Slashdot Mirror
Is The Internet Destroying Spanish?
Ant gestures ambiguously at this ZDNet Latin America story which reports the unhappiness of some academics with the increasing use of English or English-influenced words in the tech world, which they say is hurting the education of Spanish speakers. A short excerpt: "Some say the jargon of technology is destroying
Spanish, and some are worried, including Odon
Betanzos, president of the North American Academy of
the Spanish Language. Betanzos recently sent an open
letter to the other 22 academies worldwide. The letter
raised a harsh cry in defense of the Spanish tongue."
Queso?
:)
(Que Systemo Operativo - Which OS)
Im quite happy to borrow from spanish when they have words as useful as that. mmm, taco, chili con carne, tequila.
Most of the rest of the Spanish i know is from pronouncing French in a Spanish way (and similarly French by saying English words in a French way this is made possible only by a large vocabulary and a rudimentary understanding of how to construct/deconstruct English/Latin words). And of course the BeeGuy on the Simpsons. ( Me guesta tequila!
Besides, everyone speaks their own language in a very personal way that often is not understood outside a very small group of friends.
"Words are what you mean to say, no more no less" -- the Cheshire Cat, Alice in Wonderland
The main reason in which I am writing, I speak Spain-rooted Spanish (rather rusty, I haven't spoken more than a few words in years gone by.. still have it but I find myself forgetting words quite often
I remember a quote I heard that reminds me of this, "Never trust a gringo who speaks spanish, or a mexican who smokes cigars."
Dacels Jewelers can't be trusted.
No, no Nahuatl speakers that I know of here in Montreal (ahem), but there's like 1.3 million Nahuatl speakers in Mexico. There's also a few million Quechua speakers (the language of the Incas); Quechua is even an official language in a few south American countries. And 95% percent of the population of Paraguay speaks Guaraní. The Mayan language family has over a million speakers.
The conquistadores *were* very intolerant of non-catholic worship, but they were tolerant of native languages (in the sense that they had no urgent desire to eradicate them; it *is* true that monolingual speakers of a native language frequently face prejudice). Native languages in general face less of a risk of extintion in ex-Spanish colonies than in the US. The Bible was translated very early on into several of the widespread native languages, for instance.
We have little cause for pride here in the North, but to be chastised by an Hispanic for our failure to respect other cultures and languages is ironic indeed.
There is no irony. Period. The Spaniard conquistadores, despite all their inexcusable actions, were mild compared to English pioneers. This is a historical fact that can be shown by mant sorts of data-- language survival like above, or an analysis of official policy of the Spanish empire (from the very start, around 1505 give or take a few years, the queen declared the natives to be her subjects, which, yes, is very imperialistic and arrogant, but it also meant that the natives were entitled to equal protection and to be members of the colonial society, even if they hardly ever had it. Native americans in general were not granted US citizenship until the '20s, IIRC).
In a nutshell, the Spaniard colonization was interested above all in christianizing the natives, and was a lot happier to have them around than other colonizations. The American pioneers mainly wanted more land.
Maybe I've been misled. You're clearly an educated man -- can you name an AmerIndian who's known for something other than being killed by the Spanish?
Why, Rigoberta Menchú, Nobel Prize of Peace, comes immediately to mind. The Zapatistas in Chiapas are mostly amerindians. And this is only touching the surface.
You seem to be under the terrible misconception that the Spanish killed the natives where they went. I'm sorry, but that would be the English. The Spanish took over land and converted them to christianity, many times with a perjudicial effect on their culture, language, and livelihood, or many times introducing disease that decimated populations, but outright massacres were comparatively rare.
Are you adequate?
Then shouldn't we have podestrians?
You just don't get it do you?
Claims of preservation of culture are nothing but close minded bigotry. Never have there been attempts to fortify American culture against the rest of the world, and due to that we are a beautiful melting pot of all cultures. Of course our culture is not all good, but what culture is?
Bringing people together is a worthy goal, and language is a huge barrier to that. That goal shouldn't be compromised just because you are afraid it will "tarnish the culture". Besides, legislating what people can say or write is an affront to your peoples liberty.
Sigs are awesome huh?
------- What exactly is real?
Fortunately for us Indians, our British rulers set up a system of English education before they left. The net result is that if you travel to any reasonably civilized city, you'll be able to get around knowing just English.
Its those slight difference in vocabulary that can catch the unwary.
For example the following could lose the meaning in being translated between US and UK english (and vice versa):
What a gay day
Marks out of ten I'd give her one
I'm just popping out for a fag
'Bob'
Give us an 'E' Bob
franger banging
Got any Vera's
You're Mum
Camper than a VW
Your's looks a bit like Anne Widecambe
Your tits have secondary harmonics
Hmm I fancy a scooby snack
shag
John Thomas
Unlike common US terms that anyone understands
For example everyone understands WASUUUUUP!!!!
How is an influx of loanwords from other languages "destroying" Spanish? This happens all the time in other languages, and no one complains of them being "destroyed" on account of this, with the notable exception of French.
English, in parrticular, seems to thrive on loanwords. Last I checked, it had over 40,000 from Japanese alone. Why is this the case? I don't know; perhaps it has to do with the diversity and melding of cultures in the US. Several other languages, such as Japanese, also readily accept loanwords, and we don't hear people crying out that loanwords are destroying their languages.
The fact is, languages evolve over time, be that for good or for ill. Linguists have estimated that the longest any language has been able to survive without significant changes is roughly a thousand years or so. If you aren't willing to accept this, either you'll be branded as an arrogant, pretentious jerk (which you are, if you do this) or you'll find yourself left behind as the language changes around you.
----------
> Did you know that France actually has a government beauru to fight the cultural and linguistic invasions of other nations?
So Does Spain, The Spanish Royal acedmy of Lanugugae
An in spain they have other Iberian languages to worry about interefering like Basque
-Compenguin
Tío, se me murió el disco duro así que tuve que ejecutar fsck en el raid scsi y en el disco ide (que uso para las fotos)
Man, my hard disk died on me so I had to run fsck on the scsi raid and on the ide disk (which I use for photos).
:-)
I feel that if new inventions (the Internet) and thinking about the world on a global scale push everyone to speak a common tongue, in this case English, then I'm all for it (then again, I am already fluent in English, so my view may be jaded a bit).
Has anyone here seen my Penguin? The Linux Pimp
--It's Pimptastic!--
Exactly right. And you know - it's not the internet that's causing the spread of English influence in language...it's globalization. With the commodification of the Internet that has happened in the past 3 years, the Internet simply becomes the global economy's latest vehicle for hybridization of culture (language being a subset of culture).
Is this a good thing? I don't know - in some cases. Is this a bad thing? Sure, in some cases. The standardization of language is inevitable as globalism makes the world smaller and smaller and more accessible. That's "good", IMHO, sometimes. But if it results in the loss of the cultural richness of some minority, then I feel it can be a "bad" thing. The beautiful thing about culture is that it is a renewable, evolving resource. As quickly as we lose "culture", new culture pops up. The problem exists when that new culture is entirely western-centric.
And yes, while I am about as white as white can get, that is a problem. I value culture - new and old - and applaud efforts to maintain traditions. It's not a purity of language argument at all, as far as I am concerned. The spoken word should change as much as it needs to to keep up with changing times...but, when the additions to the local language include "McDonalds", "Coca Cola", "Pepsi", and "The Gap"...and traditional culture begins to disappear as the result of this influx of American culture...I question the positivity of the effects (and sources) of the changes.
hispanoamerican speech in Guanajuanto and Rio are quite different, specially because Rio is in Brazil and people there speaks Portuguese.
Dragonmagic is the homepage associated with his account. Most people have them - you don't.
Check out Sonya Keene's _Object-Oriented Programming in Common Lisp_ for examples of the utility of multiple inheritance (e.g. mix-in classes).
C++'s poor specification and poor implementations teach one to take care when designing languages, not that all the features used in C++ are necessarily bad.
Rev. Dr. Xenophon Fenderson, the Carbon(d)ated, KSC, DEATH, SubGenius, mhm21x16
I'm proud of my Northern Tibetian Heritage
Spanish will not die, as we discuss this topic, there are good internet sites being created that will keep spanish going. No nos preocupemos. But if Msoft takes over the world, we will be speaking C#.
If I wanted to say Americans I would've said it. I mean people in general. Practically everyone around me knows English as a second language and is satisfied with that. They also think English is cool as a result of USian propaganda and that contributes to the final effect.
I believe that by teaching English as a first language one contributes indirectly but strongly to future intellectual stagnation. I'm not saying English corrupts people _as a language_. I'm just saying that by learning English you receive a cultural/social baggage that might interfere with the learning of other languages.
English speakers frequently have the idea that basic communication is all there is to a language. I attribute part of the blame to the cultural/social baggage and another part to the language's inherent simplicity.
Reject does mean "not learn adequately or at all".
It doesn't take a Ph.D. to figure that out.
I agree.
I'm glad we didn't have to start the flag waiving process.
Yes, but some are much more elaborate and complex than others.
How would you compare the complexity of South American indigenous languages to that of romance languages, for example?
The same type of comparison is valid between English and other languages.
tee hee.
Wrong. I have this attitude precisely because I speak and write much better than the natives. And English isn't my mother "toungue". [Off the record, I've never heard of "spelling contests" in other countries and in other languages. It's ironic that American children turn out to be the worst spellers.]
Well, I DON'T. And not in my third or fourth either.
But you forget that's beside the point. I'm criticising English for being too simple, not because I suck at it.
For example, I think German kicks serious ass. Why? Because it has this inner logic and structure that English is just pathetic at.
As another example, have you ever compared the verbal structure from English (or German, even) to a romance language's? Latin kicks ass.
I didn't marginalize it, otherwise I wouldn't read so many books in English or even try to learn it.
This isn't a question of pride. It's an objective comment on a language's characteristic.
They have not. That's not the point.
That's reprehensible. Unfortunately, you're doing it to my language, and so you're the reprehensible one now.
You obviously have no base of comparison and fail to observe I speak of vulgar English!
One can find practically every latin root in every occidental language and syntax can be manipulated to extreme limits, thus creating the "Shakespeare effect" in any language, no matter how infantile it is.
Go read unabridged Goethe or unabridged Luis Vaz de Camoes. Shakespeare barely hits the average and is only acceptable in comparison.
Flavio
You hear the same things in Sweden, where I come from. And it's correct in a way, but it's (IMHO) both a good thing and impossible to stop.
All through history language areas have been formed by practicality. Any area where communication is so developed that people need to talk to each other frequently enough, will develop at least a common second language that everybody uses when talking to other groups, or if the contacts are frequent and intense enough everyone will speak the same first language after a few generations.
This is a good thing. Without it we would not be able to talk to most of the people we meet everyday.
The situation at this time in history is that communications are developing very rapidly. People from different corners of the planet are talking to each other at an ever increasing rate.It is already clear that English will be the second language of the entire developed world soon. There is still not enough pressure to make it the first language of the world, but I think that if communications develop at this rate for a few more decades, it definitely will be.
Already more than half of the 6000 languages spoken will not survive to the next generation- many due to pressure from Spanish. Of course, the small languages go first. Giants like Spanish will be around for a long time.
Those who fight for the purity of their language often forget that their language area was formed in a similar way (if not through far more brutal ways), and if all languages had been preserved then, there might well be 5 or 50 languages spoken there now.
And don't equate language with culture. Customs, religions and most of the other things that make up a culture are not language dependent at all. But do expect cultures to mix more and more as a result of the increasing communication as well.
the Spanish speakers of the world (and there are a lot of them) should focus their energy on making their economies more productive.
As true as this is, but sadly, it seems it won't be tried.
I'm not an econ or politics guy so I don't know why the economies of Spainish speaking countries aren't doing so well. Could it be culture? I think corruption of the governments comes into play here too.
Totally disagree. You're taking darwinian logic too far. There's a BIG difference between everyone knowing one same language to communicate between each other on a global basis (this, I agree it's necessary) and everyone speaking it on a daily basis. Why on Earth would you want to do that?, losing your very own metaphors, potential jokes, songs, hidden meanings.
I think you ought to have more respect for your own language; there's got to be great literature produced for it that no one else can enjoy as much as you danish-speaking people do. That's important; that's part of your culture and defines who you are. It is NOT unproductive or stupid for everyone not to speak the same language.
Let us translate your example to computer programming. "However, I woudln't mind if Perl was removed from the face of the earth. In fact, I woudln't mind of Lisp was removed from the earth (my programming language of choice). " That statement would instantly get you flamed by thousands of Perl and Lisp programmers who, although they know there are other options, choose to use this way to express themselves. And yes, it might be a real pain to read this guy's code when you have to mantain it or if it's been OS'd and you wish to modificate it. Or it may be frustrating because the program is written on Python and you don't know Python. BUT if it really mattered to you, you could learn that new language as many people I know who've gone to great lenghts to learn foreign languages so they can enjoy local literature without the distortions of translation. And yes, it's much harder to learn Portuguese than C (or maybe not) but it's a rewarding, culturally enriching experience.
"All the things one has forgotten scream for help in dreams". Elias Canetti
But which version of english?
:)
Do we stand in lines or queues?
Do we go on holiday or on a vacation?
We we watch or mind our step?
While on vacation in London, the first day I was standing in line to buy a underground pass and some lady walked up and asked "Are you in the queue?"
She had to repeat it four times before I understood what she was talking about.
Of course my immediate reaction was to wonder if the queue was FIFO or LIFO.
Take a look at history. It's always been revolutions or people going to a foreign land, starting fresh, that true innovation has been able to take place.
Take a look at U.S. If we didn't break from the English, the good old traditions from the motherland would never go away and people will keep grabbing on to the old ways of doing things, even though many such things are not right.
Look at Japan. They got away from China.
Look at China. Look at how hard it is for them to break from their 5,000 years of tradition. Don't get me wrong. Most of it is good, but there are still fundamental ways of thinking that just refuse to go away easily.
You see, culture is a glue that binds a people together and prevent them from breaking apart. But it comes at a price. And that price is the unwillingness to change, especially when the world is changing and one needs to adapt quick.
Think of what I just said as social darwinism. It's about the survival of the fittest. Obviously old cultures don't want to go away (they'll be extinct if they do), but at times real change is needed if one is to be fit for survival in the coming millenium.
