Slashdot Mirror


Scientists Attempting to Create Simple Life Form

derubergeek writes "The Washington Post is reporting on an apparently credible project to create a simple life form in a petri dish. The goal is two-fold: 1) to actually create a unique life form essentially from scratch and (more importantly) 2) to extensively analyze and model the entire biology of this critter. Exciting and scary at the same time. From the article, it sounds as if they are quite wary of their project and fascinated at the same time. I usually refer to that sensation as 'That little voice that I should have listened to...'" There's also a NY Times article.

420 of 565 comments (clear)

  1. Have they not seen Wierd Science by tangledweb · · Score: 4, Funny

    This has already been done.

    1. Re:Have they not seen Wierd Science by Bonker · · Score: 3, Insightful

      First thing that popped into my head when I read this was the Oingo-Boingo 'Weird Science' theme. Dates me pretty soundly, I guess.

      This here is the time to start thinking about everything science fiction has ever told us when dealing with artificaial life. It's one of the few sub-genres of science fiction that's almost always cautionary... from 'Frankenstein'--

      "FIRST POST... BAAAAD!!"

      --to 'Species'--

      "That hole in his back makes him look just like the goatse.cx guy... except it's because his spine was torn out."

      Man will create life. There's no doubt about it. It's a given. Eventually, we'll no doubt even create life that looks, acts, and feels human. What we should never forget, however, is that we are stepping into territory where angels fear to tread and should take each action with only after gut-wrenching, soul-searching thought.

      Is it resonsible, moral, or ethical to create life when the planet is as overcrowded as it is?

      Is it ethical to create life that can feel, think, or be hurt when you *know* we're going to dissect and vivisect of what we create?

      Is it ethical or responsible to create life, when we know that we're already making serious mistakes in genetic engineering, such as the genes that recently jumped between soya and corn?

      This is a wonderful new field of science that has incredible potential for human advancement. It also has incredible potential for misuse and unethical behavior.

      --
      The next Slashdot story will be ready soon, but subscribers can beat the rush and slashdot the links early!
    2. Re:Have they not seen Wierd Science by rovingeyes · · Score: 2, Insightful
      This has already been done.

      Yes, we are here...

      Not to be cynical but when will man reallize that playing god never pays off!

    3. Re:Have they not seen Wierd Science by Anonymous Coward · · Score: 1, Funny

      Hasn't been done by us. That old experiment only created amino acids. Not anything that could move or reproduce or even consume nutrients. Not life at all. 'sides, they are just modifying an existing life form. I do that every time I'm smashed :)

    4. Re:Have they not seen Wierd Science by MilesBehind · · Score: 4, Funny

      The problem of generating overpopulation and things is not even close to being relevant. Potential uses of organisms that this research will eventually allow us to produce would actually reduce the strain put on resources and the environment that a large human population will produce. Engineered organisms wouldn't be consumers, they would be slave labour for humans. As the article says, they could be used to biotransform toxins emanating from large manufacturing plants.

      That said, if these things ever get out of the lab before our knowledge about genetics is complete, we are screwed. Nature has put into DNA many checks and switches to prevent rampant mutations, which the humans will not bother to put in, or won't be aware of. Organism loose, mutating at will, and you got yourself a killer strain of urinary infection-causing organisms. I say that if the people around the lab start pissing blood, we gotta have a nuke ready to wipe out the area. It's the only way to be sure. :)

    5. Re:Have they not seen Wierd Science by andrew_0812 · · Score: 1

      By simple life form, do they mean a DMCA lawyer?

    6. Re:Have they not seen Wierd Science by IIRCAFAIKIANAL · · Score: 3, Interesting
      Is it resonsible, moral, or ethical to create life when the planet is as overcrowded as it is?

      I doubt we are going to be pumping out thousands of lifeforms as big as humans just for the hell of it. Why not produce lifeforms that can (for example) consume greenhouse gasses and produce energy? That would certainly reduce the strain on the environment.
      Is it ethical to create life that can feel, think, or be hurt when you *know* we're going to dissect and vivisect of what we create?

      You mean like the special breeds of rats and mice that we use in labratories? Already been done, essentially.
      Is it ethical or responsible to create life, when we know that we're already making serious mistakes in genetic engineering, such as the genes that recently jumped between soya and corn?

      Didn't happen. Prove that this has happened.

      --
      Robots are everywhere, and they eat old people's medicine for fuel.
    7. Re:Have they not seen Wierd Science by jorleif · · Score: 2, Insightful

      Not to be cynical but when will man reallize that playing god never pays off!

      While it is certainly true that this experiment raises some ethical issues, I think your comment does even more so. I might be feeding a troll, but I would still like to point out that your argument is very weak.

      Imagine the caveman Ugh showing the other caveman Ugh2 how to light a fire. Ugh gets a little burnt in the process and Ugh2 comments "when will man reallize that playing god never pays off".

      I mean if we want to understand life experiments like the one in the article are probably necessary. The ethical issue is not (as I see it) that the scientists are messing with the DNA of some micro-organism (=playing god), but the fact that their results might be used for producing biological weapons.

    8. Re:Have they not seen Wierd Science by 4of12 · · Score: 3, Insightful

      Your caution is well advised.

      If anything is obvious and plainly evident, it is that mankind has not done the most commendable job of managing the current set of life forms on planet earth.

      "Be fruitful and multiply..." - check.
      "Do not kill..." uhh...

      If there are overly many human beings for our existing biosphere and too many of them are living unhappy lives, then producing other sentient life forms is not likely to improve things, unless they eat septic sludge and excrete something that counts as food to us.

      --
      "Provided by the management for your protection."
    9. Re:Have they not seen Wierd Science by rovingeyes · · Score: 2
      I mean if we want to understand life experiments like the one in the article are probably necessary

      Show me one good example of putting this kind of knowledge to use. Off the top of my head two very bad examples are - cloning and weapons. I don't see these researchers spending billions of dollars gaining this knowledge to save mankind. Well atleast Einstein thought e=mc2 could enlighten mankind and use the energy constuctively, the rest is history.

      Free will and knowlegde are burden. Carry it responsibly otherwise you go down with it.
    10. Re:Have they not seen Wierd Science by windex · · Score: 2

      Mabye your morals prevent you from viewing more practical applications, medical and otherwise.

      I suppose one of the major religions still disallows the use of protective measures during sex, and that obviously means they're pro population control with AIDS and other STD's floating arround. I suppose the ability to grow new organs to save lives would be anti-death and result in less people going to hell for their statistics...

    11. Re:Have they not seen Wierd Science by n-baxley · · Score: 4, Informative

      Is it ethical or responsible to create life, when we know that we're already making serious mistakes in genetic engineering, such as the genes that recently jumped between soya and corn?

      I think we covered this in the "Gene jumping" thread. The gene's didn't jump, the two seperate products were mixed together, as solids, and so some of the genetically modifed stuff got in with the non genetically modified stuff and when ingested, poff. The genes are merged. Or some such nonsense. The article had nothing to do with genes jumping speceies. Just another case of /. editors not reading the story well enough to create a decent headline.

    12. Re:Have they not seen Wierd Science by corey_lawson · · Score: 1

      swinging the clue stick...

      the genes did not go from corn to soy.

      Some left over corn in the field grew, and was harvested along with the crop of soybeans, and thus the whole silo of soy beans. The corn seed contaminated the soy crop. the genes did not go from corn to soy bean.

    13. Re:Have they not seen Wierd Science by jorleif · · Score: 2, Insightful

      Since I'm hardly an expert in medicine I won't make any guesses about which specific diseases could be cured if the inner workings of a cell were known. However I am sure that this knowledge would certainly be useful for this purpose. If this justifies carrying out such an experiment is a question everyone has to consider themselves. I personally think it's worth doing. I feel more comfortable with this kind of information being general knowledge in the medical community rather than having some hostile party carry out these same experiments by themselves and have a weapon that none but them know how to remedy.

      What you say about Einstein and e=mc^2 misses the point a little bit. I agree that nuclear weapons have been used with terrible effects, but only for a few times. One could argue that the fact that there hasn't been any world wars since the introduction of nuclear weapons is because nobody dares to start one fearing the nuclear revenge. This is, by the way, the reason why the Nobel prizes are given, Alfred Nobel believed that world peace would be achieved if there were a frightning enough weapon. Then people would be discouraged from fighting wars. Therefore every year an award is given to researchers who have contributed to reaching this goal.
      And you certainly can't deny that nuclear fission has been used for peaceful purposes.

    14. Re:Have they not seen Wierd Science by Sj0 · · Score: 2

      Is it ethical or responsible to pretend that micro-organisms have intelligence?

      Is it ethical or responsible to present misinformation as facts, such as the genes which "Magically leaped" from corn to soy?

      Is it ethical or responsible to assume the worst, and rather than viewing this as what it is -- man trying to learn about his origins by creating a micro-organism from basic elements?

      --
      It's been a long time.
    15. Re:Have they not seen Wierd Science by Yet+Another+Smith · · Score: 2

      This here is the time to start thinking about everything science fiction has ever told us

      Yeah. If the life-form is single-cellular or even simple multicellular, I can't imagine any ethical objection other than the rather tired 'you're playing god!' Its hardly like you're creating a thinking/feeling organism that will then be exploited cruelly. However, a little sci-fi wisdom might be used.

      When creating an artificial lifeform, especially single-celled, its difficult to be absolutely certain you aren't going to run into 'Jurassic Park Syndrome' where it turns out to be more dangerous than people thought, and run amok killing the tourists. Sci-fi solution? Put it on a space station at one of the unstable Lagrange points. Then, unless the people enter a code every 20 hours or so, the whole thing is programed to fire a little rocket, pop out of the Lagrange point and completely out of Earth's gravity well, possibly then entering a sun-crossing orbit. Thus if they create a 'we'll kill earth' situation, they end up being cooked pretty thoroughly in a nice big fusion furnace.

      Plus we get a cool manned space program - bonus!

      --
      if ($it != $onething) {$it = $another;}
    16. Re:Have they not seen Wierd Science by Alsee · · Score: 2

      we gotta have a nuke ready to wipe out the area.

      Oops, guess you never saw/read Andromeda Strain :)

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
    17. Re:Have they not seen Wierd Science by Sj0 · · Score: 4, Insightful

      Why do you assume that such life forms would be sentient? Just creating basic micro-organisms is an incredible challenge, and creating a basic micro-organism is what we're trying to do here. Making a sentient, multicellular organism is so far in our future compared to this experiment, it's incredible. It's like saying that Marie Curie was trying to build a cold fusion reactor.

      I'm suprised and dissapointed at the number of kneejerk luddites in this thread who automatically make some magical connection between micro-organisms(ie. simple life, the kind which first formed several billion years ago), and human life(ie. complex life, the kind which formed several hundred million years ago), and therefore declare that all experiments of this type are dangerous. Creating simple life forms is merely a means to the end of learning more of our origins -- knowlege which is important in the grand scheme of our understanding of the universe.

      --
      It's been a long time.
    18. Re:Have they not seen Wierd Science by AvitarX · · Score: 2

      Wasn't the corn thing in recent news?

      A company that uses genetically modified plants to produce pharmacuticals recently had there plants genes jump to what was supposed to be an edible batch of corn.

      This was a cross spicies jump that required the destruction of a whole lot of food.

      I can't find proof, but it was in the news opn tuesday or monday.

      --
      Wow, sent an e-mail as suggested when clicking on "use classic" banner, and got a fast response that addressed my msg
    19. Re:Have they not seen Wierd Science by IIRCAFAIKIANAL · · Score: 2

      Here is your (lack of) proof

      Note that the problem was the seeds were mixed, not a cross species jump.

      --
      Robots are everywhere, and they eat old people's medicine for fuel.
    20. Re:Have they not seen Wierd Science by Sj0 · · Score: 2

      "Playing god" always pays off. The only people who would disagree are luddites who are ignorant of the impact of technology on our way of life, especially in terms of humanity's health, well being, security against disaster(natural or otherwise), and general enlightenment of the world around us. It's what sets us apart from the lower forms of life, and what makes us a viable species -- without our various forms of technology(and some of it can be quite scary), humanity would not exist. We're just a weak, clawless, toothless, slow species with very little survival instinct without our technology, and without "playing god" once in a while, we wouldn't have any technology to speak of.

      --
      It's been a long time.
    21. Re:Have they not seen Wierd Science by DennyK · · Score: 3, Interesting

      Why not produce lifeforms that can (for example) consume greenhouse gasses and produce energy? That would certainly reduce the strain on the environment.

      Do we really know what the long-term consequences of releasing such organisms into our ecosystem would be? Even if they are not deliberately released, if they are widely used, they're gonna get out sooner or later. Even if they're somehow designed to die outside the lab or CO2 processing plant, there's still the distinct possibility of a mutated strain that bypasses those controls.

      Who knows? Create a CO2 eating microbe today...in five hundred years, or even fifty, 90% of the Earth's plant life may end up dead for lack of CO2 because these little buggers have multiplied and spread out of control.

      The Earth is an incredibly complex, carefully balanced system. Trying to engineer it too excessively when we're really not sure at all what we're doing could backfire in a big way.

      DennyK

    22. Re:Have they not seen Wierd Science by Mac+Degger · · Score: 2

      Ohh, sigh, where do I start?

      What about the food you eat? The watre you drink? The medicines which make you better? Good, right?

      As for cloning...why is this bad? Tell me...give me ONE reason based on reason and not religion (which, having caused more war and suffering than anything else on this earth does not really make it credible at all). Shit, clone Adolf Hitler for all I care. The environment and experiences mould you, man. If AH hadn't been a messenger during WWI, he probably wouldn't have been what he became. And there are loads of reasons why cloning can be considered good; replacement organs, for example.

      Anyway, you're typing that from a climate controled house, on a friggin pc...so what exactly is your excuse?

      --
      -- Waht? Tehr's a preveiw buottn?
    23. Re:Have they not seen Wierd Science by sk8king · · Score: 1

      Yes, the deam man's switch solution. Jurassic Park definitely comes to mind where the lack of foresight caused great problems.

      It must be able to be destroyed if there is no human intervention. For everyone's safety.

    24. Re:Have they not seen Wierd Science by DroppedPacket · · Score: 1
      Man will create life. There's no doubt about it. It's a given. Eventually, we'll no doubt even create life that looks, acts, and feels human.

      Some of us have already done this. They are called children. You do need a Woman to go with that Man, though. And perhaps a side order of intercourse.

      such as the genes that recently jumped between soya and corn?

      You didn't read the article. They ended up with both corn and soya growing in the same field because they didn't clean the field of the corn first. The genes didn't jump.

      --
      I am not a resource! I am a free man!
    25. Re:Have they not seen Wierd Science by JimFromJersey · · Score: 1

      you forgot Blade Runner

      I've seen Beowolf clusters you people couldn't imagine...

      --
      between the greater and lesser infinities sleep the dreams undreamt
    26. Re:Have they not seen Wierd Science by Theatetus · · Score: 3, Interesting

      Why not produce lifeforms that can (for example) consume greenhouse gasses and produce energy?

      I'm not in principle opposed to the idea. But then again, the people who will be coding the DNA are the same people who can't check IIS buffers for overruns.

      I grew up in Mississippi. About 100 years ago, everyone was worried about soil erosion. Somebody came up with a great idea to prevent erosion: introduce a vine from Asia that had really stubborn roots and could hold soil down. The vine? Kudzu. Now the whole deep South is overrun with the damn stuff and they can't get rid of it. The effects of the introduction on the ecosystem were much broader than anyone had anticipated. Something tells me that releasing a life form that eats greenhouse gases would have even greater effects.

      --
      All's true that is mistrusted
    27. Re:Have they not seen Wierd Science by JimFromJersey · · Score: 1

      yeah, lets just chuck everything and move back into the caves. Hopefully god will take care of everything. Religon, the ultimate form of socialism.

      --
      between the greater and lesser infinities sleep the dreams undreamt
    28. Re:Have they not seen Wierd Science by Jerf · · Score: 4, Informative

      Nature has put into DNA many checks and switches to prevent rampant mutations, which the humans will not bother to put in, or won't be aware of. Organism loose, mutating at will, and you got yourself a killer strain of urinary infection-causing organisms.

      Speaking generally, those checks are not placed in the organisms to protect the greater biosphere, as you implicitly claim. Why would urinary tract bacteria put in mutation controls if by removing them they could become a "killer strain", vastly more successful? Sounds like it's all gravy for the urinary bacteria, no?

      The real reason those checks exist is that in general, mutation is bad. As you make a given generation take on more and more mutations, the probability approaches 1 that at least one of those mutations will be fatal. This is a slight oversimplication, but the probability that two mutations "cancel" or that one buffers the other, while non-zero, is even smaller then the odds of one mutation being neutral or beneficial, and can be ignored, especially as the number of mutations in a given offspring increases (because it takes those small probabilities and starts raising them to large powers, sending them to 0). As you get up into the tens, hundreds, or thousands of mutations (that aren't on introns), the organism just isn't going to survive that.

      Thus, mankind will indeed need to copy those checks and balances, or his organisms will swiftly die. In fact, almost anything we could "build" right now would swiftly die in the real world, which is immensely more hostile to life now then it was several billion years ago. That may sound wierd, but it's true; show any weakness (AIDS, for instance) and any of millions of types of bacteria, animal parasites, insects, fungi, viruses, and assorted other nasties are literally ready to eat you for lunch, all of which you can currently repel, come to some form of balance with, or avoid for the most part. It will be a long time before Man creates anything truly original, and even longer before it is strong enough to threaten anything seriously.

    29. Re:Have they not seen Wierd Science by Wolfrider · · Score: 1

      --while I hesitate to reply to a thread that mentions (shudder) goatse...

      --There are Things that Man was Never Meant to Know - let alone Accomplish.

      --Playing God is one of them, and might provoke a Tower-of-Babel response. This new life-form could conceivably (sorry, pun) turn out to be a virulent and unstoppable disease.

      --I hope they're doing this in a strictly controlled environment, and are able to destroy the thing instantly if it starts getting out of hand.

      --No, I am not kidding.

      --
      .
      == WolfriderV6 == I'm willing to admit that *I just might* be wrong... Are you??
    30. Re:Have they not seen Wierd Science by Wolfrider · · Score: 1

      --If you want to understand our origins and the meaning of the Universe, you could always try reading the Bible...

      --No, I'm still not kidding.

      --
      .
      == WolfriderV6 == I'm willing to admit that *I just might* be wrong... Are you??
    31. Re:Have they not seen Wierd Science by Wolfrider · · Score: 1

      > When creating an artificial lifeform, especially single-celled, its difficult to be absolutely certain you aren't going to run into 'Jurassic Park Syndrome' where it turns out to be more dangerous than people thought, and run amok killing the tourists. Sci-fi solution? Put it on a space station at one of the unstable Lagrange points. Then, unless the people enter a code every 20 hours or so, the whole thing is programed to fire a little rocket, pop out of the Lagrange point and completely out of Earth's gravity well, possibly then entering a sun-crossing orbit. Thus if they create a 'we'll kill earth' situation, they end up being cooked pretty thoroughly in a nice big fusion furnace.

      --Hmm... Ya know, that actually sounds like a pretty good premise for a movie.
      .

      --
      .
      == WolfriderV6 == I'm willing to admit that *I just might* be wrong... Are you??
    32. Re:Have they not seen Wierd Science by Sj0 · · Score: 2

      I could try reading superman comics or norse mythology as well, but I'm not going to.

      --
      It's been a long time.
    33. Re:Have they not seen Wierd Science by branchstudios · · Score: 1

      Making a sentient, multicellular organism is so far in our future compared to this experiment, it's incredible. It's like saying that Marie Curie was trying to build a cold fusion reactor.

      Marie Curie presented her ideas on radioactivity in 1898. By 1945 we were dropping atomic bombs. You may be underestimating the speed at which technology advances. Science can make a very quick jump from theory to application.
      If it's too early to contemplate the moral implications of applied genetic research now, then when is the time right?
      And when then is it too late?
      Of course we need to learn & to grow. But I do stop to wonder if we're mature enough as a species to use what we learn as a tool before we use it as a weapon.

    34. Re:Have they not seen Wierd Science by prell · · Score: 1

      Is it resonsible, moral, or ethical to create life when the planet is as overcrowded as it is? the planet is overcrowded? sounds like someone's never looked down from a plane.

    35. Re:Have they not seen Wierd Science by EvilBudMan · · Score: 1

      Yes,

      and one thing will lead to the next. We may even create something smarter than humans that would try to terminate us.

      Was that the Blue pill or the Red that I took today.

    36. Re:Have they not seen Wierd Science by prell · · Score: 1

      yea, remember how long it took to create the atomic bomb? man, that took forever

    37. Re:Have they not seen Wierd Science by Hrothgar+The+Great · · Score: 2

      Sorry to post so late - hopefully someone will read this. Your post is not only completely not at all helpful in any way; it's also irrelevant, stupid, and useless. You come to a site devoted to scientists and technicians and tell them that instead of doing research, they should read a book of religious mythology? Are you completely insane?

      No, I guess you're not - you're just a blinded zealot. Your post also makes you appear to be a simpleton. You should think about that before everyone you ever talk to gets the idea that you have nothing useful to contribute to anybody.

    38. Re:Have they not seen Wierd Science by Cybrr · · Score: 1

      Yes we can.

      --
      Why did GEAR crush RDP?
    39. Re:Have they not seen Wierd Science by runderwo · · Score: 1

      You wasted that much effort replying to a post that was either sarcastic or a blatant troll? I'm disappointed, sonny.

    40. Re:Have they not seen Wierd Science by 2names · · Score: 1
      So, we should:

      1) Create an organism that eats CO2
      2) Create another organism that creates CO2

      Don't we already have this?

      Yes! We Do!

      ANIMALS AND PLANTS

      --
      "I'm just here to regulate funkiness."
    41. Re:Have they not seen Wierd Science by Hrothgar+The+Great · · Score: 1

      Did you read the rest of his posts? And his signature is -I'm not kidding- or something. You don't think he's serious?

    42. Re:Have they not seen Wierd Science by Sj0 · · Score: 2

      60 years. That's a long time.

      Of course, we already have terribly effective biological weapons, so what's the point? Something tells me we're not going to be making farbtontier any time soon.

      --
      It's been a long time.
    43. Re:Have they not seen Wierd Science by 2names · · Score: 1
      Life forms don't have to be sentient to kill us, e.g. virii, bacteria...

      Some of the most dangerous (to humans) lifeforms are also simplistic (in comparison to humans) and cannot possibly be self-aware. We could quite possibly develop a simple life-form that wipes out all human life rather quickly. If this was not the case, countries around the world would not be dumping so much money into the development of Biological weapons.

      "...think, man, think..."

      --
      "I'm just here to regulate funkiness."
    44. Re:Have they not seen Wierd Science by Sj0 · · Score: 2

      Moving from genetic engineering to what they're doing right now is like the difference between knowing about radiation and a nuke bomb(which, to be honest, isn't all that complicated -- it's discovering it which is difficult). Moving from a single-celled organism to creating a multicellular organisms DNA from scratch is like the leap from the nuke bomb to creating energy by sapping energy directly from atomic movement(something that won't be possible...probably ever.)

      Since we already have biological weapons which are terribly effective, we've gone from knowing about bacteria to having the biological nuke. Creating a multicellular organism(and in this case, a multicellular organism with millitary applications) from this knowlege is a gargantuan step forward, and if we ever achieve it, I will celebrate mankinds advancement and discovery, rather than eye the darkness suspiciously.

      --
      It's been a long time.
    45. Re:Have they not seen Wierd Science by Sj0 · · Score: 2

      I think you've watched too many sci-fi television shows. It simply wouldn't be logical to irradicate the human race. Nor would it be logical to create something more intelligent than humans AND violent enough to get the ambitions to destroy humanity. We aren't THAT stupid.

      --
      It's been a long time.
    46. Re:Have they not seen Wierd Science by Sj0 · · Score: 2

      Biological weapons are here, and they are quite deadly. I don't see that as a good reason to stop an experiment which might bring us to a better understanding of the functions of a cell and possibly bring us closer to understanding the origins of life.

      As for complex multicellular war beasts, we're as far from those now as we are from directly harnessing the kinetic energy of an electron.

      --
      It's been a long time.
    47. Re:Have they not seen Wierd Science by dcmeserve · · Score: 1

      > Why not produce lifeforms that can (for example) consume greenhouse gasses and produce energy?

      Wow, great idea!

      Now, these things will need an energy source of some kind... hmm... maybe sunlight? Yeah, that'd be very eco-friendly -- we could even make up a special name for the process. "Photo"... something. Hmmm. Can't think of anything right now, but we gotta use "photo", it sounds cool.

      So anyways, you'd need the organism able to spread itself out into a wide area, so it could have more light-collecting surface area. Maybe some kind of branching structure?

      Though of course, to have any significant impact on the atmosphere, you'd have to have virtual *forests* of these things...

      Well, interesting idea, anyways.

      --
      "Orthodoxy is unconsciousness" - Orwell
    48. Re:Have they not seen Wierd Science by BlueFashoo · · Score: 1

      I doubt we are going to be pumping out thousands of lifeforms as big as humans just for the hell of it. Why not produce lifeforms that can (for example) consume greenhouse gasses and produce energy? That would certainly reduce the strain on the environment.

      I got me some o dem dar critters in me pond. I call dem single cell algae.

      --
      Nice Marmot
    49. Re:Have they not seen Wierd Science by Wolfrider · · Score: 1

      --Gee, doncha think that's a bit harsh? Calling the Words of God "mythology", and me a "blinded zealot"?? Do you think you KNOW me or something that you can just blatantly insult somebody like that?

      --Have you ever tried READING the Bible, or are you just posting with "Internet Balls"? Trust me, if you met me in Real Life I *seriously* doubt you'd try spouting off like that to my face. And if you think otherwise, I'd be *glad* to give you the chance.

      --BTW, regarding your second paragraph - (I'm actively surprised you didn't post as an AC, since you come across as a completely spiteful jerk yourself - and *you* don't even have an email address listed here) - try going to the Knoppix Linuxtag Help forum and look up some of my posts. You're a big boy, I'm sure you can google it up or JUST GET A LIFE.

      --Ya poor blinded sod.

      --
      .
      == WolfriderV6 == I'm willing to admit that *I just might* be wrong... Are you??
    50. Re:Have they not seen Wierd Science by runderwo · · Score: 2

      Hehe, I really doubt it. If he is serious, nobody's taking him seriously, that's for sure. :)

    51. Re:Have they not seen Wierd Science by Transcendent · · Score: 2

      bad. As you make a given generation take on more and more mutations, the probability approaches 1 that at least one of those mutations will be fatal.

      Actually... almost ALL mutations are bad for the organism. That is why evolution takes so long. Eventually, one out of a million mutations will be beneficial...

    52. Re:Have they not seen Wierd Science by Transcendent · · Score: 2

      Is it resonsible, moral, or ethical to create life when the planet is as overcrowded as it is?

      I guess no one should have sex then... damn... thanks for ruining it for us...

      Is it ethical to create life that can feel, think, or be hurt when you *know* we're going to dissect and vivisect of what we create?

      Who ever said that we'd be doing this? At most they're probably gonna create an RNA or DNA strand that won't even form into anything... even if they create a single-celled organism, do ya think that it'll hurt it when it fries from too much light from the microscope?? ITS A CELL!

      Is it ethical or responsible to create life, when we know that we're already making serious mistakes in genetic engineering, such as the genes that recently jumped between soya and corn?

      If we've gotten better... then why not?

      This is a wonderful new field of science that has incredible potential for human advancement. It also has incredible potential for misuse and unethical behavior.

      You're too into ethics. Why don't you give a concrete example why this is bad instead of asking redundent questions as to the ethics of this scientific project...

      In my opinion... it's ALL ethical.

      Since your arguement relies on someones opinion of ethics, then it really won't hold up that well against the scientific community.

      The way to persuade a true scientist is not by rambling on about religious-based ethics, but by logic, scientific proof, statistics, and examples...

