Slashdot Mirror


Work Around for New DVD Format Protections

An anonymous reader writes "For the new Blu-ray and HD-DVD formats, Hollywood implemented a complete copy protection scheme; almost everything has to be encrypted and authenticated. Despite the crypto-stuff in Advanced Access Content System and High Bandwidth Digital Content Protection, they left the backdoor wide open — they forgot about the PrintScreen button. Using this function you can create exact digital copies of a film picture-by-picture and reassemble them into a stream."

466 comments

  1. hrmm by paradigmdream · · Score: 5, Insightful

    thats quite a bit of work to copy a movie

    1. Re:hrmm by Anonymous Coward · · Score: 3, Insightful

      Writing a single script is a lot of work to remove the protection from an any number of movies?

    2. Re:hrmm by preppypoof · · Score: 1, Redundant

      do you really think it would be that hard to create a program to do this for you?

    3. Re:hrmm by adamlazz · · Score: 1

      Of course, you're sacraficing quality. But you hit the nail on the head when you said that. It just wouldn't be worth it. Firstly, it would probably take a week. Secondly, Sound synchronization would prove to be hard to say the least, and finally, NOONE would want to do this. The 'time-spent: money-gained ratio' would be horrible.

    4. Re:hrmm by paradigmdream · · Score: 1

      not at all

    5. Re:hrmm by Anonymous Coward · · Score: 5, Informative

      If you really want to copy a blue-ray movie, there are easier ways, such as decrypting HDCP.

    6. Re:hrmm by Yurka · · Score: 2, Funny

      No work is big enough for a very small script.

      --
      I can assure you, the best way to get rid of dragons is to have one of your own.
    7. Re:hrmm by winnabago · · Score: 2, Funny

      Sacrificing quality. A week? Bah! Just get some neighborhood kids, a box of crayolas, and a jumbo size box of tracing paper. Then, profit. Nobody said that you have to spend the time.

      --
      Dammit Otto, you have lupus.
    8. Re:hrmm by Flimzy · · Score: 1
      Yes, it is a bunch of work. But it won't be long (relative to the likely lifetime of HD-DVD/BluRay) before hardware that can do this very efficiently will exist. It used to be nearly impossible to copy a CD. Even when CD burners came out, the initial investment was huge ($1000+), it took an hour to burn a disc, and cost $10+ for a blank media. Then DVD burners came out. And the burners were expensive, the media cost $10+, and it took a long time to rip and burn the media. And to recode the DVD to another format, we had to wait quite a while for the loose-DRM to be hacked.

      All in all, it's my opinion that it will be just a matter of time before we can copy HD-DVD/BluRay with ease. Either because the HD frame-grabbing hardware will become cheap (quad-core CPUs will be a commodoty soon), and/or because someone can find a way around the DRM. Most likely both.

      Of course I still think DRM sucks, even if I don't think it will keep me from copying HD content for very long.

    9. Re:hrmm by mwvdlee · · Score: 1, Interesting

      If the "Print Screen" key can do it, so can 3rd party screen grabbers.
      They may be able to block the key, but there is no way to block the 3rd party programs unless they hack the OS. (Not that, i.e., Sony would mind doing that).

      --
      Slashdot social media options: AIM, ICQ, Yahoo, Jabber and Mobile Text. Why no MySpace?
    10. Re:hrmm by kisrael · · Score: 1

      when trying to capture a scene from a DVD for an animated GIF using previous versions of Intervideo's stuff, I was surprsied to realize there's a mismatch between what you see on the screen and what came up in the screencapture directory. Using at least the default players there wasn't an easy way to capture a series of even spaced stills.

      --
      SO YOU'RE GOING TO DIE: The Comic for Dealing with Death
    11. Re:hrmm by arivanov · · Score: 5, Funny

      Not if you script it.

      Alternatively you can "script" a sufficient number of those little slave hands instead of using them top make "Action Man" figures for Tesco.

      In either case, there are not that many frames in a movie. Even if you use "slaves" it will take less than 500£ to recover all frames in Lord of the Rings this way somewhere in the middle of nowhere in China.

      --
      Baker's Law: Misery no longer loves company. Nowadays it insists on it
      http://www.sigsegv.cx/
    12. Re:hrmm by govtpiggy · · Score: 2, Insightful

      But how long would it take to create a program that does it and syncs the audio as well? I'm sure there's a way to stream the images onto a single large file rather than dealing with compiling millions of saved images. Even if it does take a week to run on an average computer it only has to be done once before it gets spread around the net. And there will always be pirate groups that will do it regardless of the "time spent:money gained" ratio. The real question is whether it'll prove to be less effort to replicate them this way or to find a more direct way around the encryption.

      --
      do you know squarepusher?
    13. Re:hrmm by Anonymous Coward · · Score: 1, Informative

      Thank you for trying to sound fancy with latin abbreviations. Please try again next time.

      i.e.
      Function: abbreviation
      Etymology: Latin id est
      that is

      e.g.
      Function: abbreviation
      Etymology: Latin exempli gratia
      for example

    14. Re:hrmm by adamlazz · · Score: 1

      Well, I wouldn't care about how long it took to get me the movie, as long as it wasn't horrible quality. I guess you could say I'm a little anal about the effort it would take to PrintScreen every frame v.s. beating encryption. Beating encryption would ensure better quality videos and it would get the movies out faster than the various frame by frame methods.

    15. Re:hrmm by Anonymous Coward · · Score: 0

      Way to spoil the joke - I too had the vision of some ne'er-do-well in a lockup being forced to sit there pressing printscreen 60 times a second for hours on end.

    16. Re:hrmm by badmammajamma · · Score: 1

      Doesn't matter since your sound will be out of synch and the whole thing will look like shit. There are much better ways to skin this cat.

      --
      Any man who afflicts the human race with ideas must be prepared to see them misunderstood. -- H. L. Mencken
    17. Re:hrmm by tomknight · · Score: 1
      Huh?

      Surely you aren't assuming that someone's going to press Print Screen millions of times...?

      The program you write would simply grab every frame as the movie's playing at normal speed.

      Sheesh....

      --
      Oh arse
    18. Re:hrmm by multimediavt · · Score: 0, Redundant

      thats quite a bit of work to copy a movie

      That's quite an understatement when you do the math: Avg. movie length of 100 minutes * frame rate 24 fps = 144,000 screen caps

      Who would even consider doing that? You'd have carpal tunnel in no time and pay more in medical bills than you would if you just bought used copies of the movies.

      FYI, doing the full extended editions of LoTR would be 982,080 screen caps!!!! Nope, not worth it.

    19. Re:hrmm by fozzy1015 · · Score: 2, Insightful

      As others have said, if you can hit print screen to save a frame then a program can be made to do it for the entire movie.

      You know, this is just like the equivalant of saying that audio can always be copied because no matter how protected the data on the media is, you can always either hold a microphone up to the speaker or run the speaker output right back into the line-in.

      With video and audio there will always be some stage where the material is in it's raw format and in a memory buffer. At that point it can be copied. This is of course assuming the protection is unbreakable which has yet be proven true for anything yet.

    20. Re:hrmm by HoboMaster · · Score: 1

      While yes, there are better ways to do it than that, why would the sound be out of sync? The frames are displayed at a constant rate. Al you have to do is reassemble them at that rate and then sync the sound to the beginning. Pretty simple, actually.

      --
      Remember kids, tin foil doesn't work, so use LeadHat.
    21. Re:hrmm by aleksiel · · Score: 1

      not very. they might disable the print screen functionality, but as long as its outputting to the screen, there should be a way to snag it, as well as the audio.

    22. Re:hrmm by Kadin2048 · · Score: 5, Informative

      I'm surprised that they haven't disabled the print-screen functionality in some way so that it's not possible to do this.

      For example, in OS X, taking screenshots is disabled whenever DVD Player is running. It's not particularly hard to get around (actually, it's almost trivially easy; yet another situation where I feel like Apple did just the bare minimum required to look like they care) using the Terminal or a third-party applet that calls the screen grab, but the normal hotkey is disabled.

      I assume that if this method becomes a popular way of ripping movies, that the ability to take screenshots on Windows will simply be similarly crippled (probably more thoroughly), or removed altogether under certain situations. ('Printscreen doesn't function unless conditions x, y, and z exist...')

      That's not to say that I ever think it will be impossible for a sufficiently motivated person to rip a movie (or indeed, circumvent any level of DRM), but that a simple-but-useful historical feature like Print Screen could easily become a casualty of the DRM war.

      --
      "Ladies and gentlemen, my killbot features Lotus Notes and a machine gun. It is the finest available."
    23. Re:hrmm by hcob$ · · Score: 1

      Why hack the OS when you can get the OS owner to add that "security feature" for you, and thereby lock out 90+% of the world?

      --
      Cliff Claven
      K.E.G. Party Chairman
      Founding Leader of: Koncerned for Egalitarin Governance
    24. Re:hrmm by kimvette · · Score: 4, Insightful

      I don't know about your computer but on mine the printscreen function isn't exactly speedy, neither in Windows nor in Linux. I doubt 24fps or 30fps is doable with such a script. Right now DVDs can be ripped and transcoded faster than realtime.

      The best solution is to crack the new encryption (worst case use brute force harnessing setiathome-style P2P networks to speed up the process), obviously.

      Why would I want to it cracked (I'm not the one to crack it, I'm no cryptographer)?

        - I run Linux. I should not be locked out of media I purchase over the counter? Sure, you'd argue I dual boot my system, so why not reboot to Windows? Well, I have booted Windows MAYBE three times this year, twice to pull files from my telephone and once to run OCR (since gocr and orcad suck).

        - When I buy a DVD, CD, or Foo-DVD, I OWN that copy, and short of commercial redistribution of copies, I can legally do pretty much whatever I want with that media and the content, providing it is within Fair Use guidelines. Viewing on Linux is fair use. Transcoding for viewing on my crappy old iPaq is fair use. Ripping and transcoding to keep a copy on my computer's HDD is fair use. Giving copies away is a grey area and not so clear cut. Commercial distribution of those copies is right out, well outside of the realm of Fair Use.

        - I run CRT monitors since LCDs atill lag behind in resolution, color purity, and contrast ratio. They may be desk estate and power hogs, but (at the high end) they're superior to LCDs in many ways at this time. I should not be forced to view content at standard definition 720x480 or 640x480 because I have a higher-end monitor which lacks DVI and therefore no HDCP. Ditto for the television I'll be buying - the one I want with a sufficiently high contrast ratio, image quality, and a plethora of inputs (and is NOT Sony) lacks HDCP. Why should I be forced to view downsampled content?

      MPAA: If you do lock users out of legally-purchased content, you do so at your own demise. I for one will not purchase DRM media where the DRM cannot be stripped off and recoup my Fair Use rights to PURCHASED content (that's right, it's PURCHASED, not LICENSED, you MPAA asshats). You will be creating a pirate market the likes of which you have never imagined, because when you fuck over your LEGITIMATE paying customers, they compare the two options and see that they are better off engaging in copyright infringement than paying for a crippled product. I'll become one of those pirates the day you kill off DVD. Right now I buy, on average, anywhere from 5 to 15 DVDs a month - my collection in the last few months has quickly grown from under 150 to over 300, to the point where I can't even keep all the rips on my computer any more. I'm the kind of customer you don't want to alienate because I am a PAYING customer and I purchase a lot of movies (I hate rentals). If I download a commercial work, it's to preview it to decide whether or not I want to buy it (e.g., THX-1138, which I wasn't sure would interest me, but ended up liking so I purchased it). You'll be losing me as a customer if you follow through on this in your quest to get perpetual copyrights and eliminate fair use. In other words: Fuck you, MPAA.

      --
      The Christian Right is Neither (Christian nor right). See: Matthew 23, Matthew 25, Ezekiel 16:48-50
    25. Re:hrmm by tolan-b · · Score: 1

      "With video and audio there will always be some stage where the material is in it's raw format and in a memory buffer."

      With the next round of HD devices that occurs in the display device, so you're going to have to get out your sodering iron to rip it.

    26. Re:hrmm by The+MAZZTer · · Score: 1

      You can always code a program that does the following:

      • Records from Stereo Mix (aka What You Hear) to capture the audio of the movie, mutes all channels that don't contain said audio.
      • Monitors the window of the media player to capture each frame. Might also set the process priorities of itseld and the media player high to prevent frame skipping.

      Of course, this is the most extreme way you'd un-DRM video. More likely you'd be able to convert it SOMEHOW, or crack the DRM on it with some tool. If it uses standard codecs you could even reencode it with ease.

    27. Re:hrmm by Anonymous Coward · · Score: 0

      I cannot believe this kind of drivel has been posted on slashdot (ok, I can but its fun to rant..) What THE HELL ARE YOU LOT TALKING ABOUT.. I can just imagine this great automated nodding duck that presses the PRT-SCN button, shit I should start selling them on eBay right now, £9.99 and you get 5 frames a second.. £19.99 and you get the full 30.. (getting it to nod that fast would take some mechanics..)

      Has anyone thought that perhaps reading from the screen-buffer is about as simple as it gets for any decent programmer? Or (knock me down with a stupid brick) rewrite the low-level drivers to take the data direct (3 days and counting for this to occur..)

    28. Re:hrmm by Tikicult · · Score: 0

      not to mention syncing the audio!

    29. Re:hrmm by ocbwilg · · Score: 1

      Of course, you're sacraficing quality. But you hit the nail on the head when you said that. It just wouldn't be worth it. Firstly, it would probably take a week. Secondly, Sound synchronization would prove to be hard to say the least, and finally, NOONE would want to do this. The 'time-spent: money-gained ratio' would be horrible.

      I don't know if you're aware of this or not, but computers are very good at doing extremely dull, repetitive, and time consuming tasks that would take humans weeks to accomplish with little or no user intervention. In reality, the most complicated part of pirating a movie this way would be synchronizing the audio track with the images, and that is already done on a daily basis by thousands of people who work in video production. You can probably do it with off-the-shelf consumer-level video production software. In other words, the entire process of grabbing the image and audio data, synchronizing it, and producing a DVD with it is trivial. Especially if you could sell a couple thousand pirated copies.

    30. Re:hrmm by Anonymous Coward · · Score: 0

      I remember that there was a similiar tool for DVD movies before they were fully cracked.

    31. Re:hrmm by Khyber · · Score: 1

      Already one out there - VirtualDub - create a frame relay server and audio relay and do as you please - I've been doing this for years, now.

      --
      Still waiting on Serviscope_minor to wake up to fucking reality and realize that Jessica Price isn't going to fuck him.
    32. Re:hrmm by DrXym · · Score: 2, Interesting

      This is kind of a stupid exploit all right. Yes it's possible to capture screen, just as it's possible to do the same with every e-book. The next question is who is going to bother to do it. It seems far easier to just hack the software player, or wait for the inevitable dongle which streams HDCP to any device of your choosing. That's even assuming your average pirate would even be bothered to go to those lengths. I'm sure even a downsampled image on a non-copy protected device is more than adequate for viewing and ripping purposes.

    33. Re:hrmm by agallagh42 · · Score: 1

      "NOONE would want to do this"

      Well if this guy Noone wants to do it, I say let him! Not sure who he his, but he must have quite a bit of time on his hands.

      Or did you mean "no one"? Hmmmm...

      --
      Carpe Cerevisi - Seize the Beer
    34. Re:hrmm by JPribe · · Score: 1

      Ok, so here is the deal: not a bit of the content is worth it. I won't be upgrading my entertainment system, in fact it'll probably get sold off because I don't want to have to have a stack of 6 DVD players sitting in my living room so I can play "dvd roulette" trying to figure out which generation of DRM the disc has so I can decide which of the players to put it into(nothing will be backwards compatible because I could buy a $5 chip from someone in Hong Kong and solder two pins into the DVD players board somewhere.) The music isn't worth it either, hell Beethoven sounds great in MIDI format, so screw bands that get record deals with a major label. Looks like I'll be going 100% indie soon. I have no intention of giving any of the morons my $$$. It won't happen. No movie or song is that good that I should sacrifice my right to watch it whereever, however and on whatever I want. I won't bother trying to bypass it because the RFID tags on everything and the mic in my "netOS" appliance know I hadn't purchased the content and heard it play in my house...so I can expect the Feds to show up and send me to jail for 15 years (extreme paranoia.)

      And the children, think of the children! Their parents will end up buying a new Warner Brothers badged mini-van to keep the in-car DVD player up to date for watching the latest shit to come out of hollywood (they won't even think of simply buying a new DVD player, you can thank the automakers marketing gimmicks for that in 2013)...but they won't be able to afford the movies because they are still paying on the last two mini-vans that they got upside down on the loans with.

      Bottom-line: it is crap, garbage, and I won't deal with it. Too bad most consumers will simply bend over for all of it. I give up

      --

      Why go fast when you can go anywhere? O|||||||O
    35. Re:hrmm by Ragingguppy · · Score: 1

      hmmm..... I'd say the best way to deal with HD DVD is at the consumer level. If you don't buy it they can't thwart DVD's. They won't thwart regular DVD's if no one recomends it no one will buy it. Consumer back lash is the best way to go about it. That could be a hack too. I personally have to intention to buy an HD DVD player any time soon. The movie industry should understand the hacker community are the early adopters. They are the people who adopt a technology and then get other people to use it. If the hackers don't adopt the technology no one will ever hear about it.

    36. Re:hrmm by Anonymous Coward · · Score: 0

      Thats what I was thinking. If it just takes you time to rip it and set it up then you havn't spent any money. And if they are going to be selling for $50 a movie then there is going to be profit made for selling them a little over the cost of the disk to burn to.

    37. Re:hrmm by adamlazz · · Score: 1

      Heh. I actually found this mistake much after I posted that comment.

    38. Re:hrmm by Anonymous Coward · · Score: 0

      As first post, I'm assuming you made similar use of a certain other button (F5).

    39. Re:hrmm by Kosmatos · · Score: 4, Interesting

      Now with virtualization technology, where the OS is running virtually, or in VMWare, you'll be able to do a "Print screen" at a higher level than the OS, so it shouldn'T be a problem.

      --
      I'm your huckleberry
    40. Re:hrmm by Dun+Malg · · Score: 2, Interesting
      But how long would it take to create a program that does it and syncs the audio as well?
      Syncing audio is trivial. You know that clapper thing they use in filming that has the scene, shot, and movie name? The actual clapper bit is traditionally used to sync the audio with the picture (though digital filming has largely rendered the clapper obsolete). For a finished movie where they've (obviously) edited out the lead-in where some PA snaps the clapper, you need only find a scene where someone is slamming a door, hitting a table, or otherwise making a real (not foleyed in, like a gunshot) sharp, percussive noise. Line up the noise with the motion and the whole movie will be in sync.
      --
      If a job's not worth doing, it's not worth doing right.
    41. Re:hrmm by illumina+us · · Score: 1

      Screen Capture. Sleep. Write. It will take forever, but you can cap all of the images and reproduce a 24-30FPS stream.

      --
      -illumina+us "I put on my robe and wizard hat..."
    42. Re:hrmm by Anonymous Coward · · Score: 0

      Great post, and I agree with you 100%. The only thing I see is I think you remember "fair use" as it used to be. It's been pretty much gutted recently.

    43. Re:hrmm by Temsi · · Score: 1

      I think everyone here is missing the point.
      The point being that the studios are being ridiculously paranoid, with all these stupid DRM schemes.
      The fact is, if you can see it, you can record it.
      There is another way too. Get a nice 9"CRT projector or a 1080p DLP projector, project onto a nice screen and set up your HDV camera and hit record. Presto, a homemade "cam".

      Where there's a will there's a way. There's always going to be a way of "stealing" content (even if the "stealing" is simply in the form of transferring content you've already purchased onto another medium for home use, such as a media center).

      To me, the article is sarcasm.

      --
      -- This sig for rent.
    44. Re:hrmm by negativerad · · Score: 2, Funny

      Geeks make new software, geeks crack new software, any questions report to nearest geek.

      --
      God must be a civil engineer who else but a civil engineer would put a waste water outlet thru a recreational facility.
    45. Re:hrmm by Brian+Gordon · · Score: 1

      Why even consider memory buffers? Just "run the speaker output right back into the line-in" - pop your disc in a dvd player and run it to a good video capture card.

    46. Re:hrmm by Dun+Malg · · Score: 2, Insightful
      Of course, you're sacraficing quality.
      How? Does the image you're capturing somehow become less than what's on the screen?
      It just wouldn't be worth it. Firstly, it would probably take a week.
      24fps movie, even capping only 1fps will take a mere 48hrs. I'm sure you are aware of the myriad of little programs you can find that will "push the printscreen button" automatically. Did you really think anyone was suggesting you do it by hand?
      Secondly, Sound synchronization would prove to be hard to say the least
      The frames are assembled at 24 fps. Sound is recorded realtime separately. Synchronization is as easy as finding a scene with a sharp, percussive noise (e.g. slamming door) and lining up the sound with the picture. Now the whole movie is in sync. That's how they do it in real life editing film.
      and finally, NOONE would want to do this. The 'time-spent: money-gained ratio' would be horrible.
      You did think they were suggesting someone might do this by hand! HAHAHAHAHA!
      --
      If a job's not worth doing, it's not worth doing right.
    47. Re:hrmm by Mister+Whirly · · Score: 3, Funny

      Grammar Nazi
      Function: annoyance
      Etymology: English grammar, German Nazi
      smug pricks who live to point out minor flaws in other people's grammar

      --
      "But this one goes to 11!"
    48. Re:hrmm by itamblyn · · Score: 1

      ...which is why part of the DRM scheme calls for certified videocards and monitors. If Sony et. al have their way, they will control the data all the way from the disc to your eyes.

    49. Re:hrmm by slittle · · Score: 1
      I'm surprised that they haven't disabled the print-screen functionality in some way so that it's not possible to do this.
      They probably don't have to, really. Next-gen PCs will either have hardware accelerated HD playback, and/or hardware accelerated multi-layered GUIs in which the video plays in a protected layer. End result: screenshots work, but the part where the video is supposed to be is black. And of course if you have neither of these, you get to join the poor saps without HDCP/whatever enabled monitors: downgraded playback.
      --
      Opportunity knocks. Karma hunts you down.
    50. Re:hrmm by FredThompson · · Score: 1

      That only works with "clean" content. You can't serve frames if you can't decrypt them.

    51. Re:hrmm by Anonymous Coward · · Score: 0

      That's quite an understatement when you do the math: Avg. movie length of 100 minutes * frame rate 24 fps = 144,000 screen caps
      Who would even consider doing that? You'd have carpal tunnel in no time and pay more in medical bills than you would if you just bought used copies of the movies.


      Your math is good.
      Your grasp of reality leaves a lot to be desired.
      Ever hear of those 'computer' thingies?

    52. Re:hrmm by kevlarman · · Score: 1

      even today video is hardware accelerated. set windows media player to use all available hardware acceleration (the default i believe), then play a movie, pause it, take a screenshot, and paste it into mspaint, now start the movie again and alt-tab back to paint for a surprise.

      --
      A mouse is a device used to point to the xterm you want to type in
    53. Re:hrmm by MobileTatsu-NJG · · Score: 1
      I'm sure there's a way to stream the images onto a single large file rather than dealing with compiling millions of saved images.


      (A little over 100,000 images, not millions. :P)

      Question: Why save the images into one large file? What good is that, besides having a multi-gig file that takes forever to seek through?

      For the uninitiated: Sound syncing is not a problem at all whatsoever. Us digital video types assemble videos from individual images on a daily basis. Nothing to it.

      --

      "I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)

    54. Re:hrmm by piquadratCH · · Score: 3, Funny
      The best solution is to crack the new encryption (worst case use brute force harnessing setiathome-style P2P networks to speed up the process), obviously.

      If they guys who designed the copy protection have just the slightest idea of encryption, I'm afraid brute force is not an option. With key lengths of 256 or 512 bit, we couldn't get through the whole key space in a reasonable timeframe, even with millions of high end machines. And if we did, they would change it and we'd be back at square one.

      OTOH, this is the industry that brought us the disaster that is CSS, so there is hope that they fcked it up again and some russian hacker finds an easily crackable loophole once the system is out in the wild.

    55. Re:hrmm by Anonymous Coward · · Score: 0

      Actually, a very dark purple. I made a winamp skin that was made mostly of that color for video watching, and set my desktop and some screen elements to that color. It's nice for watching movies in certain situations.

      Anonymous because I'm lazy.

    56. Re:hrmm by 1u3hr · · Score: 1
      Who would even consider doing that? You'd have carpal tunnel in no time

      RTFA.