Ok, enough of my long-winded philosophy...
The true role of language is for communication, but culture has invaded it to a point where governments would rather make their own people learn the same thing many different times, than to just adapt to whatever is popular. Instead of just letting its people use "internet" they'd rather their own people use "insert-your-own-language-specific-vocab".
Really, is this necessary? This Odon Betanzos is trying to preserve his culture at the huge expense of adding that extra barrier to innovation and freedom.
A consortium of companies and universities have started a new research project for a universal translator. The translator is a tiny intelligent device that you insert into your ear, and voila, you can understand everything that I say, even though I may be talking in an alien tongue.
Now if only I could remember what the project's name was...
oh hell, let's all just use Pig Latin from now on...
flinging poop since 1969
No hablo espanol porque ingles es gordo linguistica.
Gordo spelled with a "ph" mind you.
Futhermore, Queiro conocer si seras mi novia?
Wasn't the internet developed and released from the CERN, which was on the border between Switzerland and France? There you would have German, French, Italian, minor English, but no Spanish, really. And the development of many of the materials on the Internet, including applications, hardware and designs have been mainly from an English origin.
It's not only Spanish which is being "destroyed" by having to integrate English words of "jargon" for technology, but so many more languages. Since World War II, Japanese has been adding quite a few words of English into their language, sometimes even replacing words they already had with English words.
It's a little arrogant to ask everyone to make everything accessible to everyone else. Instead of asking that people start integrating other languages into the internet, or allow for more foreign jargon instead of English words, why not just develop a Spanish network, or maybe a Hindi one?
The World Wide Web, as it is, is mainly English dominant. This is because most of the users online come from English speaking countries and locales. If someone just doesn't like that fact, get more non-English speakers online and have them develop non-English applications, etc.
* tries to excuse the rant, but hears often about things like this, where people want something established to conform, instead of themselves conforming to it.
Dragon Magic
Human nature is the same everywhere; the modes only are different. -- Earl of Chesterfield
jajaja (I'm smiling)
Hi:
I'm Spanish (yeah, from Spain, Europe... do you know? That country from which Cristobal Colon discovered America, and from the California oranges come... sure)
Do you know that Spanish language born one thousand years ago? and that Latin and Greek are his father and his granpa, and Arabian his uncle?
I know you are very tired of listen to Spanish and French people saying that our languages are being killed by English. I don't think it.
My language is very richfull, and very used (more than 4 hundred millions) across more than 30 countries all around the world (not only Europe or America, also Africa or Asia). I use it, but I wanna know more, and I study English, French, and Esperanto, and soon I wanna learn German... What languages do you speak, English (UK or USA) and Californian surfer's... bah!
Gracias a todos. Thanx to everybody (sorry for my poor English)
I think that if languages don't change then they will die completely. I mean, no new words, no new ideas. Keeping a language static isn't a good thing. Don't the French have some government thing to keep the language 'uncorrupted'?
I don't see the logic behind staying still. By adding more words, even from other languages, the range of thought improves. Take any flavour of English, it will be a mixture of dozens of languages. A large part of it is 'stolen' from the older languages, but there's a lot of words that have come from modern languages as well.
You means US English (as opposed to British English). Over here we spell:
- 'Bug' as 'Insect'
- 'Program' as 'Programme'
- 'Disk' as 'Disc'
- etc.
-- Hob - Java Spectrum Emulator
[...]
jaca "pony"
According to "El caballo español", "jaca" comes from English "Hack[ney]":
__
__
Men with no respect for life must never be allowed to control the ultimate instruments of death.
GW Bu
There once was a poet from Sufi
Who went by the first name of Rufi.
He composed in Persian
'cause the Sufi version
Paid even less than Bababufi.
If tits were wings it'd be flying around.
For you Francophones out there, if I seem misinformed, please excuse the ignorance of an Anglo from Ontario.
And don't get me wrong, if I was going to move to Canada, I'd probably brush up on my french to the point of some fluency in it.
Considering that most Canadians don't have much fluency in it, I wouldn't worry too much about it unless you intended to settle in Quebec.
This seems particularly true as you go west. My friend from Alberta only had to do 1 year of French (only in grade 9), whereas in Ontario it seems to vary from 6 - 7 years (grade 3 or 4 to grade 9).
In Quebec however, you can only go to an English primary school if 1 of your parents went to an English school. Otherwise, you must go to a French school. This, plus legal protections, is among the reasons why French remains so strong in Quebec. Yet many francophones come into Ontario to learn English -- there of a lot of French girls who take on nanny jobs.
On the other hand, if you go East, the language devolves into some incomprehensible Martime dialect. Noo doot aboot it. ;)
I can spell. I just can't type.
The English killed off Irish and Scottish-Gaelic languages. Spanish is next.
After I have received the wisdom of good teaching, I will untiringly teach all people. - The Teachings of Buddha
If you would like, I could say that in the northeast "use" is a pronoun that in the south is commonly known as "ya'll." :o) Ok, so most people write it like "you's" but it still works too.
Mas vale cholo, que mal acompañado.
Don Quixote
These are my friends, See how they glisten. See this one shine, how he smiles in the light.
Well, if you read just that first little book of the Bible, there's a story in there that languages were created (and splintered and fragmented) for a reason: to prevent us from all working together towards a common goal.
Was this a good thing or a bad thing?
Just the horrid image in my mind of a Domino's Pizza logo across the surface of the moon, makes me consider; gee, that God dude was a pretty smart guy.
These are my friends, See how they glisten. See this one shine, how he smiles in the light.
I know it is lame to reply to one's post, but I thought I should disambiguate one of the sentences. It should have been as follows:
Sorry about that. :)
I think Senor Betanzos is worrying needlessly. How do you gain a word for an object or process in a language that has no word for such to begin with? You add it in! Snarf it from another language if need be, but add it in!
Some examples: "Transistor" is the same word in English or Spanish because there's no native word for it in Spanish. There wouldn't be one because the transistor was invented in the U.S.
Let's look at another one: 'Ethernet.' It has no translation at all into Spanish. Why would it? It's a word that was artificially created out of two other words: "Ether," which derives from the Latin 'aether,' was used to refer to a rarefied element that was believed to be filling the upper regions of space (the "heavens" if you will).
The second word, "net," has many meanings altered by the context it's used in. In this context, of course, it's a contracted form of "Network." Both 'net' and 'network' do have translation into Spanish, but in multiple forms.
In short: What I see is that Spanish (and other languages) are merely being added to. Who gives a flaming banana where the word came from as long as the people involved in the conversation all understand what they're saying to each other?
I think Senor Betanzos needs to start drinking decaf...
Can I rant for second? Godwin's law (paraphrase: "if you bring up the Nazis, you've lost the argument") is utterly ludicrous. If the usage of the Nazis in an argument makes a case for something, then it makes the case. It's as if to some people Hitler and the Nazis are just a fictional novel with no historical or educational value at all.
To all those who cower in fear of using a Nazi example because of the Godwin Law idiocy, please, be my guest and use it to your heart's desire. The only people who follow The Law are people who can't defend themselves against a powerful argument.
--
Sometimes it's best to just let stupid people be stupid.
It's Funny and you're right. This guy is not a spanish speaker...
... They don't have to die. I think something: Learning more than one language makes you smarter! Why, because your brain have to manage to dial with concepts that are not represented in a particular language. What do you think?
espanol no tiene que haber aprension What does it mean? I speak spanisk and I don't know =)
You know, my first language is spanish and I studied english. I've written english both in english and in spanish and sometimes I prefer to think in english... I agree with something : It would be better if we all spoke the same language. Althought languages record history
Yo si sé hablar español y el primer *post* de este *thread* no fue escrito por alguien que habla español. Creo -es una conjetura- que si uno habla más de un idioma de alguna forma debe volverse más inteligente debido a que el cerebro debe tratar con conceptos que no estan representados en un lenguaje en particular. Qué opinan?
-----
miren que palabra uso *post* y *thread*. No sé de equivalentes -exactos- en español
http://arhuaco.org/
Spanish as used by other countries will not change as much and will always have some low-level standard (like the Spanish used by Spanish-language television) but compared to US Spanish they will sound quaintly provincial...
Once Chicanos realize their potential political and economic strength, they will have more influence on the language worldwide...
--
You think being a MIB is all voodoo mind control? You should see the paperwork!
A man who wants nothing is invincible
I agree, except that english needs to be modified before this happens. We need to move towards a language that has strict rules (their would then be spelled thier... I before E... PERIOD!) and/or more a more phonetic language.
There is no longer anything that can be done with computers that is nontrivial and clearly legal. -- Paul Phillips
The basic terminology of science and technology has spaned many languages for a long time.
Once the source of many terms was Latin, but thankfuly we have moved to modern languages. In physics we have gedankin (pardon spelling) experiments, aircraft have epanage(sp), factories use robots. The borrowing into english of words I cannot spell is natural and enriching.
I once worked for an international organization that operates a network of geosyncronous satelites. One day I needed to explain a map projection algorithim to a Spanish speaking programmer/engineer. An interpreter got us started, but was unneed as soon as we got to writing geometric diagrams and mathematical formulas on the white board. It turned out that we had the language of mathematics in common.
On the other hand, I once needed to press an Algerian programmer into service as a translator because a Canadian client couldn't or wouldn't speak English.
Now look at English. As more and more people speak it, they brutualize Standard English. The English spoken in Malaysia is nothing like the English spoken in Vermont. It's not english, it's malaysianglish.
Your point is clear and well taken - but wont the internet and hyper-connected present eliminate the possibility of this happening? sure there will be some minor differences (as you see between Toronto and Kentucky (for instance)) but the likelyhood that english will subdivide into other languages seems to be defeted by the 'global community' that we have now.
Unless you're France. Every time the English language gets a little too noticable, the French government passes another law trying to command the tide to recede. They hated the idea of calling CDs CDs, so they came up with some new Frenchified term that by law had to be used in newspapers, books, ads, etc. The world had a good laugh at that one.
"If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine
This point is kind of a sore topic with me. I am in favor of having one national language in the US: English. There are a number of reasons why this seems to be a good idea. The main problem is that the US has so many different minorities in it that I don't think we would be able to settle on two or even three national languages if the debate ever came up. I understand Canada's stance with English and French, but there is a wider distribution of cultures in the US. What would we have? English, Spanish, Native American languages, Japanese, German, French, etc? That is going to be one huge street sign, printed (correctly) in all official languages.
I think you are misunderstanding the problem by equating a national language with a Hitler proposition. No is forcing immigrants to learn English (or whatever the language is where they move), but to expect them to understand the language that the majority of the country can speak and understand doesn't seem too unreasonable.
I hope I don't sound like the ugly American too badly here, but I just don't see learning the language of the country that you live in to be too unreasonable of an expectation.
Planning to be moderated ± 1: Bad Pun.
I think the problem here is not that the Spanish tongue may just disappear, which doesn't seem very probable at the moment, as many have pointed out. The problem is fragmentation; for languages spoken over wide areas and different cultures, such as Spanish, there is always the danger that with time they may diverge, eventually becoming different languages. That would be disadvantageous for all the Spanish speaking people, as the worth of speaking any given language depends on the people you can communicate to using that language.
American English doesn't face that problem, since there is a strong culture and communication industry that will encourage the existence of a standard, although changing, language. I don't think Spanish is in the same case, and the problem of fragmentation might be very real.
I started learning Mexican-Spanish, and quickly changed to proper Spanish (Spain roots) and have studied it ever since. I do have to agree with points that proper spanish is definitely creeping into the backgrounds, while mexican-spanish is still quite prominent.
What's the difference you ask? Take the difference between American-English and England-English, somewhat quite similar. I believe that Spanish rooted in Spain sounds much more intelligent, smooth, and educated - just my $0.02c - however biased I am from spending most my childhood learning it.
I have to say I think this article is bunk though. Go spend some time in Spain -- while everybody speaks Spanish (excepting Barcelona.. not even getting into that discussion) most speak 2 to 3 languages fluently. I'd say probably 60% of people speak Spanish and French that aren't in retail, 95% of retail people speak spanish and english.
Then you have the issue of Spanglish, the mixture of the two languages. Which I dont think is a massively bad thing, but I think is inevitable. When building a global culture, whoever has the biggest vote gets their way. So what happens? Most languages die out in that culture, except the super powers.
Be prepared to start speaking a mixture of American, Chinese, and Japanese - as they are the tech super powers now.
Dacels Jewelers can't be trusted.
Language has far more grammar (word order, verb tensing, gender, agreement, etc.) and phonology (how the sounds combine with one another in a meaningful way) as it does morphology, and morphology includes a bit more than just the lexicon (dictionary/vocabulary). And, this is how English adopts so many foreign words and still remains English. There was some very interesting "congealing" of French with English in the years following the Normon conquest of 1066AD, but the language remained essentially and recognizably English just the same.
Yet, English has morphed a lot in a fairly short time. Fast enough that Shakespere sounds quite strange to many English speakers. Beowulf as originally written is totally incomprehensable (I've tried. Knowing some German helped a lot more than English did. I can't say that I comprehended more than a word here and there).
Spanglish will most likely work both ways too. I don't see that as a bad thing at all.
Oh yeah, Hiroshima was a just a miscommunication. :)
Don't get me wrong, I bleed red, white and blue, but we have been in our share of wars. True, our involvement has been less about colonizing new countries, and more about keeping the peace and fighting communism, but the Persian Gulf war sure had some Capitalistic overtones in it.
My point: we are not totally innocent.
The nice thing in german is, that almost anything is spelled as you pronounce it, and you can pronounce most stuff from just reading it.
I made a fool of myself from trying to pronounce "Leicester" not long ago...
I'd translate "eigen-" as "self-", but I'm not sure if this is really meant that way, and not the name of some famous mathematician...
languages brough us the separation of common goals and ideas, language has been identify as a common evil to our toughs, since we can't express in words our correct feelings., and then it must be translated many times over., i'm not for english as the common language, but I'm for a common language that all humans in this planet could interpret.
Solid facts, red pen, but they can't be adequately considered without pondering the effects of the common Chinese written language. :)
The only thing that we learn from history is that nobody learns anything from history.