    53. Re:Have they not seen Wierd Science by MilesBehind · · Score: 1

      Well, as much as complete lack of these checkpoints for genetic integrity would lead to a low survival, my point is that lack of a few of them can lead to some quite nasty behaviour. I'd compare this to the way a few of these genes knocked out in human cells can lead to cancers with drug resistance, secretion of angiogenetic factors and all sorts of nasty things that cells implement to survive individually, yet ultimately kill the host.

      While it is true that most of these mutations will be lethal within a generation or two, they kill off only the weak cells. The ones with survival-promoting mutations will strive and become the prominent strains. In other words, while there's small chance that one of these little critters will actually survive, it cannot be excluded. The fact that the environment is highly hostile to them means that evolutionary pressures will be higher, but high mutations would allow it to deal with it.

      Of course, since there's not going to be too much genetic material in these cells, there won't be too much room for proper adaptive mutations, which is why my comment should be taken with a grain of salt.

    54. Re:Have they not seen Wierd Science by athlon02 · · Score: 1

      Well I don't know if you'll see this post, but I'll put it anyways...

      http://www.apologeticspress.org/docsdis/2002/dc- 02 -safull.htm

      If you want to see how much evolutionists are even skepitcal of their own theories, try reading that article.

      There are a lot of so-called "Christians" who accept God and believe in God without facts. Such people I would call blind zealots. But there are many Christians who believe because of the facts. If you consider a lot of arguments for evolution they either argue in circles or have more evidence going AGAINST them than for them. For instance "survival of the fittest" is a circular argument that leads nowhere. But the URL I posted goes through it MUCH better than I could in this space.

      As for other arguments:
      (1) The Big Bang only suggests how the heavenly bodies formed, it doesn't explain how or why the universe is here, nor does it explain what's beyond the bounds of the universe.

      (2) Atheism requires that the person know literally EVERYTHING about the universe AND beyond to know there is no God, which obviously he/she can't do.

      (3) Agnosticism ignores the evidence like if I said "I've never seen George Washington and neither have you, therefore neither of us can know if he existed or not." If someone was to argue this, I could just as easily argue that they cannot know if I exist or they even exist because maybe there is no such thing as intelligence or even matter and energy. It's a flawed idea to say the least.

      Simply put, I'd rather believe in God as the creator of the universe and the Bible is His word, due to the evidence around me, than blindly follow **supposed** scientific principles.

      Those who are serious about Christianity are very much scientists, who study the evidence carefully, because if God doesn't exist then we're wasting a whole lot of time in that case.

      But to give you a taste of some of the evidence we study and consider... the Earth orbits the sun at a speed of 19 miles per second. And for every 18 miles it moves it only departs from a straight line by 1/9 of an inch. If it moved 1/8 or 1/10 we'd either burn up or freeze to death. That's a pretty precise orbit if it was only a chance occurence.

      We may all be scientists and technicians reading slashdot, but we don't all accept "supposed" scientific evidence just because someone renowned says we should. Scientists need and should be open to as much scrutiny as the Bible, otherwise believers of evolution, the Big Bang, and such are just as much blind followers as those who profess to be Christians without studying the facts for themselves.

      Well this was a long comment to post, but if at least one person reads it who benefits from a spiritual standpoint, then it's all worth it.

    55. Re:Have they not seen Wierd Science by Hrothgar+The+Great · · Score: 2

      A lot of respected, brilliant people have expressed their belief in the divine; that some sort of hand created the universe and such. And yet, those same people never would have downplayed scientific fact the way you just did.

      The article you point to is as severely flawed as every creationist "scientific" article I have ever read (and I have read many). Here is my paraphrase of a creationist rejection of evolution, taken right from your article:

      "Since all of the facts about evolution are not yet known, and the theory is therefore not complete, we as creationists reject the entire theory of evolution as invalid".

      A real scientist would never state the above, and yet creationist "scientists" throw it around all the time with little hesitation.

      They then go on to quote Darwin:

      "There is no doubt that both the historical and the causal aspects of the evolutionary process are far from completely known.... "

      So, since Darwin, the originator of the theory, said that he didn't understand every tiny aspect of the theory, the entire thing is invalid, even considering all of the scientific research done since he's been dead? Wow, good thing creationists know what logic is.

      Now, I'm reading their section on natural selection, and it makes no fucking sense at all. Do you really think that you need scientific training to understand the fact that species with a higher survivability rate gradually replace species with a lesser rate? Is this truly a difficult concept for the mind to grasp? Natural selection is a theory with such simplicity that even a child could understand it. Does it matter whether someone philosophises that it's circular because it indicates that "survivors survive"? No, this is absolutely irrelevant. As a thinking human being, the next question you would naturally want to ask yourself is, in nature, WHY DO CERTAIN SPECIES SURVIVE MORE THAN OTHERS? Could it be that the "fittest" do in fact have a much higher likelihood of survival. Yes. Refute it if you really don't understand how simple that is, but you'll be wrong.

      And now that I'm entering rant mode, what exactly is so bad about such a well researched and well proven theory as natural selection that Christians would have such a tremendous problem with it? Not all Christians either, need I remind you. I went to a Catholic high school and was taught to use my brain, not follow a religious text to determine scientific fact. I have Christian friends who have no problem with natural selection, or even, (and I'm sure this will just HORRIFY you) the entire theory of evolution. Why is it that a small group of Christians, like you, will state this:

      "We must not believe in evolution, because the theory is not yet understood in its entirety; as you can see, I can point out flaws a. here, b. here, and c. here. So therefore the entire theory is wrong. Now, let's get ready to attend Sunday Mass, where we will worship God. No, don't question God's existence. He is a fact!"

      I don't believe scientific fact just because someone tells me to either, pal, but why don't you answer this - why do you believe every single word your Church tells you to believe, even if it instructs you to reject evidence which can be easily seen, is well documented, and very well understood (despite what the apologists have to say about it). I was a Catholic for 20 years - why is it that they never said anything about evolution being evil? Isn't it ironic that the Catholic Church is now the most advanced and intelligent of all of the Churches? I guess that Counter-Reformation did a good job after all.

      Why don't YOU use your brain to decide what's right and wrong - maybe you should examine this very important point which really, to me, is the only point you need to know that proves that Creationists are completely full of shit:

      Scientists prove things.
      Creationists disprove things.

      It's true. Pick up any creationist paper. ANY. They prove by disproving, a logical impossibility in my opinion. Creationists, EVERY SINGLE ONE I have read, have always attempted to poke holes in modern science. Once they believe they have exposed an aspect of evolution or whatever they've taken issue with this week, they conclude that they have now proven that since science doesn't have a sufficient answer, the answer is that God did it.

      You see what kind of voodoo volcano-worshipping archaic crap that argument is, right? Since you are wrong, I am automatically right? Am I to understand that the scientific method interferes with your dogma as well? Guess what, jacko, science does not know many important things, still. Does this prove that God exists? No way. Can we ever disprove the idea of God? Again, no. So, to most people with the capability to think (including ALL of the religious people I know), you can't use God as the basis for scientific arguments. God is an abstract concept - God has no real definition outside of what every faction believes about him. As I've stated, you can neither prove nor disprove God, so why do you think he is an acceptable substitute to evolution, about which many things have already been proven as fact, and about which other aspects have extremely well documented evidence supporting them? Answer: he is not.

      One last thing - as I've said, a lot of people don't believe that evolution contradicts their faith. Because they've thought about it and not just followed the blind "logic" of their religious elders. Why don't you just say "God invented evolution" and then there's no way anyone could argue with you?

    56. Re:Have they not seen Wierd Science by 2names · · Score: 1

      Sorry. I read it too fast. My mistake.

      --
      "I'm just here to regulate funkiness."
  2. Safe? by YrWrstNtmr · · Score: 5, Funny

    To ensure safety, Smith and Venter said the cell will be deliberately hobbled to render it incapable of infecting people; it also will be strictly confined, and designed to die if it does manage to escape into the environment.

    hmmm...where have I heard this before? Something to do with female dinosaurs and frog DNA.

    1. Re:Safe? by Bandman · · Score: 3, Funny

      yea, I'm sure they made it Lysine dependent or something.....losers! lol

    2. Re:Safe? by earlydaysofsin · · Score: 1

      Its life Jim .. but not as we know it.

    3. Re:Safe? by GMontag · · Score: 3, Funny

      From the description of scooping out the DNA from an existing bug and adding new DNA, this sounds more like the documentry "Species".

      And they took precautions to keep it from getting away too, remember? They made it female so it could be "easier to control".

      Also, as pointed out in the movie, these guys must not have not been around many women.

    4. Re:Safe? by Amazing+Quantum+Man · · Score: 1

      There's Klingons off the starboard bow!
      It's worse than that, he's dead, Jim!
      We come in peace -- shoot to kill!
      Ye canna break the laws o' physics!

      --
      Fascism starts when the efficiency of the government becomes more important than the rights of the people.
    5. Re:Safe? by Lumpy · · Score: 2

      I can see it now.....

      December 5th 2002.... Scientists and staff at a biological research facility were quickly consumed and eaten by their simple organizim they were attempting to create..

      one surviving facilities manager was interviewed with saying, " I told them that trying to do this was wrong... Children do NOT want slime that eats arms and legs for christmas!"
      images of the beats can be found here

      --
      Do not look at laser with remaining good eye.
    6. Re:Safe? by JimFromJersey · · Score: 1

      Unfortunatly your satire is too close to the reality of "..well on star trek..." ; ".... it was in so it must be true..." My error was assuming that you were one of these blithering, mindless idiots. My apologies.

      --
      between the greater and lesser infinities sleep the dreams undreamt
    7. Re:Safe? by The_Guv'na · · Score: 2

      When I read that bit of the article, I thought "Hang on, isnt there lifeforms already like that?". I was racking my mind for nearly an hour.

      And then it dawned on me...

      I'm one of them!!!

  3. Frankenstein by e8johan · · Score: 3, Interesting

    As they say that they're going to do it in a "petri dish" I assume that we will not see Frankenstein, but rather Flubber.

    I though that this has been done part-way in simulations of earths early atmosphere using electic discharges. At least they made aminoacids that way (I think they did that).

    1. Re:Frankenstein by ComaVN · · Score: 5, Funny

      I though that this has been done part-way in simulations of earths early atmosphere using electic discharges. At least they made aminoacids that way (I think they did that).

      Amino acids are to life as a bolt is to a spaceshuttle, so no, they didn't do this yet.

      --
      Be wary of any facts that confirm your opinion.
    2. Re:Frankenstein by toxcspdrmn · · Score: 5, Informative

      You are thinking of the Miller-Urey Experiment.

      In the '50s they put some simple chemicals (methane, ammonia, hydrogen and water) in a sealed vessel and added energy (as electrical discharges). They found about 2% of the material formed amino acids.

      --
      "E pur si muove!" - attributed to Galileo Galilei, 1564-1642
    3. Re:Frankenstein by macdaddy357 · · Score: 1, Redundant

      It's alive! It's alive! It's alive! Ha Ha Ha! Igor, Bring me more brains.

      Yes, Master. More Brains Hee hee Hee hee.

      --
      How ya like dat?
    4. Re:Frankenstein by HedRat · · Score: 1

      As they say that they're going to do it in a "petri dish" I assume that we will not see Frankenstein, but rather Flubber.

      I thought FOX already funded a project like this and the result was Darva Conger?

    5. Re:Frankenstein by Frobnicator · · Score: 2
      Don't you mean Frankenstein's Monster? Frankenstein was the scientist.

      Frob.

      --
      //TODO: Think of witty sig statement
    6. Re:Frankenstein by TheSync · · Score: 4, Informative

      The Miller-Urey experiment does show that random energy into a specific set of simple chemicals can yield amino acids.

      However, it did not produce all amino acids required for life as we know it. Moreover, there is no known chemical pathway to go from a bunch of amino acids to DNA/RNA. Plus there is also significant debate about whether the initial atmosphere they began with existed on Earth at the time of the origins of life.

      Other researchers have suggested that inoganic forms of proto-life (crystal growth) may have had a role in the catalysis of organic chemicals to actually get to something leading to RNA/DNA.

      I'm not saying that there is anything particularly magic about the formation of life, just that Miller-Urey is a very small part of a very big question.

    7. Re:Frankenstein by toxcspdrmn · · Score: 1

      Absolutely - Miller and Urey showed that a few examples of a particular class of biological compound could be formed under very specific conditions.

      Other theories point to the catalytic properties of clays (see here) and their role in the polymerisation of nucleotides (the subunits of nuclic acids such as RNA and DNA).

      Then there's the formation of phospholipid bilayers to give a cell membrane - though that's not too much of a stretch given the propensity of these molecules to form micelles when mixed with water. Of course you have to have the lipids in the first place.

      The point is that in the sequence:

      1. Create Life
      2. ???
      3. Profit

      the ??? is actually a whole bunch of things that have to come together in the right way and so it may take a while - about 4.6e9 years so far on this rock we call home. Of course we may be able to speed things up a little but it is still a non-trivial exercise.

      --
      "E pur si muove!" - attributed to Galileo Galilei, 1564-1642
  4. It might escape by Jerdie · · Score: 2, Funny

    But the non-infectous-to-humans single cell organism may escape it's environment, and then immediatly die!!!!!!

    --
    Programming is simply the application of logic to creativity
    1. Re:It might escape by Sj0 · · Score: 2

      AH!!!

      SCARY!!! ...When will man learn that playing god never pays? :)

      --
      It's been a long time.
  5. You Mean by ksplatter · · Score: 5, Funny

    They are gonna create a Slashdot Moderator From Scratch.

    1. Re:You Mean by Anonymous Coward · · Score: 4, Funny

      Initially they were trying to create a Slashdot editor from scratch, but had to remove the genes responsible for repeat articles.

    2. Re:You Mean by bellings · · Score: 2

      this is the funniest damned thing i've read in a long time...

      --
      Slashdot is jumping the shark. I'm just driving the boat.
    3. Re:You Mean by Shads · · Score: 2, Funny

      Well it is a possibility... that would be a single cell organism in alot of cases...

      --
      Shadus
    4. Re:You Mean by shivianzealot · · Score: 2, Funny

      Of course not! Such science would be entirely frivolous. We already have "very tiny shell scripts."

      --

      Bored with karma, be a fan/freak

  6. I used to do that as a child by eX-fly · · Score: 5, Funny

    They are called Sea Monkeys!

    1. Re:I used to do that as a child by Bodrius · · Score: 2

      I AM GOD OF THE SEA PEOPLE!

      --
      Freedom is the freedom to say 2+2=4, everything else follows...
    2. Re:I used to do that as a child by smithmc · · Score: 1


      I hope you didn't turn your Sea People into an advanced civilization, using the same "techniques" Eric Cartman did...

      --
      Downmodding is the refuge of the weak. Don't downmod, make a better argument!
    3. Re:I used to do that as a child by ShadowBlasko · · Score: 1

      You know, every time I create a kingdom of Sea People, that Louis Wu dude comes along and boils them. I hate that guy.

      --
      There are 4 boxes to use in the defense of liberty: soap, ballot, jury, ammo. Use in that order- Ed Howdershelt Via Tass
  7. They already have a great example by JessLeah · · Score: 5, Funny

    ...of a 'simple lifeform'. It lives in the white house...

    1. Re:They already have a great example by Red+Rocket · · Score: 1


      I don't get it.

      That's funny because it's true. You really don't get it.

      --
      - Hail to our fearless misleader! Fool speed ahead!
    2. Re:They already have a great example by Anonymous Coward · · Score: 1, Funny

      ha ha bush is dumb, that is such a funny and original joke we need people to repeat it every 20 minutes because its so funny and original.

    3. Re:They already have a great example by robson · · Score: 2

      " They already have a great example... of a 'simple lifeform'. It lives in the white house..."

      "Yep, the simplest examples of the dumbest and simplest lifeforms are the entire Democratic party."

      No, you're a big dummy-head!

    4. Re:They already have a great example by argStyopa · · Score: 2

      I love these jokes, they're such throwaway lines.

      But think about it: He's president of a country of 280 million, making what, $400k, and probably the most powerful single human in the whole world.

      You're some shlub posting on /. when you should be working. Where does that leave YOU on the scale of intelligence?

      --
      -Styopa
    5. Re:They already have a great example by Tackhead · · Score: 2
      > But think about it: He's president of a country of 280 million, making what, $400k, and probably the most powerful single human in the whole world.
      >
      >You're some shlub posting on /. when you should be working. Where does that leave YOU on the scale of intelligence?

      Obviously smart enough to know when I'm being grossly overpaid :-)

      Time for a Far Side reference:

      Frame 1: Guy in a suit and tie, mainlining six cups of coffee a day and chain-smoking.
      Frame 2: Gorilla kickin' back, peelin' a banana.
      Caption: "Who's the dumb ape?"

    6. Re:They already have a great example by greenrd · · Score: 2
      Great way of measuring intelligence. Wealth == intelligence. Gee, maybe we should just dispense with exams altogether and just let people buy exam grades. It would be so much more efficient, if wealth is indeed a strong predictor of intelligence!

      You're some shlub posting on /. when you should be working. Where does that leave YOU on the scale of intelligence?

      Ah, so disobeying your corporate masters is a sign of lack of intelligence. Sure, that makes logical sense! Do you have a newsletter I could subscribe to?

    7. Re:They already have a great example by Sj0 · · Score: 2

      If you honestly think that power correlates to intelligence, you're probably not intelligent enough to make that assertion.

      --
      It's been a long time.
    8. Re:They already have a great example by pediddle · · Score: 1

      probably the most powerful single human in the whole world... You're some shlub posting on /. when you should be working

      Out of all the people who the republicans could have chosen to run in 2000, they would not have picked me, or you, or any other slashdot bunny rabbit. But why'd they have to pick Bush? A man like that does not deserve to control 280 million and influence 6 billion. Although I'm a democrat, I'll take any other republican over him.

      I'm not saying this (entirely) because of his intelligence. I'm saying it because he seems to have a death wish for the entire world.

  8. You all know where this will lead by ComaVN · · Score: 2, Funny

    When attempts to create life in a petridish are successful, scientists might actually try to create life in a woman.

    --
    Be wary of any facts that confirm your opinion.
    1. Re:You all know where this will lead by egreB · · Score: 2

      Hey, you don't need a scientist for that! Hand me the woman..

  9. Not from scratch, technically by theRhinoceros · · Score: 5, Informative

    The project will begin with M. genitalium, a minuscule organism that lives in the genital tracts of people and may cause or contribute to some cases of urethritis, an inflammation of the urethra. The scientists will remove all genetic material from the organism, then synthesize an artificial string of genetic material, resembling a naturally occurring chromosome, that they hope will contain the minimum number of M. genitalium genes needed to sustain life. The artificial chromosome will be inserted into the hollowed-out cell, which will then be tested for its ability to survive and reproduce.

    They're taking an already extant organism, "hollowing it out" as it were, and seeing if it can live and reproduce normally with a series of increasingly customized (and minimal) genetic material. Not creating something from nothing.

    1. Re:Not from scratch, technically by ReelOddeeo · · Score: 3, Redundant

      They're taking an already extant organism, "hollowing it out" as it were, and seeing if it can live and reproduce normally with a series of increasingly customized (and minimal) genetic material. Not creating something from nothing.

      That is simply because we cannot yet manipulate things at the molecular level in sufficient quantity or resolution. Once we can, then someone might not even start with an existing organism's shell script wrapper.

      Of course, I suppose, even then, they would not be starting from "nothing".

      --

      Those who would give up liberty in exchange for security and DRM should switch to Microsoft Palladium!
    2. Re:Not from scratch, technically by SpitFU · · Score: 1

      I can come up with a list of human beings that need to have this done to them. Oh... wait they already perform this procedure in psychiatric institutions.... It's call a labotomy.

      --
      reassign null to be the tape device - it's so much more economical on my time as I don't have to change tapes_BOFH
    3. Re:Not from scratch, technically by derubergeek · · Score: 1
      Well, yes and no.

      Perhaps I'm misreading this, but my understanding is that they're stripping out all of the reproductive and regulation mechanisms (RNA/DNA) and then synthesizing a new set from scratch. So they aren't building the cell membrane, but they are building the mechanisms that actually make it a living entity. I'm unclear as to whether they will keep things like mitochondrea intact (or for that matter, the cell nucleus).

      At least that's my take...

      --
      Trust me. This is an inactive account. Regardless of what the /. bean counters might report.
    4. Re:Not from scratch, technically by cybrpnk2 · · Score: 5, Interesting

      An excellent overview of minimum-gene-set research is here...

    5. Re:Not from scratch, technically by HarveyBirdman · · Score: 1
      They're taking an already extant organism, "hollowing it out" as it were, and seeing if it can live and reproduce normally with a series of increasingly customized (and minimal) genetic material. Not creating something from nothing.

      [Insert favorite quip about how Microsoft "invented" Windows here.]

      --
      --- Ban humanity.
    6. Re:Not from scratch, technically by kfx · · Score: 2, Insightful

      That is exactly what I thought when I read the article. They are not creating a life-form; they are only ripping out its DNA and seeing if it still lives with their specific, customized, meticulously built DNA (which just happens to be based on the original DNA). The article says nothing of removing any of the cell's machinery, only the DNA. So, in essence, they will be extracting the DNA and constucting an exact copy with a third or so of the genes missing from it.

      Of course, no matter what they do they have to start from -something-, but in this example they are starting from an already living bacteria and rebuilding its DNA. All they are really going to find out is if the process will kill the bacteria or not.

      Despite the fact that this experiment won't really prove anything if it succeeds, there will be many people saying that they did in fact create new life and that if they can do it in the lab, then it must be incredibly easy for life to have come into existence on its own on billions of other worlds throughout the universe.

      --
      "There's no other intelligent life in the universe. There isn't even very much of it on earth."

    7. Re:Not from scratch, technically by GMontag451 · · Score: 2
      So, in essence, they will be extracting the DNA and constucting an exact copy with a third or so of the genes missing from it.

      Just how can it be an exact copy when a third of its genes are missing?

    8. Re:Not from scratch, technically by zenofjazz · · Score: 1

      So this would be the first step in creating Plague Lite(tm) ?

      --
      -- All That's Evil in the Geek Space ... Allthatsevil.wordpress.com
    9. Re:Not from scratch, technically by inode_buddha · · Score: 1

      Are you having difficulty urinating?

      --
      C|N>K
    10. Re:Not from scratch, technically by superyooser · · Score: 2

      "If you wish to make an apple pie truly from scratch, you must first invent the universe." -- Carl Sagan

    11. Re:Not from scratch, technically by dvk · · Score: 2

      As the old joke goes...
      "One day a group of scientists got together and decided that man had come a long way and no longer needed God. So they picked one scientist to go and tell Him that they were done with Him.

      The scientist walked up to God and said, "God, we've decided that we no longer need you. We're to the point that we can clone people and
      do many miraculous things, so why don't you just go on and get lost."

      God listened very patiently and kindly to the man and after the scientist was done talking, God said, "Very well, how about this, let's say we have a man making contest." To which the scientist replied, "OK, great!"

      But God added, "Now, we're going to do this just like I did back in the old days with Adam."

      The scientist said, "Sure, no problem" and bent down and grabbed himself a handful of dirt.

      God just looked at him and said, "No, no, no. You go get your own dirt!"

      -Cheers,
      DVK

      --
      "The right to figure things out for yourself is the only true freedom everyone shares. Go use it"-R.A.Heinlein
    12. Re:Not from scratch, technically by Monkelectric · · Score: 2

      I can't help thinking this organism will be kind of like a floppy distro :)

      --

      Religion is a gateway psychosis. -- Dave Foley

  10. Did they do this already? by BurKaZoiD · · Score: 1

    I remember hearing something about this way back in the 80s or something. Supposedly a bunch of high mucky-mucks in the 50s created some simple lifeform but it quickly died because it couldn't "eat". Perhaps it's one of those urban legends, like the Easter Bunny and hairy palms.

    1. Re:Did they do this already? by Cpt_Kirks · · Score: 2

      Duh. Of course the Easter Bunny has hairy palms. He's a friggin' RABBIT!

  11. Why THIS bacterium?! by micromoog · · Score: 5, Funny
    The project will begin with M. genitalium, a minuscule organism that lives in the genital tracts of people and may cause or contribute to some cases of urethritis, an inflammation of the urethra.

    If they had to choose a bacteria to do unpredictable and possible dangerous experimentation with, why did they choose one that is known to cause crotch-burn in humans?!

    1. Re:Why THIS bacterium?! by ReelOddeeo · · Score: 3, Funny

      If they had to choose a bacteria to do unpredictable and possible dangerous experimentation with, why did they choose one that is known to cause crotch-burn in humans?!

      Probably because it was the simplest form, or the easiest to work with that they could obtain over the counter.


      (an alternate theory might have something to do with culling the herd.)

      --

      Those who would give up liberty in exchange for security and DRM should switch to Microsoft Palladium!
    2. Re:Why THIS bacterium?! by j4pjeff · · Score: 1, Funny

      Maybe they are working on a new chemical weapon.

    3. Re:Why THIS bacterium?! by slashbofh · · Score: 1
      The project will begin with M. genitalium, a minuscule organism that lives in the genital tracts of people and may cause or contribute to some cases of urethritis, an inflammation of the urethra. [...] The artificial chromosome will be inserted into the hollowed-out cell, which will then be tested for its ability to survive and reproduce.

      If it can reproduce it will already be a more sophisticated life form than the average Slashgeek. Of course the average Slashgeek hasn't irritated the genital area of someone else, but has irritated the woman it's attached to.

    4. Re:Why THIS bacterium?! by toxcspdrmn · · Score: 1

      Because we need to be very sure they wash their hands both before and after the go to the bathroom.

      --
      "E pur si muove!" - attributed to Galileo Galilei, 1564-1642
    5. Re:Why THIS bacterium?! by capt.Hij · · Score: 3, Funny

      The rumor is that they started out with something that they found in the bottom of the coffee pot in the math department. After much debate they felt that the bug that causes crotch wrotch was less intimidating.

    6. Re:Why THIS bacterium?! by leoboiko · · Score: 1

      Science without risk isn't any fun.

      --
      Prescriptive grammar:linguistics :: alchemy:chemistry. Stop being a nazi and learn some science.
    7. Re:Why THIS bacterium?! by corvi42 · · Score: 5, Informative

      If you read the article to the end, it says why. This cell has the least number of genes of any organism known, so it is easier to reduce this to a basic minimal set than something more complex. The whole point of the experiment is to get the absolute minimum requirement of genes for basic cellular operations. So a this creature is ideally suited as it is already the most minimal set found in nature.

      --

      There are a thousand forms of subversion, but few can equal the convenience and immediacy of a cream pie -Noel Godin
    8. Re:Why THIS bacterium?! by GMontag451 · · Score: 2
      This cell has the least number of genes of any organism known, so it is easier to reduce this to a basic minimal set than something more complex.

      I'm surprised they didn't try to do it with a virus. IIRC the HIV virus has a number of genes in the single digits. You can't get much simpler than that.

    9. Re:Why THIS bacterium?! by esanbock · · Score: 1

      It's debatable as to whether or not virii are actually "alive".

    10. Re:Why THIS bacterium?! by Henry+V+.009 · · Score: 3, Informative

      They did it already with Polio.

    11. Re:Why THIS bacterium?! by corvi42 · · Score: 3, Informative

      A virus is not a cell, and does not have the fundamental operations of a cell. The whole point of this experiment is to determine what genes are responsible for what cellular processes, and how the chains of cascading protein-interactions lead from a set of genes to a set of cellular functions. Therefore it would be pointless to use a virus.

      --

      There are a thousand forms of subversion, but few can equal the convenience and immediacy of a cream pie -Noel Godin
    12. Re:Why THIS bacterium?! by William+Tanksley · · Score: 2

      The definition of "life" isn't clear, but it's pretty definite that a virus doesn't have the minimal number of genes required for life, because it requires a specific set of genes provided by another cell in order to survive.

      So using a virus wouldn't be a shortcut, it would either be cheating (by failing to count the genes the virus used only when reproducing) or would result in a much higher count (if you honestly counted them).

      -Billy

  12. Is it actually creating life though? by Helmholtz+Coil · · Score: 5, Insightful

    When I read the headline this morning I thought it was going to be entirely from scratch, but the article says that they're "just" (like it's not still amazing we can do this) going to take an existing organism, and strip it of most of its DNA until they get down to the bare minimum required to sustain life. So I don't know if I'd necessarily call it "creating" life, because it seems to be more of the same modifying existing life people have been doing for a while now.

