officials to see that linux would save them money and time, because of the main reason that most of these guys are old foogies that know nothing about linux. You know what they say about teaching a old dog new trix eh? well thats just my 2 bits.
Well said, bravo, so true, couldn't have said it better myself.
Bob-
The Ludwig von Mises Institute. The reasoning individuals economics
Happy reading!
Richard
I learned to read using the sounds of the words and that has led to a very slow reading style. It takes me a long time to read because I need to hear things in my head to read. Now I must spend much time learning how to get the meaning of the word by seeing it. Please, teach your kids the right way to read, the first time!
Spoon not. Fork, or fork not. There is no spoon.
In and of itself, I doubt donating code or boxes will cause some general shift in someone's attitudes towards school and education.
However, it might contribute to a solution.
I think that is something that needs to be always kept in mind.
in France, there's a huge program about that, based on a distribution called Pingoo, based on Debian.
Informatiens about deployment here
The term 'gardner' rather than sysadmin was an acceptance of the bit rot that accompanies the various windows distributions and a recognition that even unix machines need tending/monitoring.
Anyway, it's catching on and the kids like it because its faster than NT. The bureaucrats like it because not only does the money stay local, they get more service per dollar (mark/euro).
Beta is broken and the link to classic doesn't work. Stop wasting our time or there won't be anybody left here.
Lets see:
,assuming that applications exist in Linux and Windows, you can't beat Linux in price.
Hardware: same hardware (this could be argued, Linux solution could be run in cheaper hardware becauss the options exist to do so, for the sake of argument lets say both solutions use the same hardware).
Software: depends. For a start OS and Office Suite it costs nothing in Linux. You can moan, scream and pull your hair: what is available in Linux is more than enugh for teaching basic skills, let your company in youf first job pay for your proper introduction to the wonderful world of MS computing.
If you need computers to run an application that works only in Windows well, tough luck, you have no choice and your choice is gone. But we are teaching computing skills right? Programming, working with images, Office Suites. All that is available in Linux. So
Operations: you have one guy that has to administer the computer infrastructure, a guy that either knows nothing or very little about computers (if he/she know a lot about computers, this becomes mooth point: a proficient administrator can do either solution, so no differences there). Can you seriously claim WIndows is easier to administer than Linux? Then all those books by droves about "Making windows easy" and "windows for dummies" are completely unnecesary, aren't they?
I am sorry, but I fail to see why a generaly cash starved school with a clue would use MS products (or commercial products for that matter) at all. No advantages at all: one becomes hostage to MS policies and anti-piracy orgnizations raids and licensing hikes for very little benefit, if any.
IANAL but write like a drunk one.
Most people will not use the "wealth" of features Office provides. What they use, is already there for Linux. Seems you're missing out on something as I've been using Star Office with MS Office only workplaces for 5 years now without any real issues on my or anyone else's part. "Behind" is a relative term, mister_sparkle, and I've seen Office XP and wasn't impressed- the offerings are less behind than what you think.
I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
That is what school is all about, isn't it? If you're going to teach them about the real world, then perhaps yes, you need to teach them about MS Office, but you also need to teach them about WordPerfect (MS Office doesn't run on Mainframes, but it does- and there is a LOT of places that still use Mainframes in the office context), StarOffice (there's a lot of places out there using that as well- more than you'd like to think), and others.
The real world is less homogenous than you and MS would like for to believe it is. Teaching them just MS Office isn't preparing them for office work- it's preparing them for insisting on a monopolist's product offering. Doing what I suggest would be real training for that.
And, I hold that schools are not for training laborers (office or otherwise)- they're to get everyone on the same common ground of knowlege so that we can work together in many contexts.
I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
It only does one. Think of VNC under Windows as more of a Carbon Copy replacement (which it does a fairly good job of...).
I am not merely a "consumer" or a "taxpayer". I am a Citizen of the State of Texas
I don't think you can truely learn what Art is about without using traditional media. The tactile part of the experience is invaluable. The computer _can_ be a tool, and a type of media in it's own right. However, there is so much to learn using graphite and paper.
Chasd
Silver Oaks Communications
Not only are software licenses, educational uses of computers/apps, and connectivity issues in schools. But with the plans, like the State of Maine to give laptops to schools kids, it makes the selection of a good secure & stable OS important. I believe the issue is best applied by not using a commercial OS but a solid simple embedded OS in a device that can easily be upgraded as each year passes. A small handheld or slim notebook with a set of standard tools that can change with the needs of the student and school instruction. As you move ahead in the grades, the device gets updated to a tool set that the level of teaching requires. Why you can even have the years reading material and notes pre programmed and releasable on a certain time or demand. Add connectivity software to your "standard OS's" and it could be interfaced with anyones home PC regardless of what they use. Forget free or opensource, make the student and school be able to rely on the computer to help them learn/teach and still be usable for more than the next OS release.