Eine Welt, eine Wirtschaft, eine Sprache
I live in texas, and I know a lot of english speakers (I speak a very tiny amount myself). English is a myth, there is no "English" language anymore. The "problem', if you wish to define it as such, is that it has mutated heavily in the Americas away from "Proper English" (ie. european or "high" english), and within the Americas the differences between, say, the northern U.S. speech in Boston (northern U.S. town) and in Nashville are larger than you would expect (I seem to recall that "tar" was a black sticky substance in New York and a thing you put on the wheel of a car in Alabama, or some such, as an example). This has been occuring long before tech jargon. The differences have grown to the point that the european and american versions of the tongue are almost mutually unitelligible (according to my sources anyway). It must be emphasized that this "blurring" was I think due more to migration than contact with other languages. (Not to say that that didn't play an important role as well, within 100 miles in either direction of the U.S.'s French, Spanish, English, and Dutch borders, pretty much everyone is in linguistic euilibrium between many tongues, "American English" as it's referred to.
Seriously, the tar example happened to me after moving to the south. It confused the hell out of me when I was working at Sam's Club and a guy was asking where he could get tar from. However, I think even though there are differences, I can understand the British (their language, not their minds), the Australians, Canadians, etc. It is the same with Spanish. Even though I know Spanish as my second language, I can understand someone from Los Mochis and how they sort of pronounce their "ch" as "sh", and in Guadalajara (which sounds normal to me) and even someone from Spain (but their lisp on the letter "d" sounds like faggy Spanish IMHO.) I even understand a little Italian and Portugese because of the Spanish I know. I do agree that this guy is a purist, and copying the French. I do think the Spanish speaking people have a lot of pride in their culture, including their language but sometimes pride gets in the way of intelligence.
Mas vale cholo, que mal acompañado.
As for the influence of english on other languages, it happens in ANY living language. English is influenced my many languages. When you go for a job, you usually send a resume (french word). If you get rejected, you might go eat a taco (spanish) or a hamburger (german). Half of America is named with Indian (Native American) words.
One language influencing another is nothing to be scared of. In reality, a thousand years from now, none of us would be able to regocnize any current languages.
jX [ Make everything as simple as possible, but no simpler. - Einstein ]
Looks like a linguistic junta to me! :o
Be Seeing You,
Jeffrey.
Time Lord, Dark Horse: The Techno Mage of Gallifrey
I'm not going to go in and refute your points, but you are a paranoid racist and don't realize it. The majority of the points you mentioned are the same as what the KKK uses to justify their racism. Now, as someone that comes from a mixed background I do see both sodes well enough to know that the battle is between the insane. White racists, black racists, latin racists, you all use the same things to justify your hatred rather than learn to get along with each other. Before you tell me I am a crazy gabacho, you are only partially correct. However, when I see a person, I see them for who the individual is, not the color of their skin or where their ancestors are from. Learn to care, not hate.
Mas vale cholo, que mal acompañado.
--
You think being a MIB is all voodoo mind control? You should see the paperwork!
A man who wants nothing is invincible
You're taking darwinian logic too far
I never mentioned Darwin AND it is natural in evolution to have many species and uncountable variantion within species so that one unfortunate event cannot vipe out everything.
Care to explain what you meant?
losing your very own metaphors, potential jokes, songs, hidden meanings.
I think you ought to have more respect for your own language
A language does not get better just because it's my own. Indeed, stuff in general (ideas, jokes, etc.) doesn't get better just because it's mine. A fact too many people ignore.
there's got to be great literature produced for it that no one else can enjoy as much as you danish-speaking people do
Sure there is: Kirkegård and H.C. Andersen, to name 2 authors. I happen to know that many people learn Danish just to read these two authors in their native language.
Now, that is sensible; if you want to read the literature of a language you don't know, learn the language.
What is not sensible is for this major investment to be nessecary, since there really is no reason for it to be. Wouldn't it be so much nicer if everyone had spoken the same language back then? then you, too, could read these authors in their native language! Too bad you were robbed of that oppertunity. In fact, I'd say that by far most of the literature ever written is inaccessible to both you and me because we don't know the languages in which it has been written.
Why should we rob the children of the future of the ultimate literary treasure we have been denied?
Let us translate your example to computer programming. "However, I woudln't mind if Perl was removed from the face of the earth. In fact, I woudln't mind of Lisp was removed from the earth (my programming language of choice)."
I never said such a thing and I don't appreciate having words put into my mouth, especially not when I don't agree with those words.
First, I'm not even going to get into the fact that the problems of too many programming languages are not nearly as bad as the problems of too many actual languages and that there are ALOT more languages than programming languages.
Even doing that, you're still talking nonsense, because most any language is completely sufficient to say anything you want provided you speak that language well enough.
BUT if it really mattered to you, you could learn that new language as many people I know who've gone to great lenghts to learn foreign languages so they can enjoy local literature without the distortions of translation. And yes, it's much harder to learn Portuguese than C (or maybe not) but it's a rewarding, culturally enriching experience.
Don't you see that your are making my case for me?
If everyone spoke the same language, those friends of yours wouldn't have had to "go to greath lengths" to learn a new language.
Suppose they had used the time they spent on the unnessecary task of learning the language on actually learning about the culture and reading the litterature and such. Somehow I think they would have gotten a better grasp of that culture than they would otherwise. Also, they would speak the language much, much, much better, because it would be their own.
Bjarke Roune
Language is, and always has been, a living, breathing thing.
Take Latin - it used to be THE language for all things philosophical, scientific, or otherwise academic. If you were a preist, monk, doctor, or other learned member of society, you knew latin.
But it's spoken and everyday use waned until the language died - there are no more "latin speaking" parts of the world. Now, you learn it if you want to a) Learn roots of various words, b) Study languages in general, because language itself is your interest, or c) read through academic/religious material published hundreds of years ago.
But is there a group of people that are upset that latin died? Not that I'm aware of. People speak what they speak. If the internet pushes the world into a slang mixture of English (with usa, brit and aussie influence), spanish, and japanese, rife with L337 VVR171NG that will be what people will be used to and the english of today will look to them like the King James Bible (which sounded normal at the time it was translated).
-------
Vidi, Vici, Veni
On a lighter note, nothing pollutes the english language like desperate Scrabble© players.
--
A feeling of having made the same mistake before: Deja Foobar
"Ein Welt, eine Wirtschaft, eine Sprache"
-----
"Defenestration" is to throw out of a window; what's a word for throwing 'Windows' out of something?
Honesty. Loyalty. Kindness. Laughter. Generosity. Magic!
Spanish is the silliest language there is. I mean why differentiate *everything* in the whole universe as either male or female? Every women's libber out there should be up in arms trying to ban this discriminating language. I doubt that the Internet is affecting spanish any more than any other language, but I sure wish it would.
I don't know about any of you, but I rather enjoy the irony of the fact that English is fast becoming the Lingua Franca.
But seriously, the greatest benefit to mankind from the internet and computerization is enhanced communication. Geography means nearly nothing to an email or to surfing a web page (though, poor infrastructure(sp?) certainly does)... you certainly can't tell if I'm Black, White, Hispanic, Oriental, etc... without digging a little. (Yes, I know that it's more likely that I'm hispanic if I regularly visit spanish-language sites)
So, if one of the not-directly technology-related changes brought about by the internet is to break down language barriers between people whether they be next door or halfway around the world, I think it's a good thing.
Though, selfishly, I am kind of happy that the language in question is one that I can already read, write, and speak, and that being the case, my argument is somewhat suspect.
+++++++++++++++++++++
The Digital Sorceress
All you computer heads know about grammars -- context free, the chomsky hierarchy, etc. And you know these grammars are defined by a couple of things, one being the alphabet of symbols and the rules for rewriting.
Having reintroduced that into the discussion, the essence which makes spanish spanish (or catalan or hispanic, or whatever) are the rules. And changing rules takes more than a few measily tech words. The French have tried in many instances to stop the influx of English into their languages without any solid intentions.
But what are they really trying to stop? Do they fear increasing the size of their fat dictionaries or do they suppose they might have to rewrite children grammar books? The two are distinct, and for anyone to suppose that one can clamp down change in the grammar area is pure lunacy.
So what if a few words become part of your vocabulary? Its similar to some Texan using some crazy talk I, as Jersey bred, would consider foriegn (and I suppose this holds both ways). Yet he will be using structure in his sentences similar to mine (hopefully) so that we can at least know that we have no clue what the 'question' or the 'subject' of the sentence is, etc. So give up this struggle for purity of a language. There are other things to spend our time on, other than something which is intractable (at least so far as there has been no acceptable formalization for the grammar of each and every language) and against the idea of natural language change through time.
Mierda!
-----
"Defenestration" is to throw out of a window; what's a word for throwing 'Windows' out of something?
my special knowledge becomes obsolete and uneeded, that I wont bitch and complain about its dissapearence.
-I go to Rice, so figure out my email address
Is how do you stop it from happening with another language? Lets say that the internet does become more spanish friendly; What about other languages? As for th education of spanish speaking students I believe that the internet can only helps with slang, technical jargon etc. The IT industry is a largely English speaking medium and thats because it was invented by English speaking people. What you need is more people willing to have diff lang based websites. That's all. Its rather simple; shoot off an email to a webmaster saying you'd like to know if he'd like his/her site converted into spanish or german or french and offer your services. If you aren't willing to help with the problem then don't cry about it.
Recently there was a discussion on TV about the Internet destroying the Dutch language, how the Dutch language is becoming increasingly laced with English words. But Dutch has always been influenced by other languages, and it has always survived. Many words that are accepted as perfect Dutch by everybody alive today come from French, laced into Dutch during the Napoleonic occupation. Similarly some German words filtered into Dutch during the German occupation. The Internet occupation will probably do the same: some English terms will filter into Dutch, but the Dutch language will continue to live on.
The same will happen to Spanish. You cannot force languages. Languages will always evolve, will always be influenced by its neighbours. The Internet has made English every language's neighbour, so it's only logical that all languages on earth start adopting English words and terminology.
But also other stuff. In Dutch, people say "zie je", a literal translation of "see you" more and more often, while it is totally incorrect as pure Dutch. Words like "hi", "okay", "shit" and "fuck" have been seeping into Dutch for many decades already. The world is changing, and languages are changing with it. Languages have always changed, have always adopted, and have always survived. Spanish, Dutch, German, French, Italian, Greek - they'll all survive the Internet, I'm sure of it, but they won't be quite the same either. And that's not necessarily a bad thing.
)O(
Never underestimate the power of stupidity
Never underestimate the power of stupidity
To err is human, to moo bovine
I wonder, just what is the Spanish equivalent of Intel, or the Russian equivalent of Unix? The thing is, a lot of the "polluting" tech words are names that only sound English because an English-speaking person came up with them. Half the other things are acronyms that 90% of the world doesn't know the proper meaning of so it only makes sense to say the letters as they appear in English. Even if you knew the meaning and translated the words back to your language, no one would know what the hell you're talking about. It would certainly be hard to associate it with what it originally represented.
Take GNU, for instance, and put it into French (it's easy enough so that even I can do it without offending the intelligence of every French person on the planet). What do we get? GNEPU? (GNEPU n'est pas Unix?) What the hell is GNEPU and who will figure out the fact that it's the same thing as GNU? If I'm in Germany and have GNU and you're in France and have GNEPU, do we have the same OS?
I say this problem is unaviodable. If people in different nations need to be able to talk to each other about technology (and run this Internet thingy, for instance), the names of things have to be common. Besides, in a hundred years, we'll all have a common languge; Anglomandarindian, and all this silliness will be behind us (except for Quebec, where the use of Anglomandarindian will be illegal and people will live in wooden shacks with no electricity).
However, until the glorious and all-powerful Anglomandarindian is common throughout the globe (Europe will first have to get over their inferior Geranglofrench), just stop bitching. If you invent something cool and name it in Spanish, I'll use the Spanish name and be happy to do so.
----------
Even as you read this, your pants are strangling your loins! Aaa!
Your figures are wrong. While English is still the most-used language on the internet, ". . .the Internet IS becoming increasingly multinational, with English-speaking surfers dwindling below the 50% mark".
I don't know how some of you in the rest of the US feel, but even in Minnesota I'm coming to realize that Spanish would be very useful. We've had a large influx of Spanish speakers (primarily Mexicans, I think, but "they all sound alike" to abuse a cliche) and in some situations its becoming kind of hard to deal with service people, especially in the downtown Minneapolis area, because they speak English so poorly and I don't speak Spanish at all.
I can't tell the cleaning people in our office what to do with boxes and so on, many of the restaurants I eat lunch in the people behind the counter are almost exclusively Spanish speakers. I've learned that I need to order a grande drink; I order a large and I get a small!
I'm in SoCal on business right now, and I don't see how you can function well without speaking some Spanish here, and Chinese and Vietnamese would be good too.
One thing that I find somewhat troubling though is my perception of a lack of desire to speak English by the Spanish speakers that have moved to MN. Minnesotans I've spoken to the immigrated from Germany, Poland, Norway and the like have told me pretty universally that they faced a lot of peer pressure from members of their own ethnic group to NOT speak their native tongues when they got here.
One woman said that some of her Polish-immigrant friends that spoke better English would quickly upbraid her in Polish and then switch to English immediately when she would converse with them in Polish in public. She would ask a question of them in Polish and they would respond something like "dumb pollack!" in Polish and either answer her question in English or refuse to answer until she tried to do it in English. What's interesting about this is that it was peer-originated -- it wasn't a non-Polish speaker doing it to a poor, struggling Pole.
I don't see that attitude among Spanish speakers in Minnesota, and I think it bodes ill for them in the long run because they'll stay at the bottom of the economic ladder and people like me that may desire them for their work habits or skills will have to look them over because of the communication gap.
> The sucess of English will be it's downfall. Just like Latin splintered into hundreds of languages, English will follow
Perhaps you've noticed that communication technology is a little more advanced than it was 2,000 years ago? You might want to revise your predictions in the face of trivial things like technology.
I've finally had it: until slashdot gets article moderation, I am not coming back.
Languages have always been influenced by other languages. Before the danes invaded England, the language was celtic. Then the danes came with some new words. The following list gives a hint - the left word is english, the right word is the danish one.
sister - søster
brother - broder (d is pronunciated like th)
mother - moder
father - fader
house - hus
tree - trae
grass - gras
church - kirke (pronounced a little like church in some parts of Denmark)
yule - jul
take - tage
go - gaa
root - rod
stone - sten
I could go on... but I can tell you that it is easy for Danes to learn English. What would the U.S. be without the danish language?