    1. Re:Is it actually creating life though? by CrosseyedPainless · · Score: 3, Funny

      Splitters!

    2. Re:Is it actually creating life though? by derubergeek · · Score: 3, Interesting
      That was my initial reaction to the article also. But after a couple of reads (as opposed to a couple of reds), my interpretation is that they're ripping out the entire genetic structure (RNA/DNA) and synthesizing a new set entirely from scratch.

      As I responded to another post, I'm unsure as to how much of the actual cell structure (aside from the membrane) will remain...i.e., nucleus, mytochondria, etc..

      I'm viewing it as 'creating life' in the sense that someone who 'creates software' doesn't actually build the computer from sand, program the O/S in machine, and design & implement a compiler (at least not typically - I have a handful of friends who always seem to sidetrack themselves down that path...).

      --
      Trust me. This is an inactive account. Regardless of what the /. bean counters might report.
    3. Re:Is it actually creating life though? by redfiche · · Score: 1

      Well, they're going to take the DNA, create an artificial copy of it, and put that into a hollowed out cell. They're using the existing organism as a sort of template. That's pretty close to going from scratch. And while it's a road we've been going down, it's certainly a few steps further down the road than we've ever been.

      --

      Brevity is the soul of wit

      -- Polonius

    4. Re:Is it actually creating life though? by ComaVN · · Score: 1

      and design & implement a compiler (at least not typically - I have a handful of friends who always seem to sidetrack themselves down that path...).

      Yeah, when you get a compile error, obviously the compiler needs fixing, doesn't it?

      --
      Be wary of any facts that confirm your opinion.
    5. Re:Is it actually creating life though? by kfx · · Score: 1

      --
      I'm viewing it as 'creating life' in the sense that someone who 'creates software' doesn't actually build the computer from sand, program the O/S in machine, and design & implement a compiler
      --

      Actually this would be more akin to pulling the kernel out of an OS (leaving all of the support files intact), decompiling it, looking over the code and deleting the useless parts, retyping the remainder of the code in a new file, recompiling it, then putting it back with the rest of the OS and seeing if it runs. Not an easy task, but not really creating anything either...

    6. Re:Is it actually creating life though? by sam_handelman · · Score: 2

      But after a couple of reads (as opposed to a couple of reds), my interpretation is that they're ripping out the entire genetic structure (RNA/DNA) and synthesizing a new set entirely from scratch

      That seems unlikely. When you generate DNA "from scratch" (only viruses use RNA for their genetic structure), which is to say chemically, you are typically limited to lengths on the order of 2,000 bases (last I checked). Synthetic DNA of that length is also of low quality - it has many errors and omissions, so I'm not sure you could use it. A virus like ebola - which have about a dozen genes - tend to be on the order of 10,000 bases in length. This thing will have 235 genes.

      The way I would do it would be to clone each of these 235 genes and then ligate them together. i.e. I would take the genome of the Myoplasma, and selectively copy (using PCR, which is NOT "from scratch") the 235 genes I wanted, then string them all together (ligation, this is called).

      The Craig Venter working on this project IS the guy from the private human genome project / Celera. He gives nice talks, I saw him up at the medical school last year.

      Bacteria do not contain much in the way of "cell structure". Organelles - such as the nucleus - are unique to eukaryotes. Mitochondria are actually symbiotic bacteria that live inside our cells. Mycoplasma do not have them. Mycoplasma do not have cell walls (most bacteria do,) either.

      Proteins cannot be made from scratch by any living organism - you need proteins to make other proteins. So, the cell would have to start out with proteins that had already been made by another cell.

      Your view on 'creating life' is pretty much spot-on. The membrane, and initial copies of proteins to read DNA, to make more proteins and so forth, would have to be supplied from another cell.

      Our distant ancestor - the very oldest form of life - was probably RNA (not DNA) exclusively. It was RNA, and using RNA it could make anything that it needed. There are reasons to believe that cell membranes were generated naturally and that it used whatever membrane it found itself in. However, since we have no example of such an organism, we could not make one.

      --
      The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
    7. Re:Is it actually creating life though? by GMontag451 · · Score: 2
      Bacteria do not contain much in the way of "cell structure". Organelles - such as the nucleus - are unique to eukaryotes. Mitochondria are actually symbiotic bacteria that live inside our cells. Mycoplasma do not have them. Mycoplasma do not have cell walls (most bacteria do,) either.

      There are eukaryotic bacteria. AFAIK, the term bacteria refers to the kingdoms Monera and Protisa collectively.

    8. Re:Is it actually creating life though? by sam_handelman · · Score: 2

      There are eukaryotic bacteria. AFAIK, the term bacteria refers to the kingdoms Monera and Protisa collectively

      ProtisTa, but it does not.

      There are three domains (super-kingdoms) of living things:

      Eubacteria- or "True Bacteria." Most human disease agents are of this type. The mitochondria (our symbiotes) are eubacteria, as are chloroplasts (plant symbiotes.) Mycoplasma are eubacteria.

      Archaebacteria - A different lineage of small, simple cells ("bacteria"). These cells, although they lack organelles (such as Mitochondria) are more closely related to us than they are to eubacteria; so, they might be thought of as Eukaryotic bacteria. However, they do not have nuclei so they are not karyotic.

      Eukaryotes - Includinng Protistans, Plants, Animals and Fungi (or some other assortment of kingdoms depending on your taxonomic preference.) Any cell with organelles falls into this domain.

      Does that clear things up?

      --
      The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
    9. Re:Is it actually creating life though? by gene_tailor · · Score: 1

      There are NOT eukaryotic bacteria. That is a contradiction in terms.

      --
      It also occurs to me that if one was drowning, yelling "Help! I'm drowning and I lost my bikini top" would probably be m
  13. his name... by selderrr · · Score: 4, Funny

    If it/he/she survives, they should give it/him/her a name.

    I vote for the name "spam"

    1. Re:his name... by natron+2.0 · · Score: 1

      I vote for Adam/Eve...seems to fit.

    2. Re:his name... by selderrr · · Score: 2

      so boooooooring ...

      God must be a friggin boring dude. The 2 non-characters in his Eden story have a name, whereas the only interesting one (with a personality) is the snake... I would have called him George.

      Adam, Eve & George.

      Way cooler! Good for the sales.

    3. Re:his name... by HiQ · · Score: 2

      I vote for the name 'foobar'

    4. Re:his name... by Cpt_Kirks · · Score: 2

      I prefer "Stan". Of course, chickens are dislexx..dyslax...can't read right.

    5. Re:his name... by Columbo · · Score: 2, Funny

      If we name it "spam" it's sure to replicate and plague the earth! Of course, government will try to legislate it away ... ;)

    6. Re:his name... by matvei · · Score: 1

      His name is Robert Paulson

    7. Re:his name... by SunPin · · Score: 1

      I'd hate to take the cynical route but I'd name the critter "event horizon."

      No turning back, dude. :)

      --
      Laws are for people with no friends.
  14. I got one... by natron+2.0 · · Score: 1

    So what if this thing goes tragically bad?!? Did anybody see that episode of the Twilight Zone? Oh nevermind.

  15. Franken-blob... by flippet · · Score: 2, Funny

    Can you get bolts small enough to go through the neck of a blob in a petri dish? Phil, just me

    --
    "Cattle Prods solve most of life's little problems."
  16. I wonder... by Whispers_in_the_dark · · Score: 4, Funny

    What will "Hello World" in DNA look like?

    1. Re:I wonder... by garcia · · Score: 2

      "I am God. Pheer me!"

    2. Re:I wonder... by JaredOfEuropa · · Score: 3, Funny

      I am more curious to find out what the evolutionary equivalent of "First post" is.

      --
      If construction was anything like programming, an incorrectly fitted lock would bring down the entire building...
    3. Re:I wonder... by davidc · · Score: 1
      Probably something like:


      CATGAACTTCTTCAAGTTCAACGTCTTGATTAA



      (I had to use 31337 Amino acid speak though, and used Q for O and V for W. Perhaps the organism using this sequence will speak with an Eastern European accent :-)

    4. Re:I wonder... by Mr.+Bad+Example · · Score: 2, Funny

      Something like "All your base pair are belong to us".

    5. Re:I wonder... by deathcloset · · Score: 1

      Well, if we use base 4 with A=0 C=1 G=3 and T=4 then I think Hello World with standard Ascii could be expressed as CAGACGCCCGTACGTACGTTGGAACCCGCGTTCGATGTACCGCA.

    6. Re:I wonder... by argStyopa · · Score: 2

      a Jon Katz byline?

      --
      -Styopa
    7. Re:I wonder... by meiocyte · · Score: 1

      catgaacttcttcaatggcaacgtcttgattaa

      --
      The thing in the box has no place in the language-game at all; not even as a something; for the box might even be empty.
  17. Since when did creating life become so simple? by C.U.T.M. · · Score: 1

    Really, creating life can't be *that* simple.

    It will be interesting to see what sort of things religious enthusiasts will say about this. I mean, this would go against the idea of life created by "god", "allah", "buddah", etc., wouldn't it?! It may even disprove ... well, I'll stop there.

    1. Re:Since when did creating life become so simple? by Shads · · Score: 1

      Interesting thought, that doesn't apply to this project because realistically they are modifiying existing life not creating new life... but anyways, if we do finally create life from scratch, does that make the scientist in charge a god?

      --
      Shadus
    2. Re:Since when did creating life become so simple? by leoboiko · · Score: 1

      It seems you don't know what you're talking about.

      Buddha never claimed to be anything more than a man. And he deliberatery avoided discussing about things like the creation of life or the afterlife. Buddhism is based in a "what's important is here and now" philosophy.

      --
      Prescriptive grammar:linguistics :: alchemy:chemistry. Stop being a nazi and learn some science.
    3. Re:Since when did creating life become so simple? by Tackhead · · Score: 2
      > but anyways, if we do finally create life from scratch, does that make the scientist in charge a god?

      Geek: "Hydrogen atoms are just protons, which are made out of three quarks stuck together, and about which an electron happens to be found. If I put enough hydrogen in the same place, I get a star, which I can use to synthesize helium, carbon, and all the other elements. And by combining these elements in the right way, I can make amino acids. And by combining those amino acids just so, I can make life from scratch! Yah00! I'm a God!"

      God: "Really? So, like, next time, you'll start with your own quark-gluon plasma instead of Mine?"

  18. This has been done though... by Qender · · Score: 1

    In the past scientists have been able to create rudimentary forms of life when subjected to the environment they would have been in "when life started". Amino acids combined with great heat and electricity were able to form living structures. Nothing that advanced though, I doubt they were able to reproduce or evolve in any way.

    1. Re:This has been done though... by toxcspdrmn · · Score: 2, Interesting

      No they haven't! Miller and Urey made amino acids. That's a very long way from creating even the simplest entity anyone would consider alive.

      --
      "E pur si muove!" - attributed to Galileo Galilei, 1564-1642
  19. They stole the idea! by Anonymous Coward · · Score: 2, Funny

    God has the patent!

  20. LFS by makapuf · · Score: 3, Funny

    will it now mean "life from scratch".

  21. ..it's not killing, it's called "retirement..." by Anonymous Coward · · Score: 1, Insightful

    ....the scientists reckon that these critters can develop their OWN infectious responses. So, they're building in a failsafe....


    4-minute lifespan.

    1. Re:..it's not killing, it's called "retirement..." by efflux · · Score: 1

      no, I noticed it too, but obviously whoever modded the post as insightful didn't.

      --
      Do I contradict myself? Very well, then I contradict myself, I am large, I contain multitudes. -- Walt Whitman
  22. Re:Life itself by m00nun1t · · Score: 2, Funny
    "half-human beast wandering around the country"

    If it's female, sounds like the best chance many slashdotters have of getting laid.

  23. Aaargh by Daniel+Dvorkin · · Score: 5, Insightful
    From the article:
    The project raises philosophical, ethical and practical questions. For instance, if a man-made organism proved able to survive and reproduce only under a narrow range of laboratory conditions, could it really be considered life? More broadly, do scientists have any moral right to create new organisms?
    Why the hell not? I am so fucking sick of people invoking morality (or "ethics;" IMO it's a distinction without a difference, but that's a whole 'nother argument) as an argument against biological research. No one ever brings these arguments up in chemistry, or physics, or math -- despite the demonstrated ability of, e.g., a bunch of physicists working with a few chemists and mathematicians to come up with a device that can fry an entire city in a fraction of a second. But when it comes to biology, people get squeamish because ... well, because we've had the idea implanted in our heads, at least since Frankenstein, that cutting-edge biological research is somehow "playing God." Any time you hear anyone saying there are "ethical concerns" with biological research, that's what they're talking about, even if they're too mealy-mouthed to admit it.

    Frankenstein was a story. It was fiction. And so was Jurassic Park, and so was Gattaca. I won't comment on the Bible here, although my view of that book is probably pretty clear from the context ... And none of it, none of it, justifies putting up roadblocks to research that will, almost certainly, in the not-too-distant future, save lives.
    --
    The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    1. Re:Aaargh by pubjames · · Score: 5, Interesting

      No one ever brings these [moral] arguments up in chemistry, or physics, or math

      I think Einstein would have disagreed with you.

    2. Re:Aaargh by monadicIO · · Score: 1

      I wish I could mod you up, but some modGods might decide otherwise. BTW, a question to these moral/ethics guys: At what exact point does human endeavour become "playing god"? What makes a person a "certified" ethicist to comment on what is moral and immoral? Wonder what Galileo had to say about them.

      --

      The law of excluded middle : Either I'm foo or I'm foobar

    3. Re:Aaargh by Daniel+Dvorkin · · Score: 5, Insightful

      Okay, fair enough; Einstein had serious doubts about the morality of atomic weapons -- and so did Oppenheimer, who had a lot more to do with the actual building of the bomb than Einstein did. But those were moral doubts about the applications of the science, not the research itself. No one told Fermi, when he was building his first atomic pile, that he must stop immediately because There Are Things Man Was Not Meant To Know.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    4. Re:Aaargh by Total_Wimp · · Score: 1

      Don't we have a right to at least ask the question of whether or not it's moral? That looks like all that's being presented here. And that's not a bad idea. Wouldn't the world be a better place if we supported the question of morality instead of just assuming it's irrelevant?

      TW

    5. Re:Aaargh by DiSKiLLeR · · Score: 2

      Agreed!

      Fantastic write up!

      Mod parent up!

      D.

      --
      You can tell how powerful someone is by the magnitude of the crime they can commit and be able to get away with.
    6. Re:Aaargh by Daniel_Staal · · Score: 1

      Frankenstein was a story. It was fiction. And so was Jurassic Park, and so was Gattaca. I won't comment on the Bible here, although my view of that book is probably pretty clear from the context ... And none of it, none of it, justifies putting up roadblocks to research that will, almost certainly, in the not-too-distant future, save lives.

      I'll agree on your stance on morallity, but part of the point of science fiction (and the three stories you mention are that) is to explore what might happen so we can be prepared. That doesn't mean it will happen, just that it might. Saying 'look what happened in Jurrasic Park' is an invitation for someone to prove that cannot happen in this case (or at least that we do not have to worry about it). It is an extreme example, but you do need to worry about worst-case scenarios, espesally when they involve loss of life.

      --
      'Sensible' is a curse word.
    7. Re:Aaargh by Planesdragon · · Score: 2

      And none of it, none of it, justifies putting up roadblocks to research that will, almost certainly, in the not-too-distant future, save lives.

      Tell me how is so almost-certain that biological manufacture of organisms will save lives.

      I think the only "inevitable" use of technologoy is that it will be used to hurt someone.

      Now, I don't find any moral concerns with biological research that doesn't involve harming people, nor do I find any ethical problems if they're honest. I don't think that we're "playing God" if we create new life or alter extant life--

      Or, rather, we are, but He wants us to.

    8. Re:Aaargh by Daniel+Dvorkin · · Score: 2

      Sure, you always have the right to question. But that doesn't mean the question makes sense. If I'm walking down the street, and some whacko street preacher tells me I'm immoral for walking down the street, I don't stop to debate him; I just go around him and keep walking.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    9. Re:Aaargh by Anonymous Coward · · Score: 2, Interesting

      You think morality and ethics are not brought up in physics? Can you say nuclear bomb? Chemistry? Can you say nerve gas? Just because people weren't able to stop them from being made/used doesn't make the use right... the same goes for biology. Ethics and ethical debate has a place in all human endeavors (even when humans may not be involved in the results).

      Your "saving lives" comment is meaningless without ethics... If there are no ethics, why do you want to "save lives"? With no ethics, saving lives is a "so what, who cares, it doesn't help me right here, right now" proposition.

    10. Re:Aaargh by codeButcher · · Score: 2
      And none of it, none of it, justifies putting up roadblocks to research that will, almost certainly, in the not-too-distant future, save lives.

      Now that's a very moral, ethical thing to say... Saving lives: the magic formula that justifies everything.

      So if some research does not hold much promise to save lives, is it okay to put up a roadblock to that?

      --
      Free, as in your money being freed from the confines of your account.
    11. Re:Aaargh by monadicIO · · Score: 1
      I think the only "inevitable" use of technologoy is that it will be used to hurt someone.

      Yes, I can always beat up someone to pulp using a microwave oven. Is that your justification for saying that all microwave oven will definitely hurt people? I can run people down with cars - should they not be used at all? Aspirin in large doses can also kill people - hmm let's ban that too!!

      There is a difference between use and abuse. The mere possibility of abuse should not restrict scientific temper. Sadly ethicists/moralists/religious types mostly spread FUD about things they really don't quite understand.

      --

      The law of excluded middle : Either I'm foo or I'm foobar

    12. Re:Aaargh by Izeickl · · Score: 2

      Well the fact is biology has a greater impact on morals than just about every other science. It is directly pulling at the threads of life to see "What makes it tick?", on the other hand physics, maths etc are not. Sure they can be put to use in a bad way i.e. Atomic Bomb, but "Physics" and "Maths" are basicly terms for the same thing, "working with numbers" and applying them to real life. Biology im sure has more than its fair share of complex mathmatics, its the use that the mathmatics is put too that is key! Biology has been the force behind some of the most dreadful creations to date ASWELL as some of the best! Its never the subject, but the application.

    13. Re:Aaargh by ElBeano · · Score: 1

      This AC is quite right. Apparently someone modded him/her down because they are an idiot who can't stand to deal with the logic. No doubt, they are quite zealous about censorship issues in spite of the fact that they modded down (it would seem) with the intent of burying the viewpoint. I'll take a stand and agree (posting non-anonymously) that ethics and morality have an important role in every scientific endeavour. Just becasuse we can doesn't mean we should.

    14. Re:Aaargh by Skirwan · · Score: 5, Funny
      But those were moral doubts about the applications of the science, not the research itself.
      Researching gene splicing: Good.
      Creating a three-assed monkey: Bad.

      It's really not that hard.

      --
      Damn the Emperor!
    15. Re:Aaargh by theghost · · Score: 1

      That's a good point. We shouldn't stop research, but bringing up these ethical questions is vital and is what helps to make sure the Really Bad Thing doesn't happen.

      We cannot let scientists (or anyone else) think that they work in a vacuum - that what they are doing is okay because they personally wouldn't dream of doing Really Bad Things with the knowledge they uncover. They should be thinking long and hard about the "what ifs".

      I'd feel a whole lot better if schools taught as much about Einstein's political and ethical beliefs as they do about his academic pursuits. Same thing for Henry Ford and his beliefs vs. his technical innovations.

      --
      The only thing necessary for the triumph of evil is that good men do nothing.
    16. Re:Aaargh by Total_Wimp · · Score: 1

      Why doesn't the question make sense? Aren't there moral questions in science?

      If I wanted to test a new kind of atom bomb at my house in northern Virginia it may be science but it's certainly not moral. This life-creating experiment is also potentially dangerous. Asking the question not only make sense, but should be considered a certain requirement.

      Put another way, why would they have taken such precautions if the experiment didn't have some potential downsides to our ecosphere? If it has the potential of affecting the ecosphere, shouldn't they at least question whether it's moral to begin with?

      TW

    17. Re:Aaargh by swisener · · Score: 1

      How about Bill Joy?

    18. Re:Aaargh by rawshark · · Score: 1

      >>

      It'll help us understand how our bodies function.

      >>
      You're forgetting sex :)

      >> :)

    19. Re:Aaargh by Vellmont · · Score: 1

      Well, in this example I agree with you. Creating single celled organisms that can't survive outside a laboratory isn't much of a moral dilemma as far as I'm concerned.
      But you seem to take this further. Their certainly are things I'd be concerned over involving biological research. Cloning humans and raising them to maturity is certainly a concern. Not for religious reasons, but simply for the fact that (currently) clones have damaged DNA. It seems an important ethical question whether it's morally right to create a human who might have major medical problems somewhere down the road.
      How about using otherwise healthy humans for potentially harmfull medical experiments? Pay someone $10,000 to take an experimental HIV vaccine, then deliberately infect them with HIV. I'm not saying anyone would do this, but it's certainly a very valid ethical concern.
      Biological research can directly involve humans and animals. Humans (and sometimes animals) are the main actors in ethical debates. It should be therefor be no surprise that biological research involves ethical concerns more than physics, chemistry, etc.

      --
      AccountKiller
    20. Re:Aaargh by CommieLib · · Score: 3, Insightful

      I think that there's pretty much a consensus that the world would be a better place if nuclear weapons had never existed. A bell, of course, cannot be unrung.

      What Bible-thumpers like myself contend is that man's ability to create often outpaces man's wisdom to use. Do you can consider that a controversial argument? I think that the "creation" (not really a creation, more like stripping the engine and transmission out of a car and replacing them) is the first step into creating an unimaginably powerful force. Whether that force will be for good or evil is yet to be seen.

      Simply because one can make the case that a force can save lives does not automatically trump any force for evil it may introduce concomitantly. See Edward Teller...

      Anyhow, at this point, it's way too late to have this debate. The genie is already out of the bottle, and now we have to ensure that the good guys stay ahead of the bad guys in this race.

      --
      If your bitterest enemies are people who hack the heads off civilians, then I would say you're doing something right.
    21. Re:Aaargh by Christianfreak · · Score: 2

      By that logic if I come and beat you, or shoot you, or kill your family, then you can't be angry about that because morals don't matter and its okay for me to do whatever I want.

    22. Re:Aaargh by Luyseyal · · Score: 2

      the real question is whether the research methodology itself is morally culpable. For example, while it's all well and good to dream up, plan out, sketch plans for, and patent baby mulching machines, if that research includes testing components on real babies, there is a moral problem there.

      Similarly, if research on creating DNA from scratch includes reckless dumping into the local water supply, there is a moral problem there. If researching black holes requires nuking Texas to get just the right measurements for the theory, there is a moral problem there.

      So, while I agree with the sentiment of your perspective, I cannot agree that all theorizing and research has no moral culpability. If all theorizing and research had no moral culpability, there'd be no debate over stem cell research. But, since a large enough slice of Earth's human population believes that humans are humans at conception, there is moral debate over it.

      On a little bit related sidenote, I don't understand why PETA (People for the Ethical Treatment of Animals) isn't a rabid anti-abortion, anti-stem-cell-research group. By any definition, H.sapiens fetuses are animals with demonstrable reaction to poking with sharp sticks, etc. Their argument all along is that human rights take little precedence over the animal right-to-life. What's the big fucking difference?

      I suppose some PETA person will say something about the "right to choose" for women. Well, that argument boils down to: "the right to choose death for another animal supercedes that animal's right to live". Let's not finesse it at all, the pro-choice perspective is: "the woman's right to choose, period." It includes nothing about long term chances for the baby in a cold, terrible world, blah blah. Consequently, I simply fail to see how any PETA person can be pro-choice without being ridiculously inconsistent.

      stirring up trouble,
      -l

      --
      Help cure AIDS, cancer, and more. Donate your unused computer time to worldcommunitygrid.org. Join Team Slashdot!
    23. Re:Aaargh by 4ntifa · · Score: 1

      Consensus? Is there? I for one don't agree with your anti-nuke view. If there hadn't been the threat of M.A.D. (not the comic, stupid!;) during the post-WWII decades, probably millions and millions would have died in an ultimate standoff between the Soviets (& satellites) and the US (& their satellites).

      About 200000-300000 people have been killed by nukes, and in my POV, unnecessarily. But nukes have probably prevented WWIII - this far.

      --
      -=- 4ntifa -=-
    24. Re:Aaargh by Planesdragon · · Score: 2

      Yes, I can always beat up someone to pulp using a microwave oven. Is that your justification for saying that all microwave oven will definitely hurt people? I can run people down with cars - should they not be used at all? Aspirin in large doses can also kill people - hmm let's ban that too!!

      What makes you think that [hurts people] = [must be banned]? I certainly didn't say it.

      Some people deserve to be hurt. More people than that deserve to be helped. Sadly, the only sure thing for new inventions is that they can be used to hurt (asprin probably works better for hurting someone by aiding in bleeding them to death.) It is never, even in medical research, sure that a new invention can possibly be used to help people.

    25. Re:Aaargh by Doug+Neal · · Score: 1

      Right on!

      And here's something to consider. I wonder if whoever wrote that article is a vegetarian? Do scientists have any moral right to create new organisms? Well, does anyone have any moral right to kill organisms? Seems like the logical continuation of this argument is, no, of course not. Yet this is not at all uncommon.

      As a vegetarian myself it's quite obvious to me which one seems more moral. Creating life or destroying life? Duh.

    26. Re:Aaargh by 4ntifa · · Score: 1

      Seriously, I don't see nuking Texas as a problem, as long as all peace-loving, sensible people are moved out of the way, first. (And I mean _all_ three of them!)

      --
      -=- 4ntifa -=-
    27. Re:Aaargh by utahjazz · · Score: 5, Funny

      Einstein had serious doubts about the morality of atomic weapons [...] But those were moral doubts about the applications of the science, not the research itself.

      Actually, I went to see Stephen Hawking speak a few years back, and outside the building were a group of a dozen or so protesters. They were protesting the existence of black holes etc... claiming that Hawking was sent by Satan to lure us away from the Bible.

      I can't imagine anything more benign than sitting in a wheelchair thinking about what peices of the universe billions of miles away are like. But, it goes against the bible, so it is 'immoral'.

      -see you in hell

    28. Re:Aaargh by CommieLib · · Score: 2

      I will agree that there is room for debate on this issue. A non-nuclear WW III would have been fought with a post-Stalingrad Soviet Union, and could have spared the world 50 years of communist butchery. Of course, when you get into questions of speculative history, you quickly come off the rails: it would have depended on who was president / premier for each side, our disposition with post-war Germany, and certainly the war with Japan wouldn't have ended when it did.

      I think, unfortunately, that the price for the existence of nuclear weapons has not yet been wholly accessed. Between the North Korea, Pakistan / India, and the Islamofascists think we will see another use in anger in my lifetime.

      Anyhow, we're way off topic here. I stand by original point that man's cleverness often (usually?) outpaces his wisdom.

      --
      If your bitterest enemies are people who hack the heads off civilians, then I would say you're doing something right.
    29. Re:Aaargh by CyberKnet · · Score: 1, Flamebait

      I am so fucking sick of people invoking morality ...
      And none of it, none of it, justifies putting up roadblocks to research that will, almost certainly, in the not-too-distant future, save lives.


      9 times out of ten, any moral/ethical issue arrising from cutting edge biotech is most likely to be concerned with an issue *other* than creating life. In fact, it's much more likely to be about human embryonic stem cell research, and that should always have its morality questions or ethical issues invoked. We should never justify killing new lives as "saving lives". That's just backwards.

      However, in response to your argument, you can never take too many precautions when attempting to create new life. I do not believe that even with the best of planning a scientist can be absolutely sure of the outcome of such a project. You still have to weigh up the risks. And with those risks are going to be questions related to ethical and morale issues. It doesn't even have to be about "Playing God". It could be "Do I want to risk wiping out all life on this planet to try and find a cure for cancer?"

      There are other moral and ethical issues at stake with cutting edge biotech than "playing God"; and it is usually those that are being called into question.