      Such a screenshot function could then be automated to produce copies of HD movies both from Blu-ray Discs and from HD DVDs picture by picture. As c't calculated, the performance of current PC systems is sufficient for a clean recording using this procedure.
    57. Re:hrmm by grant420 · · Score: 1

      "OTOH, this is the industry that brought us the disaster that is CSS, so there is hope that they fcked it up again and some russian hacker finds an easily crackable loophole once the system is out in the wild." Or Finnish hacker, as in the case of CSS.

    58. Re:hrmm by Anonymous Coward · · Score: 0

      ugh, ever herd of a computer? you know, those things made to take the manual work out of things? Screen capture every 1/30th of a second, pause, record, advance one screen, capture, record - doesn't seem so stupid now afterall does it?

    59. Re:hrmm by Fnord666 · · Score: 2
      The best solution is to crack the new encryption (worst case use brute force harnessing setiathome-style P2P networks to speed up the process), obviously.
      The simplest way to get the encryption key is to ask for it. Somewhere in the process will be an encryption key that must remain secret for the whole thing to work. Either take up a collection and bribe the person that knows it or create a shell corporation, license the technology and the key, then violate the contract and dissolve the company.
      --
      'The tyrant will always find pretext for his tyranny.' - Aesop's Fables
    60. Re:hrmm by deinol · · Score: 1

      Most informative grammer post I've seen on /.

      Someone mod parent up, I'm out of points for the day.

      --
      Got Apathy?
    61. Re:hrmm by nxtw · · Score: 4, Informative
      I don't know about your computer but on mine the printscreen function isn't exactly speedy, neither in Windows nor in Linux. I doubt 24fps or 30fps is doable with such a script. Right now DVDs can be ripped and transcoded faster than realtime.

      It takes about 1/10 of a second for me to hit print screen and paste the picture into Paint The screenshot resolution is 2560x1024. The blink in the cursor when the image is being copied is barely noticable. This is with a Intel Core Duo based system.

      That's all irrelevant though; if the image can be accessed so that print screen can put a copy in the clipboard, a program can access that image in memory and feed it into the video encoder directly.
    62. Re:hrmm by sharlskdy · · Score: 1

      From the interpretations of the DMCA I've heard, as long as any barrier is put in place, then that removes the burden from the manufacturer since 'casual' copying can no longer take place. The end user has to make a decision to override the copy protection, even if its as simple as disabling the 'copy to clipboard' function.

      Its like police tape around a crime scene. The tape doesn't stop you. Respect for the law stops you.

      (I'm not commenting on whether the law aught to be respected here.)

    63. Re:hrmm by The+Great+Pretender · · Score: 1

      If you take an infinate number of monkeys at an infinite number of computers, hitting the print screen button, then....

      --
      A positive attitude may not solve all your problems, but it will annoy enough people to make it worth the effort.
    64. Re:hrmm by dolson · · Score: 1

      There are quite a few frames in a movie, at least for me, when I get sick of taking screenshots after the 20th one. That means I'd be sick of taking screenshots after not even one second of a movie.

      My calculations estimate a 90 minute movie to have over 160000 frames. That's 159980 frames too many for me.

    65. Re:hrmm by paradigmdream · · Score: 1

      wasn't it a norwegian that crack css?

    66. Re:hrmm by drsquare · · Score: 1

      But then what about subtitles, menus, extra features etc? Print screen isn't going to get them.

    67. Re:hrmm by DrXym · · Score: 1

      Perhaps you are being contrary, perhaps you are being stupid. If you read what I said, you would realise there are far easier ways to accomplish the same thing than individually walking through a movie, one screenshot at a time.

    68. Re:hrmm by Anonymous Coward · · Score: 0

      No, thank you for not spelling 'Latin' correctly (latin?) while upbraiding the grammar challenged, thus inviting public ridicule.

    69. Re:hrmm by Slashdolt · · Score: 1

      He should of known better then that.

    70. Re:hrmm by Jonner · · Score: 1

      Wikipedia seems to think so.

    71. Re:hrmm by rpdillon · · Score: 1

      Its not a violation of the DMCA to circumvent the protection on a DVD (or BluRay, or HD-DVD) for purposes of fair use. It is a violation of the DMCA to distribute software which allows the user to circumvent the protection on said media, whether designed for fair use or not. If the mechanism protecting the media is trivial enough that the average user can circumvent it without sepcial tools, then all is well. But if it is as complex as CSS, and therefore requires a piece of software to execute that most people couldn't write themselves (DeCSS), then the DMCA steps in an legality becomes an issue.

    72. Re:hrmm by aardvarkjoe · · Score: 1
      There are quite a few frames in a movie, at least for me, when I get sick of taking screenshots after the 20th one.

      Of course you'd get sick of it. But if somebody paid you, say, $100 an hour, could/would you do it?

      The answer to that may be no -- I'm not sure I'd go for it either, despite the fact that it would be a massive improvement on my salary. But I'm sure that there are plenty of people who would.

      There are parts of the world where $5 or $10 an hour may be equivalent to $100 to you. Assuming that someone could process one frame a second (probably low once they get going), we're talking about 45 hours of work based on your numbers. If you were paying $10 an hour (probably way high), that's still less than $500 to rip the entire movie. It wouldn't be worth it to you, but it would be worth it to professional pirates.

      --

      How can we continue to believe in a just universe and freedom to eat crackers if we have no ale?
    73. Re:hrmm by Salden · · Score: 1

      Viewing on Linux is fair use

      Sure, if the Linux computer has the hardware and software to do so. It's a Blu-ray disk meant for a Blu-ray player. A drive is not a player alone. It needs software to view the media. If it's not available for Linux, then you do not own a Blu-ray player.

      The format is closed and the people who want to keep it closed have every right to do so. Just because you bought it doesn't mean you SHOULD be able to play it on a Linux computer.

    74. Re:hrmm by TubeSteak · · Score: 1
      It seems far easier to just hack the software player
      This *is* the hack for the software player.

      It works because the 1st gen players do software decoding instead of hardware decoding.

      It's why you normally have to turn off hardware video acceleration if you want the print screen button to actually capture video/DVD images.

      Asking "why" or "who's going to do this" misses the point. They're exploring what can be done.
      --
      [Fuck Beta]
      o0t!
    75. Re:hrmm by Dr.+Manhattan · · Score: 1
      The format is closed and the people who want to keep it closed have every right to do so.

      They have the right to try (however self-defeating the attempt may be). But we also have the right to try to crack it.

      (Well, we did until the DMCA...)

      --
      PHEM - party like it's 1997-2003!
    76. Re:hrmm by Yusaku+Godai · · Score: 1, Troll

      Actually, the parent poster who you're apparently making fun of for being a Grammar Nazi was not, in fact, being a Grammar Nazi at all. He was being a Semantics Nazi, as am I.

    77. Re:hrmm by DerKlempner · · Score: 1

      Grammar Nazi
      Function: annoyance
      Etymology: English grammar, German Nazi
      smug pricks who live to point out minor flaws in other people's grammar


      I believe the correct word to use is "whom."

      --
      UNIX: Find it, fsck it, forget it.
    78. Re:hrmm by westlake · · Score: 2, Interesting
      I run Linux. I should not be locked out of media I purchase over the counter?

      You are locked out if you are too stubborn to buy a decoder.

      --which will be offered by every Linux distro sold as an OEM systen install. Every Linux distro with the slightest chance for commercial auccess in the North American home market,

    79. Re:hrmm by badmammajamma · · Score: 1

      Try it. :)

      --
      Any man who afflicts the human race with ideas must be prepared to see them misunderstood. -- H. L. Mencken
    80. Re:hrmm by HoboMaster · · Score: 1

      It's not difficult, it's just time consuming.

      --
      Remember kids, tin foil doesn't work, so use LeadHat.
    81. Re:hrmm by smoker2 · · Score: 1
      Yeah right !

      When was the last time you edited something compressed with mpeg2 or mpeg4 ? If you have any cuts, you lose synch. And this idea is totally comprised of "cuts".

    82. Re:hrmm by Mister+Whirly · · Score: 2, Funny

      Main Entry: wet blanket
      Function: noun
      : one that quenches or dampens enthusiasm or pleasure

      --
      "But this one goes to 11!"
    83. Re:hrmm by kimvette · · Score: 1

      I'll be perfectly happy to pay for such a decoder providing that I retain the ability to exercise my rights as defined under fair use, such as making backups, format shifting, and so forth.

      --
      The Christian Right is Neither (Christian nor right). See: Matthew 23, Matthew 25, Ezekiel 16:48-50
    84. Re:hrmm by Vexorian · · Score: 1

      Decoders will get eventually done. If a dvd player can read it any program can. Only reverse engineer is required it is not like it will be hard to be done by the people that are used to decode video formats. VLC player can currently play even flv videos.

      Even if that's not possible, one can always do something with the propietary video players to send the video output to a 'friendly' format encoder app instead of the screen.

      --

      Copyright infringement is "piracy" in the same way DRM is "consumer rape"
    85. Re:hrmm by NeMon'ess · · Score: 1

      Why would it look like shit? The movie would probably be recompressed with H.264 to fit on a DVD-9, possibly at 720p or maybe still 1080p, but it will still look damn good, despite some compression artifacts at 1080p.

    86. Re:hrmm by Anonymous Coward · · Score: 0
      Screen Capture. Sleep. Write. It will take forever, but you can cap all of the images and reproduce a 24-30FPS stream.


      But this is still not an exact duplicate of the original work. If you leave it uncompressed, the output is identical, but the disk usage is out of control. If you recompress it, you introduce new artifacts that reduce the quality.

    87. Re:hrmm by NeMon'ess · · Score: 1

      One 24th of a second is 41.667ms. Re-syncing the video with the audio comes down to having two monitors, and possibly two computers. Play the original on one screen, and the rip on the other. Have two sets of speakers, or just use headphones with one audio output on the right side, and the other output on the left. Getting the audio within 1 second is a piece of cake based on listening to dialog or drum beats. Getting within half a second just takes a little concentration paying attention to when a gunshot happens, or again the beat of a drum (no not a kick one). Getting it down to exactly which frame just means using AVI-MUX and delaying the audio by 42ms steps until it's perfect. Of course I'd probably start with 200ms steps and zero-in from there.

      It might take about an hour, but it's not hard.

    88. Re:hrmm by corychristison · · Score: 2, Insightful

      Oh, so you mean pull a Microsoft?

      ... sorry. I just HAD to. :-)

    89. Re:hrmm by David+Gould · · Score: 2, Insightful
      But we also have the right to try to crack it.

      (Well, we did until the DMCA...)

      We still have that right, it's just being violated by a corrupt government.
      --
      David Gould
      main(i){putchar(340056100>>(i-1)*5&31|!!(i<6)<< 6)&&main(++i);}
    90. Re:hrmm by OverflowingBitBucket · · Score: 1

      Screen Capture. Sleep. Write. It will take forever, but you can cap all of the images and reproduce a 24-30FPS stream.

      Run it overnight on a spare PC if need be. Some copyright infringers sell their wares, so someone will step up, sell it, and down the chain people will hand it out to their friends for free.

      It'll probably reduce a lot of casual copying though.

    91. Re:hrmm by dnoyeb · · Score: 1

      To be fair it wont take forever. Don't use printscreen exactly. If printscreen can do it, then anything that can access the window handle can likely get all the data. Its part of windows design that allows such things as print preview.

      However, anyone that has encoded or decoded video on a computer knows that you may need an incredibly fast harddrive to keep up with 24 fps of unencrypted uncompressed 1280x1024 resolution x million color data being written to your drive.

      But of course the professionals will have no problems accomplishing this.

      The real truth is that it will be broken like everything else is broken, from the inside. Especially if they make the HDCP players or TV sets in China...

    92. Re:hrmm by tylernt · · Score: 1
      I don't know about your computer but on mine the printscreen function isn't exactly speedy, neither in Windows nor in Linux. I doubt 24fps or 30fps is doable with such a script.
      Er no, you have your DVD player software pause, screen cap, advance one frame, screencap, advance one frame, screencap, etc.

      Then you go back through and play it normally to get the audio.
      --
      DRM 'manages access' in the same way that a prison 'manages freedom'
    93. Re:hrmm by Antique+Geekmeister · · Score: 1

      That's part of Trusted Computing's jub: it's real commercial purpose seems to be aimed not at protecting users from attack, but at controlling their authorized use of software tools. This is reasonable for software updates, but it seems to be particularly focused on DVD and CD software: disabling the "printscreen" should be quite easy in such an encyption and software encryption burdened configuration, especially to prevent the use of any DVD players not authorized by the DVD vendor.

    94. Re:hrmm by mrchaotica · · Score: 2, Informative
      The format is closed and the people who want to keep it closed have every right to do so.

      THE HELL THEY DO! The only reason the laws "protecting" their closed format exist is to promote innovation in progress. Closed formats impede progress, therefore "IP" laws cannot (either Constitutionally or morally) protect closed formats!

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    95. Re:hrmm by mrchaotica · · Score: 1

      I will not be perfectly happy to pay for such a decoder, because my Fair Use rights are supposed to guarantee the right to reverse-engineer the thing (and therefore make a Free Software decoder) to begin with!

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    96. Re:hrmm by Anonymous Coward · · Score: 0

      Go Fraps on a large Raid 5

    97. Re:hrmm by justthinkit · · Score: 1

      I am able to cut out unwanted parts of the DivX files my D'zign DV-5 creates, then resave the file and A/V is still synced. But maybe you were implying that DivX format would not be good enough?

      By the way, anyone know where to get batteries (or any kind of support/service) for the DV-5? The 'official' web link has email addresses that bounce, etc.

      --
      I come here for the love
    98. Re:hrmm by govtpiggy · · Score: 1

      I'm just assuming that this app is designed for Windows. Windows does a lot better dealing with a single very large file than a ton of smaller ones.

      --
      do you know squarepusher?
    99. Re:hrmm by MobileTatsu-NJG · · Score: 1

      Depends on what you mean by 'large'. I recently worked with 5 gig .AVI files in Windows XP. Once I got 20% of the way in, the app started slowing down tremendously. I don't know if the fault was within Windows or After Effects, but somewhere along the lines seeking to the latter frames becams a huge time sink.

      --

      "I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)

    100. Re:hrmm by mgblst · · Score: 1

      Has everybody who used to know about computers just left slashdot and gone somewhere else? You do realise all you would do is run a program before you play the movie, play the movie, stop the program and it will automatically have created the decrypted movie in high resolution for you. It is not really that much trouble. And we can do this now, rather than wait. The point is, that they left a hole in their secure system, and there are probably many holes - so they should just stop wasting everybodies time, and forget the whole thing.

    101. Re:hrmm by Anonymous Coward · · Score: 0

      C'mon... What happens?

      Can't be arsed to start up VPC.

  2. For that matter by utopianfiat · · Score: 0, Redundant

    You could just hook up your DVD player to a VHS recorder. Ever think of that?

    --
    +5, Truth
    1. Re:For that matter by hunterx11 · · Score: 2, Informative

      This doesn't work well even with regular DVDs. Ever think of Macrovision?

      --
      English is easier said than done.
    2. Re:For that matter by utopianfiat · · Score: 1

      True- Macrovision was a problem.
      However I'm sure that somewhere someone will make a TV that allows you to pass output after the stream was decrypted. They did it with the DVD...

      --
      +5, Truth
    3. Re:For that matter by Anonymous Coward · · Score: 0

      Certain types of high-end tape recorders (editing quality) completely ignore macrovision output, or allow you to enter your own black level signal.

    4. Re:For that matter by larytet · · Score: 1
      what about replacing OS driver and hooking the DMA transactions ? DVD controller should decrypt the disk at some point ? or this is done in software ?

      if DVD controller decrypts the picture (most likely option) we have decrypted content in the RAM. Hook in the OS driver solves the problem of exact "copy"

      if the decryption is implemented in software of the player - reverse engineering of the player will do the trick.

      Interested parties will probably attempt to forbid selling Blu-ray/HD-DVD with decrypting chip for the desktops.

    5. Re:For that matter by Lehk228 · · Score: 1

      you can do some hardware hacking to demacrovision a VHS recorder

      --
      Snowden and Manning are heroes.
  3. form. This "front" is obvious. by yagu · · Score: 4, Insightful
    problematic for other reasons

    This copy protection quagmire (we need to come up with a withdrawal plan)... it creates problems in other ways on other fronts.

    Consider the long discussed issues in general with DRM and DRM's interference with easy adoption of new (and really potentially very cool) technology for consumers. This has been discussed to death on slashdot as well as other forums -- and remains one of the foremost threats to the success of HD in any

    What may be less obvious is what starts to happen when these tiny holes appear in the digital dike, and the industry discovers they're gaping holes, and the patching begins, to the detriment of other accepted technology.

    In the case of this described "hole", a screen print? This becomes the DRM's worst nightmare? If they succeed in lobbying the PC industry and others and get this hole blocked, all of a sudden a long-accepted practice, i.e., screen printing, becomes suspect and may even be taken away as an option because it is potentially used for pirating.

    Don't discount the possibility this could happen. A few years ago all may have pooh-poohed the idea as preposterous because computers just plain old didn't have the horse power and storage to pull this kind of feat off. Today they do. And if someone does start pirating DVDs this way it would be predictable the MPAA could go after that technique, maybe successfully.

    Unintended consequences. I would find it highly objectionable to see the capabilities of my computers to expand and my ability (or permission) to use those capabilities diminished.

  4. Work Around by neonprimetime · · Score: 1, Funny

    I was trying to view this story but it kept telling me ...

    Nothing for you to see here. Please move along.

    But I found a work around!

  5. My finger is going to be sore by WinDOOR · · Score: 0, Redundant

    Copying The DaVinci Code frame by frame

    1. Re:My finger is going to be sore by neonprimetime · · Score: 5, Funny

      If you spill soda in the exact spot right under the Print Screen button, it becomes much easier.

    2. Re:My finger is going to be sore by WinDOOR · · Score: 3, Funny

      Or I can get one of these

    3. Re:My finger is going to be sore by andrewman327 · · Score: 1

      I hope that you remember what happened when Homer tried to control the Springfield Nuclear Power plant with that device in "King Sized Homer."

      --
      Information wants a fueled airplane waiting at the hangar and no one gets hurt.
    4. Re:My finger is going to be sore by WinDOOR · · Score: 1

      Best episode EVER

  6. FP by Anonymous Coward · · Score: -1, Offtopic

    FP

  7. Get right. by RedOregon · · Score: 4, Insightful

    Hollywood didn't implement squat.

    They browbeat/bribed the companies that developed the software to implement it.

    Splitting hairs, maybe, but Hollywood would have trouble implementing a flush toilet.

    --
    Skivvy Niner? Email me!
    HEY! Look left just ONE MORE TIME!
    1. Re:Get right. by Anonymous Coward · · Score: 0

      Toilets & Hollywood & Crappy movies... There is a joke in there somewhere.

    2. Re:Get right. by MisterSquiddy · · Score: 1

      "Splitting hairs, maybe, but Hollywood would have trouble implementing a flush toilet."

      But at least they'd remember the horizontal mirror, eh?

      *knowlingly taps nose*

    3. Re:Get right. by Ours · · Score: 5, Funny

      Splitting hairs, maybe, but Hollywood would have trouble implementing a flush toilet.

      What a shame, with all the crap they come up these days they would sure have good use for it.

      --
      "You superiour intellect is no match for our puny weapons" - The Simpsons
    4. Re:Get right. by gsslay · · Score: 1
      Hollywood didn't implement squat.

      And yet they made the film you want to copy. Hmmmmm....

    5. Re:Get right. by Anonymous Coward · · Score: 0

      So...you're saying Sony Pictures had to browbeat/bribe Sony Electronics into implementing Blu-ray with DRM?

    6. Re:Get right. by mgblst · · Score: 1

      I think they like the system they have at the moment - ship it direct to movie screens.

  8. lots of pictures by ZachPruckowski · · Score: 0, Redundant

    30 frames/sec * 60 seconds/minute * 150 minute movie = 135000 pictures, no? That's an awful lot of times pushing the print screen button. Even if you can "print" to an image file, and use a script to "push" the button continuously, once you factor in reassembling it, that'll still take a while.

    1. Re:lots of pictures by paradigmdream · · Score: 2, Insightful

      and you would still have to rip the audio stream and add that in

    2. Re:lots of pictures by RedOregon · · Score: 3, Funny

      Not with a beowulf cluster!

      (sorry, I couldn't NOT do it.)

      --
      Skivvy Niner? Email me!
      HEY! Look left just ONE MORE TIME!
    3. Re:lots of pictures by jellomizer · · Score: 0, Redundant

      The wonders of hacking. If the print screen button works and it sends it to a file, hardware hackers will find what the button calles and call that directly. Then they find the location,software that does the final dump. That way they can avoing hitting the button and probably in 3 or 4 hours they can get a perfect backup.

      --
      If something is so important that you feel the need to post it on the internet... It probably isn't that important.
    4. Re:lots of pictures by redmond_herring · · Score: 2, Informative

      30 frames/sec * 60 seconds/minute * 150 minute movie = 135000 pictures, no? That's an awful lot of times pushing the print screen button. Even if you can "print" to an image file, and use a script to "push" the button continuously, once you factor in reassembling it, that'll still take a while.

      Do you really think that no one will write a quick script to do this automatically???

      --
      Stephen Colbert on race: "While skin and race are often synonymous, skin cleansing is good, race cleansing is bad."
    5. Re:lots of pictures by psybre · · Score: 1

      Considering 135000 "pictures," you gotta really feel for the CGI artists ... its a bit more time consuming (but a lot more fun) than pushing a button.

      ~ psybre

      --
      Authority questions you. Return the favor. -- d474
    6. Re:lots of pictures by Lehk228 · · Score: 1

      the audio stream can be captured with a simple line out line in loop with either one or two machines

      --
      Snowden and Manning are heroes.
    7. Re:lots of pictures by l3v1 · · Score: 1

      30 frames/sec * 60 seconds/minute * 150 minute movie = 135000 pictures, no? That's an awful lot of times pushing the print screen button. Even if you can "print" to an image file, and use a script to "push" the button continuously, once you factor in reassembling it, that'll still take a while.

      And christ you got modded +4 informative for that line :D Oh, never mind, since not every moderating user is it-related. So what do you think, if you really think about it, how much coding it takes to capture a screen area into a video with 2x/30 fps ? Rrrright. So, again, what's with that "print" and "push" ?

      --
      I am putting myself to the fullest possible use, which is all I can think that any conscious entity can ever hope to do.
    8. Re:lots of pictures by ZachPruckowski · · Score: 1

      The wonders of hacking. If the print screen button works and it sends it to a file, hardware hackers will find what the button calles and call that directly. Then they find the location,software that does the final dump. That way they can avoing hitting the button and probably in 3 or 4 hours they can get a perfect backup.

      I was never expecting someone to manually hit that button. But w/ 270,000 images at 1080p (forgot that HD was 60 fps), that's a lot of processing power. Probably more than 3 or 4 hours on anything short of a workstation.

      Remember that all DRM has to do is dissuade enough pirates. It'll never get every pirate, but if it's 20% less convenient to pirate, there will be a bigger than 20% drop in pirates. If you're waiting two-three weeks post-DVD release for a pirated copy (instead of 2 days), you'll just rent the darn thing.

    9. Re:lots of pictures by hotdiggitydawg · · Score: 1

      ...or, with custom hardware, you could save yourself hours of coding effort. I'm off to by shares in a drinking-bird company!

  9. Oh No! by JamesP · · Score: 5, Funny


    1 - Shift key - DMCA circumvention
    2 - Print Screen - DMCA circunvention

    Let's hope they don't take our entire keyboard to protect their stuff from the thieves...

    --
    how long until /. fixes commenting on Chrome?
    1. Re:Oh No! by Anonymous Coward · · Score: 0

      As long as they don't take away my PLAY button.

    2. Re:Oh No! by sethstorm · · Score: 1

      It'll be replaced by the "PAY" button.

      --
      Twitter supports and protects racists - by smearing their critics with the "Hate Speech" label.
    3. Re:Oh No! by juan2074 · · Score: 1

      Try a black marker.

    4. Re:Oh No! by Alsee · · Score: 1

      In related news, Senator Orrin Hatch has introduced legislation requiring all keyboards be reduced to a single Allpurpose-Notifier-for-You key.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  10. Hmmmm.... by Anonymous Coward · · Score: 0

    Yes I will spend hours hitting print screen frame by frame so that I don't have to buy the DVD. TAKE THAT MPAA HAHAHA SUCKERS

    1. Re:Hmmmm.... by mccalli · · Score: 3, Funny
      You see, on a computer you can run these things called 'programs'...