But there are also examples of other recent influence of languages on danish. Examples:
toilet (from french)
alarm (from italian)
kiosk (from turkish)
jogurt (from turkish or bulgarian?)
And approx. every third word we have from german...
We have no problem with that, and Spanish doesn't have a problem, either.
The spanish have been crying the same for centuries. They used to translate FAMILY names from famous people into spanish so their students where not influenced by "foreign" words, ie, the German artist Albrecht Duhrer became Alberto Durero in spanish textbooks.
Also it has been a common practice in spanish speaking countries not to allow foreign language first names for newborn kids. Only aproved spanish names could be use. This in most of latin america and Spain. Some countries have abandon this in the last 20 years or so, but some others still have this rule. All in the name of "protecting" the spanish language.
The real reason for this is a racist heritage and distrust of anything that is foreign. Remember, this is the same people that made whole civilizations like the INCAS dissapear, abandon their culture and convert into christianity or die. Also spanish had to be the only speaking language for them...
Nice people the spaniards, I feel soooo sad english is "creeping" up on them.
~~~Please pass the salt, I hate unsalted MD5s
I lived in miami for a while. If you want to hear spanish, go there. More people speak spanish there then speak english. Maybe they can utter some "technolgy" words for you. And that's the bottom line because stone cold said so.
Does it sound at all plausable that 2000 years ago, people were clamoring over Latin being the universal language, just like you are clamoring over English as a universal language?
<br><br>
Yes it does. I think I said I really wouldn't prefer English if I had a choice; it just seems to be the language with a greatest potential for everyone to know it.
<br><br>
<b>English is destined to fail, much like Latin, as a 'universal language'.</b>
<br><br>
So, your argument is that English will "fail" because the different language Latin failed in a completely different world 2000 years ago.
<br><br>
Ever noticed how I am talking to you, even though we're probably thousands of kilometers away? Actually, I don't even know how far we are away from each other because I don't know where you are... You know why that is? It doesn't matter!
<br><br>
The world of today is completely different from the world 2000 years ago, so your inductive argument (based on a samplesize of ONE!) has no merit.
Bjarke Roune
Well, let me just say that if people in Spanish speaking countries were designing/inventing all these new technological things, they could very well name them any old thing they wanted...Even something say...Spanish? Only problem there is that the people who will BUY the blasted things are gonna be mostly AMERICANS and their whole marketing department would scream bloody murder about alienating their consumer base...Hmmm. Death of Spanish seems almost inevitable now huh?
When the only tool you have is a claw hammer every problem starts to look like the back of someone's skull.
English
:)
Technology is destroying Spanish? Why without babelfish I would never be able to "speak"
Spanish! Oh wait, babelfish DOES destroy Spanish.
into Spanish
La tecnología está destruyendo a españoles? Porqué sin babelfish nunca podría "hable" español! La espera del Oh, babelfish destruye a españoles.
into English
The technology is destroying Spaniards? Porqué without babelfish never could " speaks " Spanish! The delay of the Oh, babelfish destroys Spaniards.
Technology destroying Spanish? Never!
If Spanish cannot survive, then it should die. It's that simple. There is nothing inherently wrong with a language dying. Survival of the linguistical fittest!
I am soooo pissed off at all of those people out there that tie their language to their culture and then their culture to their identity. I see this the most in chicano and french writing. This does not have ANY positive effects. All this does is make people close-minded and against change all because they want to "preserver their culture." Whatever...
We aren't saying, you must give up all of your holidays, cultural events, history and ancestry. But is absorbing 100 or so english words to make communication easier over the internet THAT big a deal? Is it really going to DESTROY your culture? I don't think so...
Eventually EVERYONE will be on the internet and EVERYONE will be able to communicate. So, shouldn't we have some kind of common vocabulary we can use to discuss things?
Justin Dubs
Read 1984 from George Orwell, and what there is about "Novlang"... then think again about what you wrote.
I have just uncovered an insidious plot to undermine the English language... they might kill me, but I feel compelled to warn the world anyway.
Many of you are familiar with recent advances in biotechnology such as the monkey/robot arm, the monkey head transplant, etc... the Romans, ever at the forefront of this exciting new field, have teamed up with the Greek to monopolize the vocabulary associated with Biologia in general (see?! Bio-logia = english: "Study of Life"! The bastards!). Many English speaking Studiers of Life have increasingly found it difficult to obtain employment because of the artificial language barrier created by these linguistic Nazis.
One Studier of Life (who wishes to remain 'anonymus' - or for you non-latin speakers, 'he wishes to remain unnamed') noted that: "I just can't get a job.... the Latin and Greek 'terminology' (words used in a particular field, subject, science or art) makes little sense when 'translated' (from the Latin for 'transfer or move'), and no one has taken the incentive to create english words for the concepts, so I've found it very difficult to break into the field. In Latin, "cell" means "storeroom" or "chamber"... what does that have to do with 'the little thingys that make up or are a living organism'? I've studied the 'the little thingys that make up or are a living organism' for years, and that name worked fine for me & my research team. I mean, sheesh.... 'cell'?! Oh, and what about membrana or 'membrane'? And DeoxyriboNucleic Acidus - DNA if you will - wtf is up with THAT?! That's it, I give up... I refuse to pollute my naitive tounge with that garbage. I've decided I'm just going to be a janitor for the rest of my life."
Surely, it is a dark time, fellow Angles.
*end sarcasm*
All I have to say is: Hey-soos Christ!
Life: a sexually trasmitted disease that has a 0% survival rate.
www.esperanto.org
.
okay, being a cuban-american i'm a bit biased on this subject. i must agree that english is the major language of the internet and it is suppressing other languages such as spanish. spanish is a major world language which needs to have its place on the web. I own a business called Point5, Incorporated (www.point-5.com) that specializes in bi-lingual webpage development.
I've noticed that most of the posts are pro-american english. I'd like to inform you that though english may be the most widely accepted language in the US, it will not be in the future. The US has no official language so many immigrants don't bother to learn english. Many of us assume that they are uneducated because they don't know the common language of the US.
In about five years, the hispanic-american population will be greater than the populations of every other ethnic heritage in the US combined. As of now these numbers don't mean much because a study showed that many minorities do not have computers because their income is hampered by their recent arrival in the country. As the success rate of hispanic americans increases, they will dominate the american internet and we will have to learn how to speak spanish with them. I'm prepared for that change, but you should be too.
I got a web design email a while back that stressed the importance of making your site ethnically friendly and making sure that most of all, you market to hispanics. I also remember a slashdot article a while back that was predicting the making of one global language such as esperanto for the internet. that way, all languages would be oppressed evenly.
Don't go jumping to conclusions about how the internet will stay in english, because it won't, trust me, it won't.
-"Hey, Baby. It's not a rash, it's textured love."
Pedro
Pedro
----
The Insomniac Coder
When you have international dealings, you need a common language. This is why English is the universal language of air traffic control. Having a tower of babble on the internet does no one any good, and English is as good a common language as any (although I'm sure the French would have a few things to say in that regard). I seriously doubt that Spanish is in any danger. If anything, it's becoming more widespread, as evidenced by its proliferation here in Southern California. Many of us Anglos can now understand Spanish at a basic level simply from having been around it so much. I have the feeling that we may end up with an English-Spanish patois here in a couple of generations.
"If I have seen further than other men, it is by stepping on their glasses." - Michael Swaine
From a purely pragmatic standpoint, it seems that easing global comunication is a good thing for everyone. Although loss of local cultures is a downside, I think the gains outweigh the losses. Ithink the purity arguements only make it harder for ideas to flow in and out of a country, it's like a trade restriction.
Spencer Ogden
Ummm...it's scary to know that there are people who have this opinion. I hope you were being sarcastic and that it was lost on me this early in the morning. English is not a being, so it is not "creeping" and it is not trying to dominate the world. It is a way of communication. You also made some valid points how the majority of documentation for computer related materials is in English.
By your standards, whenever we make a website we should translate it into every language, such as the languages the Pigmy tribe in Africa speaks just so we can be fair. Why is there so much English in technology? Because a lot of it is from the U.S. While we might be nice enough to translate it sometimes, we are going to release documentation and use terms we come up with. If you don't like that, you are free to write your own documentation or come up with your own terms but don't expect anyone else to use them just because you don't like the English versions.
If you feel that English is dominating the world, it is because that is what people want to speak. Right now, the U.S. is a very central point for technology. There is a lot of money here, a lot of resources (human and materials) so it is pretty far ahead of most countries in Technology. The reason we have more documentation in English instead of Japanese for example, is that the U.S. is where the internet came from, as well as such useful things as TCP/IP, unix, Windows, Macintosh, etc. I won't ignore that other countries are very significant in the technological world. I think if Japan were to fall off the face of the Earth, we'd all be in danger of losing our jobs. Also, a lot of good research and development goes on in Europe. Various European countries seem to come up with some really cool stuff that the U.S. doesn't implement or use for years after it can be used. I am aware that a European man (I forget what country though) came up with the concept of the world wide web.
Anyways, if English is "invading" your country, it is because you, your family, coworkers, friends, and neighbors want it to. Noone is forcing you to do business with the U.S. I find your logic to be extremely flawed. Almost as flawed as that of an American. ;-D
Mas vale cholo, que mal acompañado.
--
You think being a MIB is all voodoo mind control? You should see the paperwork!
A man who wants nothing is invincible
I believe this is what you're looking for.
Bill Clinton: Pimp we can believe in. - The Shirt!!!
Heh, there are some parts of Canada like that, too. There are laws and regulations that either forbid the use of printed English or state that if English is used (say on a billboard), then a full French translation must accompany it, usually in much larger lettering.
It's just funny.
Come on, the man apparently can't grasp the difference between copying and moving (upload our personalities to the Net indeed!) and you figured he'd get the other stuff right?
This next song is very sad. Please clap along. -- Robin Zander
As for your word list, sure the words exist but why go to the trouble of making up good words when the English ones will do? Anyway, what about the regional effects of slang? (i.e., folder is carpeta, which is also tablecloth. In Spanglish carpeta is carpet or rug [alfombra]. Sure the use is incorrect but if everyone uses it incorrectly it must be right, n'est pas?). The French are big on this and they look foolish when they try to dicatate what a hamburger is when most people ask for "Le Big Mac" Point granted, but you forget that many of those who create the new words are Latinos who live in the US and are not taught much proper Spanish. We create words that sound fine to us and work in the context of communicating ideas. If you don't like the new words we create, then have the "official Spanish" academy disapprove of them, we commoners will still continue to use them how we choose. (And we sure as hell will continue to pronounce words without the "lisp" that Spaniards use to separate themselves from us "uneducated" Chicanos and Central and South Americans...)
--
You think being a MIB is all voodoo mind control? You should see the paperwork!
A man who wants nothing is invincible
El problema es que muchas de las tecnologías de Internet y de sus servicios no soportan muy bien que digamos los caracteres en español. Por ejemplo, los acentos y la 'ñ' no son soportados por muchos clientes de correo electrónico. Los dominios tampoco permiten caracteres en español, aunque quiza eso cambie pronto.
I'm afraid the infiltration of english into other languages is one of those shit-happens things. In so far as English happily adopts any language it can lay its hands on, one has to advise the Spanish to get over it. The North American academics protest does seem a little reactionary; one is tempted to advise him to visit south-east Europe for a sojurn; I hear Spanish is flourishing in that area.
Languages change and evolve. Lots of words in english come from other cultures and languages. What's wrong with english words being used in other languages?
If this technological "Spanglish" continues to spread, wrote Betanzos, Spanish as such may not survive.
Of course. No language can survive if it doesn't change.
Mantle
It's just a raving pile of foolishness. The author clearly as no idea as to the effects of technology on language.
First of all, many Spanish-speaking nations aren't pumping out lots of new, headed-for-mainstream technologies. I'm sure if I'd be using a computora if IBM was located in Mexico City or we'd have a Manzana Impermeable if Steve's last name was José. The bottom line here is that the US is one of the countries that acts as a spear-head in developing technologies for the information age. Things that become mainstream tend to get the name given by their native languages stamped on those items. Since most of the computer technology in use today was made in the US, it's fitting that it's called by the names we give it all around the world.
Secondly, Spanish is not the only language being effected. My roommate is nihonjin (a Japanese person). He uses english terms for everything technology related (as they do in Japan) even when speaking in his native language? Why? Because they're smart enough know that it's just plain stupid to create new terms for things that already exist. The author states that this is about distinction. Just plain wrong. It's about REDUCING CONFUSION (which is more important anyway).
Ugh. This post was full of venom, but only because this article was so fscking retarded. It doesn't do any good to bitch about stupid shit like this - especially when it has no benefit if enacted. Come on! What benefit would there be to me calling a tamagachi a "pocket friend" instead? Or how about calling my Nintendo a "family computer"? Cripes Ana Luisa Herrera. You don't hear english speakers bitching about more and more spanish words are seeping into english. Are you so stupid that you can't understand that language 'contamination' is essential to the evolution of language?
Blah. There's no sense arguing. Everyone wants special treatment. Nothing I say will stop that.
"Stolen" implies ownership. No one owns land. You can only use it as long as you can defend it. We're not too different from animals in that regard.
Bill Clinton: Pimp we can believe in. - The Shirt!!!
In reality, Chicano culture is about INCLUSION, not EXCLUSION. I look at the newspaper and when I see a White, Black and Asian marrying a Chicano I say "Yay, another Chicano joins the flock". Of course their children will be Chicanos, but more importantly the person marrying one becomes one too because they are wholeheartedly accepted into our community. Marrying outside of our people only makes our people stronger, for we can take new ideas from the outside and adapt them to our needs.
I don't understand why White people have to be scared of the fact that we have two cultures instead of one. Maybe because they can't control us as easily? Anyway, the price of admission is low: all you have to do to understand us is learn a little Spanish. (And once you do you will finally understand when we speak Spanish in front of you that we ARE making fun of you behind your back!
--
You think being a MIB is all voodoo mind control? You should see the paperwork!