      Stop using your own pet peeve to create a baseless, needless rant.

      --
      Video meliora proboque deteriora sequor - Ovidius
    30. Re:Aaargh by Leigh13 · · Score: 1

      Yes, but how soon before those goddamn liberals give this organism the right to vote??

      --

      What I should have said was nothing.
    31. Re:Aaargh by SilkBD · · Score: 2, Insightful
      man's ability to create often outpaces man's wisdom to use.

      Well sure, this happens quite often when it comes to R&D. But that's what we are... we're explorers, creators, inventors. We are, in essense, God. This is just a new level of what we as a species have always done.

      --
      00101010
    32. Re:Aaargh by Peyna · · Score: 2

      Hmm, how do black holes contradict the Bible? Interesting people in this world, there are.

      --
      What?
    33. Re:Aaargh by corvi42 · · Score: 2

      You make some good points, but there have been examples of similar things in real history of human short-sightedness leading to major disasters.

      Think of the cane toads, rabbits and wild horses in Australia. Or the zebra muscles in the great lakes. Or killer bees. The list goes on and on. We all know that humans have ( mostly inadvertantly ) made a big mess of the world through our ignorance of its complexity.

      However, I agree that none of this justifies putting roadblocks up against research but for different reasons. Firstly, and more importantly, the whole point of research is to eliminate the ignorance that leads us to such blunders, and so preventing such research is the opposite strategy to employ to reduce such tragedies. Secondly is that you cannot fundamentally undo knowledge or prevent knowledge and so a ban in one area or country will simply allow other countries to excel in that area, causing possibly dangerous imbalances in technology. If you instituted a global ban, then you would simply force this research underground, pushing science more into the realm of organized crime, which nobody wants to see.

      Ultimately education is the best prevention. If we educate biologists and geneticists in the perils & details of bio-ethics, then I think by and large you will have a consciencious and ethical community who will implement self-restraints on what work and applications are ethical. I know this sounds dubious to many, but it has been the general rule in the scientific community up until now, and I think it has been mostly successful.

      --

      There are a thousand forms of subversion, but few can equal the convenience and immediacy of a cream pie -Noel Godin
    34. Re:Aaargh by CommieLib · · Score: 2

      Absolutely correct. The last idea I want to introduce into discussion is anti-intellectualism, or Luddism. What I'm putting forth is that when we choose what particular projects to pursue, we put too little consideration into the impact of the knowledge we will gain. The United States enjoys a unique position in that it can undertake certain projects that might not take place in other places until much later, or perhaps never. This imposes upon us a responsibility to choose these projects carefully.

      The first thing that comes to mind when I hear about this is a germ lab in Baghdad creating a virus that only attacks a Jewish genome. Hopefully that won't be a possibility for much longer.

      --
      If your bitterest enemies are people who hack the heads off civilians, then I would say you're doing something right.
    35. Re:Aaargh by HalfFlat · · Score: 3, Insightful

      We should never justify killing new lives as "saving lives". That's just backwards.
      No, it's just hard and uncomfortable.

      Hopefully such a hypothetical situation will never arise, but what if the only feasible way to save 500 people was to sacrifice 100? (The recent hostage situation in Moscow comes to mind, but it's far from clear that the use of gas was in fact the only feasible way, or that the hostages were otherwise sure to die.) What if the only way to save 2 lives were to sacrifice one? What if the one was a friend, and the two were strangers?

      And then there is the question of life. All life is not regarded morally equal, for we have little qualms in eating vegetables, and even have even less care for the millions and millions of minute organisms that die through our action or inaction every day. What makes a life valuable? It's a hard question, and not simply solved by saying that it's "human" or not. What is so special about a bunch of genes by themsleves?

      These questions are hard, as demonstrated by the lack of widely accepted answers. Blanket dismissals though just hide the problem. If the problem is not confronted, then we may be acting in ways that we would regard as morally wrong if we later viewed them in a rational light. In that sense, not thinking about these problems can itself be regarded as amoral.

    36. Re:Aaargh by Jonathan · · Score: 3, Insightful

      Yes, and because of the Computer Science orientation of most /. readers, they know that some professor's AI project is not going to take control of the nuclear arsenal of the US ala Terminator's Skynet. They understand that such scenarios are just fantasy. And yet similar paranoia applied to a field they don't know that much about is treated like a realistic worry. It's funny, really.

    37. Re:Aaargh by tshak · · Score: 2

      Although I don't have an opinion regarding the morality of attempting to create (really mutate) an organism, I strongly disagree with your apthetic attitude towards morality and science. If research was just simple observation, then I'd agree with you entirely. Even if knowledge can be used for evil, we should still seek it. However, research also requires experiments. These experiments can have very adverse affects on our environment, peoples lives, or other species lives. With math, as you mentioned, this is not an issue because running forumla's my Ti86 is not affecting anybody.

      --

      There is no longer anything that can be done with computers that is nontrivial and clearly legal. -- Paul Phillips
    38. Re:Aaargh by Mac+Degger · · Score: 2

      You should be modded 'Insightfull' (or at least 'Stating What Should Be Obvious'.

      --
      -- Waht? Tehr's a preveiw buottn?
    39. Re:Aaargh by Chester+K · · Score: 2

      But those were moral doubts about the applications of the science, not the research itself. No one told Fermi, when he was building his first atomic pile, that he must stop immediately because There Are Things Man Was Not Meant To Know.

      I bet Socrates would have something to add to this discussion.

      --

      NO CARRIER
    40. Re:Aaargh by Mac+Degger · · Score: 2

      Although I absolutely agree with your thought that man should think long and hard about the consequences (and how to avoid certain ones), I think that ultimately, we should be thankfull for the deterent nukes have formed. I'm against nuclear weapons, but without them, the US and USSR would have certainly gone up against each other in a full 'hot' war, instead of just using other nations to do so.

      --
      -- Waht? Tehr's a preveiw buottn?
    41. Re:Aaargh by Tablizer · · Score: 1

      Researching gene splicing: Good. Creating a three-assed monkey: Bad. [Morality is] really not that hard.

      What about the grey areas, like creating a 1.3-assed monkey? Chair research for Southwest Airlines may be greatly enhanced, for example.

    42. Re:Aaargh by mateomiguel · · Score: 1

      The unexamined universe is not worth inhabiting!

    43. Re:Aaargh by CyberKnet · · Score: 2

      Thanks. My sentiments exactly; I was just trying to think how to put it... superb job.

      --
      Video meliora proboque deteriora sequor - Ovidius
    44. Re:Aaargh by why-is-it · · Score: 2

      I bet Socrates would have something to add to this discussion.

      Perhaps, but Socrates claimed that he did not know anything, and he spent his time humiliating people who had what he considered to be incorrect opinions. He would probably get modded down as a troll or flamebait.

      --
      *** Where are we going? And what's with this handbasket?
    45. Re:Aaargh by Idarubicin · · Score: 4, Interesting

      This is actually kind of ironic. Our understanding of physics (general relativity and quantum mechanics, and all the floppy connective bits we've tried to stick in between) breaks down rather badly around singularities--black holes (if they exist). If anything, these protesters should be cheering the existence of black holes. They're sort of like God's practical joke on physicists.

      --
      ~Idarubicin
    46. Re:Aaargh by Tackhead · · Score: 2
      > Tell me how is so almost-certain that biological manufacture of organisms will save lives.
      > I think the only "inevitable" use of technologoy is that it will be used to hurt someone.

      Back atcha:

      Tell me how is so almost-certain that biological manufacture of organisims will hurt someone.

      I think the only "inevitable" use of technologoy is that it will be used to improve lives.

      With a twist:

      Overall, has technology improved or degraded the standard of living for Joe Sixpack...

      ...in the last 5000 years? (agriculture, writing)
      ...in the last 500 years? (germ theory of disease, sewage systems, industrialization)
      ...in the last 100 years? (mass production, running water, the toilet, in-home refrigeration, electricity, radio, antibiotics)
      ...in the last 50 years? (air travel, television, mass vaccination against polio, eradication of smallpox)
      ...in the last 5 years? (widely-available cheap computers, progress on cancer, heart disease, Alzheimer's, gene-hacked foods requiring lower pesticide levels and higher crop yields)

      Has technology been used for evil, as well as good? Sure. But has the good outweighed the bad? I've got my opinion, but hey, it's your call.

    47. Re:Aaargh by prell · · Score: 1

      wow, what a magical world you must live in, where no-one ever does anything evil with knowledge. Does Dostoevsky exist over there?

      How long do you honestly think it will be before scientists start messing with clones? "Organ farms" I believe they call them. Yea, Im sure that will go off without a hitch.

      Don't get me wrong, I think things like stem cell research can help us take great strides in genetic research, but Im not so naive that I can't see where a "first step" could lead, in the wrong hands.

    48. Re:Aaargh by gene_tailor · · Score: 1
      I don't necessarily disagree with your point, but --

      >It seems an important ethical question whether it's morally right to create a human who might have major medical problems somewhere down the road

      ANY human baby that is currently created is at risk for major medical problems (due to genetics OR environmental influences)....

      --
      It also occurs to me that if one was drowning, yelling "Help! I'm drowning and I lost my bikini top" would probably be m
    49. Re:Aaargh by Zog · · Score: 1

      I think similar arguments can be made about slavery - from certain points of view, it's not immoral in its essence. It's just having people that you have power over and provide for in return for their labor.

      However, the reason slavery was officially abolished all over the place is that slavery allows for much evil to be done: beatings, rape, starvation, excessive punishment, inhospitable conditions, and general not-cool use of power.

      The same things apply to genetic research and such: It is not inherently evil, but it can be used for great evil.

      And on the whole bible thing, I think it's important to realize that 'christians' and the church tend to be completely self-serving and couldn't care less what it says a lot of the time. See the crusades, spanish inquisition, etc. They go straight against it. It also doesn't really say anything about whether genetic research is bad or not; however, it does lay some ground rules in how the people of God (the real ones, I mean - the nominal ones don't really care unless it supports what they want) should live.

      For example, Philemon and several other spots give a pretty good idea of how slaves and their masters should act in light of being God's people: not with harshness and over-rulling force, but instead being gentle but firm, allowing others to live as they wish but still showing by their lives and the joy in them that there's a better way, acting with reason and being intentional about what's going on - not wandering aimlessly (using the brains God put in their heads), and earning their food themselves. Of course, that kind of stuff is just to serve as a guide to how to live as a man/woman of God; it isn't the road to salvation (which is too far offtopic for this thread) :-)

    50. Re:Aaargh by Fjord · · Score: 2

      We should be thankful now, but not all of history has been written yet. There could come a time that the lives saved by the lack of a hot war is outpaced by the lives destroyed by nuclear weapons.

      Not that I'm against advances in civilization. I certainly like that we have nuclear power, and I don't think that this experiment is wrong to do. I don't even think us having nuclear weapon technology is inherently bad, but I do believe that it could be used in a bad way eventually.

      --
      -no broken link
    51. Re:Aaargh by junkgrep · · Score: 2

      My position: you CAN put a value on human life, indeed you cannot avoid doing so at least implicitly almost every day, with every action you take that involves some risk to yourself and others (for instance: driving). Economists do it all the time: the price commonly ranges anywhere from 3 to 24 million.

      Can you really justify not murdering one innocent person when it would save thousands of lives? You can call the person that chooses to do it a mass murderer all you want. Perhaps they're even be condemned to hell for it. But from their perspective, it was all worth it, because in doing so they saved thousands. And I'm not sure it's so easy to refute their perspective.

    52. Re:Aaargh by dvk · · Score: 2
      > At what exact point does human endeavour become "playing god"?

      Not being an ethicist/philosopher, my opinion may not count for much, but i'd say the "Playing G-d" thing might have 2 independent stages:
      1) Creating something that is self-sustainable and self-replicating.
      2) Creating something self-aware (i.e. able to figure out it was created by you).

      BTW, "Create" means both design and manufature, since without the design part, they are both covered by any woman who gave birth to a child.

      From ethical standpoint, both of the above stages have to be treated VERY carefully as both can be cause of MAJOR harm to human race - as opposed to any arbitrary research which by itself (i.e. without some schmuck wising to do harm) aren't necessarily dangerous.

      #1: if you created self-replicating something/someone, it can replicate beyond your control, and unless it's a benigh kind intelligent thing, it'll likely compete with us (humans) for resources and might win.

      #2: If you create self-aware someone/something, it may evolve, and thus become intelligent enough to either decide to create it's own #1 (for SG1 fans: remember how replicators started? from an artifical robot who built them), or better yet make itself into #1 even if it wasn't self-replicating before (Neuromancer sequel probably could be a decent example, if I wrote it - i'm not sure if Gibson ever did write a sequel and if so then what happened).

      A very good sci-fi example of the problems with #1 was in an old Soviet sci-fi book "Burning Island", about some guy who invented a catalyst which caused oxygen in the air to burn itself out. (sorry, nothing good from English-spoeaking Sci-Fi comes to my poor tired mind at the moment, any input welcome ;)

      I will not go into theological issues - I try not to touch them with a 10^27 foot pole (both because as someone moderately observant I'd be modded to negative infinity, and because unlike some religious people, I don't fancy myself to be an expert on religion/theology just because I hold particular views/beliefs).

      -DVK

      --
      "The right to figure things out for yourself is the only true freedom everyone shares. Go use it"-R.A.Heinlein
  24. About the Bacteria M. genitalium by Anonymous Coward · · Score: 1, Informative

    Google search:
    http://www.google.com/search?q=M.+genitalium&sourc eid=mozilla-search&start=0&start=0

    Best link in search:
    http://www.tigr.org/tdb/CMR/gmg/htmls/Background.h tml

    The jist of it is, it's a simple prokaryotic creature that has been fully sequenced. The full genetic sequence is about 0.54MB of data.

  25. Considering... by keyne9 · · Score: 2, Funny

    Considering that they're using some bacteria that causes burning/itching in the crotch, I suppose that creating this new life from 'scratch' was more of a play on words?

    Who knew they had advanced so far in subtle humor? :)

  26. Re:News: Two famous scientists found dead by Daniel+Dvorkin · · Score: 4, Insightful

    No, you're the only one to whom it seems incredibly foolish. Well, okay, you and a bunch of other fools.

    As I said in another post, no one raises these objections with physics, or chemistry, or math, despite things like, oh, say, the atomic bomb. All scientific research is potentially dangerous. But stopping research because of some vague fear, or some pseudo-philosophical-religious claptrap like "some things are better off left alone" (what things exactly? Be specific) would leave us in the Dark Ages.

    Jellyfish don't do scientific research. No jellyfish has ever built an atomic bomb, or engineered a dangerous virus, true. But would you rather be a jellyfish, or a human being?

    --
    The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
  27. Results to appear in ... by gcondon · · Score: 5, Funny


    The New England Journal of Evil

    1. Re:Results to appear in ... by Cpt_Kirks · · Score: 2

      Shouldn't that be "E - Vil"?

  28. Re:Hello...? by JanneM · · Score: 4, Interesting

    And if the scientists in question are not interested in those areas? What do you suggest - making it illegal to fund "non-important" science? Who would have the say on what is important? And how exactly do you then stop those affected scientists from continuing their work at a university in another country, rather than toeing to the line and doing 'important' stuff? The science community is by it's nature a pretty mobile bunch of people; it's built into the system that spending time at other universities and other countries is seen as a good thing and a boon to one's career.

    This is a parallel to those advocating the joining of competing open-source projects. It won't work to mandate what people work with there, and it won't work here. In both cases, people are working on what they do (or financing the work) because they find it fascinating and important, and no matter what others say they should be doing they will continue doing what they do.

    --
    Trust the Computer. The Computer is your friend.
  29. This sounds strangely familiar... by cyrek · · Score: 2, Interesting

    Call me crazy, but I see a parallel here with this. - Taking an existing, known format and minimising it as far as possible. Heck - even the number returned by the code is relevant.

    --
    Insert witty sig about inserting witty sig here, here.
  30. BBC story by gingerTabs · · Score: 1
  31. Fridge. by suss · · Score: 2

    The Washington Post is reporting on an apparently credible project to create a simple life form in a petri dish.

    They should try a fridge instead. Last week i looked in there and i swear something jumped at me!

  32. Re:What's so scary? by Total_Wimp · · Score: 5, Insightful

    Star Thistle is commonly found in California fields only it's not native and it wasn't put there on purpose. It has displaced the local grasses almost completely in some areas. This is only one of thousands of examples of non-native species that have infested new (to them) environments.

    All environments will be new to this critter. That makes the "scary" part, to me anyway, the fact that if this were to escape and survive it would displace something else with absolutely unknown consequences. We are completely dependant on our environment's biology for breathable air and edible food so it's pretty damn important that we don't accidentally (no one would even _consider_ doing it purposely, would they?) introduce some species that will screw it up.

    I'm not saying we shouldn't experiment. I'm just saying that everyone should have a healthy dose of fear over this particular kind of experiment.

    TW

  33. Creator? God? by mrnick · · Score: 3, Interesting

    I've had asked this question before but never received a good answer.

    If man creates a new life form by definition man is the "Creator" of that life form. If somehow in a distance future man builds on this knowledge and creates an intelligent life form, from scratch, would man be it's "Creator"? If so, could one say that man is it's God?

    This was touched upon in the Deep Space 9 trek series. The Dominan (sp?) created two life forms and the life forms acknowledged their "Creators" as their God.

    Who knows?

    Nick Powers

    --

    Encryption: I may not agree with what you say, but I will defend your right to encrypt it...
  34. Re:Hello...? by Wonda · · Score: 1

    If they can figure out how DNA actually works, those should be easy to fix, just because they're not directly looking at those problems doesn't mean it can't help.

  35. Excellent National Academy of Sciences Report... by cybrpnk2 · · Score: 5, Informative

    The minimum number of genes required for an organism to survive has been a topic of interest for several years. An excellent semi-technical overview of this effort was produced by The National Academy of Sciences...

  36. What I would do... by Azzaron · · Score: 1

    Well, if I had this kind of power, I'd make a lifeform with these characteristics:

    1. Able to complete all my homework for me.
    2. Will take on a female humanoid form and provide sexual gratification upon request.
    3. Will do all annoying chores around the house such as cleaning the bathroom, taking out the garbage and washing the dishes.

    Basically, I'd create the perfect woman. Hmmm, I better throw "Will not ask you if they're fat" in that list...

    1. Re:What I would do... by Ozymandias_KoK · · Score: 1

      Let them ask. DON'T let them GET fat.

  37. Re:Hello...? by Daniel+Dvorkin · · Score: 5, Insightful

    There are two basic approaches to medical research. The first is the "shotgun" approach -- throw a bunch of chemicals at a disease and find one that stops the disease process without killing the patient. This approach has led to some great successes over the last century or so, but the problem is, as far as we can tell, we've just about discovered everything we're going to discover by this method. The easy stuff has been done.

    The other approach, the molecular approach, is to figure out how life works -- and, of great interest from the medical applications point of view, how it goes wrong -- from the ground up, and try to use that knowledge to build new treatments. That's what these guys are doing. I can almost guarantee you that when a cure for cancer or AIDS is found, it will come from this approach.

    --
    The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
  38. Not to be a Luddite... by CatWrangler · · Score: 2
    But sometimes the genie should not be taken out of the bottle. This will be of course eventually used for weapons. Think of small life forms targeted to attack certain ethnic groups, genders. Of course these things will mutate as well too.

    Life will find a way.

    --

    ---
    When you come to a fork in the road, take it! --Yogi Berra--

    1. Re:Not to be a Luddite... by dmaxwell · · Score: 2

      Existing life forms could be adjusted to target particular groups. That would be much easier to do than whipping up an organism from scratch to do it. I agree that there are serious concerns with this type of research but I don't think this is one of the major ones.

  39. Try it with silicon by jmcwork · · Score: 3, Interesting

    Start from the real beginning and try to create the basic building blocks with silicon instead of carbon. That would be a real accomplishment. (No, not silicone. Those life forms are already all over Hollywood.)

    1. Re:Try it with silicon by jmcwork · · Score: 1

      X-files volcano episode?

    2. Re:Try it with silicon by GMontag451 · · Score: 2

      Unfortunately, it won't work. Silicon simply can't make chains long enough.

    3. Re:Try it with silicon by Idarubicin · · Score: 2
      Silicon simply can't make chains long enough.

      The jury is still out on that one. It is possible to create long-chain silanes similar to some structures seen with carbon. They are markedly less durable, however. In particular, the faintest trace of water (liquid or vapour) is enough to break them down into smaller bits. There's way too much water everywhere on earth. In fact, there's probably too much water on Mars.

      On the bright side, if you ever did create such an organism, you'd never have to worry about it escaping from the lab.

      --
      ~Idarubicin
  40. Re:Hello...? by Anonymous Coward · · Score: 1, Insightful

    You're against basic research?

    My favourite physics teacher used to say that if the energy commisions of 19th century should've chosen between a project on more effecient candles and one on studying the relationship between magnetism and electricity they'd probably opted for the former.

    Basic research does provide practical solutions - only on a longer time scale.

  41. Exciting Modeling Prospects by airuck · · Score: 2, Interesting

    This experiment is very exciting for many reasons, but the modeling aspects alone make it worth while. Just following the up and down regulation of thousands of genes is an overwhelming burden. Modeling/visualizing the entire cell network with the normal complement of entities would be fantastically difficult. Simplification through gene reduction is a fundamentally important first step.

    Hmmm... a lot of trees will die if Boehringer Mannheim tries to print this one out (a la biochemical pathways).

    --
    First entomology, then virology, and finally bioinformatics systems. Bugs follow me wherever I go.
  42. Re:Life itself by Shads · · Score: 1

    > This is interesting research, but we have to be
    > wary. The Frankenstein effect (as postulated by
    > Bains et al.) could cause the researchers to
    > overestimate their ability to control their
    > creation, leading to the extinction of
    > humanity.

    > and harsh penalties to prevent anything
    > untoward from happening.

    uhm... isn't the extinction of humanity a pretty harsh penalty? I think if someone creates something that destroys the entire human race... well, lets not punish them, I think they are already punished enough.

    --
    Shadus
  43. Re:News: Two famous scientists found dead by Cpt_Kirks · · Score: 2

    But would you rather be a jellyfish, or a human being?

    Human. Those poisonous sea anemones are a bitch. And rocks suck as pillows.

  44. Get your own dirt! by jabber01 · · Score: 5, Funny

    One day a group of scientists got together and decided that man had come a long way and no longer needed God. So they picked one scientist to go and tell Him that they were done with Him.

    The scientist walked up to God and said, "God, we've decided that we no longer need you. We're to the point that we can clone people and do many miraculous things, so why don't you just go on and get lost."

    God listened very patiently and kindly to the man and after the scientist was done talking, God said, "Very well, how about this, let's say we have a man making contest." To which the scientist replied, "OK, great!"

    But God added, "Now, we're going to do this just like I did back in the old days with Adam."

    The scientist said, "Sure, no problem" and bent down and grabbed himself a handful of dirt.

    God just looked at him and said, "No, no, no. You go get your own dirt!"

    --

    The REAL jabber has the user id: 13196
    What you do today will cost you a day of your life

    1. Re:Get your own dirt! by Anonymous Coward · · Score: 2, Interesting

      To which the scientist promptly replied with a grumble, and returned to his colleagues on Earth.

      "God's playing hardball. Now we need our own universe," the scientist said.

      So the greatest minds on the planet assembled and laid the plans for a great supercollider in space, so powerful that a quantum bubble might miraculously explode in another big bang.

      They toiled for 5 days, and 5 nights, and at last on the 6th their collider was complete. In the heavens above them their collider glittered in the moonlight like a twinkling star.

      With great fanfare the switch was thrown, and within minutes a new universe was born in an orthogonal dimension to our own universe.

      And on the 7th day, they rested.

    2. Re:Get your own dirt! by lobsterGun · · Score: 1

      ...and since objects ar rest tend to remain at rest that is the end of the story.

    3. Re:Get your own dirt! by Sebastopol · · Score: 3, Insightful

      A joke, but typical of how religion deals with science: once science topples a divine bastion, religion is quick to come up with another one.

      - First they promoted the flat earth

      - Then they promoted the Terra-centric planetary system.

      - Then they promoted the young earth theory.*

      - Then they denied evolution.**

      - Then they said only god could make life.

      - Now they say only god can make dirt.

      Religion will always be able to regroup and criticize, without offering anything other than mircales and mythology. Remember how the Democrats lost this mid-term, by criticizing with no real substance? So will science eventually obviate the need for all creationist religions by eventually leaving religion with so little ground to stand on, no one will take it's claims seriously!

      As an athiest, and IMHO, the only "religions" science won't dismantle are the Theravada Buddhists and Confuscists, because they don't make such gross claims.

      * (There's a childrens book for Christians that claims t-rex's teeth were used for cracking nuts, and that they got along with men before original sin.)

      ** (Of course, finches and antibiotics put this to rest. Fortunately the Roman Catholics were smart enough to reverse course up to this point, just look at rights of ordainment, revised in 1987.)

      --
      https://www.accountkiller.com/removal-requested
    4. Re:Get your own dirt! by DesScorp · · Score: 2

      I don't think that post was claiming that man "couldn't make dirt", but rather tried to impress upon the reader of the sheer magnitude involving all of creation. The point was that man is quick to arrogance, thinking he has all of the answers until a situation arises that humbles him again. I would think that even an Atheist could appreciate that. It was a funny and insightful post. If anyone came close to turning it into a religious rant (or anti,in your case), it was you.

      --
      Life is hard, and the world is cruel
    5. Re:Get your own dirt! by Sebastopol · · Score: 2


      If anyone came close to turning it into a religious rant (or anti,in your case), it was you

      Apparently I see a much different subtext than yourself. Why did you get so defensive?

      --
      https://www.accountkiller.com/removal-requested
    6. Re:Get your own dirt! by superyooser · · Score: 2
      The moment you begin to use your brain to think about creating a universe, you've already failed.

      Since the group would be using their God-created minds and bodies to plan and form a new universe and they'd be taking advantage of the existing air to breath and food to eat while they plan, they would already "cheating" at the contest. Also, pertaining to whatever equipment the group constructs, they would have to create the composite substances and elements from nothing and do so without using any physical or mental capacities that are pre-existing or derived from those which are pre-existing.

      "If you wish to make an apple pie from scratch, you must first invent the universe." - Carl Sagan

      "If you wish to make a universe from scratch, you must first invent yourself in a vacuum." - me

    7. Re:Get your own dirt! by superyooser · · Score: 1
      God is eternal; He has no beginning or end.

      In the contest, both God and man are restricted to using matter that each created. If man is allowed to think, he is using matter that God created. That's cheating. God has the unique advantage of existing eternallly, autonomously outside of the natural realm. Having omnipotence is another nice perk of divinity. :-)

    8. Re:Get your own dirt! by MoThugz · · Score: 2

      Your arguments are the shortcomings of the Christian faith (Specifically Roman Catholic), not all religions in general make such false claims.

    9. Re:Get your own dirt! by Sebastopol · · Score: 2



      Um, re-read my post, I say exactly what you did, and I give examples.

      --
      https://www.accountkiller.com/removal-requested
  45. Re:Hello...? by nomadic · · Score: 1

    This isn't a computer game, you don't necessarily get better results by allocating scientists like that.

  46. Already been done... by gantos · · Score: 2, Insightful

    Back in the '70s, GM stripped the engine from and Oldsmobile so that they were left with an empty engine compartment. Then, in that same lab that resembled nothing like a petri dish, they inserted a Chevy engine. POOF! They had just created a new car from scratch!

    --

    "How do you expect me to see the forest with all these damn trees in the way?!"
  47. But ... by jorgster · · Score: 2, Insightful

    If you want to make a car you need to define "what is a car", so far so good ... If you want to make "life" they will first need to define what exactly the criteria are before we can call one of their siblings "life".

    Is it life because it moves,breathes, contains other cells, eats, sleeps, breeds, farths, burps ??

    At which point exactly do we call an life ?