      Of course you don't hit print screen yourself, you get a macro package to do it for you and automate the whole thing.

      Cheers,
      Ian

    2. Re:Hmmmm.... by Anonymous Coward · · Score: 0

      *salutes Captain Obvious*

      I was going for the crazed MPAA-hater type, I'm always taken too literally :(

    3. Re:Hmmmm.... by Anonymous Coward · · Score: 0

      hmmm, "macro package."

      You must be new here.

      Welcome to Slashdot.

    4. Re:Hmmmm.... by mrchaotica · · Score: 1
      You see, on a computer you can run these things called 'programs'...

      Sure you joke about it now, but the copyright mafia is trying to "fix" that by slowly replacing general-purpose PCs with locked-down "Trusted [sic]" boxes that will only run "approved" software, such as the PS3 and XBox 360. After all, that's what all that Treacherous Computing and "software-as-a-service" stuff Microsoft is pushing is for...

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

  11. Printscreen? by dalmiroy2k · · Score: 4, Funny

    Printscreen?
    Give me a break, somebody please send a HD-DVD/Blu-ray drive to DVD Jon so he can start doing his stuff.

    1. Re:Printscreen? by jawtheshark · · Score: 1

      Wouldn't he become HD-DVD John (or Blu-Ray John), then? ;-)

      --
      Ahhh...the great dumpster continuum. Many a free computer will be found there. -- sowth (748135)
    2. Re:Printscreen? by localman · · Score: 1

      DVD Jon moved to the US, so I don't think he'll be doing any more of those little tricks :/

      Cheers.

    3. Re:Printscreen? by Anonymous Coward · · Score: 0

      All he did last time was in fact making the GUI part. Hell, I could make a GUI this time if someone does the rest.

      And then you shall all know me as "HD-DVD Anonymous coward"

    4. Re:Printscreen? by rmadmin · · Score: 1

      Will this make him HD Jon, or Blue-Ray Jon? Ray Jon?

    5. Re:Printscreen? by WilliamSChips · · Score: 1

      He continued to do them with iTunes

      --
      Please, for the good of Humanity, vote Obama.
    6. Re:Printscreen? by wbren · · Score: 1
      Printscreen? Give me a break, somebody please send a HD-DVD/Blu-ray drive to DVD Jon so he can start doing his stuff.
      Who do you think the "anonymous reader" was? Duh!
      --
      -William Brendel
    7. Re:Printscreen? by Yallis · · Score: 0
      All he did last time was in fact making the GUI part.
      The development was insignificant, he published the program and faced two trials. What have you done to protect our digital rights lately?
    8. Re:Printscreen? by ketamine-bp · · Score: 1

      if it's that he know it before hand, then i'd suppose you're right.

    9. Re:Printscreen? by TheoMurpse · · Score: 1

      Unfortunately, he now lives in the United States, and as such would be subject to its laws and mafias were he to crack the *VD encryptions.

    10. Re:Printscreen? by localman · · Score: 1

      Did he? He hasn't cracked iTunes 6 yet... I thought he did the old iTunes before he moved. Or perhaps he's just bored with that particular challenge having cracked it already.

    11. Re:Printscreen? by WilliamSChips · · Score: 1

      No, iTunes 6 is still uncracked(damn you, Apple). I don't know when he moved so I'm not sure.

      --
      Please, for the good of Humanity, vote Obama.
  12. Not really a backdoor by gasmonso · · Score: -1, Redundant

    I wouldn't necessarily call taking 2 trillion screen captures a great hack. Thats like filming the movie with a highdef camera off of your LCD and saying they left another door wide open! I'll be more impressed when some 16-year-old kid completely H4x0Rs the entire system and movies start flowing over eMule and Bitorrent. Until then, I'm not impressed.

    http://religiousfreaks.com/
    1. Re:Not really a backdoor by Anonymous Coward · · Score: 0

      Put that shit in a signature.

    2. Re:Not really a backdoor by Anonymous Coward · · Score: 0

      If he puts it in a signature, he can't PageRank-whore for his site now, can he?

    3. Re:Not really a backdoor by Chirs · · Score: 1

      Filming off your monitor is subject to all kinds of degredation.

      Capturing the printscreen output is subject to output colour adjustments and the quality of your decoder. Beyond that, however, it's perfect digital output in full resolution.

    4. Re:Not really a backdoor by duffahtolla · · Score: 1
      Thats like filming the movie with a highdef camera off of your LCD and saying they left another door wide open!

      Actually, they are already trying to plug that hole using Camera DRM

      "I tried to send a picture of my daughter to her Uncle Tim, but this window popped up saying it was blocked. I decided to print it out and mail it to him. There was a 14-page license agreement that printed out first that I had to fill out and fax to Sony so they could send me an authorization code to print out the picture."

      I also remember reading about a proposed DRM that consists of a watermark in the video stream that would disable future digital cameras. Cant find a reference for that, but I'm sure if it can be done, they will do it.

    5. Re:Not really a backdoor by duffahtolla · · Score: 1
      I forgot to add to the quote.. My bad.

      But the reference to a video watermark was true. Can someone find a reference?

    6. Re:Not really a backdoor by ratboy666 · · Score: 5, Insightful

      This *is* a backdoor. The digital data is in the frame buffer, but cannot be extracted (programs that are not trusted cannot be run). The Print Screen function is trusted, and so can run even with end-to-end crypto. The Print Screen function has access to the entire frame buffer. I don't know of another way to do this -- this one is actually brilliant.

      And, Print Screen can be scripted. The player can ALSO be "scripted". As in, pause, and single step ("consumer" features). As to the speed of such a utility -- I would estimate that the re-encode process for a typical movie would take around 400 minutes (on a "typical" high end PC, see next paragraph for the amount of data involved). Ripping the audio track is more difficult (especially in full 5.1+ glory), but the technology for that is known. Time for that is real-time. Pulling a figure out of my ass, I would think a usable rip would take 800 minutes.

      It's not "2 trillion" screen captures. It is a lot of data, though. At maximum resolution (1920x1080p) its 2 million pixels per frame. At 24bpp, that's 672 GB per hour (108,000 frames). The data HAS to be jammed through an encoder right away. This, of course, introduces new artifacts (its not going to be a "perfect" first generation copy). But its still going to be better than DVD quality.

      I believe that the keys for this software will be revoked, and the current users (if any) "upgraded".

      The point that this attack makes is that "DRM" is actually rather laughable. Your audience needs the decrypt keys, and yet can't be trusted with the decrypt keys... It just isn't stable.

      Ratboy.

      --
      Just another "Cubible(sic) Joe" 2 17 3061
    7. Re:Not really a backdoor by Anonymous Coward · · Score: 0

      I'm gonna downmod every post I see from that fucktard until he stops doing that shit. Hope other will do likewise. He can't whore for his site very well if all his posts are at -1.

    8. Re:Not really a backdoor by Anonymous Coward · · Score: 0

      The article mentioned writing a program to do that for you which would run in the backround while the movie plays. However, this is all moot because they still need to deliver the content to the people they are protecting it from. This means it will be broken, over and over. This time they can force you to patch it to watch new content which can invalidate your current key, if I understand this correctly.

      I wonder if Grandma is going to like taking her HD-DVD player back to the store each time some kid breaks the current copy protection scheme. I just can't wait until the firmware wars begin. You'll have one group of people, we'll call them hackers, who take it upon themselves to figure out the encryption scheme, not because they plan on pirating anything, but having to update your firmware every month gets annoying. They release an open firmware for a player, then the MPAA disables the key, the whole world has to update. Then they figure out a new key, and so on. It'll be just like the XBOX hacking scene, everyone knew which games included dashboard updates and people would avoid them until a new hack came out (the softmodders at least). Though it my understanding, I could be wrong that the keys are based on some sort of tree of priority, so if a specific key is invalidated, anything below it on the tree is too. Once the hackers find the root, or it gets leaked, things will get really interesting.

      The only real casualties in this are going to be the consumer. The grandmas without internet access who's eyes get glassy if you try to explain what a firmware update is. I think the burden on the consumer is enough to kill AACS before it really gets off the ground.

    9. Re:Not really a backdoor by Halo1 · · Score: 1

      Capturing the printscreen output is subject to output colour adjustments and the quality of your decoder. Beyond that, however, it's perfect digital output in full resolution.

      So is burning a protected iTunes song to an audio CD, which consequently can be ripped again to anything you want. Still, that doesn't stop people from complaining that the re-encoding will slightly degrade quality. So I bet the videophiles with their golden DVI cables running to their CRT monitors with 500MHz refresh rates won't accept this workaround...

      --
      Donate free food here
    10. Re:Not really a backdoor by kirun · · Score: 1

      Read the bottom of the page:

      BBspot is a satirical news and comedy source and meant to be funny. If you are easily offended, gullible or don't have a sense of humor we suggest you go elsewhere.

      --
      I'm scared of numbers that can't be written as a fraction. It's an irrational fear.
    11. Re:Not really a backdoor by kirun · · Score: 1

      Well, if you're going to correct yourself, then next time do it quicker so I don't look so silly!

      --
      I'm scared of numbers that can't be written as a fraction. It's an irrational fear.
    12. Re:Not really a backdoor by HTH+NE1 · · Score: 1

      Capturing the printscreen output is subject to output colour adjustments and the quality of your decoder. Beyond that, however, it's perfect digital output in full resolution.

      Which you'd have to re-encode with something lossy to make it manageable.

      --
      Oh, say does that Star-Spangled Banner entwine / The myrtle of Venus with Bacchus's vine?
    13. Re:Not really a backdoor by robosmurf · · Score: 1
      I believe that the keys for this software will be revoked, and the current users (if any) "upgraded".

      Actually, the linked story claims Toshiba says they do not expect the keys to be revoked, as this feature does not violate the AACS security stipulations.

      However, the article also claims Toshiba have announced 'upgrades' to remove this feature. This does raise the question though of if this feature is allowed, then why are they removing it?

    14. Re:Not really a backdoor by mlk · · Score: 1

      If you have an uber screen of gold-plated doom, why the fuck are you getting pirated stuff?

      --
      Wow, I should not post when knackered.
    15. Re:Not really a backdoor by Anonymous Coward · · Score: 0

      Hehe, your ending signature-not-in-signature-space sounded like a funny unexpected insult. :-)

    16. Re:Not really a backdoor by Anonymous Coward · · Score: 0

      You really don't have a clue do you?

      This is a backdoor better than some backdoor bandits porno movie.

      Its direct access to unencrypted data in perfect form, ready to encode into whatever you want. Hell, this saves them some effort during transcoding hahaha!

      Also, if you think ANYONE will be pressing the print screen key even once, its amazing you visit slashdot. The printscreen key just activates a *function*, computers automate functions, duuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuh as to what happens next.

    17. Re:Not really a backdoor by jafac · · Score: 1

      800 minutes + time and wherewithal to setup the scripting, download tools, avoid detection by the RIAA/MPAA/NSA. ..

      To gain a permanent (illegal) copy of a movie I really only want to watch once or twice.

      Seriously. I have a library of DVDs, I have bought legitimately, as I am sure most American consumers have. And frankly, if it's not something I haven't seen before, I can usually think of a lot of things I'd rather be doing with my time than re-watching a movie. Even a really, really good one. And if I want to re-watch something, aw hell, why not shell out the $15 for my own copy to sit on my shelf in my family room and collect dust for 5 years until I feel like maybe watching it again?

      I guess I just don't understand the impetus behind movie piracy. Sure. These HD DVD's aren't going to be $15. They'll be something like $60, right? And they'll RENT, of course, for - I'm guessing, the same $25/mo. memberships that you get other DVD movies for right now.

      --

      These are my friends, See how they glisten. See this one shine, how he smiles in the light.
    18. Re:Not really a backdoor by Dun+Malg · · Score: 1
      Capturing the printscreen output is subject to output colour adjustments and the quality of your decoder. Beyond that, however, it's perfect digital output in full resolution.

      Which you'd have to re-encode with something lossy to make it manageable.
      Who says? Maybe it'll stay as one multi-gigbyte file passed around via P2P. And for that matter, what's to keep one from compressing it using the same thing they use for HD-DVD/Blu-Ray? It's not like the original was compressed with a magic codec that vastly surpasses what we "mundanes" have access to.
      --
      If a job's not worth doing, it's not worth doing right.
    19. Re:Not really a backdoor by himurabattousai · · Score: 1, Insightful

      I have to agree. This is brilliant, and rather amusing as well. While definitely not a task for the masses, it does show that sometimes the best solution to a high-tech problem is a low-tech answer. Scripting "print screen--paste--save" for some ungodly number of frames certainly qualifies as low-tech, even primitive. And yet, the brilliance lies in the simplicity. As for the amusing part--how many millions of dollars and thousands of hours went into developing locks that can be picked with the repeated and automated push of five total buttons? I'll sleep well thinking about this one.

      --
      "osake no hou ga, biiru yori ii" to omotteiru.
    20. Re:Not really a backdoor by Anonymous Coward · · Score: 0

      DRM is just waste of money.
      Maybe Hollywood has some illusions on this matter as it's their money, but surely not Vole\Chipzilla. Even if they succeed and close the box - open boxes will be produced\exported\sold at Russia, China etc. It will especially give Russian tech a boost. what an irony.

    21. Re:Not really a backdoor by HTH+NE1 · · Score: 1
      Which you'd have to re-encode with something lossy to make it manageable.

      Who says? Maybe it'll stay as one multi-gigbyte file passed around via P2P.
      >600 GB per hour for uncompressed 1920x1080 video? Yeah, sure it will.

      And for that matter, what's to keep one from compressing it using the same thing they use for HD-DVD/Blu-Ray? It's not like the original was compressed with a magic codec that vastly surpasses what we "mundanes" have access to.
      Then it won't be a perfect digital copy anymore. You'll have introduced more lossage in the video quality than the studios did. Even if your codec is better than the studio's, you're still adding lossage on top of lossage.

      Better would be a perfect copy made of the original signal after decryption but before decompression.
      --
      Oh, say does that Star-Spangled Banner entwine / The myrtle of Venus with Bacchus's vine?
    22. Re:Not really a backdoor by mrchaotica · · Score: 1
      Still, that doesn't stop people from complaining that the re-encoding will slightly degrade quality.

      I'm one of those complainers, and I'll tell you why: it's not the quality that's important, it's the principle of the thing. I have a Fair Use right to make an exact duplicate (for backup purposes, etc.), and I refuse to give up that right whether I can tell the difference or not!

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    23. Re:Not really a backdoor by mrchaotica · · Score: 1

      You're not trying to infringe the copyright of it. You're merely trying to copy it to your media PC at full quality, as is your right by Fair Use!

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

  13. BWAAhahahaha by Anonymous Coward · · Score: 0

    Hollywood makes me L-O-L

  14. Never safe... Until by SirCyn · · Score: 2, Interesting

    No consumer content will be safe from copying until they can beam it straight into our heads.
    Both video and audio, you can always plug the output device into an input capture device and copy it that way. And with new digital transmission mediums the quality can be kept very high (compared to those who remember the VCR-to-VCR via RCA cables days).
    Not to mention that any encryption scheme that can be decoded can be broken. It's only a matter of time.

    1. Re:Never safe... Until by Lurker187 · · Score: 1

      And then they will sue all those with eidetic memory, and saying "Remember the car chase scene..." will be piracy.

      --
      [command INSERTWITTYQUIP failed: insufficient wit]
    2. Re:Never safe... Until by jawtheshark · · Score: 1

      No consumer content will be safe from copying until they can beam it straight into our heads.

      Well... No... If we could beam the images straight to our head, we would understand how the brain works. In that case it would be pretty much trivial to intercept the beam and re-encode it to normal images.

      --
      Ahhh...the great dumpster continuum. Many a free computer will be found there. -- sowth (748135)
    3. Re:Never safe... Until by Anonymous Coward · · Score: 0

      you can always plug the output device into an input capture device and copy it that way.

      Ummm, no. Heard of HDMI? The whole point of these new techs is going end-to-end encryption. You WONT be able to just plug something into the output if they get their way.

    4. Re:Never safe... Until by doti · · Score: 1

      Protection schemes make it harder, but not impossible, to break.
      You could even hack the output device to get the data after it's unencrypted.

      If you can play, you can copy.

      --
      factor 966971: 966971
  15. In other News by Anonymous Coward · · Score: 2, Funny

    the MPAA has started legal proceedings against keyboard manufacturers for their "Deliberate and malicious attempt to circumvent our government guaranteed profits."

    Also, Copyright Lawyers all over the planet needed new pants in order to cope with all of the involuntary orgasms.

    More news at 7.

    1. Re:In other News by the2cheat · · Score: 1, Funny

      In response to legal pressur from the MPAA, keyboard manufacturers have begun slowly removing keys, starting with thge function and printscreen buttons, and slowly makng their way to the tilde. They took my tilde, now I cannot cheat in Half Life 2! NOOOOOOO! But honestly, no one's gonna printscreen an entire movie.

    2. Re:In other News by Compholio · · Score: 3, Interesting

      They took my tilde, now I cannot cheat in Half Life 2! NOOOOOOO! But honestly, no one's gonna printscreen an entire movie.

      The concept of taking full-blown movies of your desktop is very old and is used a lot for computer training programs, it would be incredibly simple for one of those recording programs to record the video and audio of a playing movie and save it without the copy protection.

    3. Re:In other News by Anonymous Coward · · Score: 0

      Not manually, no, but I imagine it would not be too difficult to write software to do this for you.

  16. Real pirates DUPLICATE by erroneus · · Score: 5, Insightful

    To make "other" copies is too troublesome. As always, real pirates will use the means they always have. They will work "off hours" at DVD publishing sites making uncounted copies indistinguishable from the counted copies. They will have the production equipment in their homes to make exact duplicates.

    This is not about stopping piracy because these measures to nothing to address the two primary methods. What it does thrwart is casual consumer copying to better ensure that the consumers will buy multiple copies of the same stuff.

    What I am saying is not new and has been repeated since the creation of the first DVD format.

    1. Re:Real pirates DUPLICATE by Gat0r30y · · Score: 1

      Which in turn makes pirated copies more useful than genuine.

      --
      Prediction: The real iPhone killer is going to be sex robots from Japan. Think about it.
    2. Re:Real pirates DUPLICATE by Anonymous Coward · · Score: 0

      "What it does thrwart is casual consumer copying to better ensure that the consumers will buy multiple copies of the same stuff."

        These movie companies live and die on millions and millions of sales. It can only be 1percent or 0.1percent or less that buy anything on more than one format. A dvd in many regions? A movie for your PSP that you already own on dvd?

        Never going to happen. Every consumer things its a stupid stupid idea.

        I'll concede that everybody (nearly audiophiles excluded) dumped their vinyl for cds but once they have their cd that lasts forever who would want to buy 200 replacements for another 2000 dollars?

        Their model is flawed.

  17. On the Graphics card ram at some point by Anonymous Coward · · Score: 0

    Wouldn't it be easy to reprogram the PCI-Express graphics card to slave the images to another graphics card which would then output the full glory without protection?

    Unless they protect the image in memory we can always sniffz it :)

  18. Re:form. This "front" is obvious. by utopianfiat · · Score: 2, Informative

    Whatever happened to the "I bought the DVD, I should do what the fuck I want with it"?

    --
    +5, Truth
  19. You're kidding? by VlartBlart · · Score: 0

    Is it April fools day?

  20. If I recall correctly... by Anonymous Coward · · Score: 0

    On HDCP protected hardware, if you use PrintScreen, the frame will be completely blank (solid black).

    1. Re:If I recall correctly... by Sique · · Score: 1

      That was the way it was supposed to be. But the first software players available, based on WinDVD's decoder, don't black the screen at PrintScreen.

      --
      .sig: Sique *sigh*
  21. wrong by Anonymous Coward · · Score: 0

    any decent video app worth it's salt [hell, even blender, the 3d app] can treat a sequence of numbered images as any other animation file

    [that said, I'd expect them to be using video overlays to play hd video just like every other video player [except flash]... though I could see an option to not use an overlay as a fallback, I can't see any computer less than 10 years old unable to do video overlays]

  22. So you had to tell the world? by Jeff+DeMaagd · · Score: 2, Insightful

    Really, I resent the fact that some DVD players block image capture for the occasional still frame. I would hate to see the software players remove the feature from the high def software players because some clueless weenie had to announce it to the world.

    1. Re:So you had to tell the world? by Anonymous Coward · · Score: 0

      This is usually a side effect of the video overlay device and has nothing to do with DRM.

    2. Re:So you had to tell the world? by Lehk228 · · Score: 2, Informative

      disable video acceleration in the player settings and you can screen cap from any video player software,

      --
      Snowden and Manning are heroes.
  23. A stretch by jdwclemson · · Score: 1

    That really is a stretch, the analogy about the camera filming the screen nails it, at least that way you get properly synched sound. Speaking of which, you forgot to mention that you should open up sound recorder so you can capture the audio in sub par format as well. Of course there are applications that could be created and probably already exist that would allow the recording of each frame the computer displays. This would prove to be ineffective, inefficient, and probably low quality as well when you attempted to compile the frames for distribution. I know that we aren't big fans of the encryption features, but its probably not good use of Slashdot to fill its boards with absurdly obvious "hacks" that don't work.

    1. Re:A stretch by Anonymous Coward · · Score: 0

      If by sub par quality you mean almost perfect, far greater than dvd quality, then yes. Also the audio is a moot point because that can be pirated in a similar way in similarly good quality as this. What you are a failing to realize is that once the movie is decrypted it is stored frame by frame in memory. That memory can be dumped directly to a file with print screen. Therefore you can get a perfect (minus the degradation from compression, which on HD is minimal) copy.

  24. An exercise in futility by gweihir · · Score: 2, Interesting

    This just shows that whatever the content industry (not the content creators, btw) do to protect their distribution monopoly is doomed to fail. After all it requires just one good enough rip and the thing is out there. This specific security hole is extremely stupid, since the attack is one of the most obvious things to try. Even if ripping is harder and the domain of technology enthusiasts, distribution via P2P filesharing is easy and P2P filesharing is by now basically unkillable.

    Still I think there is hope: The stuff Hollywood had been producing in the past few years is now so bad, that soon it will not be worth the bandwidth and disk space to download it, let alone the time to look at it.

    --
    Most ACs are not even worth the keystrokes to insult them. Be generically insulted by this and ignored otherwise.
  25. Macrovision by dividedsky319 · · Score: 2, Informative
    You could just hook up your DVD player to a VHS recorder. Ever think of that?
    I'm sure they've thought about that as well... since you can't even do that with a current generation DVD player. If you go directly into the input jacks on a VCR, Macrovision protection will kick in and result in a scrambled picture or a picture that fades from dark to light. Details from Wikipedia

    Plus, what's the point of going back two generations? Sure, you could watch the movie, but you're not getting a high definition picture anymore... So why not make a copy of the regular DVD, which as we know are easy to rip/decrypt. Otherwise, it would be like going from a CD to an 8 track. And I don't think there's too many people out there doing that. ;-)
    1. Re:Macrovision by Viol8 · · Score: 1

      "Sure, you could watch the movie, but you're not getting a high definition picture anymore"

      Who cares? Most people I know including myself watch a film to see the story, not
      to go "ooooh , look at how many pixels its got!". I still watch VHS , doesn't bother
      me at all.

    2. Re:Macrovision by monkaru · · Score: 1

      There lays the "fly in the ointment". People can't see or hear in digital. Pure digital sound would be as appealing to a human as listening to a dial-up modem connect and pure digital video would be incomprehensible to us. So, at some point, the signal must be converted to analog. Screwdriver and solder time. For example, the leads to the speaker cones are analog even if the speaker box circuitry only accepts a digital signal.

    3. Re:Macrovision by radtea · · Score: 1

      Yet, anyways. It's still possible to break the chain somewhere and extract content. I'm guessing that'll always be the case too, at least for a good long while. Only way to get around that with what we have today would be if MS started selling PCs that are welded shut.

      Purists will get all in a knot about degraded signal quality, but in fact all you have to do is multiple capatures of an analog playback, do some averaging or other signal processing, and you can recover something that is pretty much arbitrarily close to the digital orginal.

      DRM is Just Plain Dumb(tm).