A man who wants nothing is invincible
You are correct regarding Latin, except that 2000 (or even 1000) years ago, communication was a bit different from what it is today: you wouldn't buy in London (or say Lutetia, I am not sure if London existed 2000 years ago) a newspaper published in Rome, or telephone your girlfriend in Bombay...
Today, we have instantaneous access to whatever is said or written in the most remote parts of the world. This is certainly a major factor of "mondialisation" (don't know the word in English). In other words, there are and will be differences in the way a "universal" English language will be spoken and written, but the core of the language will be and remain reasonably universal, at least enough for everybody to understand the general meaning.
Interestingly, the major risk of deviation exists in the USA, not elsewhere, because most Americans don't know foreign cultures, don't care for them and are happy to distort their own language beyond recognition. Compare the English spoken in 1940's and 1950's American movies with the standard language spoken today in many US states. The old movies were speaking a language much closer to the Queen's English than today.
As far as other, non-native speakers of English are concerned, they need some standard model to adhere to, and this model will probably not be South Dakota farmer's English. Rather, it will be a sort of universal English as taught in the school, with possibly little reference to American or British culture.
I prepared my own website in English, because I wanted it to be accessible to the largest number, even if my 75% of my visitors are French speakers. I could have done it - with lots of efforts - in Spanish, which is claimed to be the second language in the world after Chinese and before English, but I know I have a better chance to be understood in English than in Spanish.
This is just pragmatism.
Franz der Schweizer Conentur sibi res, non se submittere rebus
You basically just proved his point.
I propose a Californian surfer's academy to lay down phraseology to ensure that no un-cool dudes corrupts our language. Ya know just like those awesome French dues have.
These people sit around and whine about how their language is changing. English changes too, just like any other language. Look at the english language, and you will see a large portion of words are derived from german, french, spanish, latin, etc. Now english is influencing other languages. Suddenly this is bad. Why?
The United States has the biggest military and economy in the entire world. SPEAK ENGLIGH DAMNIT!!
Something I have observed is the tendency to treat language as a culture.
But it's not a culture it's a tool. The job is to communicate.
Yes it's neat to be able to communicate in many languages and it means your able to gather more information. Many may chouse to learn a language not for the value of information recorded in that language but for the value of the culture.
At first I'd say this is perfictly fine as cultural matereals are recorded in the language of that culture so your better off learnning the language to learn the matereal.
But it bothers me that so many treat language as an ends not a means. That it is a culture not a gateway to it.
Efforts to protect the rights of spanish speaking americans not only nessisary it's vital. Having a vote isn't enough. They need to know what is being said. Canidates can speak poorly of Spanish speaking americans openly and the Spanish speaking croud would not know unless someone told them.
And that can go two ways.. once a person is in a position to tell a larg voting population what is going on he has a strong insentive to bend the truth or present his own spin.
While there isn't much than can be done about the fact that a larg population can only understand Spanish. There is no reason to preserve a Spanish speaking population in the United States. Preserve the rights and do everything that can be done to make them involved in the system.
But the tone I get from the defenders of the Spanish speaking population seem to be of preserving a culture and not of provding access to an English political system...
Language is not a culture.. it is a tool...
I don't actually exist.
Interesting take. My sense though is that the survival of languages is based more on politics than the merits of the language.
English is prevalent today because the English founded so many colonies, not because it was superior.
Hebrew was brought back from the dead because one guy made it his quest to do so.
On the other hand, only "dead" languages rigidly adhere to a standard.
This kind of thing's happened before. Greek became the principal language of the eastern Meditteranean, Latin became the principal language of academics in the Middle Ages, French became the principal language of diplomacy. Now it's English's turn; in a hundred years it'll change to Mandarin or Hindi or Spanish. Unless a language is spoken only by a relatively small group of people, the chances are pretty slim it will be eradicated so easily.
--
Most of comercial website in Malaysia is using english without having Malays version. :-
Take a look of this comparison from a survey survey from Nua.ie
1.5 Million Malaysian online and ONLY 40,000 for indonesian.
but take a look at Here at dmoz.org
Webiste on Malaysian is only 188
but website on Indonesian is 2,014
whose fault is it?
-- Hasbullah bin Pit (sebol)
Funny you should mention Quebec.
I am an English-speaking Quebecois who recently left Quebec (and Canada altogether) to pursue a career in the computer field. I understand the very reason to keep the French culture alive -- just visit Montreal and you will see how different a city it is compared with anywhere else in North America. If the market there where better, I wouldn't have left.
But a culture is not solely based on a language. I feel that the French speaking Quebecois who avoid learning English are simply cutting themselves off from the rest of the world, and the laws to protect the French language in Quebec are just a civilized version of ethnic cleansing.
This fear of losing one's culture by learning a foreign language is no different than the fears that make up other prejudices. If you visit Quebec you will understand that the political parties that are pushing for Separation are using this fear to gain support, much like the KKK or other such hate organizations use fear to gain membership.
The bottom line is that you are not going to lose your culture by learning another language. You lose your culture by deliberately choosing to abandon it.
A perfect example is my friend and I. We both moved to Boston a couple of years ago. Despite being submerged in American culture, I still consider myself Canadian. On the other hand, he chose to lose his Canadian identity in favour of an American one.
Actually, you are misinterpreting data yourself.
I do agree that the internet is becoming very multinational, however, that little snippet raises a few questions:
- English speaking surfers...does that mean English as a first language, or just people that understand it at all?
- The part about dwindling below the 50% mark...saying that English is the most used language on the internet, is not saying that the majority of websites out there are in English. A majority would be over 50% if I am correct. However, what the person stated in the parent post, was that it is the most used, as opposed to the smaller percentages of Spanish, Dutch, German, Japanese, etc. However I would disagree with even that English has less than 50% of websites out there. I think the statement would be better translated to:
"The internet is becoming increasingly multinational, with people that speak English as their first language making up less than 50% of the total of all internet users."
Mas vale cholo, que mal acompañado.
By your arguments, English should never have survived. Back when the Normans ruled England, English was the "local tongue" (they called it the vulgar tongue), and French was the language of the "cultural/technical/administrative elite".
But it turned out to be a Conan thing. Norman occupation of England didn't kill English, it made it stronger. The peasants who used the vulgar tongue weren't too proud to borrow terms from French and Latin, and the variety of synonyms in English is partly because of that.
So history does NOT say that English will kill Spanish.
It might. But it might make it stronger.
...ever since 1066, when their superior feudal technology overcame our cultural purity, we've had to put up with tainted words like "pork" instead of eating good old "swineflesh".
It's time we purge our language of neologisms!
I meant to say, we must kill new words in our tounge.
=googol=
> "One world, one economy, one language" (I wonder what it sounds like in German ?).
;-)
You want to know? In german it would sound like this: "Eine Welt, eine Wirtschaft, eine Sprache" (You like it?
I agree to your post. I'm german and I know and like english very much. I'm always torn between writing things in english, because everyone knows it, and german because it would somehow help it form disappearing on the net. There is no real way to solve this but write things in both languages (and that is far more work somehow... =\ )
Bye, David
One may look at this as language pollution. On the other hand, is it really so bad for languages to blend together? Wouldn't this eventually solve the age-old Babylon problem? If the politicians don't divide the Internet up along country borders, this just may happen.
--
er i hate to nickpick but m'sians speak malay not javanese, which is a rather different language. i think maybe you are thinking of indonesian which is based on malay
The correct statement, in either language is simply, "DOH!"
Mas vale cholo, que mal acompañado.
en mi opinion, la lengua de castellano no tiene que haber aprension porque la red es el protector de muchas culturas y lenguas y la lengua de castellano no tiene que preocupar sobre nada. no se mucho del castellano ahora pero pienso que la lengua es una cosa bonita y marvillosa y no quisiero ver una lengua sola de la red.
We're not machines. We have a thing which we call culture, and that culture is the very definition of our identity (this is especially true for old European countries).
But the culture you claim you have is rather arbitrarily identified. After all, French (German, whatever) culture today is not the same as it was 100 years ago, 200 years ago, or 1000 years ago. The language has changed with time as well. That is the normal course of events. Languages evolve over time. They have to have utility in the present world -- otherwise they tend to die.
Efforts to freeze or protect languages so they remain "pure" are the result of people taking a romantic view of their own lives and upbringing. I'm not going to advocate that they not try, but I am predicting that they will fail because their cause is not rational.
This is how the French people feel about it... Germans are less worried, I would say, but the best anti-paranoia example seems to be the Dutch. They have a strong cultural identity, speak their own language, and besides are comfortable with English almost as much as native speakers...
The reason for this is that it's simply stupid and unproductive for everyone not to speak the same langauge. At the time, the only language that seems to have the possibility of becoming a truely universal language is English, so I hope more people will talk English.
Either unaware or blissfully ignorant you've chosen to ignore 4000 years of linguistic development.
Does it sound at all plausable that 2000 years ago, people were clamoring over Latin being the universal language, just like you are clamoring over English as a universal language?
English is destined to fail, much like Latin, as a 'universal language'.
Here's the example of Latin:
As more and more people spoke it, they each brutalized the language a little differently -- a little colloquism here and there, different stresses on syllables etc...
It grew to the point where Latin wasn't really latin anymore. Out of this grew the romance languages. From one root, came French, Italian, Spanish etc...
Now look at English. As more and more people speak it, they brutualize Standard English. The English spoken in Malaysia is nothing like the English spoken in Vermont. It's not english, it's malaysianglish.
People argue "Oh, but they just have bad accents." WRONG. They are speaking English using the pronunciation rules of Javanese (langauge of Malaysia). Further, words and phrases completely unknown in English are used.
The sucess of English will be it's downfall. Just like Latin splintered into hundreds of languages, English will follow. The world most of you envision, one cleverly ripped off from Lennon's Imagine, is that of everyone with a flower on their lapel speaking English.
The reality is that the English spoken in South Dakota will be vastly different from the English spoken in China -- it is an entirely different dialect.
Look no further than the US. Take that South Dakotan and place him in the South Side of Chichago. Do you think he is going to understand a word of English spoken there? Hell no. It's english, but it's an entirely different dialect.
That's your Brave New World. Piss on unity. We're heading toward a day of thousands of languages and dialectss, WITH NO COMMON GROUND.
No sig is worth reading.
I tried to use Bablefish to translate a letter to a friend about a girl I met in Cuba, and when I translated it back, it looked like this:
""I met a nice girl"
became:
"Satisfice agradable a una muchacha"
which (re-translated) means:
"I satisfied pleasant a girl"
Uh... I hope I satisfied her, but that's not what I was trying to say exactly...
The internet is probably destroying Irish as well, in spite of your noble .sig effort... :-)
As a state gets corrupt, its laws multiply; the most corrupt states have the most numerous laws. (Tacitus, Annales 3:27)
About your post: You were in France, right!
Numbers 31:17,18 Now kill all the boys. And kill every woman who has slept with a man,but save for yourselves every virg
-
"Bostonians sound so much more intelligent, smooth,
and educated than Alabamans".
- "Atlantan residents sound so much more intelligent, smooth, and educated than New Jersey people."
This is so breathtakingly asinine as to beggar the imagination. The only reason I'm answering is the next excerpt. Congratulations, you've just disqualified yourself from being able to speak authoritatively on Spain, too, not just from speaking about Spanish (as you previously did).More than one Spaniard in four speaks something other than castellano as their first language. 17% speak catalá, 7% galego, and 2% euskadi. This doesn't even count the various vestigial langauges like asturianu, leonés, or aragonés--which tend to be second languages now if that, not to mention the controversial situation of the two alde(i)as portuguesas that somehow never made it back over the border in 1640.
Furthermore, you will find that outside of the major metropolitan and touristic areas, the regular people do not speak non-Iberian languages. Yes, this is starting to change a little bit in the younger generation as time progresses, but it's not true except in affluent young cosmopolitan yuppies. Your numbers are ludicrous. I challenge you to go to a random village in, oh, Castilla la Vieja, and try talking English or French to the shopkeepers of the myriad little 15 square-meter shops nestled away in sleepy, dusty towns. They will speak beautiful Spanish, sin duda, a rare prestige accent with nary a trace of seseo nor sometimes even of yeísmo, but if you think the older people and the common people of the Spanish countryside are polyglottal, you're nuts. For some, you're lucky to get Spanish!
"English" isn't a plot by english speakers to establish global control.
Oh sure, just because you're not in on it the plot doesn't exist... oops! I've said too much!
Language is a form of thought control. What you are capable of saying determines what you think about. Read languages of Pao and 1984. Yep. English stole from other languages. Thats part of our language. In fact, it is likely that the means of creating and altering lingual subsets is built into English can explain why English has more words than any other language by far. It also explains why it is useful for the internet as a primary language. Everyone can use it to speak the way they think, because there are words to describe that, and if there aren't, they can invent them. In addition, I believe it explains the success of America in using the free enterprise system. The language has encouraged individuality in thinking for a long time. Developing a society where that leads to profit is therefore extremely benificial. This is not the case for some other languages that promote unity or harmony of language, where everyone must speak the same. If you don't believe me, then examine the locations where most of the free-thinking goes on - Acadamia. Most of the best graduate and doctorate programs are in the United States, with a few in other places. And in almost all of them, English is the primary language.
Mod me down and I will become more powerful than you can possibly imagine!
In short, what a load of crap! Let me elaborate.
1. Even without foreign language influences you'll always find academics fighting for language "purity". They don't like jargon, new terms, simplifications, you name it. The truth is that languages evolve no matter how hard you try to adhere to canonized rules. Why do they look at 18-19th century language as archaic, but pride themselves for sticking to the language forms they grew up with?
2. While I can't relate to Spanish-English situation, I've seen the same scenario with Ukranian-Russian, Ukrainian-Polish/Romanian (depending on where in Ukraine you are) and Russian-English. Get over it already! People will always use forms that simplify communications. Most languages don't have sharp boundaries no matter how hard you search for them. Word borrowing and transliteration are normal processes.
I suspect that Academia is freaking out due to the speed with which languages transform now. And that's in large part due to the
Internet and daily cross-cultural conversations.
Damn damn damn damn... About your SIG: Your talking about France, right!
Numbers 31:17,18 Now kill all the boys. And kill every woman who has slept with a man,but save for yourselves every virg
I'd think it's a problem in every language nowadays.
We use english technical terms in german, and the german translation sounds a bit stupid sometimes.
So what ? Science used latin technical terms before...