    1. Re:But ... by efflux · · Score: 1
      At which point exactly do we call an life ? Definition of life Quoting

      http://www.geog.ouc.bc.ca/physgeog/contents/9a.h tml (1). Organisms tend to be complex and highly organized. Chemicals found within their bodies are synthesized through metabolic processes into structures that have defined purposes. Cells and their various organelles are examples of such structures. Cells are also the basic functioning unit of life. Cells are often organized into organs to create higher levels of complexity and function. (2). Living things have the ability to take energy from their environment and change it from one form to another. This energy is usually used to facilitate their growth and reproduction. We call the process that allows for this facilitation metabolism. (3). Organisms tend to be homeostatic. In other words, they regulate their bodies and other internal structures to certain normal parameters. (4). Living creatures respond to stimuli. Cues in their environment cause them to react through behavior, metabolism, and physiological change. (5). Living things reproduce themselves by making copies of themselves. Reproduction can either be sexual or asexual. Sexual reproduction involves the fusing of haploid genetic material from two individuals. This process creates populations with much greater genetic diversity. (6). Organisms tend to grow and develop. Growth involves the conversion of consumed materials into biomass, new individuals, and waste. (7). Life adapts and evolves in step with external changes in the environment through mutation and natural selection. This process acts over relatively long periods of time. Although not every rule is hard an fast, these rules are a good measure. You may still complain that there may be room for uncertainty in certain contrived instances, yet should that be surprising as the conception of life is an artifical construct? It's an idea we've invented to separate ourselves from dirt.

      --
      Do I contradict myself? Very well, then I contradict myself, I am large, I contain multitudes. -- Walt Whitman
  48. Jurrasic Park by bluveinr · · Score: 1

    Weren't the dino's in Jurrasic Park supposed to die if they didn't get an essential amino acid (lysine?). Look what happened there. Next thing you know Dr. Malcom will be running around telling us 'I told you so'.

  49. Hacking life by roman_mir · · Score: 2

    Their technique is equivalent of what many programmers do with someone's code when they want to see if it could be used for their own purpose. They will try removing code from the source of the program function by function and see if it still compiles and runs and what kinds of exceptions they get. So these guys are l33t h4x0r5!

    1. Re:Hacking life by lovebyte · · Score: 2

      Not exactly. That's what is done now. Take a mouse/fly/worm/bacteria/..., remove some gene(s), see what happens.

      What these people are trying to do is closer to:
      1. Assume we know just enough about C programming
      2. type %cat > first_try.c
      3. write some code
      4. compile && run
      5. if exit != 0, goto 2

      --

      I'll do it for cheesy poofs.

  50. Nanotech? by foo+fighter · · Score: 2

    With all we now understand about biology, and with the incredible advances working with "stuff" on the molecular scale, how long until we are really building single-celled organisms from scratch?

    What they are doing here looks like its not totally from scratch. They are taking an already existing shell and then putting some other stuff in there and seeing if it comes to life.

    This is very cool, but really a stepping stone to "life from scratch". How long? 5 years, 10?

    --
    obviously no deficiencies vs. no obvious deficiencies
  51. Ambitious... by RAMMS+EIN · · Score: 1

    RedHat goes further! They are developing a 64-bit apache together with Covalent!

    --
    Please correct me if I got my facts wrong.
  52. The Sweet Melody of Blood Music by Eidolon909 · · Score: 2, Interesting

    This is the same as the premise of the science fiction book by Greg Bear Blood Music .

    In which a researcher inadvertently creates sentient cells. But more importantly, the book describes a near future in which biological research outpaces computer research and that it spawns an entire "Gene Valley" type area as opposed to a "Silicon Valley". With organisms being manufactured to do just what the article describes -- Create hydrogen, purify air etc. Except the researcher decides to inject himself with his cells to "save them" and standard Sci-Fi goodness ensues.

  53. Ah! But... by jabber01 · · Score: 1

    God is Open Source.

    --

    The REAL jabber has the user id: 13196
    What you do today will cost you a day of your life

    1. Re:Ah! But... by DrunkenPenguin · · Score: 1

      GNU/God to be precise

      Heh! That was the best one for a long time!

      ----

  54. chemical hypothesis of life unproven by peter303 · · Score: 5, Interesting

    The hypothesis that "chemistry explains all of life" is nearly universal in science, yet is not fully proven yet (though I believe it). The ultimate test of the chemistry hypothesis is be to construct life from inert chemicals off the shelf. The closest one got was the constuction of a polio virus from regeants earlier this year. The virus appeared viable, but was about a thousand times less potent than its natural version. The simplest life form, as described in this article, is about 20-50 times more complicated than a virus in terms of genes and chemicals (proteins, sugars, others).

    The alternative hypothesis is "neo-vitalism" or that is some mysterious substance or force outside of pure chemistry. This was the prevailing hypothesis until well into the 19th century. But it keeps on reappearing in more "scientific" forms today. One statement is the "only living material can produce living matter", even though you can fully explain all the chemistry, physics, and genetics. Another version callled "morphogensis" is that there are "patterns" in lving matter that are transmitted from ancestor to descendent. Yet another version, championed by physicist Roger Penrose is that there is secret unknown physics involved (clarification: he specificiation is attributing human consciousness to a new form of quantum interaction). Still another variation is "holism" or "emergism" which states the totally is greater than the sum of the parts, i.e. a reductionistic explanation is necessarily incomplete.

    Note the relation of life to matter is a very old philosophical problem. The ancient Greek story of Pygmalian, the medival Golem, and the 186 year old Frankenstein novel all addressed this issue.

    An auxilary problem is artificial intelligence. Its seem obvious that this can be done by us computer geeks. But 55 years of effort have had disappointing results. Some people use similar arguments against artificial life against artificial intelligence.

    1. Re:chemical hypothesis of life unproven by hankwang · · Score: 1
      >An auxilary problem is artificial intelligence. Its seem obvious that this can be done by us computer geeks. But 55 years of effort have had disappointing results.

      The unability of creating artificial intelligence might be more because of a lack of processing power than because of a fundamental problem.

      In an article in Scientific American, it was estimated that the human brain has a processing capacity equivalent to around 10^12 instructions per second. We just need to wait until the computers are factor 1000 faster than today to get somewhere, which would take around 20 years according to Moore's law.

    2. Re:chemical hypothesis of life unproven by hankwang · · Score: 1

      >10^12 instructions per second. Oops, I mean 10^14, or 100.000 times faster, 35 years of Moore's law.

    3. Re:chemical hypothesis of life unproven by kalidasa · · Score: 2, Informative

      The closest one got was the constuction of a polio virus from regeants earlier this year. The virus appeared viable,

      Viruses are not usually considered to be organisms. And Roger Penrose is not usually considered to be a biologist.

    4. Re:chemical hypothesis of life unproven by Skirwan · · Score: 2
      The ultimate test of the chemistry hypothesis is be to construct life from inert chemicals off the shelf.
      You've done an excellent job of hiding it, but you're arguing in favor of creationism here. Either 'life' appeared naturally out of millions of random interactions of inert chemicals, or it was created by something supernatural.

      If you're going to advocate creationism, then at least come straight out and say it.

      --
      Damn the Emperor!
    5. Re:chemical hypothesis of life unproven by yelligsc · · Score: 1

      I dont believe he is advocating anything.

      I hope you will agree that it has not been proven that life can be created out of chemistry. It has not been done.

      And as there is no proof, any other theory is wide open be it creationism, or a quantum theory explination of the human mind. Believeing whole-heartedly in an unproven theory is no diferent than believeing in creationism.

      Scot.

    6. Re:chemical hypothesis of life unproven by kcbrown · · Score: 2
      The ultimate test of the chemistry hypothesis is be to construct life from inert chemicals off the shelf.

      Spoken like someone who doesn't understand science at all.

      Science isn't in the business of proving hypotheses. It's in the business of disproving them. The one trait that all theories of science have is that they are all possible to disprove. The same goes for the theory of the chemical (or, more precisely, the physical) basis of life.

      In this case, it's real simple: if you take apart something living and find a mechanism that doesn't have its roots in chemistry or physics, then and only then can you say that life isn't based on physical properties alone.

      Until then, the reason we say that life is based strictly on physical properties is that not only have attempts at the above not ever uncovered something that wasn't physical in nature, this theory makes predictions that so far have proven correct. For instance, it follows from the physical nature of life theory that disrupting a life form at the physical level should cause it to cease functioning. And that's exactly what happens. Whenever we discover something new about the chemistry or physics of life, we find new means of causing life to stop functioning properly. We find new ways to kill.

      If life had its roots in something other than physics or chemistry then we'd expect to be able to determine that. There should be, must be, some way to differentiate between life based strictly on physical properties and life based on something else. Without that the hypothesis that life is based on something other than physical mechanisms is untestable, and therefore worthless.

      --
      Use 'slashdot stuff' in the subject line in any email you send me if you want to get past the spam filter.
    7. Re:chemical hypothesis of life unproven by junkgrep · · Score: 2

      ---I hope you will agree that it has not been proven that life can be created out of chemistry.---

      I'll agree, if only because that formulation is nonsense. Chemistry is not a thing out of which objects can be created: it is a field of knowledge. The question of life's origins is not whether chemistry was involved: it was even if God did it: life works BY whatever mechanisms chemical reactions are. The question is whether it a) could and b) did begin without a designing intelligence.

  55. Organic Programming Language + Printer by roman_mir · · Score: 2

    At some point we should be able to use XML to describe properties of an organism we want to create. The XML will be validated so that our organism will be correct to some minimal set of parameters. Later we will be able to print our new organism with some sort of an organic cell printer. A machine that will print organisms ala Fifth Element, only our machines will be smaller and will only print simple cells in the beginning. The Fifth Element's printer will be used by big corporations to create PHBs and BAs in the beginning but may be powerfull enough with time to actually print slave programmers, administrators and good quality assurance people.

    That's what is really behind this project, not some waste management as they want you to believe.

  56. Energy Department = Military by theghost · · Score: 1

    When the military wants a project but doesn't want to look like they want it, the Energy Department is the place from which the government funnels the cash.

    They even state in the article that there is biological warfare potential here. Of course there's also medicinal value - imagine an anti-virus virus that infects you and delivers an innoculation against a real disease. But before we get all lovey with this tech lets remember the lessons we learned from "Jurassic Park" - things will go wrong.

    (Hey if you want a less pop-culture reference, look at the Manhattan project. Did you know that when they did the first test of a nuclear bomb they thought there was a small chance that the thing would start a chain reaction in the earth's atmosphere, burning the whole planet and killing all life? But they did it anyway. Good thing that didn't go wrong, but they also didn't know about how nasty radiation is and the long term affects it has - and i'm not talking about super-powered mutants here!)

    Done rambling now.

    --
    The only thing necessary for the triumph of evil is that good men do nothing.
    1. Re:Energy Department = Military by theghost · · Score: 1

      Apparently the humor in the JP reference was not obvious to you. Next time i'll spell it out more clearly. (In case that was intentional rather than a mistake: constructing a straw man argument out of a throwaway movie reference might make you feel really smart, but it doesn't contribute much to the meaningful conversation and makes you seem like a pedantic troll.)

      Worrying about it in 50 years when "Joe Terrorist" can do it is way too late, because by that time "Joe CIA" will have deployed the technology, and n "Joe Scientists" will have duplicated it in every tech-savvy country, some of whom may not be very friendly towards the others, and may even give or sell the tech to even less pleasant nations or groups. (Gasp! Shock! Outrage! No Way!)

      Read the post again. I said they should continue with the research but they should keep in mind the potential problems.

      "Expect the worst, train for the worst, and over-engineer everything..."
      And exactly how (or why) would we do that if we're not scheduled to worry about anything going wrong for another 50 years? To paraphrase the nonsense: "Don't worry, but prepare for the worst."

      Which is more effective: the nuclear bomb, or the radiation shielding. To put your faith in the ability of defensive measures to catch up with the development of offensive ones is a potentially disastrous, irresponsible attitude.

      I'm saying we should be thinking about (if not working on) the defensive measures right from the start, as part and parcel of the research. (Ideally we'd also make those defenses available to the entire world but that's a bit overly-optimistic too.)

      It seems like you and i agree in general, but we differ in the magnitude of our concern.

      --
      The only thing necessary for the triumph of evil is that good men do nothing.
    2. Re:Energy Department = Military by theghost · · Score: 1

      I just reread my own post: I did not explicitly say they should continue the research in that post - that was a different post under the same article. Bad theghost! Bad! Bad!

      --
      The only thing necessary for the triumph of evil is that good men do nothing.
  57. This is a Bad Idea by cowtamer · · Score: 1, Troll


    "The fear of the LORD is the beginning of wisdom;
    all who follow his precepts have good understanding. To him belongs eternal praise."
    Psalm 111:10

    "The fear of the LORD is the beginning of knowledge, but fools [1] despise wisdom and discipline."

    Proverbs 1:7

    1. Re:This is a Bad Idea by redfiche · · Score: 1

      I see no reason to postulate a god to describe the universe, nor do I need a religion to tell me what is ethical.

      --

      Brevity is the soul of wit

      -- Polonius

  58. What if it get the missing genes ? by Alain+Williams · · Score: 3, Interesting
    1. Even if the organism were to escape stringent confinement and enter the environment, Smith said, "it's a dead duck."

    One thing that small organisms do very well is to swap genes. So what if it escapes, borrows some missing/interesting genes from a passing E. Coli ?

    GM crops have been found to swap genes with plants that they weren't supposed to.

    1. Re:What if it get the missing genes ? by Idarubicin · · Score: 2
      GM crops have been found to swap genes with plants that they weren't supposed to.

      Though I certainly don't deny that this is a possibility, and one worthy of serious consideration, there is a noteworthy paucity of properly-documented cases. The recent /. posting about corn and soya involved plant matter mixed together after harvest.

      The Nature article a while back about genes migrating from GM to 'normal' maize in Mexico last year was later retracted by Nature's editors--an unprecedented move in the history of the journal.

      Finally, if the organism escapes to the wild, and if it swaps enough genes to survive, we're still not putting anything out there that isn't already in nature. Biologists are assembling the test organism from the stripped down genome of a preexisting bacterium. There's nothing new here, and there's nothing that prevents the existing bacterium already in the wild from picking up some nasty genes of its own.

      --
      ~Idarubicin
    2. Re:What if it get the missing genes ? by gene_tailor · · Score: 1

      One thing that is not being made clear by the newspapers is just how crippled M. genitalium (the bug whose genetic material they plan to use) is to begin with. The "wild type" strain that causes infections in nature was not even able to be grown in petri dishes for many years because its genome is so streamlined, that it has to rely on host cells to get some very basic building blocks of life. One has to give M.g. media (food) much much more complex than the media that E.coli needs just to get it to grow in the lab at all. It's barely more alive than a virus. Biologically, it would be incredibly surprising if this engineered bug could grow outside of a very pampered environment, and it would have to pick up a significant fraction of E.coli's ~4000 genes to even have a decent metabolism, let alone any "dangerous" qualities.

      --
      It also occurs to me that if one was drowning, yelling "Help! I'm drowning and I lost my bikini top" would probably be m
  59. Re:Creator? God? by lovebyte · · Score: 1

    ... and creates an intelligent life form, from scratch, would man be it's "Creator"? If so, could one say that man is it's God?

    Contradiction: If they are intelligent enough, they will not believe in the surpernatural.

    --

    I'll do it for cheesy poofs.

  60. Homeland Security Bene? by limekiller4 · · Score: 2

    From the article:
    "More worrisome than the risk of escape, they acknowledged, is that the project could lay the scientific groundwork for a new generation of biological weapons, a risk that may force them to be selective about publishing technical details. But they said the project could also help advance the nation's ability to detect and counter existing biological weapons."

    It used to be that you'd have to have a clear goal and some ethics to get funding and public good will. I guess all you need these days is to mention that it'll help protect the motherla, er, I mean assist Homeland Security.

    Maybe I can get a grant to play America's Army: Operations.

    Don't get me wrong, I'm not at all sqeamish about this project, I think it's great. I'm just wary of every science project ...every any project latching itself unto this Third Reich wünderclone speedboat and heelhauling itself into existence and the public faith.

    --
    My .02,
    Limekiller
  61. create a simple life form by oliverthered · · Score: 2

    No need, I've found one sitting at the dest opposite me. .... oh it's a mirror.

    --
    thank God the internet isn't a human right.
  62. Get a life! by stere0 · · Score: 2

    Finally, geeks are able to stay in their labs and get a life - at the same time!

    (Sorry, the other jokes I could think of were 'can you build a Beowulf cluster of these' and 'does it run Linux?')

    --
    Trollem mirabilem hanc subnotationis exigiutas non caperet
  63. Re:News: Two famous scientists found dead by BarMeister · · Score: 1

    I'd rather be a bird so I can poop on peoples' heads...

  64. life from scratch by f8xmulder · · Score: 1

    Seems to me that if they really wanna make life from scratch, they should start from scratch. are they doing that? No. They're taking pre-existing elements and sticking them together in a dish. That's not creation, it's manipulation. Reminds me of the joke of God and the biologist who had a bet to see who was greater. The biologist says to God "Look at all the great things man has created! We can even create man." So they go at it. God breathes real deep, says a few words, and a man rises up! The biologist takes some dirt and throws in some electricity and up rises a man. God looks at the biologist and says...Ah ah ah! You gotta create him from scratch. Of course all the biologist can do is "scratch" his head, because as we all know, creating life from scratch violates one of the Laws of Thermodynamics...

  65. I thought this already happened.. by monsieur+Penguin · · Score: 1

    when they invented the Liberal (OMG - dont kill me!)

    1. Re:I thought this already happened.. by MentalPunisher2001 · · Score: 1

      Would that be classical liberal or neo-liberal??
      I guess Locke was pretty stupid, as were all of those classical liberals that brought us The US Constitution and its Bill of Rights.
      Damn liberals, they should have listened to Burke!!!

      Conservatism is where its at!!!
      Philosophical Conservatism, that is.
      Not the warmongering and conquest known as neo-conservatism.

      (Where is the sarcasm key??)

  66. Comment removed by account_deleted · · Score: 1

    Comment removed based on user account deletion

  67. Cheap Science by gwappo · · Score: 1
    The $3 million Energy Department grant, awarded recently, will pay for a staff of about 25 to pursue the project over three years

    $3M / (25*3) = $40K a year. That's not even taking office expenses, equipment & simply running the project into account.

    Remind me to never do anything scientific.

  68. Re:News: Two famous scientists found dead by Smallpond · · Score: 1

    The danger of creating a self-replicating organism is commonly called
    the "gray goo problem". The organism reproduces exponentially,
    has no natural enemies and consumes all available resources.
    This problem is taken seriously, as shown by this paper,
    although the scare-mongering is usually applied to
    self-reproducing nano-technology.

  69. Re:News: Two famous scientists found dead by redfiche · · Score: 2, Insightful
    Before x-rays and cat-scans and that sort of thing, the only way to learn about anatomy was with a knife. If you wanted to learn about the actions of the things you found, you might need to use your knife on something that was still alive. Some people did, sometimes on other people.

    I don't think there are "some things better off left alone." I do think I have provided an example of a scientific experiment with a valid ethical question. I also think we should have some idea of the ramifications of our actions before we proceed on any endeavor, and I think it's reasonable to ask that these scientists think long and hard before moving forward. Not because we as humans don't have a right to do such a thing, but because they are dealing with complex systems, and their safeguards may fail in unexpected ways. While I would never say, "We don't have the right to know this," it may be prudent to say, "We're not ready to do this yet."

    --

    Brevity is the soul of wit

    -- Polonius

  70. So i look at the title by re-Verse · · Score: 1



    And i see "Scientists Attempting to Create Simple Life Form, so of course, the first thing that pops in to my mind is

    "Oh my god they are trying to clone George W Bush!"

    :)

  71. Before, Before, Before by Malicious · · Score: 1

    I've heard of this man, he was a doctor. Went by Dr. Frankenstein. He did something similar to this as well. You know, created a being. He considered it his child, while everyone around him called it a 'Monster'
    I'm sure we'll have religious types, who will refer to this as the same, but are they really wrong?

    --
    01101001001000000110000101101101001000000110001001 10000101110100011011010110000101101110
  72. Fear is not healthy. by ahfoo · · Score: 2

    Respect for something that is decidedly dangerous because of clear evidence is healthy. Fear is not.

  73. Congress better act fast! by kfx · · Score: 1

    Oh no! They're decompiling, editing and recompiling DNA! They're infringing on nature's intellectual property rights! Congress better make a new law ASAP to protect nature's profits from these "pirates"!

    Do your part as an upstanding citizen and call your representatives now!

  74. Actually I beg to differ... by grayhaired · · Score: 1
    Why the hell not? I am so fucking sick of people invoking morality (or "ethics;" IMO it's a distinction without a difference, but that's a whole 'nother argument) as an argument against biological research. No one ever brings these arguments up in chemistry, or physics, or math...


    Actually I beg to differ. There was a time when people found out that adding organic lead compounds into gasoline improved octane ratings, so gasoline companies did this. Later, other people pointed out that lead is poisonous, and worked to get the lead out of the gasoline (much to the chagrin of the oil companies, who wanted to keep putting it in gasoline).

    So these days we drive cars that burn lead-free gasoline. That was a moral, ethical, and health issue which squarely belongs in the realm of chemistry. I'm sure with a little work, people can find others (e.g. DDT, lead paints, etc).
  75. Umm... by Anonymous Coward · · Score: 2, Insightful

    Get your own space, your own moonlight, your own particle-wave guides...

    If nothing else, God is our bootloader.

  76. Re:News: Two famous scientists found dead by JimPooley · · Score: 2

    But would you rather be a jellyfish, or a human being?

    Or would you like to swing on a star?

    --

    "Information wants to be paid"
  77. It's Eviiill! by kmellis · · Score: 2
    Not really.

    " ...a project that raises ethical and safety issues..." - from WP article
    and:
    " ...I usually refer to that sensation as 'That little voice that I should have listened to...'" - derubergeek
    Both of these comments are just thoughtless. There is no rational justification for feeling that the construction of the most simplistic bacteria possible is more ethically dubious and dangerous than:

    Fiddling around with the genes of extent organisms; and

    Using extent organisms for our own purposes, especially when it destabilizes an ecology; and

    About a bazillion other things that we humans do on a daily basis. People's fearful reactions to anything involving genetic engineering or anything that violates the supposed sanctity on the creation of life (which is as common as dirt, literally) is mostly an irrational reaction based upon an inappropriate generalization. These sorts of things are no more inherently, and thus implicitly, ethically dubious or dangerous than is technology in general. Some activities are ethically dubious and dangerous; and people that are honestly concerned about these issues should understand that a net that is vastly oversized is useless because it catches too much. Focus on what is clearly dangerous and ethically dubious and scrutinize, regulate, or prevent those particular things.

    In this case, trying to build an organism from what is relatively first principals will be the first step in beginning to really understand life; and, more to the point, will probably enable an increase in our comprehension of what truly is and isn't dangerous by increasing our fundamental understanding.

    1. Re:It's Eviiill! by Ektanoor · · Score: 5, Insightful

      It's an ethical problem. For very religious people such experiments would equal to the most arrogant attempt for humans recreating the Creation. Even if it is inside a lab, such event would leave a huge teological hole on one of the most canonical religious doctrines: that life is somehow "different" from other physical phenomena and could only be created in very exceptional circumstances by an omnipotent being.

      Since the XIX century, we have seen how the crumbling of this "truth" is painfully received among several religions. Since Darwin and Pasteur, every step that closes nears the biotic and anabiotic world is not easy for believers. Many dogmas put living beings in a special place. Besides, humans are put in a more special place. However, the rising of Evolutionism blurred the human-living beings division. Meanwhile while we got closer and closer to the abiotic world, no one could ever mix up inorganic components and bring out an alien crawling outta the lab. So many creationists hang to this last frontier and consider it as "proof" that Life was created by someone. However the new experiments may blur this division to the impossible.

    2. Re:It's Eviiill! by derubergeek · · Score: 1
      >...I usually refer to that sensation as 'That little voice that I should have listened to...'

      Both of these comments are just thoughtless.

      And your evidence for this statement is what? Or have you actually thought about it yet?

      When I'm both wary and fascinated by something, I tread much more cautiously than normal. Failure to do so is foolishness, not thoughtlessness. But hey, if that's your definition of thoughtlessness, then I'm just dying to hear your definition of is.

      --
      Trust me. This is an inactive account. Regardless of what the /. bean counters might report.
    3. Re:It's Eviiill! by kmellis · · Score: 2

      Perhaps you should think more about what you are both wary and fascinated with.

    4. Re:It's Eviiill! by Khomar · · Score: 1

      Since the XIX century, we have seen how the crumbling of this "truth" is painfully received among several religions.

      I personnally find it funny that a study such as this one would cause a Christian to doubt his faith. Quite the opposite. The Bible says that man was created in the image of God, and as such, we have been given a great amount of creative power. It should not be surprising that we are trying to "play God". Afterall, we have been doing this since the beginning: supplanting and planting certain plants to grow our desired food or be asthetically pleasing, mining and refining metals to form tools that allow us to make even more changes to the world, the domestication of animals, etc.

      Rather, the question which should be raised is not really "moral" but an issue of sound judgement. God, as described in the Bible, is not only all-powerful but all-wise. In other words, he not only has the ability, but he has the sound judgement required to wield that power. He knows how to handle the massive power of a star without incinerating Himself in the process. Do we have that kind of wisdom or judgement? History would tell us that we do not. While technology has been and will continue to be used for great good, people have shown time and time again how it can be used for great evil. This is not to say that we should not develop new and exciting technologies. Rather, we should carefully consider our steps before we open what could be a Pandora's box.

      Back to the issue of religion, this does not even come close to the true act of creation. As another poster pointed out, the scientists have not had to "get their own dirt" for this experiment. When mankind can actually create something out of nothing, well... then we'll talk!

      --

      I believe in de-evolution. God made the world perfect, man fell, and its been going downhill ever since!

    5. Re:It's Eviiill! by bryguy5 · · Score: 1

      I personally like the distinctions.

      I would argue that we should fight to make sure that life is considered special and that human life is more special.

      Even if you don't by into the dogma that God created man in his image and therefore human life should be treated differently than other things. You have to at least appreciate the more practical aspects of cultural distinctions between lunch and cannibalism. Mutual respect for other humans keeps civilization going, along with our authority over (and responsibility to) lesser life forms.

      As for this particular experiment safety considerations are important, but I don't see it differing substantially from eating, breeding, processing, etc other life. Nor do I think it gives us diety status any more than landing on the moon and "touching the heavens". Now when we start doing genetic experiements on/with humans, we cross the moral line and have to carefully consider the consequences and rights of those involved.

  78. Go back to watching NASCAR by NDPTAL85 · · Score: 4, Interesting

    Your comment is a particularly stupid one that not only shows a lack of knowledge on the field of science, but of the personalities of human beings. There is no overlord scientific authority that directs what each and every scientist in the world should be working on. Science is very much an individual pursuit. You learn about what you are interested in or what you accidentally discover. A good scientist is a highly motivated scientist, not one forced to work on a project he/she has very little interest in.

    We have plenty of scientists working on both AIDS and Cancer. If we were to stop all other pursuits until all disease were eradicated our overall standard of living would be much lower due to a lack of innovation in every other field. I suppose just because there's still rabies in the world you think that no scientist should be working on fuel cells, or just because a cure for lupus has been found no one should care a rats ass about developing more efficent supply chain methods...etc.

    --
    Mac OS X and Windows XP working side by side to fight back the night.
    1. Re:Go back to watching NASCAR by Silvermask · · Score: 1

      Not to mention there would be, I think, a great risk in limiting federally funded science to "important things" like AIDS or cancer. Certainly, a cure for AIDS and cancer would be wonderful, but the danger comes in deciding what is "important" and what isn't. What happens when a rather uncommon disease has it's funding yanked because "it doesn't affect as many people as cancer, so it's obviously less important"? While there obviously has to be some point where you have to draw the line, I don't think we should go around drawing it so that it narrows the field of research. While it might not affect the general public much, it certainly would affect the people who had funding for life-saving research cut because their disease "isn't as big as cancer or AIDS". And besides, what about the whole "too many cooks spoil the soup" saying? ^_~

      --

      "Wild nights are my glory"
  79. You really think they're the first? by RobertB-DC · · Score: 2

    I don't mean to be a conspiracy theorist... but we have a situation where a well-known scientist is going to take a common organism and complete research that he already started a while back.