      --
      Blasphemy is a human right. Blasphemophobia kills.
    4. Re:Macrovision by blackest_k · · Score: 1

      Macrovision isnt hard to defeat,
      My DVR has no problems with me playing a DVD on my DVD player and recording it no macrovision problems there.

      When I do have Macrovision problems it is with VHS tapes so I bought a Time Base Corrector (less than $40) and with that inline I don't have a problem with Macrovision either, without it thou the DVR refuses to record hopefully I will find a firmware update that will improve the DVD recorder software. There are DVR's which can deal with macrovision in software.

      guess it won't be long before DVR's like mine will not exist.

  26. Those Idiots by frogstar_robot · · Score: 5, Insightful

    Now was not the time to splatter this information all over the world. If they had waited for wider deployment, this hole could have been kept wedged open as closing it on hundreds of thousands of clients wouldn't have been terribly practical.

    Remember would be DVD-Jons, if you find DRM holes in new media tech SHUT YOUR YAP UNTIL EVERYBODY AND HIS DOG HAS BOUGHT SOME. THEN RELEASE THE INFO. When you do release the information, do so complete with "mom friendly" utilities and use warez "spreaders" to be sure everybody and his dog can start using it right away. This also complicates shutting the hole in various social and technical ways.

    1. Re:Those Idiots by Anonymous Coward · · Score: 0

      You seem to have it backwards. If DRM holes matter to you, you will buy new media tech *after* DRM holes are found in them. If mom and dog buy the tech before, then obviously they didn't care about having DRM holes. Early disclosure is best: no need to keep the geeks waiting when their toy is ready.

  27. The Obvious Comment by SecretAsianMan · · Score: 0, Redundant

    Ooh, can I make the obvious comment?

    Oh boy, I can't wait until the MPAA takes away my PRINT SCREEN key!

    --

    Washington, DC: It's like Hollywood for ugly people.

  28. If Print Screen fails, a workaround by Revolver4ever · · Score: 3, Funny

    I'm just throwing out ideas here, but could a pirate with decent art skills redraw every frame of the movie on paper? A few thousand pieces of computer paper would be all that's needed. Staple it all together and BAM, sell on the subway corner for 2 bucks a pop. Piracy will never end!

    --
    If O2 is good, O3 must be 1.5 times better!
    1. Re:If Print Screen fails, a workaround by Hortensia+Patel · · Score: 1

      IIRC, the guy behind one of the early 3D modelling apps (Lightwave? Real3D? I forget) started out making 3D animated movies *by hand*. That is, by applying matrix transforms (using a calculator) to each point on each frame, plotting the transformed coordinates on graph paper, photographing the paper and arranging the photographs into a movie.

      They don't make graphics geeks like they used to...

    2. Re:If Print Screen fails, a workaround by cr0sh · · Score: 1
      IIRC, the guy behind one of the early 3D modelling apps (Lightwave? Real3D? I forget) started out making 3D animated movies *by hand*. That is, by applying matrix transforms (using a calculator) to each point on each frame, plotting the transformed coordinates on graph paper, photographing the paper and arranging the photographs into a movie.


      You must be remembering wrong...

      While I can believe this to be possible, I can't imagine why somebody would do this. It isn't like 3D graphics, transforms, etc is anything new. I was playing around with wireframe and solid modeling 3D graphics in BASIC back in highschool on an Apple IIe and a Color Computer 3 (ie, late 1980s), and I was far from the only person doing this. Wireframe 3D (in computer simulation) dates to far earlier - mid to late 1960s (though possibly even earlier than this - I do know of some really early animated 3D computer graphics being done on a plotter and then assembled into a film frame-by-frame - I think one was of a 2-axis sattelite orbit simulation) - with projects for flight simulation and early virtual reality (Sutherland's Sword of Damocles, anyone?).

      Since people have been dealing with 3D graphics for so long prior to the development of a desktop microcomputer (let alone a "personal computer"), I can't imagine why anyone would go to the trouble of creating a movie, by hand calculating transforms, after about 1977 or so (when the Apple II was introduced, thus making "high resolution" graphics more easily accessible to the masses - though hobbyists had long adapted S-100 bus computers for this task long before the Apple II), unless it was an art project or something. It isn't like such an exercise would likely lend itself to revealing any new insights into the art or math of 3D computer graphics, that couldn't be found out by simply plugging it all into a computer in the first place.

      So, no, they don't make graphics geeks like they used to - but on the other hand, they don't make geeks period like they used to, either - back when geeks used to remember history, instead of repeating it like they seem to do today...

      --
      Reason is the Path to God - Anon
    3. Re:If Print Screen fails, a workaround by Hortensia+Patel · · Score: 1

      You must be remembering wrong...

      Shrug. I might be remembering details wrong, but that was certainly the gist of the article - plotting by hand on graph paper and photographing.

      More to the point, I don't find the story so unbelievable. Perhaps as a kid he couldn't afford a computer. Perhaps at that time he was a graphics geek but not yet a computer geek. (Allen Hastings, one of the guys behind Lightwave and my prime suspect for this foggy memory, lists his background as fine art and music.) We tend to forget how easy it was to be completely unaware of things happening in other fields, back in the dark days before the internet. Carmack has said on the record that he had no idea how "real" 3D was done when he wrote "Doom", hence all that mucking about with polar coordinate systems.

      they don't make geeks period like they used to, either - back when geeks used to remember history, instead of repeating it like they seem to do today...

      Miaow.

    4. Re:If Print Screen fails, a workaround by mgblst · · Score: 1

      Maybe we could join this idea with the anti-scammers we met last week. Get a scammer to draw out a few frames of the movie each, utilise a few different scammers, combine into a movie and watch the money come rolling in. There are certainly enough scammers out there for a few hundred movies.

  29. hrmm-Doing the fanny-wave. by Anonymous Coward · · Score: 1, Insightful

    Well see now, the analoge hole argument ignores little details like that, and plays up the "see! see! you can't stop us from getting what we want". It's basically a game of one-upmanship, not of technical superiority.

    Of course everyone misses the point that DRM and other mechanisms isn't about stopping every "infringer", any more than having police is about zero crime. One just needs to keep the problem to the background noise level.

    1. Re:hrmm-Doing the fanny-wave. by rolfwind · · Score: 2, Insightful

      How is DRM going to keep it to background level noise when one crack is all it takes to spread it to the internet?

      DRM is less than useless right now because all it succeeds in doing is annoy real paying customers and teaching them the cracked versions are better after all. It's bad enough I am forced to watch the blue FBI screen everytime I watch a DVD (actually, on most anime, they are smart enough not to include that from what I have seen, but not Hollywood), and be dragged through several commercials if they are really sadistic - sometimes I have the feeling that the companies are intentionally promoting copyright-infringement with these tactics.

      That may change with TPM, but I have given up so much media by this point (TV, most Hollywood movies, RIAA Music, etc) that I won't bother buying anything more than anime unless they start producing an inferior product and blaming the audience for lousy sales. My time can be better spent learning, coding or doing some sport in the future.

    2. Re:hrmm-Doing the fanny-wave. by 1u3hr · · Score: 1
      How is DRM going to keep it to background level noise when one crack is all it takes to spread it to the internet?

      Thay can revoke the key of the software player. So it couldn't play any new movoes till you "upgraded' it to a new, crippled version.

      But real pirates will solve it in hardware.

  30. DMCA and Circumvention by Anonymous Coward · · Score: 1, Insightful

    Err... Isn't even this post a violation of the Digital Millennium Copyright Act and its anti-circumvention terms? The law basically says it's illegal for you to fix a design defect (like DRM). I believe it's also illegal to share information on how to point toward a way to fix a DRM problem. Hmmm....

    I can't believe prison is a threat for someone writing news like this. Too bad the poster of this news had to be anonymous to engage in free speech! Time to kill this stupid law!

  31. Yeah right by Britz · · Score: 5, Interesting

    So the new copy protection sheme is supposed to keep professinal pirates (the guys that copy the movie and then sell th ecopies in large quantities) from gaining a copy? Gimme a break!

    And it is supposed to be a hurdle to those "release groups" (the guys that compete with each other to be the fastest to release a movie to the p2p networks)? Yeah, right!

    This hole (and there will be others) is another prove that there is no protection against those two groups. They will simply find another way.

    But it puts a major obstacle in the way of paying customers that just want to watch movies. The movie studios don't realize it because there is no pressure from an alternative. That is also called a monopoly. And who is going to break it up? The movie industry and the record industry both seem to need a little "help" to get some competition back into their respective markets.

    1. Re:Yeah right by westlake · · Score: 1
      But it puts a major obstacle in the way of paying customers that just want to watch movies

      1. Family loads Walmart's $150 blu-ray player wirh Netflix HD rental.
      2. Family watches movie.
      3. The end.

      This scenario or one very much like it will play out in tens of millions of homes as HD media takes hold. The entire edifice which the Geek builds around his fear of DRM is the one which will collapse.

      I suppose you could reconstruct an HD movie frame by frame. Synchronize the lossless digital audio track. Repair the closed captioning, foreign language dialog and multilinguak commentary tracks.

      Reprogram the alternative camera angles. Deleted scenes. Etc. Recorded to one or more 50 GB disks.

      But why anyone sane would go to all that trouble when with one click in Vista, OSX, Xandros or Linspire, he could launch managed copy to HDD, archieve to an HD burner, and synch low-res feeds to portable players is beyond me.

    2. Re:Yeah right by Britz · · Score: 1

      How about the millions of lcd tvs sold with the HD Ready logo that don't have HDCP? How about the HDCP tvs tested that lost sync many times and had to start over. You scenario is bullcrap and the only reason why you shit it out here is because you don't have any idea what you are writing about. This is NOT dvd. The technology behind all these new "features" seems to be very complicated and we are still far from interoperation between devices from different companies like a Sony player with a Samsung display. Then there is Blueray AND HD ...

  32. DirectX recorder by cjb-nc · · Score: 3, Insightful

    DirectX recorders exist, primarily used for recording videos in games. I'm pretty sure most DVD player apps use the same directx layer, and so could easily be recorded by such a program. This is just an idea off the top of my head.

    Result: watch for the MPAA to start outlawing your favorite DirectX recorders in the near future. Seems they will always find it easier to prosecute the loopholes than to fix their own stuff.

    1. Re:DirectX recorder by Wesley+Felter · · Score: 2, Insightful

      Vista's Protected Video Path will presumably disable all such recorder software. DirectX recording may work on XP, but I suspect the XP-based HD-DVD/Blu-ray players will use "proactive renewal" where you have to install new DRM patches every month to keep up with all the hacks. These patches will probably incorporate PunkBuster-style scans for known "bad processes".

    2. Re:DirectX recorder by Lehk228 · · Score: 1

      with HDCP protected content the framebuffer would be encrypted so your fraps output would just be a bunch of static

      --
      Snowden and Manning are heroes.
    3. Re:DirectX recorder by Wesley+Felter · · Score: 1

      I'm pretty sure GPUs don't support encrypted framebuffers. HDCP is implemented in the refresh logic or the TDMS transmitter, after the pixels have already been read out of the framebufffer.

    4. Re:DirectX recorder by Lehk228 · · Score: 1

      that is what Trusted Computing is all about, it wouldn't even require that current hardware be altered if the computer reads and passes along the encrypted stream possibly adding a control channel of some sort so the computer can adjust the properties and playback without having access to the data stream itself

      --
      Snowden and Manning are heroes.
    5. Re:DirectX recorder by mrchaotica · · Score: 1

      And no current GPUs fully support Vista, either. This is not a coincidence.

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

  33. And just to make things easier... by Noryungi · · Score: 5, Interesting
    You can automate the whole process using the two software below:
    1. AutoIT to create a script.
    2. IrfanView to grab the entire screen and/or apply optional transforms to the captured image. This is optional, since AutoIT can probably send the "PrintScreen" command itself, and move the resulting file(s) into a capture directory.


    Just set your DVD software to play frame-by-frame. The rest is taken care of by the automated script. Sure, it may take a couple of attempts, but once you have the formula down, ripping an entire DVD movie should not take more than 4x or 5x the normal duration of the movie. Just let your computer run all night and you can have a brand new DiVX in the morning.

    Now, what I'd like to know is: how do you rip the soundtrack off those uber-protected DVD? Hook the DVD player to an MP3 recorder? Or do you use one of the software that pretends to be a valid sound card?
    --
    The right to offend is far more important than the right not to be offended. (Rowan Atkinson)
    1. Re:And just to make things easier... by Ant+P. · · Score: 1

      Most, if not all sound card drivers allow you to record the sound output directly. Failing that you can just plug the output into another PC's line-in.

    2. Re:And just to make things easier... by EnsilZah · · Score: 4, Interesting

      Software that pretends to be a valid sound card?
      We had a virrtualization story just four stories back, i'm thinking it wouldn't be that hard to modify an open source virtualization solution so that the video and audio output devices can be captured from.

      Wouldn't be that hard for someone who knows what they are doing that is.

    3. Re:And just to make things easier... by mynickwastaken · · Score: -1

      On Windows the DVD's can be played used DirectShow. In the Directshow all the pieces needed for DVD playback are set in a so called FilterGraph.
      You can Render a graph, intercept a pin (with a YUV or RGB) and drop it uncompressed to harddisk with a Dump Filter. You can even recompress them on the fly and Dump them in a DivX
      The audio you can intercept as well in the same graph and you will have it syncronized with the video.

      Anyway, whichever protection will be choose, the solution of puting a Video Camera ;-) in front of your PC Screen in a dark room is unbeatable. With additional post-processing you will get even better quality.

    4. Re:And just to make things easier... by Anonymous Coward · · Score: 0

      TotalRecorder. On Windows, anyway.

    5. Re:And just to make things easier... by eieken · · Score: 1

      Great, your little comment caused Auto-it to go down!

      --
      Meet new people, and kill them.
    6. Re:And just to make things easier... by Anonymous Coward · · Score: 0

      The soundtrack is going to be the same as the one on the standard DVD; perhaps pirates could rip the soundtrack off that? Sure, HD and Blu- have some fancier sound formats, but once it's a DiVX you won't be able to tell which source you used anyway...

    7. Re:And just to make things easier... by evilviper · · Score: 1
      Now, what I'd like to know is: how do you rip the soundtrack off those uber-protected DVD?

      Tell your HD-DVD software you've got a digital reciever that supports AC3/DTS/etc... Hook your soundcard's "digital audio out" to "digital audio in", and start recording the bits. You've got a bit-exact multichannel copy of the soundtrack in AC3/DTS/etc.

      It's even easier if you want a high-bitrate lossless audio track, as then you can copy the decoded LPCM stream, and re-encode with the codec, and still not lose anything.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
  34. *GASP* - Another hole found! by GogglesPisano · · Score: 5, Funny

    Check this out:

    Using my 733t hax0r sk1llz, I can use my EYES to COPY the movie to my BRAIN, where I can remember it OVER and OVER again -- for FREE!

    Eat THAT, MPAA!

    1. Re:*GASP* - Another hole found! by MaXiMiUS · · Score: -1

      *next week on /*...*

      --
      It's never just a game when you're winning. - George Carlin
    2. Re:*GASP* - Another hole found! by roman_mir · · Score: 1

      I believe they already have a fix for that. Every newborn will have its eyes gouged out. The grownups can have a choice of either gouging their eyes out as well or have their lids glued shut.

    3. Re:*GASP* - Another hole found! by Jugalator · · Score: 1

      Hmm, isn't that an example of intellectual intellectual property infringement? :-)

      --
      Beware: In C++, your friends can see your privates!
    4. Re:*GASP* - Another hole found! by adrianbaugh · · Score: 2, Funny

      Noted. Our men will be round shortly to remove your brain. Do not attempt to leave your current location.
      - The MPAA.

      --
      "'I pass the test,' she said. 'I will diminish, and go into the West, and remain Galadriel.'"
      - JRR Tolkien.
    5. Re:*GASP* - Another hole found! by Anonymous Coward · · Score: 1, Funny
    6. Re:*GASP* - Another hole found! by gEvil+(beta) · · Score: 1

      Can you post the code for that?

      --
      This guy's the limit!
    7. Re:*GASP* - Another hole found! by rm-R-winnt · · Score: 1

      actually, the MPAA has something in the works that will encrypt the data link between your eyeballs and your brain. anything that you look at that is not legit will be blocked.

    8. Re:*GASP* - Another hole found! by Anonymous Coward · · Score: 0

      because slashdot would commit suicide if nobody said this...

      The thought police will ctach you. In the end, you Will love the DMCA

    9. Re:*GASP* - Another hole found! by GogglesPisano · · Score: 1
      OK, but this is going to take a while:

      ccgccaaatctatcaccgccaccgccaaatctatcaccgc
      ccgccaaa tctatcaccgccaccgccaaatctatcaccgc
      caatgatgaacggtag ctaatcgggaatcaaggtccaaac
      atgacgatcaaagtcaggattcaa gctacgggatatagca
      tgactagctagctacttgaactacctgatcca agtactat
      tgacggatatacgatctagctagacgttactagacgatcg
      atcgatcatagcatcatgggaaatctatgactatcgatag
      ccgcca aatctatcaccgccaccgccaaatctatcaccgc
      caatgatgaacggt agctaatcgggaatcaaggtccaaac
      atgacgatcaaagtcaggattc aagctacgggatatagca
      tgcattgacaatcatcgatcgatcgatcga tcactagtag
      ttacatgattaccggatttaccaatcagattcgatacc ta
      ggatccattcaattccatgatcattaggatcatagtagta
      caaa tctatcaccgccaatgatgaacggtagctaatcggg
      aatcaaggtcca aacatgatagcatgattaacgggcatac
      ...
  35. Re:form. This "front" is obvious. by Anonymous Coward · · Score: 0

    I'm a digital dike, you insensitive clod!

  36. Does HDCP solve this? by MasterC · · Score: 5, Insightful

    High-Bandwidth Digital Content Protection (HDCP) "protects" DVI & HDMI interfaces but for this to work on a regular PC then the OS has to be in on the deal as well, right? So if a drive and video card support the devil that is HDCP, does this "back door" work if the OS is in on the HDCP? I would venture a "no" on that one.

    Taking print screens is a weak solution, but a solution nonetheless. All it takes is one person to have the patience or scripting skills to automate this for a copy to hit the internet. One. That's the problem with DRM in that it may deter most people but to be totally effective it requires determent of everyone. Feeding millions of individual frames to an encoder is not beyond some people, I'm sure. Especially since hollywood raised the stakes.

    If this is a back door, then it's one of those miniature clown doors. When someone figures out a way to completely strip out AACS (like what was done with CSS) then we can call AACS hacked and laugh again at the never-winable battle that is DRM.

    DRM is unwinable because you have to give the decryption key to the user so that they can use the product. If you don't give them the key then they can't use it. So DRM gives the encrypted data and the decryption key to the user every time.

    --
    :wq
    1. Re:Does HDCP solve this? by Wesley+Felter · · Score: 1

      HDCP only protects pixels flowing over the DVI/HDMI cable; it doesn't help while the pixels are in the framebuffer.

    2. Re:Does HDCP solve this? by Stalyn · · Score: 4, Insightful

      TC(Trusted Computing) solves this. TC puts encrypted data in memory that is unavailable to unauthorized programs(the OS as well). And if they try to access this memory the hardware component, in the worst case scenario, becomes a brick or more likely the component just shuts down.

      That's the real fear of DRM with TC. In essence you won't even own your computer anymore.

      --
      The best education consists in immunizing people against systematic attempts at education. - Paul Feyerabend
    3. Re:Does HDCP solve this? by Anonymous Coward · · Score: 0

      And just to make the point very clear, if you had 100 computers working basically non stop on a frame-by-frame rip, and you assumed that each one ripped 3 frames per second (low? high? a wild guess by me, that's for sure), then every second you would rip 300 frames ie 10 seconds of NTSC (12 seconds of PAL) footage. So a 1:10 time/output ratio.

      So you could rip a one hour program like Lost or The West Wing (actually 44 mins minus commercials) in 5 minutes.

      Now if only there were programs out there that can divvy up a single file into 100 unique packets to be distributed to 100 computers for collective ripping ...

    4. Re:Does HDCP solve this? by nkh · · Score: 1
      All it takes is one person to have the patience or scripting skills to automate this for a copy to hit the internet
      One person only? We have the whole internet for that. Just get a team of 120 guys who would each copy 1 minute of the movie and concatenate all the frames back together when they're finished. Of course this grab-screen idea is still highly inefficient but those "pirates" can organize themselves.
    5. Re:Does HDCP solve this? by Anonymous Coward · · Score: 0

      TC only works until I attach an independent PCI card to the bus. So, maybe the OS boot path is signed. I don't care, I'm going to modify the OS by DMA requests to main memory. Or maybe reading it will suffice :)

    6. Re:Does HDCP solve this? by Wesley+Felter · · Score: 1

      If you have an unknown PCI device the BIOS can set a "taint bit" or something, and HD-DVD/Blu-ray player software would simply refuse to run at all. Now maybe you can bypass that with a PCI bus master that is not enumerated, but I don't know if such a thing is possible.

      Oh, and I think LaGrande prevents this DMA attack.

    7. Re:Does HDCP solve this? by Anonymous Coward · · Score: 0

      Nah, just have the PCI device ignore the probe request, and behave to the CPU as if there is nothing on those IO ports.

      Besides, what prevents me from clobbering the taint bit setting code in BIOS before it even executes? Even LaGrande can't stop a PCI device from clobbering main memory.

    8. Re:Does HDCP solve this? by JAFSlashdotter · · Score: 1

      I'm not a TV / electronics guru, so forgive me if I over simplify things... but doesn't SOME piece of hardware inside of a 1080p capable HDMI equipped monitor have to eventually end up figuring out what LCD spots on the screen have to be given particular values? And won't someone eventually just insert a tap into the output of that component and sample it? OK, not me, but I wasn't going to do the print-screen thing either. But if that's what it takes to make 1,000,000,000 copies of "Pirates of the Carribean: Dead Man's Chest" to sell on the black market, I'm sure someone is going to do it eventually. How exactly do they prevent THAT from happening? Make the LCD components have encrpytion built-in and encase every one of them in melted glass? It's getting ridiculous. The regular users will get screwed a little more every day, but the pirates that make millions selling pirate copies will continue to do so. If they want to recoup millions lost to piracy, maybe the MPAA ought to sue the shady individuals that told them copy protection was a good idea.

      --
      We apologize for the preceding message. All those responsible have been sacked.
    9. Re:Does HDCP solve this? by TwilightSentry · · Score: 1

      That's the beauty of virtualization (read, a custom, virtual TC chip with readout of all stored data, and other such stuff)

      --
      How to enable garbage collection on a system without protected memory: #define malloc() ((void *) rand())
    10. Re:Does HDCP solve this? by Anonymous Coward · · Score: 0
      "That's the real fear of DRM with TC. In essence you won't even own your computer anymore."

      Sounds like tit for tat. The pirates take away the content, and the industry takes away their computers.

      Anyway L.M. Lloyd pretty much sums up my position on the issue.

      You know, bombastic articles like this only make the problem worse, by trying to cast the situation as democracy vs. copyright. It is easy to blame the content industry for clamping down on these technologies. However, one could also ask why the viewing public is so quick to misuse any technology they are given access to in order to get around paying for content? Of course that is not the easy place to point the finger.

      Copyright is an agreement between the artist and society. There is no argument that as of late that agreement has been strained in various ways, and needs to be reexamined. However, to pretend that the agreement is no longer needed, ignores the whole reason the agreement was made in the first place. The whole reason cheap and simple reproduction has worked out well for almost everyone, is because a system was enacted where the artist could be assured incentive to produce work, even in the face of cheap and simple reproduction. If you move to a system where cheap and simple reproduction is given more priority than the protection of the artist from that cheap and simple reproduction, then you will quickly find yourself in a situation where there is very little art worth reproducing, no matter how cheap or simple it is to do [Emphasis mine].

      Note he doesn't say that art will disappear, just art worth having will be diminished.

      And how do you expect this glorious revolution to take place, if the second an artist publishes their work, anyone can reproduce it and distribute it without the consent of the artist, and without giving any compensation to the artist?

      You seem to be forgetting that unless the artist can monetize their work, then they will either have to devote their time to working a job to feed themselves, or will quickly stop producing art when they starve to death. It is a fantastic technoutopian vision, but one that requires very stringent copyright law and DRM to occur.

      That is a valid point, but not one I think is shared by most anti-copyright advocates. I think most people take it for granted that the entertainment will just keep coming no matter whether they pay for it or not.