(joking here) My last semester of college is coming up, and one class I have to take is Spanish (4th semester of). Now I can't speak for everyone, but I have been damn good in school all my life, except for one notible exception, spanish. Why? I think quite simply I do not use it enough. Plain and simple. So with that said, I hope the growth of the net over the holiday season leads to its destruction so I do not have to take it in the spring semester and run the risk of not being able to graduate :)
In my opinion, the Spanish language doesn't have to be worried because the Net is the protector of many cultures and languages, and the Spanish language doesn't have to worry about anything. Now, I don't know much about Spanish but I think that a language is a beautiful and marvelous thing, and I wouldn't want to see only a single language on the Net.
First of all, languages are not static but rather they evolve and change all the time. This does not destroy them, it just makes them different. Just by observing that single fact one can see how rediculus this is.
However, I woudln't mind if Spanish was removed from the face of the earth. In fact, I woudln't mind of Danish was removed from the earth (my own native tongue). The reason for this is that it's simply stupid and unproductive for everyone not to speak the same langauge. At the time, the only language that seems to have the possibility of becoming a truely universal language is English, so I hope more people will talk English.
There's nothing special about English, though; I'd much prefer a synthetic language like Esperanto that's actually thougth out and easy to learn, instead of the random suckiness inherent in natural languages. But [i]everyone[/i] learning Esperanto or anything besides English unfortunately seems rather unlikely right now.
Some would say that this would destroy culture, but if a culture is so weak it cannot survive the "loss" of its language, I'd say that people weren't really serious about it anyway.
Bjarke Roune
Really... Check the German, French, Italian, Russian, Arab, Israeli, Portuguese... Press and the same articles are written like what they don't want to end up like Esperanto.
:>
This is why many many YEARS AGO they started having their own web site in their pown languages.
But still as far a technology, it's been english since the days of the first Radio Operators and Sonar/Radar specialist, Pilots... Nothing new here.
"(This means) corrupting two universal languages that deserve the utmost respect: English and Spanish."
Congratulations, you can have a star now.
It's been years since I took french or saw the original article I was refering to, so I went to babelfish and created an equally long phrase. I know my example was lame, captain obvious, and that wasn't the point anyway. Anyway, here's some more french for you to run through bablefish:
Déplacez-vous en France, vous oreiller-biter rétentif anal.
Alcohol, Tobacco and Firearms should be the name of a store, not a government agency.
AgoraBasta has, inadvertently I'm sure, illustrated the strenghth of the English language. Despite his posts bizarre structure and grammar it is understandable. I doubt that many other languages could take this sort of treatment and still be readable.
Latin never ceased to change. It changed into Spanish, French, Romanian, Italian, Catalan, etc. These languages are still changing, and some people don't like it - which is the whole point of the article.
People are tempted to think that Latin stopped changing because the Romans left excellent written records that we still know how to read. Written records don't change, but that does not mean the spoken language they were meant to encode stopped changing!
Languages are not subject to the evolutionary force of natural selection. There's no natural selection that makes it more likely for you or your language to survive if you use a bilabial fricative for "b" (like Spanish) instead of a bilabial plosive for the same sound (like Latin). For this and other reasons linguists tend to characterize linguistic change as "drift" because the way it occurs is chaotic, random, and (so far) inexplicable.
Creedme, el español es una lengua importante para el norteamericano.
Hello, let me introduce myself, I import noodles into North America, mostly linguini
Todos sabemos que la cultura protestante del norteamericano le hace buscar el beneficio económico (la cultura latina es más "católica").
Although I'm catholic, I like protestant girls just like your next latino guy but they're expensive to date.
Y el mercado latino será cada vez más importante.
My large mercury capri has those controllable shock absorbers, bouncing up and down at a stop light is indeed important.
Los hispanohablantes son cada vez más, al igual que los chinos. En un mercado globalizado como este el que sepa más idiomas tendrá más mercado y ganará más dinero.
And yes, its an american car, cost me a bundle too
Esto los europeos lo tienen muy claro por su diversidad lingüistica.
Linguini is a popular form of european pasta used in many dishes
Aquí en europa los estudiantes preuniversitarios
which while primarily a european staple, is quite universal in favor and worth studying the preparation of
aprenden 2 lenguas además de la materna. Un universitario europeo que se precie (de cualquier ámbito del
I had to get this job as my protestant girlfriend is pregnant, and dropped out of university
saber) dominará su lengua materna (por ejemplo el español),
she is a dominatrix, albeit a pregnant one that speaks spanish
hablará con suficiente fluidez el inglés,
She has been 'retaining fluids' as you english say
y sabrá defenderse en alemán y francés. Si además es de una región con lengua propia
so I feed her linguini, with french fries prepared properly
(catalán, vasco, gallego)
along with some other dishes (I don't know the translations there)
conocerá esta lengua también. Sin embargo los anglosajones siguen ciegos. Yo puedo entender una
she is legal aged, I'm not a puedo or anything, i met her in LA.
conversación en inglés y se de lo que hablais, pero cuidado!, si no quiero que os entereis de lo que digo solo
she told me in conversation that I'm going to have to 'do it myself' for awhile
tengo que hablar en español...
are you understanding my spanish so far?
italiano...
something about italian
Ya sabeis que nosotros inventamos la "guerrilla", mi consejo: aprended español o perdereis. :D
So I'm being inventive, although its not consensual, my girlfriend does sleep with her mouth open :D
Personally I don't feel that technical jargon (regardless of the industry) is any language other than it's own. Much like slang, it is made up, and exists as a kind of third language or buffer between two or more other languages.
If I invent something and call it a "Fritnal", just because I speak English, does not make it an English word IMO, just as the word "Zip" in Zip drive is not a part of any language, it's a proper name, and exists on it's own. I also feel this is true with existing words, sure the words Palm and Pilot are english words, but when used to represent a product they are no longer English.
I think what most of these higher ups who complain about certain languages dissapearing among the tech sector are too detached and not realizing that we as a culture of techie and geek people have created our own language thats transends all other languages so that we can understand one another, and we have our own jargon and slang.
I don't really see the need to worry about us hurting a language when in reality what we are doing is creating a new language, much like in Bladerunner where a lot of people spoke the street language which was a combination of slang, jargon and words from all languages, and I see nothing wrong with that.
Besides if you ever take a non techie/geek and have them listen to two geeks talking in a server room, and every second or third word is something they don't understand or have never heard of, to them we are speaking another language. It's not really any different when you go to say a rave, it has entirely it's own culture and language, just as the hip-hop culutre has it's own, and street kids have their language and so on.
Language should be fluid and allowed to grow, change, combine with other languages, not stagnate and be forced to remain within parameters of what and can not be said. Language is just another boundry to break so that we can live as one planet and not a bunch of people who's governments are too scared to let them mix freely.
I'm pretty fly for a white guy
so what do you call a "frisbee"(tm) when you do not wish to pay Whammo royalties?
We ultimate players call it a "disc". Last I checked it didn't use optics or lasers though.
I don't really know how to write "old english", but then there really is no right way to write it. Before the 19th century there was no single dictionary and the literate English speakers were free to spell words any way they wanted.
Has this been a bad thing for English?
To me, the question does not even matter. Que sera sera.
--- -- - -
Give me LIBERTY, or give me a check.
Oh come one. Only middle and upper class people in Puerto Rico know any enough english to actually carry on in a conversation. Poor people know things like hamburger but the syntax of English itself has not moved into the language. Besides the complexity of Spanish structure is a benefit not a hindrance. The only advantage that english has over Spanish is a larger vocabulary but that can be translplanted into Spanish and used within the more complex and exact structure of Spanish. Unix is to DOS and Spanish is to English.
When it comes to affectations, I guess the operative rule is "to each his/her own"...
--
You think being a MIB is all voodoo mind control? You should see the paperwork!
A man who wants nothing is invincible
I think their priorities are a little mixed up. If I was going to be worried about english words infiltrating the vocabulary of my native tongue, then I would be trying to educate the children bilingually so that they would have a greater ability to express themselves in the language that most fits their thoughts. English is inevitable - for the time being at least, and it has a lot to offer by way of the expression of ideas. Just as much as most other well-developed and living languages (counterexample: vietnamese... what?! no VERB TENSES?!). I'm sure spanish has at least as many good points as english because it probably has at least as many dialects... that's probably a good indication that the language is alive and well, though I'm really rambling right now.
In any case, teach the children both. Give them the tools they need and they'll use them well.
Besides, last I heard "linux" wasn't really an english word...
We use the word "Tory" to describe our (Canadian) conservative party, as well.
For those like me who have had an almost life-long interest in the Irish language, would you be able to recommend some good resources? I want to make it my third language (I speak English and a fair amount of French), but where I live (Saskatchewan), there's zero in the way of Irish speakers.
>DISC means the medium involves optics or lasers >in some way, such as "optical disc", "Compact >Disc" etc...
...
>DISK means the medium is magnetic based, so you >have "Hard Disk", "Floppy Disk" etc....
No no no. "Disc" is English from the correct side of the Atlantic. "Disk" means too many US computer-types decided they needed a word for "something bounded by a sirkel"
Unfortunately, I've never studied linguistics, so my comments will be completely unsubstantiated. But here goes...
English is destined to fail, much like Latin, as a 'universal language'.
Agreed. However...
1) Your argument doesn't preclude English from being a universal written language, even if the spoken dialects are so different that they are incomprehensible to others. I think there is precedent here (I'm under the impression that this is the case with Chinese dialects and Arabic dialects, where the spoken languages are completely different but the written ones are the same).
2)As a previous poster mentioned, technology is a factor now that it wasn't before. You gave the following example:
Look no further than the US. Take that South Dakotan and place him in the South Side of Chicago. Do you think he is going to understand a word of English spoken there? Hell no. It's english, but it's an entirely different dialect.
I can guarantee you that both the South Dakotan and the...um...guy from Chicago can both understand "The Simpsons", even if they can't understand each other. If American movies and television become popular all over the world, this might somehow help keep English more mutually comprehensible.
--
-- Will quantum computers run imaginary-time operating systems?
I agree. Cultural purity arguments are not only close-minded, but generally ignorant. The Nazi's and similar groups adopt pseudo-Darwinian ideas about how an ethnic group can be biologically superior and argue that to maintain that superiority they must maintain the purity of their genetics (and only marry inside their group) Of course, they completely ignore any other evolutionary ideas, such as how mixing diverse populations and inter-breeding benefits the species. Cultural purists seem to pick and choose their 'scientific' theories and selectively discard anything else.
The Apocalypse is nigh! Remember Babylon, when brother could understand brother? The Unnameable was gentle and punished Man by confusing their tongues, until mothers could not understand their children. The Merging has begun, and with the Merging comes the destruction of Man and the world, for the Unnameable will not be so forgiving this time. This is why we must not let English become the One Tongue!
Am thinkink that Russian is definitely pollutink English, da? It must beink some ingenious plan by some evil genius...
If you open yourself to the foo, You and foo become one.
I still hate the phrase "action item", and not just because it means i'll have to do more work.
Let's make killing "marketing-speak" an "action item"
It seems whoever moves the learning makes the rules.
OS/2 - because choice is a terrible thing to waste.
"(This means) corrupting two universal languages that deserve the utmost respect: English and Spanish." I would strongly disagree. English Is a combination of other languages already. Adding another language would serve to enhance it not corrupt it. Second as a Canadian I can testify to the destructive nature of Quebec speaking another language from the rest of the country. That one just about caused our country to break up. (less than 1% in a reffurendum). So Refusing to accept incorperation of another language into your own does far more damage than the alternative.
What if the result looks/tastes/feels like crap? Would it be worth then it to distill all culture into a single culture?
The way I look at it, if you distill everything down to the lowest common denominator, you will miss out on a lot. It is like food: you are hungry for some chicken. Would you rather be served a bland, relatively plain boiled piece of chicken by itself or a savory Chinese chicken dish loaded with vegatables and chiles?
As a Chicano I would say: "extra chiles, please!"
--
You think being a MIB is all voodoo mind control? You should see the paperwork!
A man who wants nothing is invincible
Well one problem is that imported words don't fit into the language structure. E.g. anyone who is new to computers will not know how to pronounce or spell the words. This creates a considerable barrier for people who are not fluent English speakers. - In any non-English speaking country that's the vast majority.
:^) - the spelling was derived from a number of different dialects, making learning to spell a ridiculously difficult task. You can see that on this board - even very educated people make considerable numbers of spelling mistakes. In most other languages spelling is a comparatively straightforward task. Importing many English words will create the same problems there.
Another problem is that the words typically are redundant or overlap with already existing words - again that's a barrier for anyone just learning about computers.
Also English is unfortunately a good example for a ridiculous spelling system
On the other hand this is not a new problem - all languages have imported words from other languages, quite possibly most of the English terms in the computer field will disappear again within a few decades, leaving only a few remnants. While it makes sense to react on this development (support translations etc) I think it's also important not to go overboard and declare the death of Spanish/German/Greek/whatever just because of a handful of new words.
Ha Ha Ha, you poor spanish fools! The internet is a vast conspiracy created by native american secret agents to destroy the evil spainish hugemony. We covertly infiltrated the American government, schools and military, and we used their resources to create a tool to destroy you with. HA HA HA! Prepare for the cultural destruction you evil colonizers so richly deserve!!! HA HA HA!!! Take that Christopher Columbus!!! Get bent Hernando DeSoto! New Spain my ass!
The current Slashdot moderation system is made by gay communists!
Languages are a very important part of our culture (humanity's culture), a way to understand the social evolution, gives us a feeling of unity, ect. Now there are only a few thousands left and many more disappearing each year. It's as sad as species disappearing and unique geographical locations being destroyed... We are losing what makes life so unique and rich: diversity. Now although I prefer my native language, I love english and I think it's a good thing that it's universal, helps people communicate no mater their native language; I just wouldn't want it to become the only one or the major one out of a few. Which is why we have to protect ourselves from the assimilation english-canadiens and americans have been trying to force on us. Yes, this results in stupid laws. And with globalization, I think this tendency is nothing like what we've faced in the past. Abandonning religions, borders and such is great. 'Standardizing' languages is not. Computer languages, maybe, not humans ones. Chacun exige d'être innocent, à tout prix, même si, pour cela, il faut accuser le genre humain et le ciel. Albert Camus
I have a very simple response to this article.