    Ummm... are you telling me that *nobody* in the military -- this country or some other -- has thought of this before?

    I'd guess that there's a report on modified Mycoplasma genitalium somewhere in the bowels (bad pun) of some defense department vault.

    So, which conspiracy theory is it?

    * No conspiracy, he just happened to get $3 million from the government on good looks and charm.

    * The military couldn't manage to do it, so there's no harm in letting this guy fail as well.

    * The military couldn't manage to do it, so they're going to "open source" the development of artificially created organisms.

    * The military *did* manage to do it, so they need this guy to recreate the results so they can blame him when the New Plague appears in the wild.

    Excuse me, there's someone knocking on the door... wow, nice suit. Uh oh.

    --
    Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
  80. Already exist by Quixote · · Score: 2
    Looking at some of the comments on this thread, it looks like the said "simple lifeform" already exists and is busy posting to /.

  81. "Essentially" is the key word by paiute · · Score: 2

    From what I have read so far (caveat: none of what I have read has yet been in the scientific literature) what they are doing is taking a whole cell that already exists, removing the native DNA, and replacing it with synthetic DNA to see if they can control the cellular processes with their inserted DNA instructions. This is equivalent to taking a PC and wiping the hard disk of Windows, replacing it with Linux, and seeing how the Linux programs drive the video, memory, speakers, etc. They are not building a PC from scratch.

    Replacing the DNA is the easy part. The hard part or creating "life" will be building a cell wall and getting all the receptors and ion channels and all the other embedded transmembrane proteins to work, making sure that the translational mechanisms are there to make proteins from the DNA, etc. The cell is a complex factory.

    Probably what will really - to me - qualify as made life will come from using what is known about constructing small vesicles from phospholipids or perhaps synthetic equivalents. A small sphere of a lipid bilayer with one embedded synthetic protein, a short hunk of DNA that codes for that protein, and appropriate RNA to translate the instructions is the minimum requirement. But even then you have to worry about: getting the amino acids through the cell membrane, sequestering them at the assembly area, getting energy to drive the process into the vesicle, and on and on. The simplest cell imaginable is still going to be a huge project - manyfold times more complex than this experiment.

    --
    If Slashdot were chemistry it would look like this:Cadaverine
  82. Attack of the green stuff by rendermouse · · Score: 1


    People also thought Kudzu was a good idea. Now it's devouring the entire southeastern United States.

    --
    "Follow your Bliss." -- Joseph Campbell
  83. Re:News: Two famous scientists found dead by znaps · · Score: 1

    But the only way to learn is to meddle with things we don't yet comprehend!

  84. Do scientist have the right to create life? by e.m.rainey · · Score: 2, Insightful

    Did anyone else catch this obvious question? Do scientists have the right create life? Well, can they have childern without people fretting over some frankenstien killer virus child springing fully evil out of their groins? I don't believe anyone is challenging their ability to procreate, which by definition is creating life, so I don't see why are we asking these kind of idiodic questions. We should be far more concerned with why we let non-scientists procreate! Creating a rogue human is far more dangerous than creating a rogue crotch burning bacteria.

    --
    The next remark is false. The previous remark is true.
  85. Must they use Mycoplasma genitalium? by PizzaFace · · Score: 2

    I'd feel better about this experiment if their starting point weren't a pathogen, especially one that causes urinary tract infections.

    We'll know something went terribly wrong if the authors can't present their paper because they keep having to excuse themselves to go to the restroom.

  86. Patents? by why-is-it · · Score: 2

    The Washington Post is reporting on an apparently credible project to create a simple life form in a petri dish. The goal is two-fold: 1) to actually create a unique life form essentially from scratch and (more importantly) 2) to extensively analyze and model the entire biology of this critter.

    Just great - I wonder how long it will be before this:

    3) Patent the life form

    If corporations can apply for and get patents on human genes (in stark denial of a few million years worth of prior art), why wouldn't the patent office grant this one. Harvard has already got a patent on a mouse after all...

    Oops! I almost forgot the obligatory reference:

    4) ???
    5) Profit

    --
    *** Where are we going? And what's with this handbasket?
  87. How do your verses prove "Bad Idea"? by RobertB-DC · · Score: 1, Troll

    I'm a Christian myself, so I'm not going to jump on the "what's God got to do with it?" bandwagon.

    But the Old Testament quotes you gave don't lead me to the conclusion that this is a Bad Thing.

    Psalm 111:10 - "The fear of the LORD is the beginning of wisdom; all who follow his precepts have good understanding" could be used by a scientist of faith to show how his/her success in the lab comes from following the way that God has shown.

    Proverbs 1:7 - "The fear of the LORD is the beginning of knowledge, but fools despise wisdom and discipline" would seem to be perfectly suited to science, where wisdom and discipline are highly revered.

    You've given biblical quotes that would make a great cross-stitch sampler above the petri dish where Life, Jr. is peacefully sleeping.

    --
    Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
    1. Re:How do your verses prove "Bad Idea"? by cowtamer · · Score: 2

      Moderator: we are discussing the ethics of this technology, and much of Western ethics is based on Biblical morality. Posting discussion-provoking quotes is not the same as "Trolling"
      Metamoderator: do your thang...

      BTW, IAMB=I Am a Molecular Biologist
      (so says my diploma, anyway--and no, it is NOT from a "Prestigious non-accredited university")


      To answer your question: there is no Bible verse (to the best of my recollection) that says "thou shalt not attempt to create life." However, someone who actually believes in the God of the Old and New testaments and actually _fears_ him (as the verses I posted above recommend) might want to think twice about going ahead with this experiment.

      Throughout the Bible, there is the repeated theme of being punished for Pride/wanting equality with God/trying to do what only God is allowed to do.

      Examples: Satan (cast out of Heaven because of pride)
      Adam & Eve (cast out of the garden because "The man has now become like one of us"(Gen 3:21))

      Tower of Babel (literal example of technology used with pride, and its consequences)

      Herod: struck down for not praising God when others claim that he _is_ a 'god.'

      I am sure we will be punished for not even thinking twice about such things.

      Although it might have decent applications, we're probably better of for not allowing such technology to exist (yes, I'm comitting blasphemy in /. terms)

      Life, by definition, has the capability to reproduce. Having this capability will a) let us mess up in some pretty grandiose ways b) open the doors the engineering of really nasty biological warfare agents c) probably enable the creation of fully patentable lifeforms

      I am far from being a luddite, but we would be a lot better off if certain technologies had never been developed/invented (biological/chemical warfare, A-bomb, PCP, mind control, landmines, e-meters, spamware, particle-board, C#, etc.)

      Moderator: how about hitting 'reply' ???

  88. They did create Polio by pommiekiwifruit · · Score: 1

    from raw materials, didn't they? (Scientists that is). That's less than 1Kbyte isn't it (fits on a t-shirt). But a virus is much simpler than a bacterium (since it is not self-replicating).

  89. Would this qualify as an Elf? by cheesyfru · · Score: 2
    Ari Patrinos, a senior Energy Department administrator who will help oversee the project, said the organism was an attractive starting point to create a "minimal genome" because it is so minimal already. "We know even the simplest of cells is incredibly complicated," Patrinos said -- too complicated, at least so far, to understand completely. "This is a case where we're trying to cheat a little bit, to take the smallest and simplest and make it smaller and simpler."
    Perhaps they should team up with the crackpot who came up with the smallest possible ELF executable.
  90. Actually the goal was three-fold - by znaps · · Score: 1

    1. Create new life form
    2. Send to work at Disney Land
    3. Profit!

  91. Throwing chemicals at diseases by phorm · · Score: 2

    Let us not forget to consider that this process also likely spawn a few nasty mutations, that may have otherwise been easier to kill. There are actually a few mutations of AIDS (or maybe it's HIV) out there.

    So yeah, despite the pessimists this might not be such a bad way to go about things.

  92. Sounds like Cold Fusion to me. by Ruger · · Score: 1

    Everyone remember that hoax? Wired: What If Cold Fusion Is Real?

  93. Re:News: Two famous scientists found dead by Yunzil · · Score: 5, Insightful

    We are meddling with forces we do not comprehend,

    Yes. The technical name for such meddling is "science".

  94. Life will find a way by magi · · Score: 2
    To ensure safety, Smith and Venter said the cell will be deliberately hobbled to render it incapable of infecting people; it also will be strictly confined, and designed to die if it does manage to escape into the environment.

    I feel safe now. I hope they'll put up a Created Life Park, where people can sit in an automated tour cart and see different evolved artificial creatures. With modern techonology it will be totally safe.

    "'Ooooooh' and 'aaaaaah', that's how it always starts. But then later comes the running and screaming. I mean, life will find a way." -- Ian Malcolm
  95. Hello? How did this get modded up? by Savant · · Score: 2, Informative

    This is a regular straw man attack. The original, informative post didn't claim viruses were living organisms (in fact, it specifically said that viruses were 20-50x less complex than the simplest forms of life), and it called Penrose a physicist. So how is this response relevant in any way?

    Savant

    1. Re:Hello? How did this get modded up? by kalidasa · · Score: 2

      No, it isn't a straw man attack. My point was that using Penrose as an authority (and he is used ex auctoritate here) is pointless because he isn't an expert in the field the poster is discussing. Sure it called Penrose a physicist; it simply failed to recognize the significance of that fact to its argument. If the argument were not ex auctoritate, Penrose's field would be irrelevant.
      Anyway, you're right about one thing, it should have stayed at 2, and not been modded up to 3. It was a throwaway comment. But the moderators have corrected that, no? And I don't care about karma so long as I have a +1 bonus.

  96. "I've created Lutherans!" by Anonymous Coward · · Score: 1, Funny

    Sorry if someone already posted it. I didn't see it and thought it was a travesty not to make that reference.

  97. Constructed, not designed by Jeppe+Salvesen · · Score: 2

    I think they constructed a working Polio virus. They didn't design the thing - if they did, they would be mass killers and way ahead of their time.

    The scientists in the article are trying to design and construct a new organism, if I understand correctly.

    --

    Stop the brainwash

  98. Science versus creationism by peter303 · · Score: 2

    A "scientist" considers *any* hypothesis, and then ranks them according to the facts, the repeatable experimental observations, the simplicity of explanation, etc.
    A "dogmatist" has a conclusion in mind and forces all observations to fit that conclusion, even when that conclusion becomes so contorted to lose belief.

    As a "scientist" some variations of the creation hypotheis are in my [ large ] inventory of hypotheses, but ranks low in likelihood.
    A religious creationist has only one immutable conclusion in mind. And I've met scientists who are dogmatic about their pet theories and dont consider any other.

  99. Engineers and genetists aren't talking yet by xtal · · Score: 2

    "One statement is the "only living material can produce living matter"

    Biologists say crap like that. It makes life simple. You know the old joke about the alien biologist and the alien engineer? The alien biologist sees a TV for the first time, and promptly goes about dissecting it, drawing and photographing every diode, transistor and capacitor in excruciating detail. Doesn't really explain much about how the system works though.

    What does the engineer do?

    The engineer presses the power button.

    Until recently - VERY LITTLE work has been done on how you would go about creating life from bare chemicals in any kind of serious sense, because until recently, the tools just weren't there. Now the tools are there, and people who think about problems like engineers are getting at those tools. I have no doubt we'll be able to create organisms from scratch, something I think is much more near-term than assembler-based nanotech - in a way, it is nanotech, though.

    Artificial intelligence is a much more complicated problem. For example, dispite overwhelming evidence, mention a psi effect in mainstream journals - or even slashdot - and you get mocked. Obviously, there are things going on in our brains we're not aware of, but as one famous hypothesis you mentioned indicates, that just might be quantum nonlocal effects - something that we can engineer.

    The arguement that humans have 100-1000+ billion neurons is only part of the problem (although a large one). Simpler creatures exhibit obvious concious reasoning dispite having far fewer neurons. That doesn't mean there's inexplicable magic going on. It just means -we don't know-. So we go about finding out. That's why life is interesting, ya know?

    ObShotAtCreationists: 55 years isn't bad compared to how long it took evolution, by all measures, several hundred thousand if not millions and millions of years.

    --
    ..don't panic
  100. Re:Creator? God? by hyperizer · · Score: 2

    It depends how you define God. The Christian God is usually described as all-knowing, all-powerful, and all-good. Humans certainly don't come close in those departments. (Although many aetheists would argue that a god as described above couldn't possibly exist in a world where so many bad things happen seemingly at random.)

  101. Re:Creator? God? by Sloppy · · Score: 2
    Godhood comes from power, not creation. Man would only be the God of the created lifeform, if the created lifeform is really, really lame.

    Indeed, a far more likely scenario would be that the created lifeform would be more powerful than Man, and thus it would become our God. (At least until an interfering starship captain came by and talked it into self-destructing.)

    --
    As copyright owner of this comment, I authorize everyone to defeat any technological measure which limits access to it.
  102. What a piece of crap by abhinavnath · · Score: 5, Informative

    The paper you talk about (Cello, Paul and Wimmer, Science 297: 1016-1018) describes the de novo synthesis of Poliovirus. The authors used polymerases in a cell-free system to translate synthetic cDNA derived from the entire polio genome. The synthetic virus did not differ significantly from the wild-type phenotype (i.e., it was not a "1000 times less potent"). Admittedly, the polymerases used were ultimately of biological origin; however there was no force vital that hindered the synthetic poliovirus. Article specifically states that vitalism was shattered, and that poliovirus is "a chemical with a life cycle". Quo vadis, neovitalism?

    And the rest of your troll goes downhill from there. "Life begets life" dates back to the mid-19th century, and is an empirical observation that countered hypotheses like maggots spontaneously arising from rotting meat.

    Morphogenesis is a genuine scientific concept, but there is nothing mysterious about it. These "patterns" you speak of, they sound strangely like "genes", don't they? Hmm.

    I could find no reference to Penrose and a quantum description of human consciousness. This sounds bogus to me, but even if he did seriously make that claim, human consciousness is in no way a prerequisite for life. A bacterium or an earthworm has no human consciousness.

    And finally emergism. Certainly, in living organisms, the whole is greater than the sum of the parts. The whole can replicate, while the parts cannot. Living organisms are emergent systems, but there is nothing mysterious about emergent systems per se.

    The relation of life to matter is indeed an old philosophical problem. My own religion (Hinduism) has some very interesting perspectives on the divisions between mind, matter and spirit. However this has nothing to do with the issue at hand.

    I am not personally qualified to talk about AI and whether are not it is feasible. However, judging from the rest of your post, I doubt your competence in that field of human endeavor as well.

    --
    My other sig is also a .Porsche
    1. Re:What a piece of crap by kalidasa · · Score: 2

      Excellent posting. It's amazing what damage a copy of "The Cosmological Anthropic Principle" can do in the wrong hands.

    2. Re:What a piece of crap by junkgrep · · Score: 2

      ---He argues consciousness is a quantum mechanical process, but does not go so far as to describe the specific process by which consciousness arises.---

      The problem is that describing a specific process, regardless of it being a quantum effect, would lead to exactly what Penrose doesn't want: reducing consciousness down to an alogrythm. The problem with his argument is that it boils down to gapism: there are conceptual problems with consciousness that he doesn't think can be solved given what we know about how matter works. Unfortunately, there are just too many places where this sort of argument breaks down: where it argues from incomplete information about the (non-quatum) natural world, where it relies upon definitions of consciousness which may or may not be valid in the first place. Penrose gives it a very good go in a field that's probably way beyond anyone's current death.

  103. Re:News: Two famous scientists found dead by f00zbll · · Score: 1

    And we are better because we have atomic bombs. Oh give me a break. Research is important and understanding is important, but lets be more cautious. I doubt we are really ready to go down that road. Prove to me the quality of life has measurably improved in all aspects across the entire planet and I'll buy that argument. Saying the invention of internal combution engine saves lives, makes it easier to transport food and so on, but we're simply trading one set of problems for another. In the end, non of these things address the real issue of making life measurably better for everyone. I would think their time would be better spent visiting elementary and high schools inspiring kids to enter research or medicine. Helping to create future scientists that will solve cancer and other problems. My original post wasn't a troll, just because moderators don't agree. There heck of a lot more to life than "people are freaking out". Knowledge != wisdom. Can != should.

  104. Re:Creator? God? by inerte · · Score: 1

    would man be it's "Creator"?

    I guess so.

    If so, could one say that man is it's God?

    I guess so.

    More important, what if our God is to us what we will be to our creation?

    And if we become God of a life, how will we divide ourselves, in ethical and values terms? We aren't Black and White, Evil and Good. We are far more complex. Will our creation realize this, or will they simplify?

    Does it justifies religions with multiple Gods? They created us, we will create others, others will create others. Will it ever stop, the believe that your creator is somekind of God?

    If it doesn't stop, "Gods" are immortal. If it does, does it justify what Nietzsche said?

  105. Re:Creator? God? by Peyna · · Score: 2

    The difference is that God the creator is able to create out of absolute nothing. No raw materials needed.

    The scientist still needs some raw materials in order to create.

    Also, it is likely that this organism (if it can be 'created', would not survive beyond a few generations and be a failed attempt. If you accept evolution of life here on earth (many people don't, so I feel I should address that); then you also realize that there were many different paths it could have taken, and tried to (numerous mass extinctions changed its course). So, it is also likely that early on that if these living things sprang out of nothing, that it could have happened simultaneously in different places and that not all variations would have survived for various reasons. After all, the odds are pretty much not in favor of the living thing have the proper characteristics to survive in its environment.

    --
    What?
  106. Dyson's metabolic life by hawkfish · · Score: 1

    I'd like to see someome have a go at making Dyson's metabolic life (c.f. Infinite in All Directions). He had the idea that reproduction was not necessary for life and did some simulations that showed this approach led to a reduction in the complexity threshold for viability of two orders of magnitude. Basically, the idea is that you have a soup of chemicals that can perform metabolism - manage energy and synthesize new chemicals - without accurate reproduction. The thing can divide, but there is no guarentee of success for the daughters.

    --
    You will not drink with us, but you would taste our steel? - Walter Matthau, The Pirates
  107. Re:Creator? God? by d0a0b · · Score: 1

    Do you consider your parents gods? They created you, eh?

    --
    "Just tell em Large Marge sent ya." -Large Marge, (the Ghost)
  108. Re:Creator? God? by CustomDesigned · · Score: 1
    If somehow in a distance future man builds on this knowledge and creates an intelligent life form, from scratch, would man be it's "Creator"?

    We already do this. We don't fully understand the technology, but my wife and I have created four intelligent life forms. Initially, they were completely dependent on us, and looked to us as "god". As they matured, they became more independent. In fact, the oldest one is 13 years old, and figures she could do much better without us.

    Our life forms soon became aware that we were also created, and our parents as well, and so on back in time. They have therefore transferred their ultimate allegience to the Ultimate Creator - while still giving us the respect and temporary allegience due to our role in their creation.

  109. obligatory #465 by Tablizer · · Score: 2

    Athiest Version:

    1. Put a bunch of gunk in a beaker
    2. Wait
    3. ???
    4. Life!

    Monotheistic Version:

    1. Put a bunch of gunk in a beaker
    2. Wait
    3. Ask God for help
    4. Life!

    Polytheistic Version:

    1. Put a bunch of gunk in a beaker
    2. Wait
    3. Ask gods for help
    4. Life!
    5. Sacrifice new life to gods

    Capitalist Version:

    1. Put a bunch of gunk in a beaker
    2. Plant outside life
    3. Sell company before fraud found
    4. Profit!

  110. Re: fragile organism... by corey_lawson · · Score: 1

    from the WP article:
    'Even if the organism were to escape stringent confinement and enter the environment, Smith said, "it's a dead duck."'

    Well, the HIV-4 virus is extremely fragile outside the human body, also, but that hasn't stopped its spread now, has it...

    Even if the organism has the ability to attach to human cells, if the living conditions of the new organism are close to the parameters of the human body, if it gets out of the lab, humans would be perfect walking Petri dishes.

  111. Who owns it? by Irvu · · Score: 2

    If the DOE is sinking money into funding this project then do they own the subsequent life form? Does J. Craig Venter get to patent its genes and control who does and does not use it. They say that they are planning to hobble it so that it can't leave the lav without their assistance.

    I realize that this may sound farfetched (this is a single-celled lifeform). But, what legal precident does this establish with regards to ownership. If they argue "we made it we own it," what does that mean for clones?

    Ownership of genes is already a big issue (they can patent you see here)

    So that having been said I'm glad to hear J Craig mention "eithics" but I'm still not sutre that I trust him, the DOE or this project.

  112. Now it makes sense... by TV-SET · · Score: 1
    This story is just right after: Backup Your Life on a DVD. :)

    --
    Leonid Mamtchenkov ...i don't need your civil war...
  113. A good Joke by rootmonkey · · Score: 1

    After I read that it was a genitial disease and then the statement, a priest and a rabbi.... Isn't this dying to be made into a joke.

    --

    Yes but every time I try to see it your way, I get a headache.
  114. Cowboyneal... by mblumber · · Score: 1

    ...is a simple life form.

    --
    Anyone who posts about bad moderation are themselves off-topic and should be moderated accordingly.
  115. Re:Have they not seen Wierd [sic] Science by i0lanthe · · Score: 5, Funny

    This is a wonderful new field of science that has incredible potential for human advancement. It also has incredible potential for misuse and unethical behavior.

    Heck, forget honest mistakes made by intelligent, thoughtful, ethical scientists; forget unethical misuses slowly plotted by glacial corporations and governments. What I'm worried about is N years after that, when the biology script kiddies swing into action.

    --
    "The Crystal Wind is the Storm, and the Storm is Data, and the Data is Life"
  116. Re:Creator? God? by $0.02 · · Score: 1

    "If man creates a new life form by definition man is the "Creator" of that life form. If somehow in a distance future man builds on this knowledge and creates an intelligent life form, from scratch, would man be it's "Creator"? If so, could one say that man is it's God?"

    No. To claim divinity man is not to create a bacteria but a Universe.

    --
    If enithin kan gow rong it whil. (Murfey)
  117. Re:What's so scary? by Alsee · · Score: 2

    That makes the "scary" part, to me anyway, the fact that if this were to escape and survive it would displace something else with absolutely unknown consequences

    They are making a minimal cell with almost all of the genes stripped out. It is about the equivalant of taking a human baby, cut off it's arms and legs, gouge out its eyes and ears, wipe out its immune system, remove it's entire skeleton, slice out every muscle except the heart and diaphram, rip out it's digestive system, and connect it to a feeding tube of pre-digested nutrient solution.

    Now take that baby and toss it out on your local freeway during rushhour traffic. And be terrified that the baby is going to displace the local wildlife and kill us all.

    -

    --
    - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  118. Re:Creator? God? by HalfFlat · · Score: 2

    I think many thinking theists would argue that too. The argument against an all-knowing, all-powerful and all-good entity existing is too simple to dismiss (e.g., natural evils, etc.)

    One can still have a Christian-style God without the omni-this and that; it is in fact the only way to deal with the idea rationally. Nearly omnipotent for example is a good starting point!

    Then there are more sophisticated models which have God being omnipotent and all-good, but within limited domains, such as an individual's subjective experience. This starts diverging from canon somewhat though ...

  119. Re:Creator? God? by martyros · · Score: 1
    I think we do create, and we do have a peculiar relationship with the things we create. Isn't that why guys name their cars? We have an affection for the things we create and use on a regular basis, things that are properly subordinate to us.

    But there are different types of things. In a sense we "create" our children, but we do not own them -- we are making another creature like ourselves, a peer so to speak, and we have no right to dominate a peer the way we do our subordinates. If we ever did create an artificial intelligence or another form of life similar to our own, we would not be inventing something new, but copying what's already there -- ourselves; and such a thing would not belong to us, although we have had a hand in making it, any more than our children do.

    In other words, God has a patent on the making of a "spiritual" being (whatever that means to you), and licenses the patent to us on the stipulation that we respect other spiritual beings as peers. =)

    --

    TCP: Why the Internet is full of SYN.

  120. If only... by greymond · · Score: 2, Funny

    we could create life from nothing, could we consider ourselves equal with god...

    except for his childish qualities of course....

  121. Re:how is it a contradiction? by mtrupe · · Score: 1

    Are you suggesting that all non-religious people are more intelligent than all religious people? I wonder what Albert Einstein would have said about that...

  122. Re:Creator? God? by mtrupe · · Score: 1

    I wish I had some points to mod this comment up...

  123. Genetically engineered agent of genital infection! by maydog · · Score: 1

    Great!

  124. HIV == AIDS == DEATH is FALSE by Loundry · · Score: 1, Offtopic
    The cure for AIDS is going to be sociological, not molecular. AIDS is the largest medical fraud ever to occur in humanity. Before you mod me down, please consider the following questions:

    1. When and for what reasons was AZT first shelved?
    2. What are the symptoms of AZT poisoning?
    3. What is the rate of HIV infection outside of the original "control groups" (specifically, I.V. drug users and promiscuous gay males)?
    4. Under the current "HIV == AIDS" model, how is it explainable that a child acquire HIV in vitro but not develop AIDS?
    5. If you test positive for HIV, then what is the probibility that the test will be a false positive? Hint: it's NOT 99.9% despite the fact that the test claims to be "99.9% accurate."
    6. Who first isolated the HIV virus?


    Find some answers here. Read before you criticize.
    --
    I don't make the rules. I just make fun of them.
    1. Re:HIV == AIDS == DEATH is FALSE by the+gnat · · Score: 2

      Go tell that to the East Africans. Better yet, go spend a week barebacking in San Francisco and tell us how you feel in a few years.

    2. Re:HIV == AIDS == DEATH is FALSE by scientistguy · · Score: 1

      I'm amazed that this disinformation still persists. You can line up many times more scientists and physicians who work on infectious disease or viral and/or bacterial infections, and they will agree that an HIV-1 infection will lead to the destruction of CD4+ T cells in the body which leads to immunodeficiency and susceptibility to secondary infections which characterize AIDS. There's many lines of evidence to support this. Consider ...

      (1) Exposing purified CD4+ T cells in culture outside the body to HIV-1 leads to their infection and killing. I've observed this many times under a microscope.

      (2) Introduction of the genetic material obtained from HIV-1 through a method called transfection into these same cells leads to HIV-1 production and cell killing by the virus.

      (3) In either of the circumstances listed in (1) or (2), if one uses and antiviral drug that specifically targets the virus, virus spread is stopped as is cell killing.

      (4) The same antiviral drugs used in humans who are infected with HIV-1, prevents diminishment of CD4+ T cells, reduces the amount of HIV-1 present in the body, and extends life of HIV-1 infected persons.

      (5) People with specific mutations in genes required by HIV-1 isolates in cell culture (such as CCR5), are highly resistant to natural infection by HIV-1 relative to the population at large. Persons who engage in behavior deemed to put them at high risk to HIV-1 infection (unprotected sex with different HIV-1 infected individuals multiple times) live longer and do not get infected with HIV-1 or develop AIDS at rates probably 100-1000 fold lower than the general population.

      (6) Unfortunate laboratory workers who have exposed themselves to unique genetic HIV-1 isolates present in their respective labs have gotten infected by these specific virus isolates and had their CD4+ T cell numbers decimated by the infection until put on antivirals. Unfortunately, over time, retroviruses, such as HIV-1, under drug selection acquire resistance to the drugs through adaptation/evolution so the drugs are a temporary panacea.

      (7) Different monkey species which in the wold were never exposed to HIV family viruses, when exposed in captivity under experimental circumstances, develop an infection, demonstrate loss in CD4+ T cell numbers, and ultimately succumb as a result of the infection. Antiviral drugs can prolong the life of these animals (sometimes indefinitely in the current time frame) and some vaccine strategies targeting certain viruses appear to be protective (unfortunately, because of HIV family viruses genetic diversity, thse vaccine strategies do not work against viruses that are genetically different -- imagine dealing with 1000's and 1000's a different flu isolates at once to get some perspective).