      For example, do you think that garage punk band is just doing it because they want to be cool, or do you think they are also hoping they are going to get rich and famous? We already had a good long era where the only artists were one who did it for the love of art, and some amazing art was produced. However, most of that art was only ever seen by the patrons who could afford to fund its creation.

      You have to face (which it would seem you might well have) that either you have a right to see art, or you have a right to copy art, but you can't have both. If you take away the ability of the artist to control the distribution of the work, then the inevitable result will be a return to all the best art being in private collections that are never seen by the public.

      Not to be too snippy, but you aren't turning down the paychecks in protest, are you? Wink It does make for an odd argument though, when you are getting paid to produce content, but you don't think it is worth buying, and I am producing content with no hope of financial compensation (in fact it is costing me money), and I am the one defending the commercial value of the content.

      Seriously though, what about the DMCA offends you? Is it the law itself, or some of the egregious misapplication of the law? For example, I am quite offended by the abuse of personal injur

    11. Re:Does HDCP solve this? by mrchaotica · · Score: 1

      The data would be encrypted on the bus as well, you know. Once Treacherous Computing gets fully implemented, "Trusted [sic]" content won't be decrypted until it's in the monitor itself -- that's what makes it so dangerous!

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

  37. Star Wars Print Screened Will No Copies Be by digitaldc · · Score: 1

    Using this (printscreen) function you can create exact digital copies of a film picture by picture and reassemble them to a stream

    George Lucas found out about this, had a fit, and now will release another set of 'Star Wars' DVDs & HD-DVDs that disables this printscreen copy method in order to in his words, 'restore the monetary balance and order to the market force.'

    --
    He who knows best knows how little he knows. - Thomas Jefferson
    1. Re:Star Wars Print Screened Will No Copies Be by toomz · · Score: 1

      Lucas of all people should know that's not going to help anything. Any jedi worth his salt can simply will an exact copy of the movie onto his hard drive.

      --
      If a chair is thrown in a forest, and there are no witnesses, did Ballmer still do it?
  38. Is it April 1 already? by elgee · · Score: 1

    I seem to have lost track of time.

    This is a joke, right?

  39. Re:form. This "front" is obvious. by RichardX · · Score: 1

    Whatever happened to the "I bought the DVD, I should do what the fuck I want with it"?

    You've still got that right, just as you always have!
    You can use it as a drinks mat, a frisbee, a wall hanging, a-...
    Ohhh... you meant movie contained on the DVD?
    Why do you hate freedom?

    --
    Curiosity was framed. Ignorance killed the cat.
  40. Get right-MJ's: Beat IT! by Anonymous Coward · · Score: 0

    "They browbeat/bribed the companies that developed the software to implement it."

    Obviously noone here sees the catch-twenty-two.

    1: DVD player company has player they want to sell.

    2: Said player is mostly useless without something to play on it.

    3: Most content comes from commercial sources (that applies to TV too).

    4: Commercial content creators have product they want to sell.

    5: Said content is mostly useless without a player to play it on.

    6: Most players are produced by commercial companies.

    Now the question is whom has the strtonger standing in this equation? Player? Content creator?

    I'd say the content creator.*

    *One little detail. Sometimes content creator and player manufacturer are one and the same. No browbeating needed.

    1. Re:Get right-MJ's: Beat IT! by Anonymous Coward · · Score: 0

      I'm embarassed that I'm part of a species which has to have this explained to them. Thank you for doing the work this time. I'll get you next time around.

  41. If it can be seen it can be copied by sxmjmae · · Score: 3, Insightful

    Anything that appears on my computer screen I can copy - even streaming video.
    It is not that hard of thing to do, even if you have to write the code yourself.

    --
    My Sig indicates the end of the comment I posted.
    1. Re:If it can be seen it can be copied by evilviper · · Score: 1
      Anything that appears on my computer screen I can copy -

      Please explain how.

      Hardware overlay ensures that the data is going directly to the videocard, and your OS can only grab a blue/green screen. If they disable non-overlay output (perfectly reasonable, since it would be too slow for playback), you're out of luck.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    2. Re:If it can be seen it can be copied by mrchaotica · · Score: 2, Informative
      It is not that hard of thing to do, even if you have to write the code yourself.

      But then your locked-down "Trusted [sic]" system will simply refuse to run your unsigned code, and you'll be back at square one (and if your system isn't "Trusted [sic]", the HD player software and/or the drive itself will refuse to decrypt the movie to begin with).

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

  42. Not so much, really by Weaselmancer · · Score: 5, Insightful

    It would be a lot of work, if you did it manually. The print screen button is really just a proof of concept idea. Remember that the device is a computer and they excell at repetition.

    For example, it wouldn't be too hard to write a DirectX driver for a virtual display device that simply passes every frame it sees into a filter for recording. Same should work for audio, really. Just take the inbound stream and stash it somehwere. As long as you've got the bandwidth inside the machine to move the data and the space to store it, why not?

    This is why MS is pushing so hard for that "driver verification" thing. User created drivers can bypass the DRM just before the media gets pushed out to the hardware. The Windows box simply isn't built for DRM level trust at all points in a broadcast. Yet, anyways. It's still possible to break the chain somewhere and extract content. I'm guessing that'll always be the case too, at least for a good long while. Only way to get around that with what we have today would be if MS started selling PCs that are welded shut.

    --
    Weaselmancer
    rediculous.
    1. Re:Not so much, really by a_nonamiss · · Score: 2, Funny
      Only way to get around that with what we have today would be if MS started selling PCs that are welded shut.
      Damn, dude, don't go giving them ideas like that.
      --
      -Arthur
      Cave ne ante ullas catapultas ambules
    2. Re:Not so much, really by Bert64 · · Score: 1

      In which case you could still use a virtualization tool to virtualize the video-playback OS, and then grab the screenshots from that.

      --
      http://spamdecoy.net - free throwaway anonymous email - avoid spam!
    3. Re:Not so much, really by radtea · · Score: 4, Interesting

      Yet, anyways. It's still possible to break the chain somewhere and extract content. I'm guessing that'll always be the case too, at least for a good long while. Only way to get around that with what we have today would be if MS started selling PCs that are welded shut.

      And that don't have any output.

      So long as it's possible to get output, it's possible to produce a nearly-perfect digital replica of any content.

      A/D conversion isn't perfect because of noise, but you can play back the movie/audio/whatever as many times as you want and average the noise away, or use fancier statistical algorithms to reclaim the original content, pixel-by-pixel, frame-by-frame. If you're worried about A/D bias, run it through multiple playbacks on different hardware. It just isn't that hard. Anyone who has worked in digital imaging (my own backgroud is in realtime x-ray) knows how easy this is.

      I can see the videophile's system of the future: a video driver card with an external analog output plugged into a video capture card, plus a bit of software to repeat the process of playing the movie and averaging the frames until the desired quality is reached. Instant (ok, maybe 1 day turn-around) DVD/Blur-ray/HDTV-quality non-DRM'd video.

      We've hardly begun to scratch the surface of means for making DRM obsolete. People who invest in DRM Just Don't Get It(tm).

      --
      Blasphemy is a human right. Blasphemophobia kills.
    4. Re:Not so much, really by ToxicBanjo · · Score: 1

      For example, it wouldn't be too hard to write a DirectX driver for a virtual display device that simply passes every frame it sees into a filter for recording.

      Don't need to, there is a component of DirectX (DirectShow in Particular) called the SampleGrabber. It is used for this exact purpose, to grab sample of media from the stream being played. The sample grabber can grab any decoded video stream. Since someone will have to make a software only player that will need to work with XP and DirectX it will be no problem to use the samplegrabber to rip the video. Audio would be another issue but it could also be "gotten" readily and then it is only up to syncing the two streams.

      Honestly, when will people realize that copy protection takes years to develop and usually only takes a day (at most) to crack it. Big waste of time and effort.

      --
      There are only 10 kinds of people in the world. Those that understand binary and those that don't.
    5. Re:Not so much, really by arodland · · Score: 1

      Except that your movie playing software will refuse to work because your video card has an analog output, and isn't certified to use a digital protocol with end-to-end encryption and authentication.

    6. Re:Not so much, really by FireFury03 · · Score: 2, Informative

      In which case you could still use a virtualization tool to virtualize the video-playback OS, and then grab the screenshots from that.

      Isn't this the point of having DRM hardware? My understanding is:

      1. Read encrypted content off bluray disc
      2. The media player software decrypts the content and shoves it at the display driver with a "DRM flag" set
      3. The display driver encrypts it and sends it to the graphics card
      4. The graphics card decrypts it, re-encrypts it with HDCP and shoves it at the monitor
      5. The monitor decrypts it and displays it.

      So the weak points are the media player, the display driver and the monitor.

      If you ran it inside a VM then you would either have to emulate the graphics card (almost impossible because you'd need the graphics card's encryption keys to convince the driver to talk to you) or let it talk to a real graphics card and intercept the stream (which would be encrypted, so completely useless).

      The assumptions the industry is making are basically:
      1. The media player is trusted since only trusted players can licence the bluray decryption keys (we saw how well that worked with DVDs - I play them regularly on Xine)
      2. The display driver is trusted - this might be the case if you only trust signed drivers.
      3. The monitor is trusted to not have a "decrypted output"

      In any case, the easy way to grab bluray content at the moment is to decrypt the HDCP stream, since HDCP has already been cracked. I don't hold out much hope for the media players remaining trusted for too long - putting any kind of DRM system in the hands of a large number of suitably motivated techies is going to result in it being cracked reasonably quickly.

      Until bluray/hddvd has been cracked there's no way I'll be buying movies in those formats anyway - DRM is fundamentally incompatable with FOSS media players, and if the MPAA thinks I'll be putting any closed source software from them on my system they're very mistaken - after things like the Sony incident I really wouldn't trust software from that industry unless it could be audited by the public. (Not to mention that I have no HDCP capable hardware and have no intention of buying any any time soon).

    7. Re:Not so much, really by IamTheRealMike · · Score: 1

      That's what the Secure Video Path in Vista is designed to do. The idea of using Print-Screen is stupid anyway; how exactly do you get the audio, subtitles, extras or indeed anything except raw frame data?

    8. Re:Not so much, really by capologist · · Score: 1

      We've hardly begun to scratch the surface of means for making DRM obsolete. People who invest in DRM Just Don't Get It(tm).

      Some day -- Ten years? Less? -- we'll have displays and camcorders of such quality that we can just stick a camcorder in front of a monitor and it will be capable of making a near-perfect recording of anything the display can render for viewing by human eyes.

      Then the industry will start putting watermarks in content and successfully lobby Congress for legislation requiring that all camcorders must contain technology to recognize the watermark and refuse to record anything containing it. Pre-legislation camcorders (as well as post-legislation camcorders tampered to bypass the protection) will be declared contraband and subject to confiscation.

      A few decades after that, we'll have transhumanist (Or is it posthumanist? I always get them mixed up.) technology that we can put in our eyes, ears, and brains to record anything we see or hear, recall and replay it into our minds upon demand, and produce copies for other people. The potential applications of such technology will be ginormous, but one of those applications includes making copies of movies and music, so it will be forbidden for such technology to be possessed or used by anybody besides Big Brother. Either that or they'll stick a Clipper chip in it so they can monitor you for illegal activity like remembering a movie that you only paid to see once.

      Give it up, DRM folks. Even with Congress's nose inserted firmly into your anal sphincter, your loss of this war is inevitable. You got all up in arms because technology advanced to the point where the average consumer can produce perfect or near-perfect reproductions of images and sounds. For the moment, the technology is still limited enough that, with help from the government, you can severely restrict the behavior of consumers (both legitimate and otherwise). That situation won't last long. We will have the ability to record anything we see or hear and to transmit copies around the world at 10 Gbps. DRM is already on life support, and some day -- within ten years, I'd guess -- it will be dead as a concept. You can either learn to live without it, or die with it.

    9. Re:Not so much, really by Threni · · Score: 1

      > This is why MS is pushing so hard for that "driver verification" thing.

      Same reason they do everything - profit. Assming they're doing it, it'll be because there's a demand for it. I think in general they want drivers sorted out because most Windows crashes happen in the drivers.

    10. Re:Not so much, really by gnomino · · Score: 1

      Will the pirates care about the work? The more technically competent ones will probably invent a device (software or mechanical) that can automate the work, and soon that device will become present in every civilian's home. The MPAA is effectively a) converting law-abiding citizens into pirates, b) stimulating the technical competence of the average citizen, and in effect, c) helping to electronically industrialize the world. When they have converted enough people into experienced (h|cr)ackers, they will finally realize that all their work on DRM was for nothing.

    11. Re:Not so much, really by Anonymous Coward · · Score: 0

      Signed drivers have nothing to do with QA, they will not go up in quality. Infact, it will be the opposite, since there will be less hacks, modifications, etc. for the drivers, there will be less competition for the drivers and the driver quality will go down. They have to do with making someone legally accountable if the driver allows someone to violate DRM or other restrictions they don't want you to, and making a couple extra bucks when they sign your driver.

    12. Re:Not so much, really by Tim+Browse · · Score: 1

      Since someone will have to make a software only player that will need to work with XP and DirectX it will be no problem to use the samplegrabber to rip the video.

      And the only way to defeat this would be if Microsoft somehow had the source code to DirectX and Windows, and changed them to release an update that required signed drivers to playback protected content, etc. An update that would be required by any software HD-DVD or BluRay players, of course.

    13. Re:Not so much, really by ncc74656 · · Score: 1
      For example, it wouldn't be too hard to write a DirectX driver for a virtual display device that simply passes every frame it sees into a filter for recording.

      DirectShow already has the Sample Grabber filter, which can be inserted nearly anywhere in a filter graph. Insert it before a renderer and you can capture whatever gets passed to the renderer.

      (This assumes that you can construct a filter graph to play a DVD (or whatever) and then modify the graph. It's also not something you'll be able to do from within GraphEdit, as GraphEdit knows nothing about the ISampleGrabber interface.)

      --
      20 January 2017: the End of an Error.
    14. Re:Not so much, really by Antique+Geekmeister · · Score: 1

      It's specifically called "Trusted Computing".

  43. "security hole"? by pr0nbot · · Score: 2

    "Toshiba confirmed the security hole found by c't"

    In what way does being able to do a screen grab constitute a threat to my computer's security, or anyone else's?

    Here's to the day when we read:

    "In response to the recently-discovered security flaw -- which could, if uncorrected, allow terrorists to molest your children -- the developers of WinDVD have ensured that only the encrypted data is displayed on-screen."

  44. Feature not a bug... by Distan · · Score: 2, Insightful

    Neither of these formats is going to go anywhere unless there is a way to make backup copies. This so-called "hole" is actually a feature, not a bug.

    I predict that this format war will end when one of these two formats finally has a robust backup solution. At that moment in time, the other format will be dead.

    1. Re:Feature not a bug... by sfontain · · Score: 0

      Neither of these formats is going to go anywhere unless there is a way to make backup copies. This so-called "hole" is actually a feature, not a bug.

      I predict that this format war will end when one of these two formats finally has a robust backup solution. At that moment in time, the other format will be dead.


      It's funny you should say that, because, really, I can't think of anyone I know who keeps backups of their movies unless they pirated the movie in the first place. The only people who care about backups are those who don't pay for the movies. What this means, most importantly, is that the "backupability" of a movie is going to have virtually zero negative impact upon the companies' bottom lines.

    2. Re:Feature not a bug... by Anonymous Coward · · Score: 1, Funny

      You don't have young children do you?

  45. Time to.... by Barny · · Score: 1

    Buy a copy of fraps then i guess, sucking data strait out of the video cards output buffer would be the best way of doing this.

    Would be a small guess but with the user level drivers in vista, couldn't you wrapper a program within another program, and intercept all driver commands, pretending you are not listening but grab that framebuffer at a nice smooth 30fps? Of course doing this in realtime would be nasty, sucking in that big an image at 30fps in full frames AVI would be very very bad, last time i recorded a 1600x1200 25fps vid i was useing a gig every 5min.

    --
    ...
    /me sighs
  46. We own you... by Anonymous Coward · · Score: 1, Interesting

    "When asked to comment, Toshiba confirmed the security hole found by c't, which affects the computers already sold, and announced updates for the player software and graphics card driver. These new software versions should disable the screenshot function."

    So, basically, not only does Hollywood own the playback hardware you buy, but they can remotely disable your application software and drivers, too?

    NEW AND IMPROVED! HIGH DEFINITION DVD! BUY NOW!

    Oh, and, by the way, if we don't like how you are viewing our product, we'll remotely break it.

    Remind me again why I should pay any money for something I won't actually own?

    1. Re:We own you... by FryingDutchman · · Score: -1

      "Why I should pay any money for something I won't actually own?"

      That seems to be the strongest argument among the non-nerd community. There is a huge consumer population that could care less about piracy and backups and the neat MythTV hacks we slashdotters gush about - they just want to buy a movie, take it home, and watch it on either of their brand new $1,000 Samsung BR DVD players. When they start to hear things like "You own a license to watch this that can be revoked" and "you have to buy a TV with HDMI because it won't play over analog signals like Component" that's when the uprising will begin. I spelled it out to my father the other night and he was taken aback by the practice.

      This is an identical argument to the Apple lawsuit in France - telling people they've just spent $0.99 on a song and can't do with it what they'd like. We can only hope the land of the free can catch up with the civil liberites of .... France??? *shutters*

  47. Re:form. This "front" is obvious. by Anonymous Coward · · Score: 1, Informative

    You never did have the right to do what the fuck you want with it. You never were allowed to copy it and sell it. You never were allowed to charge people to see it. You never were allowed to rip it and upload it to random others whom you don't know.

    What you have had the right to do is view it for your own private entertainment, to loan the disc to a friend, and to give away or sell the disc provided that you don't keep any copies of it. What you should have the right to do is make a backup copy for safekeeping, or for viewing on a device that doesn't have a DVD drive/player (notebook PC, iPod, whatever).

  48. Was a workaround ~10 years ago by Anonymous Coward · · Score: 0

    This was one of the ways to rip DVD's when burners were useless due to the +/- battles on burners. It required powerDVD 5.0 and a simple software program to take and encode all the "printscreens" into a video file (for the most utility an .mpg). The video file would then simply be burned onto 2 VCD's (or SuperVCD's) and you could play it in your DVD player. TV's had such poor resolution it was hard to tell the difference if the video had a decent bitrate.

    I'm surprised here at slashdot so many 1337 nerds (news for nerds, no?) think they'd have to physically press the button 135k times.

  49. duh by spyrochaete · · Score: 1

    Here's a hilarious excerpt from the EULA of a Dreamcatcher game:

    "You will not copy, decompile, reverse engineer or disassemble the Application Software, or otherwise reduce the Application Software to a human perceivable form;"

    This is the only surefire DRM:

    http://www.rockingham.k12.va.us/sound_sorting/init ial_blends/bl/images/blindfold.jpg

    If a non-interactive medium can be percieved by humans, it can be duplicated. There's no way around it. One of these days copyright law will inevitably state that any media released in any percievable form to the public domain is ripe for the picking.

  50. Lazy hackers by CopaceticOpus · · Score: 5, Funny

    Wait, HD DVD and BluRay aren't cracked yet? They've been out for weeks... Come on, you lazy hackers!

    1. Re:Lazy hackers by evilviper · · Score: 1

      CSS on DVDs took 3-4 years, and it would have been longer if not for some idiot leaving the key unencrypted in the player software.

      In other words, don't hold your breath.

      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
  51. Not equivalent to a direct copy by vijayiyer · · Score: 3, Informative

    There will be an image quality degradation since it's the decompressed stream that is being copied, and it will have to be recompressed to get it back to a size that will fit on HD-DVD/Blu-Ray. Therefore, this isn't equivalent to a direct copy of the compressed data stream.

    1. Re:Not equivalent to a direct copy by Junior+J.+Junior+III · · Score: 1

      Also, how do you "print screen" the audio, the menus, etc.?

      --
      You see? You see? Your stupid minds! Stupid! Stupid!
    2. Re:Not equivalent to a direct copy by Jah-Wren+Ryel · · Score: 2, Informative

      There will be an image quality degradation since it's the decompressed stream that is being copied, and it will have to be recompressed to get it back to a size that will fit on HD-DVD/Blu-Ray. Therefore, this isn't equivalent to a direct copy of the compressed data stream.

      But, on the other hand, it is only one transcoding generation away from completely unrestricted copying. I think even most videophiles would be hard pressed to distinguish between a 1st generation and a good 2nd generation transcode of equal resolution and similar bitrates.

      Plus, if you look at the pirating on the net today, it is almost always transcoding to lesser quality - be it DVD-9 down to DVD-5 (for easy burning to single-layer DVD blanks) or DVD to one or two 700MB CDs of xvid/dvix. Some people do pirate raw hdtv transport streams but they are compartively few and far between.

      --
      When information is power, privacy is freedom.
    3. Re:Not equivalent to a direct copy by Anne+Thwacks · · Score: 1
      About 10 years ago, I worked for a company that made hardware which could rip from video memory in real time, and shove the data on a private bus to another (arbitrary) card. The other card could include a real-time mpeg compressor chip, and SCSI bus port, allowing the data to be streamed to a HD in real time. (You can buy hardware mpeg compressors from regular IC manufacturers - I did that at a different employer, later. Or you can make one youself with a Xilinx chip - I don't think they give out Blue Peter badges for that.)

      Hell, I could even make a system that would rip the DVD into a DVD writer faster than real-time - but it would be about 2 man-years work. I think it might be more fun sailing round the carribean with an eyepatch and a bottle of rum - Ar-harr, Jim lad, pass me a shot of the hard stuff, and let the hardware heave to for a while <Sound of timbers shivering> but others, less seafaring than myself might have other ideas...

      --
      Sent from my ASR33 using ASCII
    4. Re:Not equivalent to a direct copy by stud9920 · · Score: 1

      Don't know about the compression scheme in new formats, but theoretically the only lossy step in video compression is the quantization step. The system goes like

      (A) video in space "time" domain =(a)=> sliced in 8x8 =(b)=> video in space freq domain ==> (B) quantized video in space freq domain ==> lossless entropy encoding

      decompression goes like

      lossless entropy decoding ==> quantized video in space freq domain ==> (C) somewhat degraded video in space "time" domain. This is the prtscreen image.

      In theory if you run (a) and (b) on the degraded picture (C), the picture will be exactly like in (B). Unless you do further quantization TO REDUCE SIZE FURTHER, there is no picture degradation.

      Now this was supposed to work with good ol'DVD's DCT/iDCT, but screengrabbing was silly when the plaintext was available. I don't know if this is still true for fancy schmancy HDDVD/BD.

      Disclaimer: I wrote this text assuming there are no rounding faults.

    5. Re:Not equivalent to a direct copy by courtarro · · Score: 1

      Also, plenty of people have no qualms with catching the latest flick in glorious camcorder-vision. It's basically transcoding several times with D-to-A and A-to-D conversions that yield terrible quality, but I know lots of students who aren't concerned with the lack of image or sound quality. They simply want to see the film, hear the jokes, and watch the story unfold. Many of the /. crowd wouldn't put up with that, but then again many of us are probably buying DVDs legally anyway.

  52. Ban screens ...? by pbhj · · Score: 1

    So you're saying they're going to ban screens?? Or perhaps they'll be sold with a piece of black plastic glued on them?

    Oh and they'll need to do some more work on bitwise copying.

    Perhaps if they stopped making stuff, that would stop people from seeing it ... hmm it just might work !

    1. Re:Ban screens ...? by MindStalker · · Score: 1

      Well bitwise copying can actually be successfully detected because a copy will have random errors that are CRC corrected different that the pressed original. Of course if you can press your copies you are a extreme mass pirate and there is no hope. :)

    2. Re:Ban screens ...? by smokeslikeapoet · · Score: 1

      How about this, You buy a scrambled DVD and you have to use secret decoder glasses to watch it. You could get special decoder glasses in cereal boxes to view easter eggs and special features. Or maybe you could get retinal implants that would decode scrambled HD signals. This could get really ridiculous... If you attempt to view a movie that you haven't purchased then on the first offense your optic nerve chip blinds you for 10 minutes, 1 hour on the second offense, and life on the third.

      Speaking of ridiculous, if piracy is wrong, why is Disney glamorizing it in another movie?

  53. Awful by Anonymous Coward · · Score: 0

    This is terrible. Clearly, the PrintScreen button must be banned.

  54. Re:form. This "front" is obvious. by kenthorvath · · Score: 3, Interesting

    What you should have the right to do is make a backup copy for safekeeping, or for viewing on a device that doesn't have a DVD drive/player (notebook PC, iPod, whatever).