I knew it was happening. English is becoming very universal. I've considered the plausability of creating a new, more efficient and expressive language. English has its flaws, moreso than most others. But it has its positive points too. For one, it doesn't have the subjunctive, which is impossible to learn. And how would you write a MUD entirely in Spanish? How would the commands be phrased? Vaya? Va? Ir?
Basically, my response is this:
What the hell are you going to do about it? Blow us all up?
Aciel
aciel@speakeasy.net
"Good Riddance" is all I can say.
Or perhaps "?Donde las drogras in la salada?" would be more appropriate.
Spanish is the lamest language on the planet and I suspect that it actually has suppressed the technological development of those unfortunate enough to be saddled with it from birth.
One of Spanish's BIGGEST problems is it's senseless obsession with gender. WHY DOES EVERY*THING* HAVE TO HAVE A GENDER?
Please...someone explain to me why Mayonaise ("la mayonaisa") is feminine?
Mayonaise cannot reproduce nor does it exhibit any vaginal structure or other sexual attributes...
El Endo De Posto
"A microprocessor... is a terrible thing to waste." --
"A microprocessor... is a terrible thing to waste." --
GeneralEmergency
I absolutely love the idea of everyone on earth being able to speak a common language. That language would not necessarily be the speaker's first language, but it would be one in which they were fluent. At this point in time English looks like the best bet to fill this role. It is the language of international business first of all. The elites in many countries around the globe send their children to schools where they are taught english. I know, I work in a university where 80% of our student workers come from the elite classes of other countries, they all speak english fluently. Not like what you'll find at McDonalds. Is there some kind of corporate policy there which requires that anyone working the front counter cannot speak english?
As internet use increases around the globe, a universal language will eventually come into being. I doubt very seriously that it will be pure english, or pure anything. More likely it will be an amalgamation of many languages.
This is exactly what happens when two or more languages are mixed together due to the geographic merger of speakers of those languages.
English itself did not always have the form it does today. Take a look at middle english, or old english sometime, they're truly foreign to speakers of modern english. After the norman conquest of england, words from french slowly seeped into the language to the point that today English, while germanic in origin, could almost be considered a romance language.
So as time goes by the internet itself will foster the creation of a new language, derived from old, that anyone online will be able to use.
The sooner this happens the better.
Lee Reynolds
Muslim community leaders warn of backlash from tomorrow morning's terrorist attack.
That would be sentence
--
But yes, you might be right, although I would say is european custom.
--ricardo
sgis ddo ekil t'nod i
If you consider this from an evolutionary perspective, you can see a little more of the future of linguistics. I'm talking about memetics, not genetics.
Disclaimers: I'm not implying that evolution always creates improvements, especially not for our aesthetics. I'm also not saying that human language had a single origin (although it may have); that's irrelevant here. And I'm not being rigorous here, but I believe there is a solid parallel.
If you have a population that has a broad geographic coverage and a low amount of mixing, then diversity tends to increase. One region can have radically different rabbits than another. Take that far enough, and you can get and preserve full special differentiation. If they adapt to different niches of life, they can coexist for unbounded periods of time. But if they compete for the same resources, then if they lose their barriers they will compete, some species will tend to lose (or merge), and you'll lose diversity.
Consider that situation as a parallel to the historical state of language. Communication between people leads to language mixing in a comparable way that mating between creatures leads to genetic mixing. We have had languages isolated by geography, class, and role (e.g. latin in science).
Well, now we've collectively decided that the world should shed many of the barriers that prevented us from communicating. We should not be too surprised that this will create some change. It's not even clear that this is a terrible thing; shared languages help open and easy communication, and that may have a mild suppressive effect on violence, racial discrimination, etc. But we will lose some things.
We shouldn't reject open communication out of hand, but we should be aware that this will lead to competition between languages, and that some will disappear or merge with others. It's a nearly inevitable result of greater communication.
El nino! I am El Nino! For those of you who don't habla espanol, it is spanish for.....the boy!
Yo quiero Taco Bell! --Picture the ugly little mutt here.
You see! English is being subverted by Spanish!!! We must preserve our english heritage! Oh wait, we incorporate almost every language into our own. We have a Bastard language!!!!!
"Disk" is short for "diskette". I don't recall anyone ever using the full term even back when it was new. If we're talking about a round flat thing, that's still spelled "disc" in the US. As in "compact disc".
The real issue here is that certain individuals feel that their language is their culture and that the "uniqueness" of their culture is threatened by outside influences.
People who obsess over Cultural Purity need to get a life.
I'm not saying that cultures are irrelevant, but cultures only matter as they exist at the current moment. A culture's past and present are merely academic concerns.
An indivual culture, much like an individual human, is only healthy as long as it is changing, at whatever pace. The process of growing, adapting, and learning is the very essence of what makes us human beings.
Languages change because the people who speak it are exposed to new influences. They occassionaly need new words to express new concepts, describe new items, or to better differentiate existing ones.
It's not wrong to borrow a word from another language to serve one of the above purposes, by any ethical or objective standard.
English and English dialects are largely composed of words that didn't have an origin with the English. A typical English speaker uses thousands of word that have Latin, Greek, German, French, Arabic, and other roots.
"Academy", "discourse", "ninja", "karma", "rendevous", "liason", "justice", "nocturnal", "science", "biology", "pow-wow", "siesta", "canoe", "library", etc...
English and most other major languages lose many words from their vocabularies as time passes, but new ones - begged, borrowed, stolen or created - spring into place.
Worrying about the fact that languages change due to foreign ifluences seems to me to have origins in Elitism, Xenophobia, rather than a simple fear of change.
If anything, an interest in the alien & alien vocabularies, and the adaptation of a few terms, is a sign of a healthy and vibrant culture.
Most humans are more than happy to use a "foreign" word for something new if is reasonably easy to pronouce and "sounds" right.
The fact that English technical vocabularies are influencing other languages isn't a sign of Neo-Colonialism so much as a sign that items that they describe happened to originate in English-speaking nations.
"Lookit!! It's a 'microprocessor'!" (btw - Mikros = greek, processus = latin)
And don't confuse culture (as in anthropology) with Culture (as in Arts & Literature). Culture is a product of a culture. Most the great stuff from Culture can be adapted or understood with a little help. Shakespeare has been translated into many languages. Dostoyevsky has been translated into most languages. Kurosawa is available with sub-titles. Music and Art don't need translation.
A lack of growth and change equals stagnation. Stagnation equals death and uselessness.
The only thing that we learn from history is that nobody learns anything from history.
Why? Is the average American so much dumber than the average European? Or many Canadians and Latin Americans?
When I went to Canada (Quebec City) there was no shortage of people who spoke French only. There were those who were Bilingual- if you work in restaurants where English & French spearkers frequent, that'd be very helpful I'm sure. But I don't believe the western provinces and much of Ontario is very bi or multi-lingual.
As far as US vs Latin America, I don't for a second believe that there are fewer bilinguals in the US than in South America.
Or me? :-> I think the reason more Americans don't learn other languages is sheer intellectual laziness...
Or a lack of need to. In Europe, in areas where there's little interaction with people who don't speak the local language, I'm sure the locals don't know anything but the provincial tongue. It's no different anywhere around the world I'm sure.
Many high schools do mandate some sort of foreign language instruction-typically Spanish, but if you don't use it, you lose it.
I don't know about that, but it certainly does help you understand how your own language works, and, if you're sharp enough to put the pieces together, to figure out how better to talk with foreign speakers of your language.
I think that it is absolutely moronic that children in american schools are taught grammar without first or concurrently studying a foreign language (ANY foreign language) first. I know that I didn't understand anything beyond "noun, adjective, verb," and "subject, predicate," because I couldn't recognize anything else in English, because I never had to THINK about it. After studying German (with a really bad teacher, grammar-wise) I was able to understand a lot more about the structure of English (and I was able to appreciate the ways in which English is simpler than most European languages, and how Japanese is simpler still)
Well, anyhow, it may not make you smarter, unless you pick the right language to study. For an English speaker, I think Russian might be a good one. (from what little I know about it)
Honestly, I haven't gotten many new concepts from Japanese...if anything it is far poorer than English with regard to subtle distinctions in...well, everything, and I've found a lot more that can't be translated INTO Japanese than can't be translated FROM it.
I visit a couple spanish sites everyonce in a while -- most of which are based in Mexico, and I've yet to see a single site use the terms "aplodear" or "chatear" or "printear" -- I'm sure other native Spanish speakers out there will agree with me in that these words are almost impossible to pronounce, and to be honest I've never really heard anyone use them.
If they are being used at all my guess would be that they are being used by bilingual hispanics in the United States. This isn't anything new -- people in the United States have been using Spanglish or Tex-Mex or whatever you want to call it since even before the internet with terms like "bloke" for "block" or "watcho" for "see you"
I can't speak for people from other contrys but I can assure you that although the use of these terms is very popular in the US they are not used (in fact they are despised) by most (I would go as far as saying all) Mexicans. The English terms that do end up being used are those which have no direct Spanish translation (Software is one of them -- programa means program) and which are easy to pronouce. Personally I don't have a problem with that -- how else is a language to grow??
So is spanish being destroyed? -- well in the United States maybe, but I think the rest of the Spanish speaking world is safe.
example: Here, In Puerto Rico (no, I'm actually Brasilian and speak Portuguese), they call a trash can a "safacon."
Everywhere else, its a "basura."
It happens to be that (much)after the U.S. got P.R., (1898)during WWII they put a "save material" campaign. (typical war propaganda.)All trash cans had the words "save a can" on them, to promote recycling. Nope, I'm not kidding, Save-a-can became "safacon," which will baffle any other Spanish speaker in the world.There are many others, such as the town (also here in P.R.) with the big "wipe out the trash" sign on its entrance. It is today known(on the maps) as the town of Guaipao. Weird, huh?
-----
Score 3? For what? Being wrong, at length? - smirkleton
French is... it may sound sexy, and living in Canada I heard enough of it, but its grammer rules and all other rules of it are totally lame, and they just plain don't have words for somethings, and are not allowed to makeup words unless the french langauge police say it's ok.
I'm pretty fly for a white guy
does anyone follow the 'Latin Explosion' that's going on in united states of america right now? in something like 50 years, it will be the first time that the majority ethnicity of a country will change through peaceful means. (caucasian to latino/hispanic)
sure, english may be the majority of the web now, and chinese may be the future, but at some point, america is going to be mostly spanish speaking... so don't worry about spanish disappearing. not anytime soon anyway.
--
Peace,
Lord Omlette
ICQ# 77863057
[o]_O
The 'invasive' nature of language tends to cut both ways. Look at how much Spanish has been absorbed into American English in the last 100 years or so. Look at the invasion of terms coming in from Japan now. Plus, how many terms have come in through pop culture?
As someone else pointed out, integration of multiple languages into a 'Common' isn't necessarily a bad thing. Especially for a multinational communications network like the Internet.
Segmenting a portion of the Internet for speakers of this or that language/dialect would be counterproductive in such a circumstance, as it builds barriers to communication instead of breaking them down.
If it creeps into the common usage of a language? Isn't that what schools are for anyways?
Chas - The one, the only.
THANK GOD!!!
Chas - The one, the only.
THANK GOD!!!
Smaller percentages? I happen to know that portuguese is one of the largest languages in the web, around top 3. (Sorry, no link.) I'm sure that German is right up there, too.(Yes, I AM brasilian.)
-----
Score 3? For what? Being wrong, at length? - smirkleton
I don't think that it's a big deal because the guy that invented it was the one who got to name it. So if anything people who speek Spanish should invent some stuff to make every one feal better.
By its very nature, Language is the most democratic of all possible institutions. If you decide to call the thingamabob over there a wongle and everone else agrees, it is called a wongle foreverafter until folks decide that it should be called something else. If nobody agrees, then you wander the space asking for a wongle and getting blank stares. Purity of the language agruments are pure rot. The strength of American English (at least) is that it is a total mongrel and thus has hybrid vigor. Given the fact that the rest of the world shipped their treasure to us (black gold from africa, yellow gold from aisia, white gold from europe, red gold from the americas, etc...) we have one of the richest languages in existance. Each of those people had special contributions to make, and these pearls were simply strung on the tread of the old world syntactic construction (sometimes). Thank God that American English did not have any of the "purity" arguments that are being made...
evolution weeds out what it doesn't need. apparently, spanish is no longer needed. i find it likely that some dominant language (like english(?) or mandarin) will evolve over time, as we all need to communicate more. it will likely take parts of each dying language with it. so, what's to whine about?
I'm sorry, but hasn't this 'phenomenon' been occurring since the advent of languages? If there's no word for something in one language, taking the word from another has always happened. Especially since the Internet is the model for the new "Global Economy", doesn't it make sense to share a universal language? That way meaning isn't lost in the translation of translations, etc. The same thing is occurring here in Germany. I'm an American here to increase my fluency in the language, and whenever I talk to someone about computers, it seems as if the conversation is half-English and half-German. I thought it was funny at first, but then I realized that English stole the majority of it's words from other languages, so what's the big deal? Sometimes I think I'm crazy for spending the time to learn the German language when everything these days seems to be merging towards English, but what are you going to do??
Spanish academics are worried about the influence of English on the CASTILIAN language (Spanish language doesn't exist)... F*** THEM!!! They destroy the catalan language using nazi laws, police and army, against all expression of any culture but castilian. So if they want to preserve their language first thay must respect other languages. Visca Catalunya Lliure i Independent.
This whole debate ignore the dymanic nature of language. "English" isn't a plot by english speakers to establish global control. People learn english in order to buy into that power. English speakers use so many words from other languages that the language can't be said to have evolved so much as congealed.
It's virtually impossible to go through a day in the US without using at least a couple of words that have filtered into US english from other languages. And that's the way it should be. Dr. Samuel Johnson, when he published the first english dictionary, dispaired that people would try to use it as an authority; that it would define the language. He understood that no language in static except a dead one.
"How perfectly Goddamn delightful it all is, to be sure" Charles Crumb
Not only would Spanish (and in many cases above, also Portuguese) be severely impoverished without these words, so too in many cases would most other European languages. One can hardly begrudge them these.