      An early proponent in questioning whether HIV-1 caused AIDS was Peter Duesberg at UC-Berkeley. I've met Peter before, and some fo my senior colleagues know him quite well. Peter is a smart man and has made important contributions as to our understanding of cancer usng retroviruses as a model to explore oncogenesis. Indeed for his work in this area, some scientists (even those who disagree with his views on HIV and AIDS) think he may have been deserving of Nobel consideration. However Peter is a somewhat scorned man and he definitely possesses an ego - at least this was my impression as a junior scientist meeting one of the old big guys who had made important scientific contributions (the guy's also a pretty slick dresser relative to most scientists I know). Some of the same crowd involved in retroviruses and studying cancer moved into HIV-1 when it was discovered because it was a retrovirus. These included people Peter may not have liked and people he may have thought dissed him regarding credit for his work on oncogenesis. Thus Peter was probably a little more skeptical about work these scientists were involved in. I think this was fine at the beginning and Peter posed some legitimate questions. However, over time, this seemed to become personal. A lot of evidence has mounted about HIV-1 killing CD4+ T cells and causing immunodeficieny since the early days. In fact, a lot of the scientists that Peter may not have thought best of are no longer involved in the cutting edge of HIV-1 research or in the limelight as much. Peter's boxed himself in a difficult position and so I am unsure of whether he would ever be publically accepting of the evidence in favor of HIV-1 causing immunodeficiency no matter what it was.

      Anyway to get perspective on the early days of the field aside from Peter, I would recommend John Crewdson's excellent recent book called Science Fictions. He mostly treats the tawdry characters who were involved in characterizing HIV-1 in the mid-1980's when first isolated and recognized. Some of these characters Peter (and those of us in the field) probably found distasteful in behavior - and for good reasons. However, in the long term, despite the players, the facts remain ... HIV-1 causes an immune destruction in individuals, the earth is not flat (remem, many more argued for years despite the evidence of the era that is was), and evolution is more than just a theory.

      (as per the website, rather than quote Nobelist Kary Mullis on the topic who understands the area as was as he might string theory, consider Nobelist Howard Temin's opinions on the topic ... or Nobelist Harold Varmus ... please)

    3. Re:HIV == AIDS == DEATH is FALSE by Loundry · · Score: 2

      Go tell that to the East Africans.

      Show me the body bags. We saw this for Ebola. Why not for AIDS?

      Better yet, go spend a week barebacking in San Francisco and tell us how you feel in a few years.

      I guarantee you that I'd feel better doing that than I would if I were taking the poison known as AZT for a few years, incubation period or no incubation period.

      --
      I don't make the rules. I just make fun of them.
    4. Re:HIV == AIDS == DEATH is FALSE by Loundry · · Score: 2
      I think what you didn't write is more imporant than what you did write. Why did you duck every single one of my questions?

      You can line up many times more scientists and physicians who work on infectious disease or viral and/or bacterial infections, and they will agree that an HIV-1 infection will lead to the destruction of CD4+ T cells in the body which leads to immunodeficiency and susceptibility to secondary infections which characterize AIDS.

      AIDS research is the single most well-funded disease research in human history. More so than other diseases which kill and harm many, many more people than AIDS does. Is it possible that money may be a factor? I think the answer is Yes. I notice that you write as if you are in the AIDS research field.

      Exposing purified CD4+ T cells in culture outside the body to HIV-1 leads to their infection and killing. I've observed this many times under a microscope.

      HIV has not been isolated. How can any of your claims, which deoend on the existence of HIV, be true?

      The same antiviral drugs used in humans who are infected with HIV-1, prevents diminishment of CD4+ T cells, reduces the amount of HIV-1 present in the body, and extends life of HIV-1 infected persons.

      Antiviral drugs such as AZT? Do you work for Burroughs-Wellcome?

      An early proponent in questioning whether HIV-1 caused AIDS was Peter Duesberg at UC-Berkeley. I've met Peter before, and some fo my senior colleagues know him quite well. Peter is a smart man and has made important contributions as to our understanding of cancer usng retroviruses as a model to explore oncogenesis.

      Duesberg is one of the principal opponents of the HIV-AIDS hypothesis. I don't understand why you write so fondly of him since you labeled my claims, where are partly based on his writings, as "disinformation."

      Here are some more questions for you:

      1. How can AIDS be called an "epidemic" if it does not follow an epidemic pattern?
      2. Did Burroughs-Wellcome give money to Act Up!?
      3. What is the relationship between Kaposi's Sarcoma and amyl nitrate?
      4. How many times has the list of "AIDS diseases" changed since the declaration of the HIV-AIDS hypothesis?


      --
      I don't make the rules. I just make fun of them.
    5. Re:HIV == AIDS == DEATH is FALSE by scientistguy · · Score: 1

      >I think what you didn't write is more imporant than what you did write. Why did you duck every single one of my questions?

      i wasn't ducking your questions as they weren't posed to me per se but posted in this forum. moreover, i was stating facts and not questions as you were. you can dismiss the facts as you choose based on whatever general or specific knowledge you have in the topic area. obviously you're someone who's concerned about being informed, and i in no way intend this to be personal. just giving you the perspective of someone who's seen these things up close as well as knows scientists involved in driving the debate on both sides. you've picked up on some of the points that peter duesberg originally put out. thus i also wanted to raise the possibility that his motivation might be influenced by other personal factors other than the science (ego is both a good and a bad thing in science). to briefly and honestly treat the last 4 points/questions you've brought up ...
      (1) & (4) are semantic issues, right? the larger question you were posing prevoiusly was whether HIV caused an immunodeficiency that allowed secondary infections. i think the data is unequivocal on this point. as per what secondary infections occur in 'AIDS' caused by HIV-1, this has changed somewhat over time because people learned more about the disease and some of the early second infections became treatable and non-issues (thus saving lives). as per question (2), i don't know what burroughs-wellcome does with its money but am generally suspicious of large drug companies. as per question (3), supply whichever peter duesberg theory you want as this is one of his issues. he stopped scientifically publishing on HIV for the past 4-5 years, and has primarily gone back to his cancer work.

      >HIV has not been isolated. How can any of your claims, which deoend on the existence of HIV, be true?

      do you have specific knowledge of this or perhaps have done any molecular biology research to back this up? HIV has been isolated numerous times. it's real. it's not so hard to do. you can in fact isolate just it's nucleic acid genome, put this into cells, and they will make the virus. peter duesberg (again the leading scientific figure who used to question the HIV/AIDS link) has done the same exact experiment with other retroviruses. it's a pretty simple one. anyway, go to this website ...

      http://www.ncbi.nlm.nih.gov/entrez/query.fcgi

      search for ...

      hiv isolation

      or whatever terms you want and you'll find more than a few scientific references in the literature database.

      >Antiviral drugs such as AZT? Do you work for Burroughs-Wellcome?

      No. Why are you so hung up on this company?

      I could work for big pharma if I wanted and prob triple my salary. Would probably make my wife a lot happier too. However, I am guilty of doing basic research. My specialities are immunology and virus biology. Run a small lab, train students and postdocs. We work hard, do our best to do good science and stay out of politics, and see if we can make a contribution to the common good. I decided to professionally continue studying retroviruses after seeing a friend die of HIV-1 infection that progressed to AIDS while I was a grad student. Pretty sad as it was the year that these drugs called protease inhibitors were coming out experimentally and he was trying so hard to get in a protocol so he could get the meds. If he had hung on a year longer, he still might have been here when they became generally available. It's amazing what the virus would do in those pre-protease inhib days. The guy went from being a healthy and fit 30-year old to looking like a gaunt and emaciated 80-year old man in the space of a year when his CD4+ cell counts were decimated. Every day, he would still come into work and try to do his job as if in denial. When these drugs were introduced in the early 1990's, the life expectancy of those HIV infected in the US has steadily shot up. I suspect persons like Magic Johnson would not be around now if it were not for this series of drugs/antivirals and those that have come out later (remem AZT was a first gen drug and not specifically designed to fight HIV ... it was in fact originally an anti-cancer candidate).

      As per speaking 'fondly' of Peter Duesberg, I was just giving the guy his due. He's done good research in cancer, but I think some of the things he's said about HIV/AIDS are incorrect based on an examination of the body of scientific data and experiments I've performed with my own hands. Sometimes smart people make mistakes. I'm not going to get into a debate of whether you have or I have on this topic because I think you're coming at it with an open mind and willing to examine information or evidence as presented (obviously beyond what spin or rolling stone or the popular press may report). I decided to put my own curiosity on the research bench and test things myself. It's no conspiracy. HIV kills CD4+ T cells. Stopping the virus saves these important immune cells and it prolongs life.

    6. Re:HIV == AIDS == DEATH is FALSE by the+gnat · · Score: 2

      AIDS research is the single most well-funded disease research in human history.

      I find this dubious, and the NIH spends vastly more on cancer research: see their official funding page.

      HIV has not been isolated.

      Even Duesberg contends that HIV exists. The genome has been sequenced, the structures of the protease and reverse transcriptase have beeen solved. You people are more interested in dogma than science- just as bad as the creationists.

      As for AZT, everyone with more than a basic knowledge of biology and chemistry understands how dangerous it is- a brute force attack on reverse transcription (and, unfortunately, normal DNA replication). It's a particularly poor example, because the nasty side effects are obvious; why don't you try arguing against the therapeutic power of, say, Crixivan or d4t instead?

  125. Re:News: Two famous scientists found dead by Sj0 · · Score: 2

    Step back a minute. Are these forces "we" don't comprehend, or forces "YOU" don't comprehend? Just because YOU don't understand the subject, doesn't mean that a genetic scientist doesn't.

    More importantly, who cares if we kill a "frankenstien" micro-organism? You seem to be thinking that we're making a multicellular organism here, perhaps with sentience. This is not the case. It's a simple micro-organism. We kill millions of them every day walking down the street, laying in bed, or even floating in space(with a space suit, mind you).

    Everybody should stop believing that fiction is somehow a prophecy of what will happen if those "nasty scientists" try treading on something interesting. Do you think that we should hold off a manned expedition to mars because the space creature from planet X will get us? Should we stop using vaccines because someone might slip a mind control drug in there? Doubtful.

    --
    It's been a long time.
  126. Re:News: Two famous scientists found dead by Sj0 · · Score: 2

    If we have a problem that big, most organisms have a natural enemy known as "fire". :)

    --
    It's been a long time.
  127. Re:Creator? God? by Mac+Degger · · Score: 2

    Nah...the dispoof of a being compliant to all the abilities above can't exist due to the paradoxes involved (ie creating something he/she/it can't lift and lifting it).

    Dumbing the powers down, and restricting its responsibilities (ie he's responsible for the earth being flat, oh no...uh...the planets spinning round...uhhh...well, he created gravity!) just proves more and more that a god is a lie which is losing more and more credibility with every discovery made. The real question is why does humanity need a god/pantheon in the first case? True, religion is a great control mechanism, but why do so many buy into it?

    --
    -- Waht? Tehr's a preveiw buottn?
  128. On playing God by drew_kime · · Score: 4, Insightful
    But when it comes to biology, people get squeamish because ... well, because we've had the idea implanted in our heads, at least since Frankenstein, that cutting-edge biological research is somehow "playing God."

    Actually, according to a Catholic theologian when asked about this, to "play God" you would have to invent the rules then sit back and watch what happens within the rules. What we do is try to figure out what the rules are and then do everything we can within them. So trying to create life within the rules that we've got is not "plyaing God" but "playing Man".
    --
    Nope, no sig
    1. Re:On playing God by JM_the_Great · · Score: 1

      So John Conway is God? ;)

      --

      --Justin Mitchell
      "2nd Place is a fancy word for losing" --Bender (Futurama)
  129. Re:Creator? God? by Mac+Degger · · Score: 2

    Reading this just makess that god character more and more ridiculous. The hoops you jump through...BTW, why aren't creatures just popping into existence now then? God got bored?

    --
    -- Waht? Tehr's a preveiw buottn?
  130. Re:Hello...? by Sj0 · · Score: 2

    Yes! What we need to solve the worlds problems is millions of scientists working on something they aren't interested in!

    By the way. You're first. I hope you know something about retroviruses and human gene modification, because you're heading straight in. With no training. Oh, you're a scientist, you'll figure it out, even if you *don't* care!

    --
    It's been a long time.
  131. a rabbi and a priest? by Tablizer · · Score: 1

    A panel of ethicists and religious leaders, convened several years ago at Venter's request, has already wrestled with the latter issue. The group, which included a rabbi and a priest, concluded that if the ultimate goal was to benefit mankind and if all appropriate safeguards were followed, the project could be regarded as ethical.

    Please don't tell me that they walked into to a *bar* to discuss the issue :-)

    BTW, where is the *Islam* representation? Omitting that will just give Bin Laden's more excuses to bomb people and whine about being "downtrodden" blah blah.

  132. Re:Aaargh - Morality has to be considered. by let_freedom_ring · · Score: 1

    Science can only answer the 'can we question'.
    The process of law making (aka public morality) is designed to answer the 'should we' question.

    For instance we have the technology to import babies from China & India and butcher them for their organs but we don't. An extreme example but you get my point. If you must have an actual example then the nazi death camp experiments are a real case of unconstrained research.

    Now I don't have any problem with this particular research but if someone wants to raise the issue than let's debate them in the open. I think it's trite to say that biological research is some how above the law.

  133. Re:Creator? God? by Peyna · · Score: 2

    I'm curious what hoops I am jumping through? I was stating that in order to actually 'create' you have to do it out of nothing. Thus, these scientists will not be 'creating' life, because they have to work with something.

    If you don't believe that God (or other diety(s)) created the universe (emphasis on who not how), then you have to have some other explanation for how matter and energy came into existence.

    I never stated that creatures popped into existence, but it is a pretty sketchy area of biology and evolutionary theory. They've been able to get amino acids from non-living things, but they haven't been able to get a living thing from non-living things. There are many theories as to how this took place and most of them boil down to something (single celled organism) just 'popping' into existence. It's what's needed to make that happen that they're trying to figure out.

    So, it is highly likely that if this were the case that it would have occured in many places on earth simultaneously/in parallel, and it's also highly likely that not all of them would have survived or have been able to. Thus, I am basically saying that even if they were to get non-living to become living, chances are it would either die right away, or not last more than few generations.

    Many people would claim this is a failure, but it's really not.

    --
    What?
  134. Why do we hurt the ones we love??? by JasonUCF · · Score: 1

    Banjo? BANJO!
    BaaaaaaaaaaaaaaaNNNNNNNNNNNjjjjjjjjjjjjjOOOOOOOOOO !!!

    Adult Swim

    1. Re:Why do we hurt the ones we love??? by Anonymous+Cow+herd · · Score: 1

      Best... episode... ever!

      --
      Ita erat quando hic adveni.
  135. Re:Creator? God? by Hubert_Shrump · · Score: 1

    I've had asked this question before but never received a good answer.

    Well, if you dereference the pointer, you'll see that they have the same address.

    --
    Keep your packets off my GNU/Girlfriend!
  136. grereg by mrseth · · Score: 1

    They should probably aim a bit lower than a virus at first...Maybe they should try to recreate George W. Bush? Maybe they could even improve upon the original. Maybe they could give it a simple brain or something.

  137. I was confused. by Herkum01 · · Score: 1

    When I read the Headline, I thought a slashdotter somehow "Got Lucky", well another dream down the tubes.

  138. Signing up by gr8_phk · · Score: 1

    So how does one go about getting a job at this place? I'm always looking for something cool to work on, and this would qualify.

  139. Two-way transcription should present a puzzle by TimFreeman · · Score: 1
    According to the NCBI, the chromosome for M. Genitalium is circular. Some proteins are produced by transcribing one way around the circle, and others are produced by transcibing the other way.

    My question is, does the DNA encoding the conterclockwise proteins overlap with the DNA encoding the clockwise proteins? If so, then you can't rip out one without damaging the other. I randomly looked at a few by clicking on the aforementioned link and I did see some overlaps; for example, MG264 and MG265 overlap.

    According to GeneQuiz, the entire genome of this creature is only 0.58 Mb (which I presume stands for mega-bases). About 3/4 of the genes have guesses about their function, to varying degrees of certainty.

    It's also interesting that this bacterium uses a non-standard transcription. The latter reference above says "UGA, normally a stop codon, in this organism encodes for the amino acid tryptophan.". Does anyone know how common this is?

  140. Re:Creator? God? by Photon+Ghoul · · Score: 1

    This is waaaaay off-topic, but I have to say something.

    First of all, I am not a thiest. Okay, as far as religion and those that 'but into it', it is a very simple matter. There seems to be an inherent need in human beings to 'believe' in something. There are also anicllary needs for belonging, community, 'solid' moral grounding, easy-to-grasp explanations of nature and the universe, having an enemy to hate, etc.

    Religion, in all of it's various forms, fulfills these needs for a vast majority of people in the world.

  141. Re:News: Two famous scientists found dead by meringuoid · · Score: 2
    We are meddling with forces we do not comprehend

    Yes. The technical name for such meddling is "science".

    'Funny'? Did someone take this as a joke? 'Insightful', certainly, but definitely not 'funny'. Meddling with forces we do not comprehend is what's brought us this far. Most animals run from fire, giving a force they do not comprehend a very wide berth. Our ancestors meddled with it, they learned how to control and use it. I'm sure a great many of them got burned before they got it right. People still burn to death on a daily basis because of a fire getting out of hand. But if we hadn't meddled with forces we didn't comprehend, where would we be now?

    Electricity was a force we did not comprehend. Radio. Magnetism - should navigators have used compasses if they couldn't write out and solve Maxwell's equations? Meddling with forces we do not comprehend is what humans DO. It's our big evolutionary advantage, that where most creatures will run from things they don't understand, we'll go right up to them and start prodding, even at the risk of our lives. Meddling with forces we do not comprehend has won us the Earth. Meddling with forces we do not comprehend can win us the stars too. Maybe it can win us near-immortality. If you don't want to meddle with forces you don't comprehend, switch off your computer, take off all your clothes that contain synthetic fibres and live in a cave.

    --
    Real Daleks don't climb stairs - they level the building.
  142. Greenhouse gases and energy by sean.peters · · Score: 1

    There are more than one greenhouse gas (methane and CO2 come to mind) but only CO2 is present in any quantity in the atmosphere. Making energy AND getting rid of CO2 is more or less impossible... because CO2 requires an energy INPUT to break up. As far as creating life forms just to crack CO2... we already have these. They're called green plants. And they already do such a good job that in spite of all the CO2 inputs to the atmosphere, it remains a trace constituent. The bottom line is that I doubt that there's much reason to create special creatures for this purpose, since it's unlikely they could do better than the plants that have been evolving to scavenge CO2 for millions of years. It would be a lot more feasible and less risky to just move to alternative energy sources. Sean

  143. BRAAAAAINS !!! by RembrandtX · · Score: 2

    And maybe when they are done, they can store them in rusting canisters in a medical storage facility. Where those said canisters can accidently be punctured by a fire axe, and spread the now mutated organism through the air.

    And after the chop up and burn the cadivers, it can be spread to a nearby graveyard !!

    COOL!

    U.S. Govt: "And now we award Dr. Romaro's development research team their requested grant."

    --

    --Ne auderis delere orbem rigidum meum, non erravi pernicose!
  144. morality by prell · · Score: 1

    why do we always ask the moral questions after we do it?

  145. Re:?? Jewish Genome?? (was: Re:Aaargh) by CommieLib · · Score: 2

    All it takes is a Google search, my friend...

    Israel has actually been accused of the reverse by some nutcases.

    --
    If your bitterest enemies are people who hack the heads off civilians, then I would say you're doing something right.
  146. Re:Creator? God? by prell · · Score: 1

    yea, this is touched on in a number of sci-fi works, including "super-toys last all summer long," the short story that inspired the movie AI. For a more dudical approach, check out Terminator 2.

  147. Re:Creator? God? by efflux · · Score: 1

    I've had asked this question before but never received a good answer. If it was a good question, then you'd get a good answer. As it stands, the question doesn't real mean anything, except in how you define "God" which is really quite arbitrary.

    --
    Do I contradict myself? Very well, then I contradict myself, I am large, I contain multitudes. -- Walt Whitman
  148. Make-Your-Own-Human Kit by Peale · · Score: 2

    Something I thought about once was getting together 46 different people, taking a chromosome from them each, and throwing them together to make a new individual, completely at random.

    Of course, after Captain America destroyed my evil cloning plant, this won't happen, but was my idea feasible?

  149. Killer Strain is not more successful by cappadocius · · Score: 2, Interesting
    they could become a "killer strain", vastly more successful?

    That wouldn't of really be more successful, though. If right now, they live (usually) harmlessly in the urinary track of every human, then that is a huge habitat. If they start killing off the human race in a plague of bloody toilet water, then they will drastically reduce their habitat, perhaps even killing off so many hosts that they will no longer be spread.

    Think about it, as a species which is better, small pox or the common cold?


    (and yes, I know that viruses are not life, therefore not "species" yadda yadda yadda, but the example still holds)

    --

    omnia tua castra sunt nobis

    1. Re:Killer Strain is not more successful by Jerf · · Score: 2

      Take "killer strain" figuratively, not literally; the point is the idea that "mutations -> wild success", and "more mutations->more wild success" is false.

  150. Is it ethical or responsible by mindstrm · · Score: 2

    to simply abandon the idea and not experiment with it?

    I'm sorry.. but those who think that "creating life" or other forms of genetic research are unethical are nothing but religious whackjobs.

    yes, when it comes to genetically engineering HUMANS, there are ethical, and more importantly, sociological concerns, but they are not about "right" and "wrong" or "good" and "evil"; they are about society living and dealing with the consequences.

    This research is fantastic... I see no ethical issues whatsoever.

    1. Re:Is it ethical or responsible by n-baxley · · Score: 1

      I did n't say anything about the ethicality of this research. I'm just saying corn article was not as frightening as it sounds so lets not use that as evidence for anything it doesn't support.

  151. Mother Nature by Shrug · · Score: 1

    "don't fuck with mother nature or mother nature will find a way to fuck with you" Whats to say this thing that is grown in some lab won't be the next super virus.

  152. Only 3million? by Sophron · · Score: 1

    Is it just me, or does it seem that 3 million dollars is far too inadequate for an experiment of this magnitude? Salary and equipment costs, I'm sure, add up over 3 years.

  153. Re:What's so scary? by ShooterNeo · · Score: 2

    Unfortunatly, this level of ignorance is why I am cutting back on slashdot. Not only do you have no reason to believe this stripped down cell will be dangerous, its very likely a bacterium like this existed...and was driven extinct by a more complex version. You're basically implying that with some random tinkering we could create a life form able to supplant existing life on earth. This isn't reasonable.

  154. To all the Catholic/Christians out there... by Squidgee · · Score: 1
    Don't say any thing about morality. I'm a...uhm, kind of Catholic, and I was trapped in Catholic school for a while.

    Don't talk about morality in this. In Genisis, does it not say "And God created man in his own image" or something to that effect? Well, God made life, God made us in his image, so we can make life. End of story.

    Ok folks, move along, nothing to see here.

  155. Re:Creator? God? by agm · · Score: 1

    I accept what you are saying but I disagree that there is an inherent need to believe in something (at least from my own perspective).

    It's an interesting philosophical point though:
    Is it better to have believe in a lie because it is "comfortable" or to not believe the lie? (Although I must say I am perfectly comfortable grounding myself in reality).

  156. They only had a few days... by SofaMan · · Score: 1

    However, it did not produce all amino acids required for life as we know it. Moreover, there is no known chemical pathway to go from a bunch of amino acids to DNA/RNA. Plus there is also significant debate about whether the initial atmosphere they began with existed on Earth at the time of the origins of life.

    All of what you've said is true, but let's not forget one other very salient point: The Miller-Urey experiment took place over a period of days (or weeks; I forget which). The evolution of self-replicating RNA and DNA took place over a period of about 100 million years.

    Let's not cane too hard on these experiments, simply because they couldn't reproduce in a few days what it took nature a hundred million years to do .

    --

    SofaMan -- Occasionally Battling Evil With His Mighty Powers Of Indolence.

  157. Re:Creator? God? by Photon+Ghoul · · Score: 2

    I think that for some, yes, believing in a lie is the only way that they will be able to go through life. It's better for them and I think that's what matters.

  158. federally funded project slashdotted! by scientistguy · · Score: 1

    now that this hit the popular press, how long do you thing venter's U.S. Energy dept funding is going to last? given the current regulatory climate in funding human embyronic stem cell research, one would think that those same legislators ensuring restrictions in this arena are not going to be so thrilled with the US gov't funding research that news headlines trumpet as 'playing god'. dude, your research funding has been slashdotted.

    in truth, as has been noted in prior posts, he's not exactly proposing starting from scrath. indeed, ventner has had a long standing interest in the basic living unit prob for some time now, and now that he's primarily been hyping personal genome sequencing, it's nice to see him trying to push a scientific frontier once more.

    there's an interesting CNN quote from him on the topic ... "We'll have a debate on what should be published and what shouldn't," Venter said. "We may not disclose all the details that would teach somebody else how to do this."

    somewhat ironic as he was also accused of withholding info on his company's sequencing efforts when they were published a couple years back (although there were no security reasons in that case). he seems to be prepping ahead of time here, but how can someone judge if he's really accomplished what they set out to do without adequate scientific review of the data, and more importantly, allowing other scientists to determine if the data is reproducible? it's like saying 'i made this gold from lead, but i can't show you how'. making this type of comment so far ahead of the efforts seems odd.

    anyway, it's all mute if his funding gets nixed.

    1. Re:federally funded project slashdotted! by scientistguy · · Score: 1

      whoops, meant the point is 'moot' ...

  159. We've had those for quite awhile already. by dsanfte · · Score: 1

    Why not produce lifeforms that can (for example) consume greenhouse gasses and produce energy? That would certainly reduce the strain on the environment.

    They're called trees. Go plant one.

    --
    occultae nullus est respectus musicae - originally a Greek proverb
  160. Playing God by BlueFashoo · · Score: 1

    I never got the playing god argument. If playing god is so wrong, why were we made in god's image. And wouldn't that make these scientists godly people? Also, if Jesus Christ is the son of God, and the whole trinity thing, ( what were they smoking? ) and being a Christian means your supposed to be like Christ, therefore like God, then wouldn't playing god be a Christ like, and therefore Christian, thing to do?

    --
    Nice Marmot
  161. Re:Creator? God? by agm · · Score: 1

    I agree completely. As long as they don't push their beliefs onto anyone else.

  162. The Penrose reference by stokes · · Score: 1
    Roger Penrose Jr. wrote a book titled The Emperor's New Mind, which argues that sapience is some sort of mystical quantum effect or the like. He's clearly a brilliant guy and did a lot of research, but I found the book verging on wishful thinking.

    As for his credentials, I believe Penrose is a mathematician. His father, the better known Roger Penrose, was also a mathematician. The elder Penrose produced a set of wooden blocks that, when shaken, linked into patterned chains -- a little demonstration of order arising from chaos. Living under his materialist father's shadow, it's not surprising that Penrose the Younger rebelled a little.

  163. In IRL, there are still a few hurdles to leap... by leonbrooks · · Score: 2

    Scores of chicken-and-egg problems remain. The best they could hope for is modifying an existing lifeform, and that's boring.

    --
    Got time? Spend some of it coding or testing
  164. Re:News: Two famous scientists found dead by stokes · · Score: 1
    In a bizzare accident, two famous scientists attempting to create "new" life died today in their homes. The cause is unknown at this point, but the CDC/FBI/CIA have quaranteed the research lab, their houses, the coworkers, their family and dozens of other people.


    In a follow-up bulletin, the coroner has announced that the apparent cause of death was repeated application of torchfire and rustic peasant pitchfork.

  165. Bring new meaning... by LilGuy · · Score: 1

    to the old phrase your parents used to use... I created you, I can destroy you!! Or was that just mine...

    --

    You're nothing; like me.
  166. Pathetic! by Loundry · · Score: 2

    i wasn't ducking your questions as they weren't posed to me per se but posted in this forum. moreover, i was stating facts and not questions as you were.