    Don't forget having the ability to rip certain parts of the movie to disk to edit and play with, use for presentations (PowerPoint, etc...), and just plain old make parodies of. Making amateur derivative works without charging for them is beneficial to society as a whole. Just look at youtube.com to see countless examples. The real problem is that user-created content is starting to steal the spotlight from Big Media, and DRM is one way to lock out the non-conglomerates from competing.

  55. A workaround for no print screen by Prototerm · · Score: 1

    If they take away the print screen button's functionality, I have an equally effective work-around: simply hold a piece of tissue paper up to the monitor screen and trace each frame of the movie.

    Print screen each frame of a movie to copy it -- give me a break!

    --
    "My country, right or wrong; if right, to be kept right; and if wrong, to be set right." --Senator Carl Schurz (1872)
    1. Re:A workaround for no print screen by SuperRob · · Score: 1

      And none of these "options" provide you with the AUDIO.

  56. Just like iTunes "DRM" by nickheart · · Score: 4, Insightful
    **warning, rant**

    I'm sorry, but am i the only one who thinks all these codecs, DRM tools and other garbage are just a waste of time?
    There are already many ways to get a clean WAV file from anything playing on your computer, drivers that hook into the direct sound and just copy what ever is there. Or how about just burning the CD from iTunes, then ripping it with a freeware tool?
    What these XXAA need to do is just understand that if you can watch/listen to it, it can be copied. That's it! Make people want to buy the product for other reasons. I own sooo many different seasons of different television shows because i like to have the boxes sitting on display. Anywho, is this really news? another attempt to create "un-copy-able" media failed?
    thanks for listening

    **end rant**

    1. Re:Just like iTunes "DRM" by oneandoneis2 · · Score: 1

      am i the only one who thinks all these codecs, DRM tools and other garbage are just a waste of time?

      Amongst geeks? No - we all know that already.

      Amongst media executives? Yes - none of them have a clue.

      --
      So.. it has come to this
    2. Re:Just like iTunes "DRM" by Golthur · · Score: 1

      Yeah, pretty much. As Bruce Schneier said, "Making bits uncopyable is like making water not wet".

      Too bad the dinosaurs at the MPAA/RIAA don't get it yet. The sooner they do, the better it will be for everyone - them and their profits included.

      --
      Hofstadter's Law: It always takes longer than you expect, even when you take into account Hofstadter's Law.
    3. Re:Just like iTunes "DRM" by greed · · Score: 1
      Or how about just burning the CD from iTunes, then ripping it with a freeware tool?

      That's a waste of time. Burn it with iTunes and rip it back with iTunes--then all the ID3 info is copied over, too. (Not the artwork, though.)

    4. Re:Just like iTunes "DRM" by Anonymous Coward · · Score: 0
      (Not the artwork, though.)


      There's a key for that, though. It's called [Print Screen]
      Which means we're back where we started.
  57. History Repeats Itself by Anonymous Coward · · Score: 1, Interesting

    The first DVD ripper program ever released, long before deCSS and various hacks to windvd/powerdvd actually used this method.

    MS and the content industy will close this hole and similar ones easily with the new tools that tcpa , vista and "protected video path" gives them.

    But then again, how hard is it to just strip the hdcp and capture the resulting raw video :)

  58. how about analog duplication? by roman_mir · · Score: 2, Interesting

    I suppose it will be possible to create a 'camera', a CCD really, that is of the same size as your screen and that goes on top of your screen like a film and captures each pixel's intensity and color in multiple points even, averages out the color of the actual pixel and records this data as a video. Audio can be also copied in analog mode. Of-course it will always be possible to just point your camera at the screen and shoot (they will try to prevent analog copies as well, of-course, but that will be nearly an impossible war.)

    1. Re:how about analog duplication? by Anonymous Coward · · Score: 0

      Heck, why not intercept the data stream going into a CRT's electron guns while you're at it? (That doesn't sound like such a bad idea, actually...)

      But really, a software-based method would probably be a bit more feasable to Joe Pirate.

    2. Re:how about analog duplication? by monkaru · · Score: 1

      I think the point of that is there is always a fundamental fallback point with analog. As digital signals are just indecypherable garbage to humans as the signal has to be converted to analog at some point the "hole" will always exist. Also, analog is pretty darn good. If you take a high quality VHS tape and put it into a high quality VHS player you will enjoy the movie.

  59. Re:hrmm.. uh and the audio by Anonymous Coward · · Score: 0

    Not to mention: What are you going to do for a soundtrack? Hum along?

  60. HAHA!! by fury88 · · Score: 1

    Holy slowness batman! Even if it is automated!

  61. Re:form. This "front" is obvious. by Bert64 · · Score: 1

    I demand the right to make backup copies of any media i purchase...

    I have CD's which i like to listen to in the car, they often end up getting damaged by extremes of temperature in the car.

    I have younger brothers/sisters, and i could have kids, who are highly likely to want to play games and watch movies... Can you really trust kids to take care of media? I have made countless copies of various CDs, Games and DVDs for my younger brother, who has managed to scratch or otherwise destroy hundreds of them through mishandling (he likes to carry CDs/DVDs around in his pocket, which also contains coins) and when he's finished using a piece of media, he likes to just leave it laying around, on the floor to be trodden on or picked up/chewed by the dog, in direct sunlight, on/near sources of heat like radiators, or he handles them with dirty hands...

    I don't mind losing a pile of $0.05 cheapo blank CDs to kids, it just goes with the territory, but to lose a $50 game is another matter.

    --
    http://spamdecoy.net - free throwaway anonymous email - avoid spam!
  62. Sound... by Anonymous Coward · · Score: 0

    OK - you've stripped the pictures for the movie.

    Where's the sound coming from? (I'm assuming that the sound is also 'protected' by the encryption system.)

  63. this happened with dvd's by Anonymous Coward · · Score: 0

    there were programs that did screen caps and ripped the audio stream from the system's playback, so it was 2 pass, once to grab the audio, another to grab the frames. the resulting files were then combined.

    I'm sure this will happen again.

    Then I'm sure some vendor will be an asshat and leave an unencrypted key in the public and DeBSS or whatever wil lbe born.

  64. An exercise in free futility by Anonymous Coward · · Score: 0

    "This just shows that whatever the content industry (not the content creators, btw) do to protect their distribution monopoly is doomed to fail."

    Um, you may want to sit down for this? Without content creators there can't be a content distributor. And by extension there can only be a monopoly on what the content distributor has licensed from the creator (Coke having a "monopoly" on Coke).* Now I know most of you are fresh out of your eggs and don't have an inkling about why distributors are needed (it has nothing to do with the internet, and most do more than "distribute", despite the name). But they serve a useful role, and a lot of content wouldn't have seen the light of day without their dollars (obviously pirate dollars don't contribute (1)).

    *Side note: Piracy shows contempt not only for distributors but content creators as well. It's like you creating and distributing code under a F/OSS license and me then doing things with it contrary to both the license and your wishes (lets not drag the "Apple vs KDE code" issue up).

    (1) Because of the "I'm not stealing (hurting) because I never would have bought it anyway" excuse

    1. Re:An exercise in free futility by gweihir · · Score: 1

      Oh, I did not say the distributors were entrirely valueless. But at the moment they have completely undeserved profit margins and dominate the content creators, the content consumers and try to dominate technology. They do this at a point in time when their importance is sgteadily dropping. As such they are a huge problem. A functioning Internet is worth many times over what the content industry is worth.

      Copyright infringement (calling it 'piracy' is dishonest) will not go away. However if the content industry reigns in their greed and reduces their costs, they can still survive. Until they do, they are doomed to die. Artists are still not threathened. Well, except the fabulously rich, but why should a singer or an actor earn many times more money than any other craftsman? And as long as you can make a decent lifing as a content creator, good quality content will be created. That is what matters primarily.

      --
      Most ACs are not even worth the keystrokes to insult them. Be generically insulted by this and ignored otherwise.
  65. It's not an 'analog hole' by NateTG · · Score: 1

    The fact is that the notion of DRM is intrinsically flawed. This 'print screen' workaround is another version of what has been referred to as the 'analog hole'. Any time something like this is being done on a general purpose machine (read 'in software') it's trivial to get a machine-readable copy of the content by using storage as the audio/video device.

  66. End-user commercial encryption will never work... by piotrr · · Score: 1

    ...because the seller will have to provide the data, the decryption hardware, and the decryption key to every single user every time. That means they're giving you the very means required to unlock the "protected" data, every time, or you wouldn't be able to watch your movie at all. This is self-evident if you just stop and think about it.

    It does not matter if the "protection" is embedded into hardware - it is still a part of your system. As long as you as a buyer have access to all these three things, you are able to copy any data you are able to buy, even without buying it.

    --
    / Per
  67. 30 frames per second? by aapold · · Score: 1

    This is HD we're talking about. Presumably they' be capable of 720p or (hopefully) 1080p, and not be doing interlaced screen shots. So 60 frames per second. And fwiw, even regular tv isn't 30 fps, it is 29.97. That slight drop was introduced when color TV came around. It necessitates doing "Drop Frame" calculation to find out how many frames there are in, say, 30 minutes of video. You drop 2 frames every 10 minutes or something like that, video software does it for you, but it needs to be done or else you'd creep increasingly out of sync with your daily schedule...

    --
    "Waste not one watt!" - CZ
  68. DCMA Section 7(b) Article 145 by Van+Cutter+Romney · · Score: 1

    Watching a movie on a computer with the keyboard attached will result in copyright violation.

    Sorry honey, I can't pause the movie!

    --
    Help a man when he is in trouble and he will remember you when he is in trouble again.
  69. Imagine a Beowulf cluster... by bshroyer · · Score: 1

    Seriously, This is a beautiful application for distributed computing:

    Since each copy of the DVD titled "Foo" is identical, one could:

    Write an app that will grab a random ten seconds (or 256 frames, whatever) of audio and video from a DVD
    Distributed app will then share those ten seconds via bittorrent protocol with the rest of the world
    Distributed app also monitors trackers to grab other ten-second chunks of movies you're interested in
    Buy a DVD, share ten seconds, get ten movies in return. Not a bad model. Unless you're the MPAA.

    --
    The cure for cancer is coming: Reovirus
  70. Re:form. This "front" is obvious. by WedgeTalon · · Score: 3, Funny

    I don't mind losing a pile of $0.05 cheapo blank CDs to kids, it just goes with the territory, but to lose a $50 game is another matter.

    One might say... It's a thousand times worse!

    Buh-dum-cha!

  71. Of course by lapagecp · · Score: 1, Insightful

    I am suprised at the number of people talking about how hard this would be to do. Its actually pretty easy. Hitting the print screen button is calling an operating system feature that can easily be called with another program. The whole thing could be autimated with a program pretty easily. The real issue here is that no matter how hard you try at some point the DVD has to show up on a screen. That means pixel 1,1 is going to be blue and pixel 1,2 is going to be green. There has to be a point where the image is not incrypted and thats the point at wich "hackers" will capture it. The same is true for Audio. At some point it has to go to the speaker. The only way to stop this effect is to require tv/monitors to recieve an encrypted signal. Before you start yelling I know that this is already happening but whats also happening is that people aren't adopting it because they don't see a point. You loose a big demographic if you tell people there old equipment won't work with there new equipment.

    1. Re:Of course by Anonymous Coward · · Score: 0

      That means pixel 1,1 is going to be blue and pixel 1,2 is going to be green.

      I think I know that movie... it had Kevin Bacon in it, right?

  72. 1TB per movie by Diamara · · Score: 1

    The movie stored on the disk will be heavily compressed. Each frame will have been de-compressed for display, so assuming a 32bit colour-depth and a 1920x1080 screen, each frame would take up about 6MB. At 24 frames a second a two-hour movie would take up about 1TB of space. Before it could be distributed, the 1TB would have to be authored to identify key-frames and so on. Very time consuming.

  73. It's worse for DRM than that by Anonymous Coward · · Score: 0

    DRM not only gives the encrypted data and the keys to the users, it gives the unencrypted data also. And the unencrypted message is hardly random data that you'd have no way to know if you decrypted it correctly.

    What kind of successful crypto scheme gives away literally hundreds of millions of keys and decryption devices along with thousands upon thousands of different encrypted and unencrypted messages of a known format?

    It's bound to fail.

    Heck, even the NSA only uses keys for short periods of time for US military comms. And they keep those keys about as secret as they can. And even then they toss them as fast as they can replace them.

    The MPAA wants to distribute "forever" keys and decryption devices by the millions. When the decrypted message is a movie that only needs the Mark 1 mod 0 Eyeball for quality control.

  74. Recompression by D.+Book · · Score: 1

    You can't create an "exact digital copy" via this method unless you store the file in an uncompressed format, which would be monstrously large. You can create a lossy version the same size as the original. Whether the loss in quality is significant is an open question (one would suppose HD users are relatively fussy about quality...), but the fact is it doesn't allow the same type of ripping you can do with DVDs where the copy is exact apart from the removal of contect protection.

    1. Re:Recompression by D.+Book · · Score: 2, Informative

      You can't create an "exact digital copy" via this method unless you store the file in an uncompressed format

      May I add that, even if you did the above, it would still not be exact in many cases, since screenshots are usually taken after the player has filtered the video (brightness/colour adjustments, deinterlacing, etc.), so you'd see a lot of irritating variability between different rips. Someone who downloads an unauthorised copy for free may not care so much, but it'd hardly be ideal for things like personal backups of your discs.

    2. Re:Recompression by Kjella · · Score: 1

      Whether the loss in quality is significant is an open question (one would suppose HD users are relatively fussy about quality...), but the fact is it doesn't allow the same type of ripping you can do with DVDs where the copy is exact apart from the removal of contect protection.

      Considering that those with a 1280x720/1368x768 HDTV will never be able to tell the diffence, I think most are covered. Besides, with the current BD/HD recorder/disc prices, I imagine many will welcome a DVD-R9 rip. 50GB exact BD dumps just aren't very practical at the moment. Since the keys are now AES, they can never be "broken" like CSS was. All you can do is to find a key and unlock all movies up to that point, which at the moment are very few. The "prize" is rising though, the more time passes...

      --
      Live today, because you never know what tomorrow brings
  75. Real complainers DUPLICATE by Anonymous Coward · · Score: 0

    "To make "other" copies is too troublesome. As always, real pirates will use the means they always have. They will work "off hours" at DVD publishing sites making uncounted copies indistinguishable from the counted copies. They will have the production equipment in their homes to make exact duplicates."

    Uh, huh. Just a side-question here. Just how many here are actual pirates? I want to make certain I'm getting this "anecdotal evidence" from the horses mouth, instead of the other end.

    "What it does thrwart is casual consumer copying to better ensure that the consumers will buy multiple copies of the same stuff."

    Really!? Are you telling us that bits ARE like physical objects and will rust and rot and fail in the future?*

    *BTW just how many "multiple" cars have you bought so far because either they came out with a "new and improved" car, or your original car didn't last forever?

    "What I am saying is not new and has been repeated since the creation of the first DVD format."

    Or at least at the point slashdot got taken over by the "me generation".

    1. Re:Real complainers DUPLICATE by erroneus · · Score: 1

      A car analogy is a bad one. Perhaps if you are talking about LEASING a car, it might be closer to accurate.

      But as I own a car, I have the right to modify it or use it in any way I see fit. Under present law and mainstream technology, I don't have that right with media that I purchase legally. And what is my proof of license? Nothing, apparently. So there is no warranty, no guarantee and every restriction imaginable.

      I refuse to call personal and social copying "piracy." At most it's civil disobedience.

    2. Re:Real complainers DUPLICATE by Anonymous Coward · · Score: 0

      "But as I own a car, I have the right to modify it or use it in any way I see fit."

      Yes, however you may not necessarily drive your modification on the road. And your modification could open up you to liability if someone else is injured, or property damaged.

      "Under present law and mainstream technology, I don't have that right with media that I purchase legally."

      Are you aware of what your rights are? Or do you have the slashdot interpretation of what your rights are?

      "And what is my proof of license?"

      It's called a receipt. Just like with all your physical goods.

      "Nothing, apparently. So there is no warranty, no guarantee..."

      Same with F/OSS.

      "and every restriction imaginable."

      And yet you all consume, be it P2P or the store.

      Anyway you're off the beaten path. The point is that you're not entitled to an upgrade of what you have, and you're responsable for taking care of what you purchased. Simple as that.

  76. Re:form. This "front" is obvious. by Sonnekki · · Score: 1

    "screen printing becomes suspect and may even be taken away as an option because it is potentially used for pirating."

    Its called using an old keyboard...are they going to take that away too?
    So sure, they can be Big Brother and take away my keyboard; they'll have to change the OS too. Just because the key isn't on the keyboard doesn't mean I can't invoke it!

  77. The hackers of the future by Random+Destruction · · Score: 1
    --
    :x
  78. what about ppv? by SirSmiley · · Score: 0

    if you wait a few days after a dvd release, it is streamed on ppv on digital units...Ive never had an issue recording from the receiver outputs into a tv tuner input....high def or standard res....be easier than trying to hack a disc?

    Just a thought

  79. workaround by Anonymous Coward · · Score: 0

    I switched my print screen key with my scroll lock key. They took the wrong one! Hah! I am the master of the internets.

  80. Re:form. This "front" is obvious. by Anonymous Coward · · Score: 0

    You already have the right to make a single backup of any media that you legally own in the US. Its given by the copyright laws (came from the time of 8tracks).

    You may make a single backup provided that you do not profit from it (IE sell it without selling the original). Nintendo tried to stop it from happening to SNES carts but failed horribly as the courts ruled against them.

    Happy hunting.

  81. The solution is simple by Anonymous Coward · · Score: 0

    All they need to do is sell the DVDs embedded into a DVD player which in turn is embedded into a HDTV and sell the whole package to the consumer. "A brand new TV with every DVD purchase!"

    That, and have it self-destruct in any attempt to disassemble it.

  82. Re:hrmm.. uh and the audio by Criterion · · Score: 0, Troll

    Damn. Just... damn. Are all Anonymous Cowards as stupid as you?

    --
    We have enough youth, how about a fountain of SMART?
  83. Am I missing something? by underling · · Score: 1

    There is absolutely no way to create a data format that makes it impossible to extract a perfect unencrypted digital representation of that content. At some point, no matter how much encryption and encoding and authentication you add to the disc, the consumer is going to be able to play it in all its digital glory. The mere fact that this is possible means you have to have access to the unencrypted data, which can always be copied.

    They're employing encryption techniques in a field it wasn't suited to address. PKI is meant to be used to allow a user to authenticate that the content on the disc came from a trusted source. It fails when you try to forcefully disallow reading content from a disc if the source (in the case of DVDs, the player. in the case of an XBox, the disc) isn't trusted. This can generally be circumvented by a nerd with a soldering iron.

    Hollywood is spending millions on making it more difficult to emulate an authenticated player, but it's fundamentally futile. You only need to circumvent the authentication once. From then on, you can release software that can do it for anyone that wants it, as long as there's a player on the market that gives you software access to the encrypted content.

    1. Re:Am I missing something? by Anonymous Coward · · Score: 0

      At some point, no matter how much encryption and encoding and authentication you add to the disc, the consumer is going to be able to play it in all its digital glory.


      That's a bad assumption. Currently there are DVD's that Wal-Mart sells that the Sony DVD player I bought at Best Buy will not play due to "region limitations." About 40% of my collection is unplayable with new band-name players, but they play fine with new Cyberhome or with my older Sony DVD player. Why assume the studios are going to allow the consumer to play the movie?

  84. Re:form. This "front" is obvious. by Anonymous Coward · · Score: 0

    While I'm not arguing that they are bullheaded enough to try this, it does show that "we have already won"
    I don't expect AA execs to understand this, or even if they do, to stop pursuing the 'patching' of these holes, but there is essentially no way for them to win other than simply sell us discs that do not have the movie/music on them.

    Let's take up your example, they ban prntscn. Now I'll run your DRMd dvd under QEMU, fullscreen and have my opensource OS prtscrn. Or maybe I'll have another comp run your dvd and hook my OS on it and capture with an x11 tunnel. You'll ban opensource OS's? Maybe I'll take out my handcam and film my screen. Sounds like to much work for a too low quality? Quite. But what I'm trying to illustrate is that no matter what they do, the only way to stop us is to sell a disk that does not contain the sold data on it. And once copied by any person, anywhere, the information can be copied further. And from this point it goes on the terms of the person that did the copying. If I prtscrn your movie I can release it in any format, without DRM if I choose. And doubleclicking a movie on a p2p prog is a whole lot less trouble than holding a cam to the screen. Unlike software, which also contains logic, media is solely information. Crack once, play anywhere still goes for them.

    And all this leads back to a law that no amount of legislation can change: Information is copyable. This isn't a law made by a dude at some point in history and one that can be overturned by bribing judges. This is a law of our universe. When you change the value of pi, we can talk about changing this law.

    Not saying that we should let our guards down, but this fact does give me a good feeling.

  85. In the good ol' days... by LiquidFaction · · Score: 1

    When DVD's first hit the market and DVD-ROM drives became availible for PC's, this was the same approach used in the first-gen DVD rippers... This is preaty close to the "Analog hole" circumvention of DRM, all you really need is a multi-plexer coming off any decent HD home theater setup and run it straight into a tuner card on your pc - Tada! - frame capture without the sore print screen finger.

    --
    Wherever i go, There i am.
  86. Oh no. by Anonymous Coward · · Score: 0

    I found another gigantic hole. I could potentially put a camcorder in front of the monitor or tv and press play while recording. That would record both the sound and the video at the same time. Egads. is the MPAA and RIAA gonna make it illegal to have a television or computer monitor now.

    I've been trained as an artist. Oh God, that means that I could potentially draw the frames that I see by hand. AHGHRRH!!! Help. I hear the MPAA, FBI, and RIAA beating down my door. They are coming to rip my eyes out!!! Help!

  87. Re:form. This "front" is obvious. by MyDixieWrecked · · Score: 1

    In the case of this described "hole", a screen print? This becomes the DRM's worst nightmare? If they succeed in lobbying the PC industry and others and get this hole blocked, all of a sudden a long-accepted practice, i.e., screen printing, becomes suspect and may even be taken away as an option because it is potentially used for pirating

    In theory, this is relatively easy to fix (although I don't agree that it should be "fixed"). Unfortunately, apple has already done something about this in OSX.

    My friend was doing a project for art school and he wanted to paint a collage of madusa's head from Clash of the Titans and Golem from Lord of the Rings... so, being that he didn't have a DVD drive in his computer, I popped the first DVD into my powerbook and when I tried to take a screenshot of the scene he wanted, OSX blocked my cmd-shift-3 keystroke and told me to close DVDPlayer before doing that.

    Luckily, I knew about the screencapture commandline command and that one let me capture the frames from the movies that he wanted. And what's to say that the DVD you're trying to take screenshots of wasn't a home-burned DVD of your friend's wedding or similar?

    So, in my feelings, all this DRM and copyprotection bullshit really encroaches on fair use. It's not just an opinion, it's a fact. It's lame that they make it so hard to print frames from your favourite movie. It's lame that they make it so hard to convert movies into a format that you can watch on the devices that you want to watch them on. Next thing you know, they're going to try to prevent you from inviting your friends over to watch a movie at your place (RFID tags embedded in everyone's skin to make sure that you paid to be able to view the content on the screen).

    --



    ...spike
    Ewwwwww, coconut...
  88. ignorant question about the encryption schemes by ScottLindner · · Score: 1

    I have an ignorant question about these encryption schemes. If the hardware can decrypt it, why can't software decrypt it? They are deploying this hardware, so someone can determine what the algorithm is. Using brute force techniques we should be able to crack the keys, right? I'm curious what makes this encryption so challenging to crack compared to other encryption schemes.

    --
    Slashdot.. where people join together in deliberate ignorance.
    1. Re:ignorant question about the encryption schemes by Wesley+Felter · · Score: 1

      If the hardware can decrypt it, why can't software decrypt it?

      There are software HD-DVD and Blu-ray players, but they are full of obfuscated code to slow down reverse engineering (aka the proverbial sixteen-year-old with a six pack of Mountain Dew and a cracked copy of SoftIce).

      They are deploying this hardware, so someone can determine what the algorithm is.

      The algorithms are already documented in the AACS spec; you're welcome to read it. The secrets are the player keys, which are hidden deep in some ROMs or obfuscated Windows binaries.

      Using brute force techniques we should be able to crack the keys, right? I'm curious what makes this encryption so challenging to crack compared to other encryption schemes.

      You're right; you can't crack any modern crypto with brute force, and thus you can't crack AACS with brute force either.

    2. Re:ignorant question about the encryption schemes by bemenaker · · Score: 1

      All crypto can be cracked brute-force. It's a matter of horsepower and time. Question is, how much horsepower and how much time. There is NO such thing as unbreakable encryption, just how long it takes to break it.

    3. Re:ignorant question about the encryption schemes by ScottLindner · · Score: 1

      That's technically not true but effectively it is. An uncrackable key/algorithm is when the key is longer than the message. Which ain't ever going to happen with movies.

      Isn't this how DVD-Video encryption was cracked? By brute force?

      --
      Slashdot.. where people join together in deliberate ignorance.
    4. Re:ignorant question about the encryption schemes by Wesley+Felter · · Score: 1

      OK, after you spend a trillion dollars and a hundred years cracking a Blu-ray movie, be sure to share it with the rest of us.

  89. Where's Congress when you need them? by kent1146 · · Score: 1

    This is an analog hole. Lawmakers better get to work on finding a way to legislate this kind of piracy tool out of existance, before all of the pirates in the world exploit it and cost the hard-working and honest MPAA another $250 billion in lost revenue.

  90. Re:form. This "front" is obvious. by Mister+Whirly · · Score: 1

    So it is somehow the fault of the CD manufacturer that you can't take care of your CDs? Substitute any other object for CD and see how pointless your argument sounds..
    "I bought a new car and kids/brothers/whatever scratched it up. I believe I am entitled to have my car replaced."
    I have a novel idea - if you spend $50 for a game CD, take care of it.

    --
    "But this one goes to 11!"
  91. Broadcast Flag? by Mateo_LeFou · · Score: 1

    I think the answer's pretty simple: disallow Shift keys and PrintScreen keys on devices that can play DVDs. This could be enforced by a simple "flag" embedded in the content.

    I feel this idea is worth studying and would like Jack Valenti to give me a grant of $10,000 for this purpose. I am completely convinced that this measure will stop unauthorized copying for at least a day and a half.

    --
    My turnips listen for the soft cry of your love
  92. Re:form. This "front" is obvious. by Lord+of+Hyphens · · Score: 1
    So, in my feelings, all this DRM and copyprotection bullshit really encroaches on fair use. It's not just an opinion, it's a fact. It's lame that they make it so hard to print frames from your favourite movie. It's lame that they make it so hard to convert movies into a format that you can watch on the devices that you want to watch them on. Next thing you know, they're going to try to prevent you from inviting your friends over to watch a movie at your place (RFID tags embedded in everyone's skin to make sure that you paid to be able to view the content on the screen).

    It doesn't encroach on fair use, it tramples over it with the subtlety of a panzer division.
    Blitzkrieg isn't just for the military, you know!
    --
    "I've spent my whole life figuring out crazy ways to do things. It'll work." -- Montgomery Scott, "Relics"
  93. hmm by Anonymous Coward · · Score: 0

    Why are they going thru all this bullshit for such shitty movies? Most movies now are not even worth downloading, the best anti piracy is mediocracy.

  94. fetch the coffee by Anonymous Coward · · Score: 0

    this is the lamest thing I have ever seen

  95. Mod parent up up up!!! by Spy+der+Mann · · Score: 1

    We had a virrtualization story just four stories back, i'm thinking it wouldn't be that hard to modify an open source virtualization solution so that the video and audio output devices can be captured from.

    Virtualization. In other words, "rootkit". Take that, Sony!

    Anyway, we users DON'T need such rootkits. It's the "smart sheep" argument. Only one needs to find the hole, the others will follow. And with "follow" i mean "download".

  96. Re:form. This "front" is obvious. by ceoyoyo · · Score: 1

    Your last line is the key. He's NOT paying $50 for the CD. The CD is like the box a computer comes in. If the box gets damaged should your computer stop working?

    Note that you CAN do anything you want with your car or computer. You can make changes to it, take it apart, make a backup copy, whatever you want. It might be expensive to do so, but it's perfectly legal. In fact, I believe manufacturers were recently required to release their trouble codes to make it easier for independent mechanics.

  97. With apologies to Pastor Niemoller by Anonymous Coward · · Score: 0

    First they came for my printscreen key, but I was silent, because I don't print my screen. Then they came for my tilde key, and I was silent, because I don't play Half Life 2. Now they've come for my enter key, and I can only be silent.

  98. In other news... by Anonymous Coward · · Score: 0

    MPAA has begin suing movier goes and DVD buyers (again) for remembering specific frames seen in movies and specific lines spoken by actors in movies. MPAA insists that this is the only way to plug the analog (brain) hole.

  99. Not practical.... by Chanc_Gorkon · · Score: 1

    This is not a practical method. Now it MAY be able to be taken advantage of, but I doubt it. You may be able to record the audio in another file, but getting everything to sync is going to be a pain.

    --

    Gorkman

  100. Re:form. This "front" is obvious. by Mister+Whirly · · Score: 1

    And any game manufacturers offer replacement CDs if you scratch them - since you did buy the game license, they will replace the media it came on. Or you could just do the easy thing I recommended - take care of it from the start. If your brother is a moron who destroys things, don't borrow stuff to him. Duh. Nobody takes personal responsibility for anything anymore - it is just to convenient to blame someone else...

    --
    "But this one goes to 11!"
  101. lol nigger by Anonymous Coward · · Score: 0

    --> slashdot

  102. Multiple Owners of a DVD? by kthejoker · · Score: 3, Funny

    This is only vaguely ontopic, but are there limits to how many people can "own" a DVD (or the license to watch the DVD, or whatever)?

    I ask because if my wife and I purchase a DVD with our collective funds, am I the owner? Is she the owner? Or are we both the owner?

    What if 100 people all contributed a nickel and bought a $5 VHS tape of a movie? Can they each make a copy of it? Do you have to own majority share in the VHS to make a copy?

    What if 10 million people each paid $1 and all agreed to purchase a certain bundle of films and music that was valued at $10,000,000? Clearly SOMEONE must own it, but who?

    Are there any laws about this? I can't seem to find any online (I think my searching skills are for crap on this one), but it seems like a very interesting question.

  103. market forces by matthewg42 · · Score: 1

    I suspect much of the cost of the hardware and the media will be paying off the development of this DRM scheme and buying enough silicon to decrypt the data. Furthermore I suspect they'll try the price increase trick which was done with CDs... tapes and vinyl stayed the same cost, and for years CDs were 150% the price per album that people were used to paying.

    All in all, are people really going to be willing to pay high prices for HD over DVD quality? There'll be some, but frankly I'm skeptical that it'll take off at all. If the new DRM scheme is successful, it'll be interesting to see the effect on sales. If people really do have to pay to get the content, wouldn't it be an embarrassment if the marlet decides that the crap hollywood is putting out simply isn't worth it? Could be the opening the indie film makers have been waiting for. They could buy up the "old" DVD fabrication plants for cheap and really get in on the game. The result might even be in improvement in quality of product for once.

  104. Screencasting? by trashbat · · Score: 1

    Wouldn't screencasting software be of use here? I've successfully used Camtasia Studio to remove the Windows Media DRM from time-limited content that I'd paid for, although the output files were huge.

  105. Virtualize your PC by Anonymous Coward · · Score: 0

    I think the better way of cracking system like this is to virtualize the PC. This way not even the OS knows that you are redirecting the output to a file.

  106. re: hope they don't take our entire keyboard by DonChron · · Score: 1

    This is the whole problem with integrating consumer entertainment media (CD's, DVD's, etc.) and general-purpose computing devices. General-purpose hardware with general-purpose operating systems are good at lots and lots of things. That's why people buy billions of $US worth of computers and software every year. But these general-purpose devices don't fit the expected distribution conditions for entertainment media companies - they can't handle an environment in which the consumer can change the use of the media. The DVD and CD players work just fine in this model - they just play the media.

    But the machine with the keyboard is trouble because of the keyboard and the general-purpose OS environment. Microsoft started down the road to DRM-friendly media-player-only operating systems with Windows Media Edition, but this version of Windows still maintains all the existing Windows functionality.

    This could work out well if an enterprising OS vendor merged cheap PC's with a media-player operating system to create single-purpose appliances. But the general-purpose OS genie is out of the bottle and hardware isn't cheap enough yet (no $50 computers, plenty of $50 DVD players) for people to give up web-browsing and text editing and email so they can have a dedicated media-player. So these two worlds are joined and general-purpose computing is already suffering.

    -don

  107. Re:form. This "front" is obvious. by carlos92 · · Score: 1

    There are a few differences between cars and CDs:
    * Cars are not for kids, CDs are.
    * Cars are still useful after you scratch them (at least for transportation), CDs are not.
    * Cars are not licenced, they are bought.
    * You buy the car to use the car itself, you buy the CD to run the game that is *inside* the CD.
    * The car manufacturer does not restrict what you can do with your car - you can show it to anyone, take pictures od it and publish them on the internet, sell it, rent it, lend it, use it in another country, fill it with gas from any company - anything provided that you comply with applicable laws.

  108. Re:form. This "front" is obvious. by 1u3hr · · Score: 1
    If they succeed in lobbying the PC industry and others and get this hole blocked, all of a sudden a long-accepted practice, i.e., screen printing, becomes suspect and may even be taken away as an option because it is potentially used for pirating.

    Note what has has already happened for Adobe PDFs. If the author is paranoid enough, he can set the security level so you can't print, can't select text in the normal way, etc. Which is a pain whern you actually need to quote a few lines, or copy a string exactly. There are ways around it, of course, the print-screen discussed here for instance; and the notorious AEPBR to strip hte restrictions away, that got Dimitri Sklyarov in trouble, but the latter fails on newer versions.

  109. Re:form. This "front" is obvious. by 1u3hr · · Score: 1
    "I bought a new car and kids/brothers/whatever scratched it up. I believe I am entitled to have my car replaced."

    Whenever I see a car analogy explaining a digital concept I reach for my gun. The point is that the cost of the physical media (of a CD or DVD) is trivial, a few cents. 90% at least of the money you pay is for the use of the information encoded on it. The cost of manufacturing a car is a large part of what you paid. But if you love car analogies, it's like they've made it illegal to paint your car; and have got selling touch up paint made illegal as well. So you can't mix up a pot and touch up the scratches yourself, you have to live with it or buy a new car.

  110. Re:form. This "front" is obvious. by Mister+Whirly · · Score: 1

    Thank you Captain Obvious. I was merely substituting "cars" for "CDs" to show the argument had no teeth. The original conversation had nothing to do with cars.

    --
    "But this one goes to 11!"
  111. ICT not used on titles! by benwaggoner · · Score: 1

    Your concern about CRT is incorrect at this point. All released HD DVD and Blu-ray titles don't use the analog downrez techology ICT (Image Contraint Token). Most of the studios have indicated they don't have any short-term plans to do so, either.

    Also, it doesn't downrez to 640x480. It goes to 960x540, which is quite a bit more pixels.

  112. This is stupid by jocknerd · · Score: 1

    If the movie was actually good enough to make me consider this, then I think I wouldn't have any trouble spending the $25 to purchase the disc.

    1. Re:This is stupid by Brix+Braxton · · Score: 1

      It's not really that stupid - this is how DVD copying started out. It used to take forever and a day because it was a frame for frame capture.

      --
      www.wildpad.com
  113. Re:form. This "front" is obvious. by Mister+Whirly · · Score: 1

    It was not a "car analogy" per se - I was merely substituting one object for another to prove a point. Feel free to substitute any other object for "car" if that word gets your undies in a bundle. Also, I was not explaining a "digital concept" - I was explaining a "personal responsibility concept" . (And your car analogy is possibly the worst I have seen in a while...)

    --
    "But this one goes to 11!"
  114. Re:form. This "front" is obvious. by ceoyoyo · · Score: 1

    Certainly, taking care of things is a good idea. However, CDs are delicate. Playing your CDs in your car is reasonable, but they can warp due to temperature. If your medium isn't in a form that's appropriate for my use either provide it to me in a form that is (free of charge, of course because I paid for the license to the content) or allow me to copy it into that format for my own use.

    You're right -- game manufacturers offer replacement CDs. As they should.

    Nobody's blaming someone else for their CD getting destroyed. I accept the blame. BUT there are two options. Either I bought the content with the exception of the right to distribute it, in which case I should be able to do what I want with it so long as I don't distribute it, OR I bought a license, in which case it's the manufacturer's responsibility to make sure I always have access to that content.

  115. Non-issue by Brix+Braxton · · Score: 1

    I think it's a non-issue. People have been enjoying HDTV movie content for a couple of years now and the leap from DVD to HDTV isn't all that huge so by the time these formats even get a chance to take off, we'll be ordering our movies ITunes style through our cable providers.

    --
    www.wildpad.com
  116. Here's another way. by Anonymous Coward · · Score: 0

    This is a cute technique, but another insanely obvious way is to just "cam" your HD-DVD with your HD-Camcorder. They may have Department of Homeland Hollywood Gestapo Protection Officers stationed in the public theaters with machine guns ready to cut down any would be cammers, but this otherwise brilliant technique of using police and draconian prison sentences to enforce Hollywood's bidding sort of falls apart when the theater is in a private lving room. Moreover, this cam situation offers a far better chance of a good quality rip than a theater situation. The cammer will be able to set up a tripid and do a few test runs to make sure the edges aren't being clipped. The lighting will be easily controlled and evenly adjusted to result in a color matched capture and there won't be people in the audicance talking or standing up in front of the cammer. The audio can be ripped directly from the system resulting in a product very hard to distinguish from the "real" thing. Basically, High-Def should result in a huge increase in the quality and quantity of files available on P2P networks despite all the ridiculous wastes of money and time that the foolish studio execs have been suckered into by the protection racket hustlers who no doubt are well aware that it is all a pile of bullshit.

  117. Re:form. This "front" is obvious. by justasecond · · Score: 1

    youtube.com is beneficial to society? How is a collection of crap videos beneficial to society. Gonna cure world hunger or something?

  118. Only 25 percent more pixels by tepples · · Score: 1
    It goes to 960x540, which is quite a bit more pixels.

    Half 1080 (960x540) is only 25 percent more pixels than full-screen PAL DVD (720x576), although they are likely to be slightly less artifacted pixels.

    1. Re:Only 25 percent more pixels by benwaggoner · · Score: 1

      They can be 10-bit 4:4:4 pixels in fact. And he's assuming that he'll get 640x480 output, so he'll be getting 69% more pixels than he expects.

  119. I'm totally shocked ! by AftanGustur · · Score: 1


    Does this mean that someone has actually bought these things ?

    At least something good came out of it since they found a flaw, but as with DVDs I'm going to wait for the system to be broken before I buy a player myself. (And yes, I have bought heaps of the copyright mafia's movies on DVD, however I want to be able to use tools such as AnyDVD to skip annoying ads and trailers on disks when I watch the stuff I have paid good money for)

    --
    echo '[q]sa[ln0=aln80~Psnlbx]16isb572CCB9AE9DB03273snlbxq' |dc
  120. Trusted Platform Module by tepples · · Score: 3, Insightful
    Now with virtualization technology, where the OS is running virtually, or in VMWare, you'll be able to do a "Print screen" at a higher level than the OS

    But if the PC's Blu-ray Disc or HD-DVD player detects that the operating system is running virtualized, or if you have your computer's Trusted Platform Module turned off, then the software will decode at 960x540 at best or refuse to run at worst.

    1. Re:Trusted Platform Module by Korin43 · · Score: 1

      I was under the impression that there's no way for a program to know that it's in a virtual environment..

    2. Re:Trusted Platform Module by Amouth · · Score: 1

      there are ways to see but most of them are educated guesses.. such as the name of hardware devices and bios info.. but you are right .. there is no register saying HEY YOUR NOT REAL..

      and so there for.. virtulizing it would work quite well

      --
      '...if only "Jumping to a Conclusion" was an event in the Olympics.'
    3. Re:Trusted Platform Module by tepples · · Score: 1
      I was under the impression that there's no way for a program to know that it's in a virtual environment

      The Trusted Platform Module was designed from the ground up not to be virtualizable. It contains a secret key that cannot be extracted from the chip. This key is used to validate its assessment of the boot process.

    4. Re:Trusted Platform Module by mrchaotica · · Score: 2, Insightful

      Well, except for the whole Treacherous Computing thing, that is, because the entire point of it is that there would be an unbroken chain of "Trusted [sic]" hardware and software leading from the framebuffer itself to the TPM to the virtualization software itself to the OS to the application.

      In other words, if the entire system is "Trusted [sic]" then the system will know that it's "safe" to play at full resolution because nothing including the VM will take a screenshot. If, on the other hand, there is a "non-Trusted [sic]" object anywhere on the chain it would immediately assume that it was compromised and would play at the low resolution to begin with.

      So no, virtualization -- or any other "take a screenshot"-like method -- will not work. Not to mention that such a workaround is lossy anyway, and is therefore not a solution.

      In the end there is only one solution to this whole mess: outlaw DRM, and crack the encryption for all the DRM that already exists. I don't have much hope for the US (or the world in the short term), but eventually it will have to happen or else we'll fall into this sort of dystopia.

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    5. Re:Trusted Platform Module by tinkerghost · · Score: 1

      Um, yawn.... If it's on a chunk of silicon, it can be extracted. The documents on how to retrieve the key have to be available to make the MB - that means any cracker with the time on his hands can make an interface to read the data on the chip. Once you have the key, it's easy enough to pass that key back to the OS when you are creating the VM. That's the whole point of VM - you are creating a virtual machine for each of the guest OS's - the trust key is just another driver module.

    6. Re:Trusted Platform Module by tepples · · Score: 1
      The documents on how to retrieve the key have to be available to make the MB

      As I understand it, the TPM doesn't disclose its private key, not even to the motherboard maker. It discloses its public key and can perform RSA using the keypair.

  121. XBOX 360 by tepples · · Score: 1
    Only way to get around that with what we have today would be if MS started selling PCs that are welded shut.

    Five words: Ecks. Box. Three. Six. Tea.

    1. Re:XBOX 360 by Weaselmancer · · Score: 1

      You're right, with the 360 that was exactly what MS was trying to do.

      Unfortunately for them, they don't know how to weld a box closed very well. =)

      --
      Weaselmancer
      rediculous.
  122. *yawn* Whatever by Sloppy · · Score: 1

    This is just one link in a long chain where player software is incrementally subverted. The software gets deployed to the user! It is inevitable that it will be picked apart. Eventually someone will use what they have learned from the player software, to rip a perfect unencrypted stream without any lossy decode/reencode step. It's merely a matter of time.

    Why this isn't obvious to everyone concerned, I have no idea.

    --
    As copyright owner of this comment, I authorize everyone to defeat any technological measure which limits access to it.
  123. Umm yeah right by gr8_phk · · Score: 1

    Is it really feasible to snag the raw pixel data and recompress it in real time? Of course it is, but Joe Public doesn't have hardware to do that. Someone could make a converter box, but it might be hard to buy one in the US.

    1. Re:Umm yeah right by Suddenly_Dead · · Score: 1

      One clever pirate has to rip the movie. Just one. Then it's all around the internet in a heartbeat.

    2. Re:Umm yeah right by NeMon'ess · · Score: 1

      But how many of the movie-releasing organizations have managed to survive for at least five years without being raided by the FBI or equivalent Information Bureau in their countries? A couple times a year there's news stories of some bittorrent-releasing movie group getting caught. How many of these groups have yet to be brought down?

    3. Re:Umm yeah right by i8puppies · · Score: 0

      It only takes one person, not a group, nor an underground organization evading authorities. All it takes is some 16 year old kid in his mom's basement with a high speed connection to IRC or a P2P network and the whole system comes crashing down, because that one kid sends it to maybe a dozen people, then those dozen people send it to another dozen each, and so on and so forth until a couple weeks later when Sony execs download it off of KaZaA or find it floating around as a torrent and realize they have their thumbs up their asses.

    4. Re:Umm yeah right by NeMon'ess · · Score: 1

      Sony pays BayTSP and others to monitor the filesharing networks and try to infiltrate the private FTP networks to track down who is releasing DVD rips and screeners. Hence we get news stories several times a year about groups of people being arrested for releasing movies onto the net. You obviously don't understand how the system works. One person isn't enough to get a file widely spread over Kazaa or eDonkey. And when it comes to HD-releases, the movie studios are NOT going take such an attempt lightly.

      The screeners and rippers upload to private FTP networks, who then allow the uploaders to download their terabytes of movies and software. This way one copy quickly becomes 100. Several weeks later after spreading through college networks and being seeded on BitTorrent, enough people are sharing it over P2P that tens of thousands now have it.

      Now do you think the elite groups are retarded enough to let just anyone in without trying to find out if they're working for the FBI and MPAA? Well the groups that get busted are, or maybe they just got unlucky. You're naive if you think ignorant and or stupid people alone are going to be able to release HD copies onto the net. The studios are counting on Blu-ray and HD-DVD to remain unbroken for twenty years, and after DeCSS, they have the resources, contacts, and co-operation of law enforcement to stop any leaks from a few daring pirates before the leaks become a flood.

    5. Re:Umm yeah right by Antique+Geekmeister · · Score: 1

      Who cares how long they last? Seriously, there are enough eager thieves and hopeful scammers to keep the flow of downloadable DVD images alive for years. And there are plenty of small mom&pop companies in places like China, where copyright enforcement is a tragic joke, that will keep the market well supplied with pirated DVD's for years.

      It only takes a few crackers begging, borrowing, or stealing pre-release review DVD's to keep the crackers ready with their works even before the commercial DVD's are released.

    6. Re:Umm yeah right by NeMon'ess · · Score: 1

      The topic is HD-DVD and Blu-Ray, not DVD.

      Impressively there's been little comment from people who really know about the security in the next-gen DVD systems. From the sound of the article, the firmware has been patched. So other than a few thousand computers with this security hole, the problem is contained. That really hampers the number of people who can exploit it. It also means cracking down on copyright infringers will be much easier, even if the computers are sold for cash to strangers. The Chinese government periodically puts on showpiece raids to placate the West. There's a difference though between a hydra that re-grows its heads all the time, and one that has a maximum of a few thousand. I also wouldn't be surprised if the player firmware can be updated by newer movies. Sony's PSP does this. The title will not run unless the firmware is updated. If so, it'll be hard to frame-capture a movie that won't play without the update.

    7. Re:Umm yeah right by Antique+Geekmeister · · Score: 1

      We seem to be speaking orthogonally. I agree that pirates are taking some extra steps to protect themselves: but it's so cheap and easy to start such piracy, and so easy to protect oneself from the demonstrably foolish and ineffective efforts of RIAA and MPAA to frighten people from file-sharing, that such piracy is certainly going to continue with very considerably success, despite additional technical hurdles raised.

      It only takes a single copy or two, consistently introduced to file-sharing or DVD piracy, to keep the business seeded. If the consumer digital recordings become more difficult to copy directly, the more 3l33t of the crackers will simply move their source of materials upstream, to pirating the files from the often poorly secured networks of movie and CD producers. That raises the initial cost to the pirate, in time and perhaps money and risk of prosecution, but there's just too darned many of them and many of them are too happy to steal their resources.

      And it doesn't matter if, in the long run, individual pirates find it too expensive or time-wasting or dangerous to continue. There continues to be a new group of hopeful crackers to seed the next round of piracy. Such behavior can only be managed somewhat, not prevented, by current efforts. Efforts like Trusted Computing are trying to be more effective, by getting the access to the DVD drive and software tools to play it signature-enforced at a very deep level that would be too expensive for most people to subvert, but I suggest that this will not work well until and unless digital media players are rendered incapable of playing anything *without* a mothership authorized signature. And folks in the recording industry are unlikely to admit this as a goal for some time, or ever to achieve it, even with efforts like Trusted Computing underway.

    8. Re:Umm yeah right by i8puppies · · Score: 0

      "ignorant and or stupid people"

      Don't put words in my mouth.

      Also, you're suggesting as if there is only ONE way to distribute a pirated copy of a movie over the internet, and that you have to be a member of some elite hacking group to do so. That my friend is naive, to think information sharing works within a single paradigm and to think that the internet is policed the world over.

  124. End-to-end, so what's an end? by tepples · · Score: 1
    Except that your movie playing software will refuse to work because your video card has an analog output, and isn't certified to use a digital protocol with end-to-end encryption and authentication.