    And you still haven't answered the questions, you've only given me an excuse as to why you haven't. And don't try to turn this back on me.

    you've picked up on some of the points that peter duesberg originally put out. thus i also wanted to raise the possibility that his motivation might be influenced by other personal factors other than the science

    Don't try to pin this on Duesberg, either. He's not the only one who has questioned the HIV==AIDS mantra. And he's not the only one to suffer financially, emotionally, and physically from having the audacity to do so. AIDS is BIG MONEY.

    (1) & (4) are semantic issues, right?

    No, they are not.

    Concering #1, the definition of epidemic is specific. The pattern of AIDS does not meet the criteria, yet it is called an "epidemic" anyway. Why is this?

    the larger question you were posing prevoiusly was whether HIV caused an immunodeficiency that allowed secondary infections. i think the data is unequivocal on this point.

    So the immunodeficiency "allowed" secondary infections? I suppose you've chosen this verb because you can't say "caused." In fact, you know that ALL of the secondary infections existed in absence of HIV before the alleged discovery of HIV. And the data is certainly not unequivocal.

    as per what secondary infections occur in 'AIDS' caused by HIV-1, this has changed somewhat over time because people learned more about the disease and some of the early second infections became treatable and non-issues (thus saving lives).

    You didn't answer my question. How many times has the list of secondary diseases changed? And, once you figure that out, can you form the list of these so-called secondary infections for each time the list changed? Wouldn't the contents of those lists be interesting? I find it to be very important since a diagnosis of AIDS has always been either a death sentence or "buy our drugs if you want to live" sentence. It's just ripe for abuse, isn't it?

    as per question (2), i don't know what burroughs-wellcome does with its money but am generally suspicious of large drug companies. as per question

    This might be my foot in the door! ;)

    (3), supply whichever peter duesberg theory you want as this is one of his issues. he stopped scientifically publishing on HIV for the past 4-5 years, and has primarily gone back to his cancer work.

    Weak, weak, weak. I can reference writings that are NOT by Duesberg that discuss the positive link between KS and amyl nitrate ("poppers"). Why do you keep trying to pin this on Duesberg? He's not the only opponent of the HIV==AIDS hypothesis. Is Duesberg your scapegoat?

    do you have specific knowledge of this or perhaps have done any molecular biology research to back this up? HIV has been isolated numerous times. it's real. it's not so hard to do. you can in fact isolate just it's nucleic acid genome, put this into cells, and they will make the virus.

    Wrongo Dongo, amigo. It is you that has to back up your claim that the virus has been isolated. You can't just assert that it has been isolated and then tell me that I have to disprove you. The easiest way for us to solve this is for you to link to the paper which describes the circumstances under which the HIV virus was isolated. Don't tell me to go to some website and dig around. Just link to the paper. There is a prize for anyone who can claim isolation of the HIV virus. Perhaps you'd like to claim it?

    peter duesberg (again the leading scientific figure who used to question the HIV/AIDS link) has done the same exact experiment with other retroviruses. it's a pretty simple one.

    Yes, let's bring it back to Duesberg again. This is not convincing.

    No. Why are you so hung up on this company?

    Because they are the manufacturer of AZT and have thus made millions off of the "AIDS epidemic."

    I decided to professionally continue studying retroviruses after seeing a friend die of HIV-1 infection that progressed to AIDS while I was a grad student. Pretty sad as it was the year that these drugs called protease inhibitors were coming out experimentally and he was trying so hard to get in a protocol so he could get the meds.

    One question: was your friend on AZT therapy?

    I'm not going to get into a debate of whether you have or I have on this topic because I think you're coming at it with an open mind and willing to examine information or evidence as presented....

    Flattery will get you nowhere.

    I decided to put my own curiosity on the research bench and test things myself. It's no conspiracy. HIV kills CD4+ T cells. Stopping the virus saves these important immune cells and it prolongs life.

    I'm not the slightest bit impressed. For all I know, you could be working for a pharmecutical company and lying about your job. The profit motive is certainly there for just such a fabrication, considering that AIDS has more money than God does, and the only thing which might stop the gravy train are those which actually question the bald and hollow assertions which support the HIV==AIDS house of cards. And your "stopping the virus" (through drugs, presumably) is the same line that the big AIDS drug manufacturers have been preaching since the alleged outbreak.

    If you answer my questions you will gain more credibility with me.

    --
    I don't make the rules. I just make fun of them.
  167. Technical obsticals/difficulties by Naguk · · Score: 1

    I'm surpised no one has commented on the technical obsticals/difficulties associated with this project. It says they have already "hollowed out" the organism to the point where it has a mimimal set of genes in the previous work. Exactly what is the next step that they plan to take? Looking for ways to cut the number down further? Or are they actually planning on engineering new genes to take the place of 2 old genes? If so, will they try introducing genes from other (presumably prokaryotic) organisms, or engineering them de novo? (which seems pretty far fetched) Also, how will they define success? How will they no when there is no possible way to get the number of genes any smaller? How about promoters, operators and other regulatory sequences that aren't actually transcribed/translated? Are they going to try and cut these down too? They could try and aggregate genes together into an operon to cut down the number of promoters. Also they might be able to delete an operator and its associated inducer/repressor without killing the cell- just making it less efficient. And finally, how efficient does the thing need to be to qualify as alive? What environment must the organism survive in to qualify? This seems to be a key issue, which is fairly arbitrary. But then in biology, many things are.

  168. We aren't THAT stupid. by EvilBudMan · · Score: 1

    It was meant to be FUNNY, but I hope you are right. I hope we aren't that stupid, but humanity has done some pretty stupid things in the past and also now. Hopefully the future won't get worse.

  169. Re:Creator? God? by Mac+Degger · · Score: 2

    Watch 'Brazil' by Terry Gilliam if you get the chance. You'll like it :)

    --
    -- Waht? Tehr's a preveiw buottn?
  170. Jerry Falwell may agree with you ... by scientistguy · · Score: 1

    but I don't. In fact, a scientist whose original arguments you're using, wouldn't agree with half the stuff you've written to either. Listen, you started this thread with the left field assertion that HIV does not cause AIDS. Then you back up the assertion with questions and not facts. You finish 'with go read this lammo website that tells you all about it'. Guess what? I write a response based listing facts used to prove that HIV causes AIDS. Yeah, that's the ticket, list some evidence before making an assertion that you can't back up. Give it a shot. You spend a good deal of your posts getting hyped about AZT and know full well that HIV/AIDS existed prior to any individuals getting AZT. You probably know that most of the people in the world that are HIV infected and develop AIDS never see AZT or other antivirals. In the absence of any other information other than HIV is found in many people who have this immunodeficiency whose disease manifestation is called AIDS, you prefer to ignore Occamm's razor and go with what is mostly a crowd of scientific misfits, dilettantes, and yahoos (check out the board of your source material website) that claims that people get AIDS because of poppers, their nutrition, because they take antivirals, because their 'lifestyle' is unhealthy for whatever reason (Falwell's fav), because they live in Africa, yadda yadda yadda ... but not because they're HIV infected. But of course, there's many more facts than just the etiologic association of HIV and AIDS as I've listed previously. I don't think you were able to really dispute a single one of then, right? Even that apocryphal claim that HIV hasn't been isolated doesn't sound too strong now, does it? (I think I'll let someone else contend for the lammo website's prize on this). Given that you're so 'fact' based why don't you start with some and show us what you know about the topic before demanding answers to questions to a thesis you can't back up? What causes AIDS and how? Why does HIV not cause AIDS? These two are simple and would substantiate the thesis of your post before venturing off into being po'ed at burroughs-wellcome, claiming you have scientific proof of the link of KS and poppers (i presume at least a couple papers from reputable scientific journals and not someone's manifesto/novel), what's the proper definition of an epidemic (actually the UN refers to the HIV/AIDS crisis as a pandemic ... but they're probably similarly clueless in your book), etc. Stick to the big questions and fact based evidence first for the claim you put forward and then deviate into your lists of random questions.

    Are you out of your depth?

    Yes

    Will you ever admit it?

    No

    Typical of a good /.er?

    Absolutely.

  171. Nice suit: Mafia. Ordinary suit: FBI. by Manhattan+Project · · Score: 1

    Excuse me, there's someone knocking on the door... wow, nice suit. Uh oh.

    "No, sir, we in the government don't get nice suits."

  172. Again, pathetic by Loundry · · Score: 2

    Listen, you started this thread with the left field assertion that HIV does not cause AIDS.

    "You started this!" How middle-school of you. My assertion is not left-field.

    I write a response based listing facts used to prove that HIV causes AIDS. Yeah, that's the ticket, list some evidence before making an assertion that you can't back up. Give it a shot.

    You have listed no facts. You have merely reitereated the point in dispute, that HIV==AIDS. I refuse to believe it until you show me the evidence. The burden of proof is on you, not on me. Just becuase I go against the single most well-funded disease research in human history does not shift the burden of proof.

    You spend a good deal of your posts getting hyped about AZT and know full well that HIV/AIDS existed prior to any individuals getting AZT.

    You are wrong. AZT existed before HIV and was shelved. Why was it shelved? What were its side effects?

    You probably know that most of the people in the world that are HIV infected and develop AIDS never see AZT or other antivirals.

    I doubt that there is anyone who is infected with HIV and who is developing AIDS as a result of it. Where are the millions of corpses from those Africans who should be dying from AIDS right now? We all saw images of what Ebola did, but the so-called AIDS epidemic (which is called an epidemic despite the fact that it does NOT follow an epidemic pattern) in Africa is nothing but talk so far.

    you prefer to ignore Occamm's razor and go with what is mostly a crowd of scientific misfits, dilettantes, and yahoos

    Yes, it's so much easier to slander your opponent than to refute his argument, isn't it? This is called argumentum ad hominem and it's a logical flaw. It's a sign that your argument is weak.

    that claims that people get AIDS because of poppers

    It claims no such thing. It claims that people get KS from poppers. Even the exalted Gallo has shifted his position on KS and poppers, where previously it was "caused by AIDS (HIV)."

    But of course, there's many more facts than just the etiologic association of HIV and AIDS as I've listed previously.

    So why don't you share some? Your ad hominems are getting boring.

    I don't think you were able to really dispute a single one of then, right? Even that apocryphal claim that HIV hasn't been isolated doesn't sound too strong now, does it?

    Your attempts to indimidate me will fail. Produce the document which shows that HIV has been isolated. Until you can produce this document, I think all of your claims about HIV are baseless and don't need to be refuted.

    I think I'll let someone else contend for the lammo website's prize on this

    Probably because you can't. You don't have a document that shows HIV has been isolated.

    Given that you're so 'fact' based why don't you start with some and show us what you know about the topic before demanding answers to questions to a thesis you can't back up?

    I don't need a thesis because my position is skepticism, not belief. Show me the evidence that HIV exists and causes AIDS. The evidence is not in your favor.

    What causes AIDS and how?

    We first have to agree as to what "AIDS" is. The definition of AIDS keeps changing. What is the list of the so-called "secondary diseases" this year?

    Why does HIV not cause AIDS?

    You're assuming a point in dispute with this question. If HIV has not been isolated, then why do you believe it exists?

    i presume at least a couple papers from reputable scientific journals and not someone's manifesto/novel

    It's very hard for those who doubt the HIV==AIDS hypothesis to get published in reputable scientific journals. Anyone who deviates from the Holy Sacred Truth that HIV==AIDS is treated with disdain, scorn, and violence. The rude and disrespectful way that you've treated me is an example of this.

    what's the proper definition of an epidemic (actually the UN refers to the HIV/AIDS crisis as a pandemic ... but they're probably similarly clueless in your book

    This is not a useless question. If the UN calls AIDS a "pandemic" yet AIDS does not meet the requirements for a pandemic, then why is AIDS labeled as much?

    Stick to the big questions and fact based evidence first for the claim you put forward and then deviate into your lists of random questions.

    I'm all about facts and I am still waiting for you to give me some. And I note that you can't seem to answer my questions. Why? They aren't unfair. Are you afraid of the answer?

    Are you out of your depth? Yes[.] Will you ever admit it? No

    Your attempts to intimidate me will fail. If you're such a big-shot scientist then you'll produce the document that shows that HIV has been isolated. You'll also be able to explain why AIDS is called an epidemic or pandemic even though it doesn't meet the criteria.

    Typical of a good /.er? Absolutely.

    I'm just "another typical slashdotter." Do you know what this is? It's another typical ad hominem argument. In other words, your argument sucks. You rely on ad hominems, ad numerams, and ad verecundiams to try and make your point which gets weaker and weaker every day. You dismiss my questions as if they were irrelevent when they most certainly are not.

    --
    I don't make the rules. I just make fun of them.
  173. Better late than never by Loundry · · Score: 2

    I find this dubious, and the NIH spends vastly more on cancer research: see their official funding page

    You win points for actually linking to data, and what you say about the NIH is partly true. I wouldn't call twice the amount on cancer research to be "vastly more." I would call it twice as much. If it were one hundred times greater then I might accept "vastly more." Then again, consider the rate of AIDS cases verses the rate of cancer cases and the story changes. Also consider that you've only linked to funding done by NIH. Are they the only group funding AIDS research? So I don't think my statement is as dubious as you claim it to be.

    Even Duesberg contends that HIV exists. The genome has been sequenced, the structures of the protease and reverse transcriptase have beeen solved.

    I notice that you do not claim that the virus has been isolated. You claim it exists and attempt a sort-of ad verecundiam by sticking Duesberg onto it (even though you don't provide any evidence that Duesberg believes such a thing, so you could be making it up), but who cares what Duesberg thinks anyway? Either the virus has been isolated or it hasn't been. You could very well be making up your statements about protease structures and reverse transcriptase since you post no links to your claims.

    There is a one-thousand pound reward offered to anyone who can isolate the alleged HIV virus. Are you prepared to claim it?

    You people are more interested in dogma than science- just as bad as the creationists.

    Not only is this a cheap-ass "you people" ad hominem, but it's really ironic that you'd accuse me of being "like a creationist" when all I am asking for is evidence and also in light of the the language coming out of the mouths of the HIV==AIDS adherents. Consider:

    "Dr. Mark Wainberg, president of the International AIDS Society, called for jailing AIDS dissidents, whom he called 'HIV deniers' (his explicit analogy to "Holocaust deniers').

    "Said Wainberg: 'If we could succeed and lock a couple of these guys up, I guarantee you the HIV-denier movement would die pretty darn quickly.'"

    --John Lauritsen in AIDS REALISM VERSUS THE HIV HYPOTHESIS

    As for AZT, everyone with more than a basic knowledge of biology and chemistry understands how dangerous it is- a brute force attack on reverse transcription (and, unfortunately, normal DNA replication). It's a particularly poor example, because the nasty side effects are obvious; why don't you try arguing against the therapeutic power of, say, Crixivan or d4t instead?

    "Basic knowledge of biology." "Pretty poor example." "Crixivan." "d4t." You know what? Your efforts to indimidate me will fail. If you can spout off these condescending phrases and big words then you can also muster up the chutzpah to actually answer my questions. As is, your own words condemn you. Do you work for a big pharm company?

    My bringing up AZT is certianly NOT a "particularly poor example." AZT was the AIDS therapy for years. It was a veritable gold mine for Burroughs-Wellcome during those years. Yes, the nasty side-effects are obvious, but trying to cloud them with language such as "brute force attack on reverse transcription" only makes your argument more suspicious, particularly in light of the questions that you've failed to answer. What, exactly, are the side effects of AZT? When and why was AZT shelved?

    Here's a side story which helps my position and hurts yours. A while back, a major network aired a special about gay adoption. (As a gay adoptive parent, I was particularly interested.) They highlighted a gay couple who had taken in five foster children, four of which had HIV. A bit later in the show, the narrator explained that the HIV in these children "went away," a phenomenon that has "only been observed in children."

    Under my (lack of) belief (specifically, that there is no such thing as HIV and it certainly does not cause the disease-with-the-ever-changing-definition "AIDS") this is easy to explain: the children were never given the poisons used to treat "AIDS" and thus never suffered from this alleged "epidemic."

    How do you explain it under your belief system, you know, the one that dictates that HIV==AIDS?

    --
    I don't make the rules. I just make fun of them.
    1. Re:Better late than never by the+gnat · · Score: 2

      Do you work for a big pharm company?

      No, and I have never had any sort of connection with any of them. I'm a programmer affiliated with the med school of a very large private university, doing computational biology (I was a molecular bio major). I do not work on anything remotely AIDS-related, nor does the group I'm in receive any AIDS-related funding, but quite a few other scientists here do.

      (Actually, my university does make some money off AIDS therapies developed here too, but this pisses off a lot us anyway. It doesn't indicate ulterior motives, because like most universities they try to commercialize anything they can, and AIDS research is only a small part of that.)

      even though you don't provide any evidence that Duesberg believes such a thing, so you could be making it up

      It says so on that page you quoted, fairly close to the top- Duesberg tried to claim the award. This is one of the things that bugs me; the HIV-is-bogus lobby can't even agree on this. And you didn't read the page before posting it, either. Shame.

      As for the genome, protein structures, etc., you could always do a Google search, but that would require an open mind. HIV-RT is (indirectly) of interest in my line of work, so I do actually know a little bit about it (and the people down the hall know quite a bit more). A few of the many, many structures are this, this,
      or this, and you can find many more by simply going here and doing a search for "HIV" or "reverse transcriptase". The genomes of HIV1 and HIV2 can be found, like almost every other genome, at the NCBI here and here.

      Yes, the nasty side-effects are obvious, but trying to cloud them with language such as "brute force attack on reverse transcription" only makes your argument more suspicious, particularly in light of the questions that you've failed to answer. What, exactly, are the side effects of AZT?

      I don't see how that's clouding the language; you're making a big deal about the side effects but you don't appear to know much about pharmaceuticals or molecular biology. AZT is a nucleoside analogue chain terminator, meaning it replaces thymidine in nascent DNA chains but prevents further addition to the chain. I believe the problem is that it fucks with normal transcription too, and it was originally intended as an anticancer drug. I don't know anything about the actual external side effects, only the molecular ones, but I seem to recall it involves some sort of anemia. (Okay, other pages say it basically just makes you feel horribly ill.)

      I'll agree AZT is a nasty drug. But you didn't answer my question: what about other therapies that do appear to be successful? Some of these can't be taken in combination with AZT, so you have to leave that out of your argument.

      How do you explain it under your belief system, you know, the one that dictates that HIV==AIDS?

      "Belief system"? Um, well, the evidence doesn't necessarily dictate anything- medical science isn't advanced enough. I would argue that "AIDS is (usually) cause by HIV", which is a good bit different, and I don't have an answer for what happened to those children. There are plenty of weird examples like that involving AIDS, but they don't mean existing hypotheses about the role of HIV are wrong, only that disease resistance and molecular biology are very complicated. And we knew that already. You can't use anecdotal evidence as proof of a broad generalization; it's just not statistically valid.

      As a counter-example, how do you explain the 2.2 million Africans who died from AIDS last year, where they can't afford AZT and certainly aren't doing many poppers? And, for that matter, I'm not clear on how you can cite the children as an example when you believe they were misdiagnosed in the first place. Did they have HIV and not get AIDS- either because of weird biology (my argument) or HIV's harmlessness (Duesberg's argument)- or did they not have HIV in the first place? If the latter, does this mean everyone who's tested positive for HIV does not have any such virus in them?

      So, the first problem here is that all you're able to do is nitpick. The second problem is that your hypotheses, to be correct, require that there be a vast conspiracy on the part of the news media, the medical establishment, and the pharmaceutical companies to fabricate AIDS so that GlaxoSmithKline can boost its revenues. It's one thing to claim that Gallo acted inappropriately, but to extend this to accuse a vast number of AIDS researchers of falsifying data is sort of absurd. You clearly haven't even bothered to do the most cursory sort of investigation, and you seem to have virtually no knowledge of biology beyond what you've read on the Virus Myth web page. And I'm a bit peeved that you keep accusing everyone of working for pharmaceutical companies- heck, the assholes didn't even read my resume when I sent it to them last spring.

      Here's a challenge: read this from beginning to end and see if you understand it.

    2. Re:Better late than never by Loundry · · Score: 2

      I'm a programmer affiliated with the med school of a very large private university, doing computational biology (I was a molecular bio major). I do not work on anything remotely AIDS-related

      I'll keep this in mind.

      It says so on that page you quoted, fairly close to the top- Duesberg tried to claim the award....And you didn't read the page before posting it, either. Shame.

      Touche!

      This is one of the things that bugs me; the HIV-is-bogus lobby can't even agree on this.

      You raise a valid point here. Chalk one up to the "problems with the HIV-is-bogus skeptics' positions" scoreboard to match against the many chalkmarks on the "problems with the HIV==AIDS theory" scoreboard.

      As for the genome, protein structures, etc., you could always do a Google search, but that would require an open mind.

      Does the fact that I don't accept your opinions automatically make me closed-minded? How do you know it is not you who is closed-minded for not accepting mine? I hate it when people say, "Just go look it up, doofus." Why should I? Isn't it your ilk which puts forth the "HIV==AIDS" hypothesis? Shouldn't the burden of proof be on you?

      A few of the many, many structures are this

      Snip. Forgive me for being so ignorant, but these pictures mean nothing to me. What should I make of them?

      I don't see how that's clouding the language; you're making a big deal about the side effects but you don't appear to know much about pharmaceuticals or molecular biology.

      Do I need to mention again that your attempts to intimidate me will fail?

      I don't know anything about the actual external side effects, only the molecular ones, but I seem to recall it involves some sort of anemia.

      If I may quote John Lauritsen, "It is a drug whose basic action is to terminate DNA synthesis, all of it. It is a random terminator of DNA synthesis, which is nothing less than the life process itself. Such a drug cannot possibly be beneficial. And so it is not surprising that AZT has many terrible toxicities-it causes the muscles to waste away, it causes excruciating muscular pain, it attacks the nervous system, it especially attacks the blood, it causes life-threatening anemia, violent headaches. And all of these are merely the short-term toxicities." (Emphasis mine.) Isn't it true that "wasting" was called one of the symptoms of "full-blown AIDS"? Wouldn't it be a tragedy if the wasting (as well as other so-called "AIDS symptoms") were caused by AZT instead of AIDS? Are you open-minded enough to consider this possibility? Isn't it also true that AIDS patients started getting better when they started taking the so-called "AIDS cocktail" (and STOPPED taking AZT)?

      You can find the paper in which he wrote that here. You can find lots more articles about AZT here. AZT was shelved for being too toxic, then it was revived as the one and only treatment for the "epidemic" of "AIDS." Since you obviously know a lot more about molecular biology than I do, I'm interested in your take on these things.

      I'll agree AZT is a nasty drug. But you didn't answer my question: what about other therapies that do appear to be successful?

      You are assuming the point in dispute. What is the relation between amyl nitrate and KS? Lots of gay men with KS were assumed to have AIDS and given AZT. It turns out that KS may be caused by amyl nitrate ("poppers") which were extremely popular among gay men having promiscuous sex.

      I would argue that "AIDS is (usually) cause by HIV", which is a good bit different, and I don't have an answer for what happened to those children. There are plenty of weird examples like that involving AIDS, but they don't mean existing hypotheses about the role of HIV are wrong, only that disease resistance and molecular biology are very complicated.

      Sometimes I debate people who believe that the Bible is the word of God. When I point out a theological problem contained in scripture, a common answer from them is, "The ways of the Lord are mysterious." This is what you have done here with your, "disease resistance and molecular biology are very complicated."

      The definition of AIDS used to include by necessity HIV infection. Now, apparently, it doesn't, and it seems like there is not agreement among the "HIV adherents" on this issue either! Nonetheless, many people were given AZT as the "only means to treat their fatal illness" and made to pay for it with their money and their lives.

      And we knew that already. You can't use anecdotal evidence as proof of a broad generalization; it's just not statistically valid.

      Agreed, and it still blows holes in the "HIV==AIDS" theory. Something has to give.

      As a counter-example, how do you explain the 2.2 million Africans who died from AIDS last year, where they can't afford AZT and certainly aren't doing many poppers?

      Where are the bodies? The web site shows images of children. Where are the 2.2 million corpses which should result from this "epidemic"? The header of the web page read, "AVERT is an international HIV and AIDS charity." "Charity" means "we get money from the HIV==AIDS hypothesis." Not exactly an objective source. And I believe AIDS is much more about money than it is about science or health.

      A counter question to you is, "Why are the cases of KS (an 'AIDS disease') relegated only to a particular target group of HIV-infected persons?"

      Did they have HIV and not get AIDS- either because of weird biology (my argument) or HIV's harmlessness (Duesberg's argument)- or did they not have HIV in the first place?

      I believe they did not have HIV. I do not believe there is such a virus. Perhaps you will be the one to convince me of such. It will take more than you spouting off about how much more you know about molecular biology than I do.

      If the latter, does this mean everyone who's tested positive for HIV does not have any such virus in them?

      Would you like to talk about the so-called "99.9% accurate" HIV test?

      So, the first problem here is that all you're able to do is nitpick.

      My position of skepticism is not nitpicking.

      The second problem is that your hypotheses, to be correct, require that there be a vast conspiracy on the part of the news media, the medical establishment, and the pharmaceutical companies to fabricate AIDS so that GlaxoSmithKline can boost its revenues.

      It's Burroghs-Wellcome, not GlaxoSmithKline, and I seriously doubt that they're the only ones on the benefiting end of the gravy train. I think you grossly underestimate the power of money. All three of the news media, pharm companies, and medical researchers have much money to gain of the so-called "AIDS scare." Do you remember when Liberace died? Do you remember the news helicopter which followed the van carrying Liberace's corpse?

      It's one thing to claim that Gallo acted inappropriately, but to extend this to accuse a vast number of AIDS researchers of falsifying data is sort of absurd.

      I disagree.

      You clearly haven't even bothered to do the most cursory sort of investigation, and you seem to have virtually no knowledge of biology beyond what you've read on the Virus Myth web page.

      (As a quick note, your pointing out that my knowledge comes from the virusmyth web page is an attempt to paint me as getting my knowledge from a single source. The web page is actually a collection of articles from many different sources. You'll have to do better than this.)

      I'll write it one more time. Maybe this time you'll start believing it: YOUR ATTEMPTS TO INTIMIDATE ME WILL FAIL. My knowledge or lack thereof of biology is not relevant. Consider the following questions:

      1. Is it true that AIDS is called an "epidemic" despite the fact that it did not follow an epidemic pattern?
      2. Is it true that many of the symptons of AIDS can be attributed to the use of AZT?
      3. Is it true that amyl nitrate can be responsible for KS?
      4. Is it true that AIDS research receives easily half as much funding as does cancer research even though the rate of AIDS cases is much, much less than one half the rate of cancer cases?

      Now, tell me, how much knowledge of molecular biology do I need to ask those questions? How much do I need to understand the answers? How much do you need, for that matter, to attempt an answer? These are the reasons that cause me to have serious doubts about the whole "HIV==AIDS" (which, by your admission, is not always true) hypothesis specifically and the HIV industry (yes, it's an industry) in general.

      Furthermore, if I am as slow and ignorant as you seem to be constantly apt to point out, then what good is it for you to post links to biology information that I'm sure not to understand? I have no way of knowing if it's bogus or not. Do you think that I should just take your word for it? My questions are not hard to answer. I don't believe you're too ingorant to answer them. Don't you think we'll find better dialog on a playing field where we can both play?

      You seem like a smart person who has a lot of knowledge about things that I don't. Do my questions not interest you even slightly? Are you so loyal to your friends down the hall that you won't even stop to consider that they might be wrong?

      Your condescending "You're just so ignorant" attitude stops now. Your attempts to intimidate me are more apt to make me distrust you than to doubt my own position of skepticism.

      And I'm a bit peeved that you keep accusing everyone of working for pharmaceutical companies- heck, the assholes didn't even read my resume when I sent it to them last spring.

      Hey we have something in common, we both think that pharm companies are assholes! ;) I propose that we try and find bridges instead of walls in our discussion. I think I may have a lot to learn from you. Perhaps you'd prefer email -- this has gotten really long.

      --
      I don't make the rules. I just make fun of them.
    3. Re:Better late than never by the+gnat · · Score: 2

      *sigh*

      email q2tgiquo23@yahoo.com if you really care that much. (yes, it's real- I hit a bunch of keys at random in the hope that random-address spammers would miss me. didn't work.)