    Define "end". The "end" of the MPAA digital restrictions management system is the human eye. Replace that with a high-definition video camera pointed at the monitor and synchronized to the monitor's refresh rate. In piratese, they call this a "telecine".

    1. Re:End-to-end, so what's an end? by arodland · · Score: 1

      Notice that this is specifically not what I was talking about. From the grandparent: "I can see the videophile's system of the future: a video driver card with an external analog output plugged into a video capture card" -- my point is that the external output and the capture card would become useless. Sure, you can point a camera at your screen, but doing it right would be expensive and slow. And maybe the next step would be for your video card to refuse to output to a monitor that doesn't have a working "camera killer". Sure, it wouldn't be effective, but it would be one more bit of restriction that you'd be paying for.

  125. Ye cannae stop the analog hole by tepples · · Score: 1
    how exactly do you get the audio, subtitles, extras or indeed anything except raw frame data?

    To get the subtitles, you do another Print Screen run with the video player's subtitles turned on. Extras are merely additional titles that can be played in separate Print Screen runs. To get the audio, you put the player into matrix surround output and play the audio over an analog stereo cable into a second PC's line in.

  126. The jokes on them by popsicle67 · · Score: 1

    Digital encrption just takes time to crack. A formula and a program to run it. It used to be daunting to think about all the power you need in a computer to achieve this but now all you need is a linux cluster of all your friends gaming rigs and even the most sophisticated encryption will be layed open for all to see.

  127. No analog conversion needed by gr8_phk · · Score: 1
    Make some hardware to snag the digital signals going into a DLP chip inside a TV. Of course that's probably much more effort.

    Hey, how much are digital x-ray "plates" running these days? I want to build a home CT device.

  128. DirectX overlay by tepples · · Score: 1
    The concept of taking full-blown movies of your desktop is very old and is used a lot for computer training programs,it would be incredibly simple for one of those recording programs to record the video and audio of a playing movie and save it without the copy protection.

    No. There is more than one way to draw something on the screen: GDI, DirectX window, or DirectX overlay. Most productivity apps (that is, everything but fast action games and video players) use GDI, which the screen capture apps easily pick up. An "overlay", on the other hand is a hole cut out in video memory using a special "magic pink" (#FF00FF) color to display a video in a separate frame buffer "behind" the main screen buffer. Have you ever tried recording a video using screen capture and got only a blank space because the video player uses a DirectX overlay? The new Protected Video Path in Windows Vista is like that but even stronger.

    1. Re:DirectX overlay by Compholio · · Score: 1

      Have you ever tried recording a video using screen capture and got only a blank space because the video player uses a DirectX overlay? The new Protected Video Path in Windows Vista is like that but even stronger.

      I'm fully aware of that; however, when the screenshot key works then recording video with a screen capture works as well.

  129. Line out, line in by tepples · · Score: 1
    how do you "print screen" the audio

    Matrix surround, line out, line in.

  130. DRM Has Too Many Holes by Siker · · Score: 1

    Allowing people to take screenshots is obviously a bad idea in general. How often can you take a screenshot of your computer screen without including copyrighted material? A Firefox logo here, a Windows start button there. Of course I already wrote about an even bigger hole here.

  131. Not on all video cards. by Kaenneth · · Score: 1

    With some driver/hardware combinations when you take a screen shot of a playing video, all you get is the chroma key box.

    The way that works is that wherever the video is to be shown, the player software sets the pixel color to a specific color, like a TV 'Green Screen' (used to be Blue), I've seen dark purple or hot pink used for video card chroma key.

    So, you hit print screen, you get a dark purple square.

    The video output hardware then replaced all of that one shade of dark purple with the hardware decompressed video feed.

    In a 'trusted' video playback situation, the OS may not even have access to the output video stream.

  132. Re:form. This "front" is obvious. by Anonymous Coward · · Score: 0

    You are a fucking idiot. One of the stupidest fucks ever to disgrace the human race.

    You cannot easily make spare copies of those items. There is no option to make a backup on your own. For CD/DVD media, it is a very simple matter to make a spare copy.

    Your analogy is as stupid, misguided, and pointless as your own existence.

  133. Same ol stupidity by sgt+scrub · · Score: 1

    D2AA2D set ups have yet to be "foiled" by copy protection of any kind. The cheapest version of do it yourself D2AA2D converters:

    1) Project the movie on a white screen in a dark room.
    2) Record the movie with a camera.

    I would like to add. This type of behavior by the industry would make someone think along these lines: "Any movie I purchase that is ecrypted to the point of going to extreems to watch it, WILL be posted on the web the next day". Not that I would do anything illegal like that.

    --
    Having to work for a living is the root of all evil.
  134. Next they'll use digital watermarking by bigtrike · · Score: 1

    I predict that the industry's next move will be to require every player to use digital watermarking to encode the devices serial number into the image. I doubt it will have any real impact however.

  135. Ground-breaking new idea! by Anonymous Coward · · Score: 1, Insightful

    "DRM is less than useless right now because all it succeeds in doing is annoy real paying customers and teaching them the cracked versions are better after all."

    Okay, folks, here's how you deal with DRM. It's really easy, so listen carefully and you'll never have to deal with DRM again!

    First, don't buy the movie or pay to see it in a theatre. Second, don't pirate the movie. Third, don't even bother to see it at a friend's house, regardless whether he/she bought it or pirated it. Fourth, just don't see the movie, period!

    Our consumer society needs to get over this perceived need (desire, really) to participate in contrived money-making schemes that are presented as "culture." One way to recognize contrived nonsense advertised as the biggest thing to ever happen ever is to see of the authors/producers/etc. put DRM into place. Putting DRM on something means they are privately convinced their product cannot stand on its own merit.

    "My time can be better spent learning, coding or doing some sport in the future."

    Yes, and this is true for everyone.

    1. Re:Ground-breaking new idea! by Chandon+Seldon · · Score: 1
      The problem is that movies and stuff *actually are* our culture (or at least a significant portion of it). Anyone who doesn't watch any popular movies is seriously culturally retarded. One of the basic properties of culture is that it builds on itself - and today that base includes Darth Vader, Superman, and Captain Jack Sparrow.

      You can argue that hearing the story of Captain Jack Sparrow isn't important, but given the number of people who will have heard it, it's more a part of our culture than any "cultural experiance" you'd be likely to name. It'd be great if our culture was higher quality, but missing out on what little culture we do have doesn't help.

      Now, I'm definately not saying that anyone should pay to see these over-bugetted movies - I'm sure your local street merchant will happily sell you a copy for $3 once they're out on DVD.

      --
      -- The act of censorship is always worse than whatever is being censored. Always.
  136. Re:form. This "front" is obvious. by Anonymous Coward · · Score: 0

    Duh! You don't have to pay for it! Wow, do you need to be spoonfed everything? Think man! What a moroon!

  137. R U Kidding Me? by Anonymous Coward · · Score: 0

    Print Screen? This is definitely in the "dumbest" category.

  138. DejaVu ! Done ~10 years ago with DVD software. by Brit_in_the_USA · · Score: 1

    This is exactly how PC DVD software playback protection was first defeated when DVD's came out. I remember hacks of Playback software that automated pausing the film and doing single frame advances with screen captures.

    The resulting frames where then sent straight to an encoder so a compressed version could be generated.

    The sound would be interleaved later with the compressed video AVI container by playing back the movie at normal speed and capturing the sound by looping the line out of the sound card into the line in and using a standard audio recorder program.

    This was in the few months before the DVD encryption was cracked allowing easier / "pure" digital capture.

    It's is very funny to see after years of development that a work around that was used ~10 years ago on PC DVD playback software still works today.

    Yes there will be artifacts and noise fromt his method but if you are taking the 20+ Gb MPEG2/4 HD source and compressing to ~4 Gb of MPEG4 then you would be hard pressed to tell which were artifacts of this process compared to a "pure" digital trans-code / conversion.

  139. Re:form. This "front" is obvious. by 1u3hr · · Score: 1
    It was not a "car analogy" per se - I was merely substituting one object for another to prove a point

    My point was that it's not just an object you're buying. Every manufactired good has an intellectual property component -- design, research; but a game CD that's virtually the entire cost. For a car, it's mostly hardware.

    In any case, analogies can't prove anything; they can only suggest. People start with "think of X as a sportscar..." and before you know it, you're not talking about X, but sportscars.

    (And your car analogy is possibly the worst I have seen in a while...)

    Thank you. I'm hoping to wipe them out by showing how absurd they are. Sadly, people never realise how absurd their own analogies are.

  140. Oh Yeah Right... by eno2001 · · Score: 1

    ...like some dude is going to sit there hitting the print screen button 97,000 times. But wait, that gives me an idea! OB HACK: Overclock the repeat timer in the keyboard so that the key click rate is something like 100,000 a second and maybe this would work! And it would be WAY faster than using a ripper since it could just take a single key press to rip a whole movie!!! OK. So maybe this isn't such bad news after all! :)))

    --
    -"...bad old ideas look confusingly fresh when they are packaged as technology" - Jaron Lanier (Digital Maoism on Edge.o
  141. Re:form. This "front" is obvious. by Mister+Whirly · · Score: 1

    "Sadly, people never realise how absurd their own analogies are."

    Ain't that the truth!

    It's like if you bought a sportscar, and then,...

    --
    "But this one goes to 11!"
  142. Re:form. This "front" is obvious. by jaxom_01 · · Score: 1

    I doubt very highly that the print-screen function would be removed entirely. I work in a FDA controlled company. Part of that FDA controlling is that we must write test cases to validate software. The output of those test cases are almost always a print-screen. -Aaron

    --
    The post made with 100% recycled electrons
  143. You are wrong, wrong, wrong. by Anonymous Coward · · Score: 0

    If the holes are closed before "mom and dog" buy the tech then the game is over. Us geeks are a ridiculously small minority of the population. We need "mom and dog" to care about the issue, and to do that requires blowing holes in the technology only AFTER MOM AND DOG HAVE SPENT THEIR HARD-EARNED DOLLARS ON IT. Until then, "mom and dog" simply cannot be educated on this issue. It is far too technical, far too complicated, and far too out-in-the-hazy-distant-future for them to understand.

  144. 3 reasons piracy continues by Anonymous Coward · · Score: 0

    1. Children enjoy watching movies over and over again.
    2. Pack-rats are more entertained by growing their collection than by its contents.
    3. L337 H4xoRs like the challenge of breaking the protection.

  145. Who gives a crap about real time? by Anonymous Coward · · Score: 0

    Unless they are also going to ban the pause button and frame-by-frame advance features, who cares about the ability to do this in real time?

  146. Better idea by dawhippersnapper · · Score: 1

    If they just start making the movies where only computers can view them, people won't want to copy them anymore. *hint: people can't view them*

    --
    Freedom is fragile and must be protected. To sacrifice it, even as a temporary measure, is to betray it.
  147. DMCA by Kaseijin · · Score: 1
    Its not a violation of the DMCA to circumvent the protection on a DVD (or BluRay, or HD-DVD) for purposes of fair use.
    Fair use is not a defense to DMCA violations.
    If the mechanism protecting the media is trivial enough that the average user can circumvent it without sepcial tools, then all is well.
    As far as I know, no standard for 'effectiveness' has been set. Do you have information to the contrary?
    1. Re:DMCA by rpdillon · · Score: 1
      Fair use absolutely is a defense for DMCA violations. This is a factual dispute and can be easily resolved by reading the actual law. In section 1201(c) of the DMCA text:

      "(c) OTHER RIGHTS, ETC., NOT AFFECTED- (1) Nothing in this section shall affect rights, remedies, limitations, or defenses to copyright infringement, including fair use, under this title."

      Not sure they can be much more clear than that.

      "then all is well" was a reference not to the law, but rather my determination that "all is well" when the average consumer doesn't have to violate the DMCA to circumvent the protection for (supposedly) fair use. If a normal user, in the course of exercising fair use, was made a criminal by this law (which can happen, say, with DeCSS), then all would not be well. It was just a statement of my opinion on the subject, not a legal determination.

    2. Re:DMCA by Kaseijin · · Score: 1
      Fair use absolutely is a defense for DMCA violations. This is a factual dispute and can be easily resolved by reading the actual law.
      You've made the typical error in your reading. Copyright infringement is not an element of the offenses defined in 1201(a) and (b), so 1201(c)(1) is totally irrelevant to those offenses. Those two sections direct the Librarian of Congress to assess the chilling effect and grant exemptions for specific noninfringing uses, which would be unnecessary if infringement were a prerequisite for those offenses. Members of Congress have introduced bills which would extend the fair use defense to DMCA violations, which also would be superfluous if it already implicitly applied.
    3. Re:DMCA by rpdillon · · Score: 1

      Now you've piqued my interest. =)

      I think you're right. But...it is only illegal to circumvent the protection (which includes unscrambling a scrambled work, as a normal DVD player might do when you purchase it) when you do not have authorization to do so from the copyright holder.

      If I use DeCSS on my Linux box to watch a DVD I purchased, haven't I obtained authorization from the copyright holder to descramble it implicitly, given that I purchased the DVD for home viewing from the copyright holder? Surely purchasing the DVD is authorization to descramble it for purposes of home viewing, yes? In this respect, I would assume DeCSS is no different than your standard DVD player.

      A related question would be whether the actions a totally legal DVD player engage in to watch a DVD quality as "circumvention" as it is defined in 1201. It look like it would: "descramble a scrambled work, decrypt an encrypted work..."

      However, this would have a huge impact on "fair use" backups that I copy to my laptop for travel, for example. Is it illegal for me to copy my DVDs that I purchased to my laptop for viewing on an airplane? It would seem so, given the reading you propose (but not under the reading I've been assuming all this time).

  148. You're a fucking idiot by James+A.+V.+Joyce · · Score: 0

    When you use a completely different Latin phrase to the one you meant to try and look smart, that's not a fault of "grammar", that's a fault of "vocabulary", aka "ignorance". Way to be a grammar nazi nazi.

  149. You're also a fucking idiot by James+A.+V.+Joyce · · Score: 0

    "Whom" is never used for the subject of a sentence. Idiots who make this mistake are irritating to whomever their poor victims are.

    1. Re:You're also a fucking idiot by DerKlempner · · Score: 1

      I'd rather be an idiot making that joke again, than be the idiot you are who can't understand it was a joke.

      --
      UNIX: Find it, fsck it, forget it.
  150. DMCA by dannoz · · Score: 1

    So... what... pressing a button on my keyboard is a DMCA violation?

  151. Re:form. This "front" is obvious. by Anonymous Coward · · Score: 0

    Yeah, just like good old email. I can't send a great many files as attachments because someone said they were "bad", mmm'Kay?
    Well, Duh! opening packages from any unknown source is potentially deadly, so why haven't we all boarded up our letterboxes?
    What's even worse is when a whole linux newsgroup starts supporting this type of censorship. WTF? How can some people misunderstand the meaning of "free" so completely???

  152. Not so much, really-Something from nothing. by Anonymous Coward · · Score: 0

    "A/D conversion isn't perfect because of noise, but you can play back the movie/audio/whatever as many times as you want and average the noise away, or use fancier statistical algorithms to reclaim the original content, pixel-by-pixel, frame-by-frame. If you're worried about A/D bias, run it through multiple playbacks on different hardware. It just isn't that hard. Anyone who has worked in digital imaging (my own backgroud is in realtime x-ray) knows how easy this is."

    Uh, huh. Did they also teach you in class that you can't get out what isn't there. Oh you can fake it. You might want to read shannon's paper when you get a chance.

  153. Re:form. This "front" is obvious. by True+Vox · · Score: 1

    Wait, WHAT game maker will hook you up with another copy for a scratched game? I'm not familiar with this. Honest question, I'm really very interested.

    --
    "Gratuitous complexity is akin to chaos" - True Vox
  154. or by mattyrobinson69 · · Score: 1

    What about recording a VNC session, or playing it inside a VM? Im pretty sure vmware can record to flash, can it record to avi?

  155. A week per movie by Wry+Cooter · · Score: 1

    Let's say your script to advance a frame, save a screenshot to a folder takes 3 seconds. For a 90 minute film, at approximately 30 frames every second of movie, for 5400 seconds (162000 frames). One minute and a half for every second of screen time. 135 hours or 5.6 days to copy a movie that way. Any one want to do a calculation for the amount of disk space you would need just to save the screen caps without all that mpeg compression reducing the redundancy?

  156. Re:form. This "front" is obvious. by sl4shd0rk · · Score: 1

    > screen printing, becomes suspect and may even be taken
    > away as an option because it is potentially used for pirating.

    Everyone.. switch your keytops around on Print Screen and Scroll Lock. That should keep the MPAA busy for a while.

    --
    Join the Slashcott! Feb 10 thru Feb 17!
  157. Who's to say people even WANT the best? by photomonkey · · Score: 1
    I don't think people are as interested in having the highest quality anymore. They want something acceptable to them.

    Back before CD burners were available/commonly affordable, how many of us were happy to get a tape made of the same disc? The loss in digital to analogue conversion wasn't enough to keep people from doing it.

    Today, people will happily take pretty high resolution (DVD or TV content) and resize/compress the heck out of it for playback on an iPod or other portable device.

    I think for most of us, if we're paying for a product, we want it to work at its fullest potential. Whereas if we're not plunking down hard currency for an item that typically costs money, we don't care so much about quality.

    DRM may temporarily or even permanently prevent people from making full-res copies of music and movies, but how many of us will really care about the nearly imperceptible loss of quality in a ripped/copied/pirated movie or music album?

    Hell, if I were a movie or music label, I'd gladly GIVE away (over t'IntarWeb) acceptable, but lower quality digital copies of movies and music; while at the same time SELLING high resolution or best-quality versions of the same content. Use the freebies to discover the markets that will pay for the added features of the 'paid-for' version (such as liner notes, director commentary, reliable media, quality packaging, etc.).

    --
    Message contains 1 attachment: spam.gif
  158. Re:form. This "front" is obvious. by Mister+Whirly · · Score: 1

    All of the bigger ones. You would have to check the indiviual companies for their policies, but for example, here is what Blizzard's http://www.blizzard.com/SUPPORT/?id=asc0133p replacement CD policy is -
    Damaged or broken CD:
    You will need to mail in the damaged or broken disk(s), and a $10 US dollar money order (per game) to the P.O. box listed below to cover shipping and handling costs. No personal check or cash will be accepted.

    --
    "But this one goes to 11!"
  159. Ground-breaking new DRM. by Anonymous Coward · · Score: 0

    "One way to recognize contrived nonsense advertised as the biggest thing to ever happen ever is to see of the authors/producers/etc. put DRM into place. Putting DRM on something means they are privately convinced their product cannot stand on its own merit."

    I was with you up to this point.* If DRM sends that message, then what does locks on your doors say? "Hi I'm Mr homeowner and I'm not a REAL MAN(TM) able to defend what's mine by standing 24/7 with a REAL GUN(TM) to blow you away."

    *Which BTW is from the same class of statements as "If you're not doing anything wrong, then you shouldn't have a problem with government surveillance". In other words DRM has nothing to do with merit, and anyone who tells you different at best is naive, or at worst has an agenda.

  160. Theres always a way by Mantrid42 · · Score: 1

    Even if they encode it with an unbreakable cipher, even if they remove PrtScr, even if they lock out unsigned drivers and plugins, there will never, ever, be anything to stop me from putting a video camera in front of my monitor.

  161. A pictures worth a 1000 words but I cant hear them by Anonymous Coward · · Score: 0

    Not only that but no one seems to realise that this doesn't 'do' audio... where's my 7.1 surround?

  162. Piracy - an activity for sleazebaggs or, in this by notaprguy · · Score: 1

    case...people with nothing better to do with thier time than save thousands of files one at at a time. Please...rate this post flame-bait. I'm beyond disgusted with the low-lives of the computerworld.

  163. When will they learn? by abertoll · · Score: 1

    When will people learn that if someone can decode it in order to view it, they're just ONE step away from making a RECORD of whatever they saw? I mean it reminds me of those people who try to use javascript so you don't download pictures from their website.

    Hey, if I can see it on my screen, that means I've already got it. I can figure out a way to make a copy.

    And does all of this help with the pirates who just want to make exact copies of the discs anyway?

    --
    "he drew his sword Ringil that glittered like ice... and he wounded Morgoth with seven wounds..."
  164. Invisible hand by BerlinHipster · · Score: 1

    Fortunately, the market is regulating itself. For example, Gnarls Barkley rose on downloads in the UK and are signed with a small Indie label - no major. See http://www.businessweek.com/smallbiz/content/jun20 06/sb20060628_285213.htm?campaign_id=search

  165. The "Enemy" Knows the System by orospakr · · Score: 1

    AACS still suffers from the same critical flaw as CSS did, and indeed most other forms of DRM.

    It violates Kerckhoffs' principle. http://en.wikipedia.org/wiki/Kerckhoffs'_principle

    Secret algorithms or data that the consumer is not "meant" to see are still stored locally inside that little black player box you bought from wal-mart. And, more usefully, inside player software intended for a personal computer. This information is kept hidden only by security-by-obscurity mechanisms. There is a long history of people successfully extracting such information from executables or ROM firmware dumps.

    It really is only a matter of time until this is cracked, just the same as CSS was.

    Apparently Johansen, one of the people to originally break CSS, is already working on AACS circumvention.

  166. Print screen?!? by Anonymous Coward · · Score: 0

    Pshh, I've got a video camera and a tripod.

  167. Camera killer? by tepples · · Score: 1
    And maybe the next step would be for your video card to refuse to output to a monitor that doesn't have a working "camera killer".

    How do "camera killers" work, and how are they not visible to the human eye?

    1. Re:Camera killer? by arodland · · Score: 1

      For reference, see, um, slashdot. Plenty of articles recently. I'm talking about the sort of thing they use in movie theaters, just miniaturized. I'm quite sure that they can be bypassed as well, but as I said before, that's not the point.

  168. It would be nice, but... by Kaseijin · · Score: 1
    In this respect, I would assume DeCSS is no different than your standard DVD player.
    Your standard DVD player is authorized by the DVD Copy Control Association to decrypt CSS. However, since my last post, someone has reminded me of Chamberlain v. Skylink. The Federal Circuit found that the owner of a product containing embedded software has an inherent right to use that copy of the software as they choose (in this case, the software in a garage door opener in conjunction with an 'unauthorized' remote). If this finding is correct, I see no good reason why the doctrine of implicit authorization would not extend to all copyrighted works. Unfortunately, I think the court got it wrong; they held that Congress did not intend the DMCA to alter the balance of copyright. I think they did, for the reasons I gave above.

    Is it illegal for me to copy my DVDs that I purchased to my laptop for viewing on an airplane?
    Making an image of an encrypted disc is legal, since the access control measures remain in place. The usual rip-decrypt-transcode process violates 1201(a), by my reading.
  169. Re:form. This "front" is obvious. by Bert64 · · Score: 1

    Then why are these companies being allowed to get away with copy protection schemes?
    They may be easily crackable, but not by joe public, who is the most likely to need a backup copy.

    As with most such security measures, copy protection schemes just hurt the legitimate users.
    Those who can crack the schemes themselves, or know people who can, probably already use downloaded versions anyway.

    And to continue the trend of a car analogy (even tho the first one made no sense whatsoever) look at codes on car radios.
    I have a radio in my car, which has a 4 digit code that needs to be entered if the battery is disconnected, recently the battery was replaced and i spent a couple of weeks without a radio because that's how long it took me to find the business-card sized card with the code on it.
    On the other hand, someone who steals car radios (or deals in radios stolen by others) will know methods of easily and quickly resetting the code... I've seen (and user) legit garages that do it in seconds, and car radios still get stolen even tho most have codes nowadays, so it's pretty clear the thieves know how to break these codes in a pretty trivial manner.

    And then you have my grandfather, who managed to get his radio locked out (3 failed attempts) because the code supplied with his car, was not the code currently set on the radio (clearly the previous owner had mislaid the code and had it reset, because the serial numbers on the radio matched the car according to the dealer) was not the code written down in the car's handbook (which was the original code according to the dealer)...
    Anyway he took it to a main dealer, they looked up the code that was supposed to be on that car (seems most manufacturers keep a database of radio cars linked to chassis numbers) and that didnt work, so they reprogrammed the code, reprogramming it took all of 5 minutes but he still had to pay for the service.

    A radio without a code would have saved him a considerable amount of time, hunting around for the code, calling the guy he bought the car from, taking time off work to go down to the car dealer...
    It would have saved a thief 5 minutes of his time.

    --
    http://spamdecoy.net - free throwaway anonymous email - avoid spam!