What the author of this article is actually complaining about may in fact be the fact that nominally bilingual people in the United States often, in fact, no neither language particularly well. Later on in the same page as I cited earlier, one also reads the following:
That's certainly true in the Southwest, where you routinely hear this "code-switching" en las calles and with the ubquitous cucina-help chavalines washing sus dishes sucios, if tu takes my meaning aquí.One thing that's seldom mentioned, which is going here, is that Spanish is not in the United States considered a prestige language. It is widely disparaged, relegated to the working class, or even the nominal underclass. This is completely different from what happens in, say, Canada, where the French language heritage is elevated and venerated--and vehemently and vociferously so, too, for where else but Québec can you find supercilious arrête signs where in even Paris and Madrid and Bonn and Tokyo you see normal stop signs? Sigh.
It is very sad but true that Spanish speakers in America are not taught their rich heritage. They do not know their writers of antiquity, like Cervantes, Unamuno, Lope de Vega, Galdós, Fray Luis de León, Santa Teresa, Quevedo, or San Juan de la Cruz. They do not know their writers of this century, like Federico García Lorca, Carlos Fuentes, Gabriel García Márquez, Manuel Puig, Jorge Luis Borges, and Rudolfo Anaya (to spread around the honors geographically). As I've heard say in New Mexico (the only State which is legally bilingual), "It is even easier to be illiterate in two languages than in one." :-( Then again, how many English speakers know their
own literature? Few, I suspect.
You can hardly fault tejanos for their curious code-switching or their rampant Spanglishization. You may flinch at hearing how in Texas then rentan something instead of alquilándolo, or talk about driving their troques instead of their camiones. (The former is especially annoying, because la renta is one of those faux amis that already has a meaning quite different in Spanish than the English cognate would suggest!) Then again, when you listen to Texans speak English, you might be a bit unnerved there, too. :-)
In technical jargon, Spanish certainly has much of its own terminology, as this article on El sistema de ficheros virtual de Linux will show you. Sure, you see a few foreign terms there, like driver and off-line, but by and large, they are perfectly native terms, such as an enlace simbólico. Somtimes there are transliterations, like superbloques and inodos (eg " El NFS guarda una tabla de inodos virtuales y su correspondencia"). But Spanish has plenty of its own words for things, like teclado "keyboard" and pantalla "screen".
(In Portuguese, interestingly enough, although teclado is keyboard, you have ecran to be screen, a French borrowing (the French word is actually éran), not an English one. I don't hear anyone in Portgual complaining about borrowing the French word, although I wouldn't completely blame them if they were to spell it eicrã to better match the pronunciation.)
Better that the hispanohablantes (hispanophones?) should use driver or superbloque though, which are obvious in derivation, than that they should use such deceptive monstrosities as the recently legally approved term in French, cédéron, meaning, of course, "CD-ROM". This is evil because it is not traceable back to Romance roots, and requires several linguistic jumps to decode. You must first say it out loud, transliterate back to English, then lookup an acronym in English (misspelled, too--see the "n"?) before you have a chance of knowing what it means. This is wicked.
Now, you'll always have people arguing about ficheros versus archivos in Spain and Mexico respectively, or ficheiros versus arquivos in Portugal and Brazil respectively. But these are no different than arguing about trucks and lorries between the US and UK, or heros versus hoagies versus grinders versus sub(marine sandwiche)s here in the States. These are really immaterial. The transliterations are a bit more jolting, such as people using salvar espacio to save space rather than ahorrar espacio, or salvar un fichero to save a file rather than guardar un fichero. It annoys because salvar is--well, originally--one of those religious things having to do with salvation. Agonizing purists tell you that you simply cannot salvar dinero--that you can only ahorrarlo, of course, and that buffers must be guardados, as their souls are not in peril. :-)
But probably, this is no greater a shift than the mutilations we see daily in English, like "unique" weakened to mean merely "unusual", "ubiquitous" weakened to mean merely "commonplace". In the technical arena, we see it when people use "hacker" to mean "cracker" and "memory" to mean "disk space"--and, I suppose, "software" to mean by default source-less for-pay "fleeceware", although I nominate "Billware" for that. :-) It's
happened before (consider "awful" last century), and there's just
no stopping it.
Let me finish this up with a note of encouragement, taken from the concluding page of the chapter in the reference book I've already quoted from:
These languages are growing, not always as one wants them to, but really no differently than they've always grown, and not as nastily as the article would have us all believe. If you want people to know a language, a literature, a history, and a culture, then you have to teach that to them!I now return you to your previously scheduled mano-a-mano diatribes; me, I've got a burrito nuking. :-)
Also try:
y pe =url&url=http%3A%2F%2Fslashdot.org&lp=en_sp&lo=en& t=jj9_xxx_trans
http://translator.go.com/cb/trans_entry?input_t
Ant(Dude) @ Quality Foraged Links (AQFL.net) & The Ant Farm (antfarm.ma.cx / antfarm.home.dhs.org).
This is not an English language issue. This is an issue of words specific to a trade being in the language of the country where the trade originated or is most prolific. It occurs in many, many fields.
Er your claim that this is merely another language cycle that we have seen before is flawed as it doesnt take into account the very point of the article ... the internet is changing language in a way we have NOT seen before. Sure the language is changing but it is NOT SPLINTERING. this is largely due to its written form, vocabulary is added not pronunciation therefore is much more resilient to 74!/\/7!/\/9 .... although not invulnerable ;-^
This is the point you are failing to grasp, both in my original post and in my previous. I will make it very simple for you:
I shall walk to the corner market to purchase some eggs
As opposed to:
Imma be walkin to the store down the fuckin street to buy some shit
Now, which one sounds more soothing, and intelligent? Look, from our conversation and my lack to speak any language with any degree of success.. hell I got a C in college english because I dont care enough about it one could assume that I'm not very intelligent. I'll give you a hint though, my IQ is near what you would see in say, Sharon Stone [same testing sequence].
So, that aside, I'm not saying anything about bigotry -- I have no idea where you got that from? For someone who is associated with Perl and seems well educated, damn you are lacking intelligence in quite a few areas. I say this due to one major reason:
You charge forth with an objection without even understanding what you are objecting too.
You spewed a bunch of numbers and expect authority over a subject.
But since you've impugned my credentials, which appear to be of some import to you, permit me to display them for you.
Well then, you sure showed me didn't you? Damn man, you have obviously been beaten as a child for not standing up for things because you are so far out of whack of what I am saying then I think I have ever encountered.
Point #1 I did not attack your credentials, lets go back to the original statement that I wrote: .. yep, there we go that sums it up right there, ask anyone you know what sounds more intelligent (not the speaker, just the sentence) and my guess is most of them would say sentence #1. So my point is this: You have no idea what the hell I am talking about. Hell, I dont even know if you know what you are talking about really. Reviewing things, just to make sure I am not off base, reveals that you have a stick shoved up your ass about something and you think that entitles you to accuse me of being wrong when you dont even understand what I am talking about.
If all you can pull is statistics instead of life experience then that's bullshit.
Did you or did you not spew a bunch of statistics (that was actually in favor of my original post, talking about the linguistic diversity of Spanish folks - thanks for that point, appreciate it), yes.. yes you did. So.. if that is all you can do, then you are full of bullshit. These two points are very factual
Another point, I dont even really care about your credentials, a simple "Yeah, I've been through spain and speak a bit of spanish" would have sufficed, thanks for your life story though. You have completely and totally misread what I was saying, maybe it is due to my lack of writing skills which I acknowledge (I dont care to write better, it is sufficient) but then I look back.. Ah yes, my example of the British lady who sounds (being the operative term, as you put it previously) more intelligent.
You sir, are in the wrong. However I'm expecting yet another response illustrating how it is wrong to make judgements about a person based off of their dialect. I'll save you the trouble: No shit, that is what I am saying. I'm talking about the sentences, the language, the words and phrases and how those sound. Spare me another long lecture about my bigotry, because you are the one who needs to relax.
But thanks, you are at least intelligent to discuss things with even though you aren't understanding my point.
Dacels Jewelers can't be trusted.
Let us translate your example to computer programming. "However, I woudln't mind if Perl was removed from the face of the earth. In fact, I woudln't mind of Lisp was removed from the earth (my programming language of choice). " Uurgghh another crappy comparison. "Lets us translate your example in to limer bean varieties". This doesnt address th issue. Spoken language like every other form of communication is a tradeoff between a "standard" and specialization ... "Eskmo" is the best language to describe snow with but not really good for a "general use language" ... a standard is needed for communication between computers its TCP/IP between people on computers its English ...
Most countries (especially "latin" ones) have bureaus for the language. These bureaus permit which words will be allowed on any dictionaries. I am Brasilian, and I know that there is a bureau for the (Brasilian) Portuguese language in Rio. This department regulates which terms are allowed onto the dictionaries, but I'm not sure if they let the dictionaries add "extra" words, such as e-mail. Well, at least with a little "unapproved" note...
-----
Score 3? For what? Being wrong, at length? - smirkleton
Barraponto.com
Also not a transcription, but I dont think its been updated anytime soon...And there are these amazing numbers of comments, like "1", "0", and even sometimes....."2"!!!!!!!
-----
Score 3? For what? Being wrong, at length? - smirkleton
Voy tomar un break. hehe, I'm a Brazilian living in PR, and though I speak Portuguese as a first language, I am also surprised at these language butchers down here. I also remember hearing that joke in Brasil a few years back. Check my other comments, I have one with the story of "el safacon." You're bound to get a kick out of it.
-----
Score 3? For what? Being wrong, at length? - smirkleton
Oooh, look at the violence inherent in the system.
The Americans stole the land from the Spanish, who stole it from various Native Americans, who stole it from other Native Americans, and on and on it goes. You are going to have a hard time finding a decent piece of land on this planet that hasn't been "stolen" several times.
Mea navis aericumbens anguillis abundat
The real scary part isn't that languages are dying, but the fact that english is our lingua franca. I am so glad that I was born english, as I would hate having to learn it as a second language. What we really need for the internet's language is {esperanto,lojban,interlingua}. :)
I agree. We've all heard these wonderful "purity" arguments before. Sieg Heil!
"Any connection between your reality and mine is purely coincidental." -Slashdot
A short list of as many languages I can think of off the top of my head that are dead.
Latin
Phonecian
Egyptian
French
Galic
Some of these migh not be quite dead, but are on thier last gasps. *cough*french*cough* Don't think it's dying? It's in pretty sore shape if everyone in the country speaks a second language and the government has to pass laws to make them use french on the radio and tv.
If Mr. Edison had thought smarter he wouldn't sweat as much. --Nikola Tesla
En passant, I just submitted my résumé after a rendez-vous in a café. Fortunately English is safe.
Why don't y'all go sleep siesta under a jacaranda? Wait, no jacarandas on the northern hemisphere...make it a saguaro, then, lulled by the coyotes...
it's called linguistic darwinism. deal with it.
Founder, Americans Allied Against Alliteration
Just to clarify:
DISC means the medium involves optics or lasers in some way, such as "optical disc", "Compact Disc" etc...
DISK means the medium is magnetic based, so you have "Hard Disk", "Floppy Disk" etc....
Technically speaking, you shouldn't interchange the spelling - in reality, non-techies and the vast majority of people do, so geeks tend to as well.
By-the-by, I'll never forgive the fact the world has to spell 'Sulphur' 'Sulfur' due to US English...but that's just me.
8)
Concrete analysis...
I live in texas, and I know a lot of spanish speakers (I speak a very tiny amount myself). Spanish is a myth, there is no "Spanish" language anymore.
The "problem', if you wish to define it as such, is that it has mutated heavily in the Americas away from "Castilian" (ie. european or "high" spanish), and within the Americas the differences between, say, the hispanoamerican speech in Guanajuanto (sp? northern mexico university town) and in Rio are larger than you would expect (I seem to recall that "sanitares" (sp?) was fruit in Guatemala and bathroom in Mexico, or some such, as an example). This has been occuring long before tech jargon. The differences have grown to the point that the european and american versions of the tongue are almost mutually unitelligible (according to my sources anyway).
It must be emphasized that this "blurring" was I think due more to migration than contact with other languages. (Not to say that that didn't play an important role as well, within 100 miles in either direction of the texas-spanish border, pretty much everyone is in linguistic euilibrium between the two tongues, "spanglish" as it's referred to.
So to sum up, this guy is just a hyper-purist, much like hyper-purists in pretty much every culture. As is typical of most purity fanatics, he's focused on one thing as the root cause of all the changes he doesn't like (like a Southern Baptist focusing on Disney as the corruptor of Family Values).
--
News for Geeks in Austin, TX
They are speaking English using the pronunciation rules of Javanese (langauge of Malaysia).
/Roman/ script.
The major language in Malaysia is B.M. - "Bahasa Malaya" or "Bahasa Malaysia". (Bahasa (from Sanskrit Bhasha means "language".)
Interestingly, it is now written in the Roman script and borrows many words from English, but with B.M. spelling in
My other sig is also a
But the original example erred simply in using Japanese as a major source language. The basic point, that English dictionaries are full of loanwords we take for granted, is valid. Pizza, odor, vision, computer, program, machine, engine, develop, soda, diploma, degree, company, corporation, yacht, waffle, booze, dollar, crap, tattoo... none of these are Anglo-Saxon in origin. Although claiming French words as loands might be cheating; one could argue that English is a creole of Anglo-Saxon and French. But we still have a lot from Latin and Greek directly, and Italian. And Scandinavian. And Dutch.
List of loanwords by language and period
C++ :)
More than one Spaniard in four speaks something other than castellano as their first language. 17% speak catalá, 7% galego, and 2% euskadi. This doesn't even count the various vestigial langauges like asturianu, leonés, or aragonés--which tend to be second languages now if that, not to mention the controversial situation of the two alde(i)as portuguesas that somehow never made it back over the border in 1640.
I'm not sure how that disqualifies me at all. I said that most spaniards speak multiple languages and this is statistically proving it. I did not ever say that they spoke Spanish as their native tongue. I really should have clarified my statement about 60% speak spanish and french. I intended metropolitan areas but left that out *doh*.
Now, to go to the cream of the comment - you say that it's stupid to associate a language with having a more smooth, intelligent sound. Why? I dont think that anybody would ever argue that a nice traditional British lady sounds very much more intelligent then say, a lad in the ghetto that uses mother-fucker to describe quantum physics. It sounds different, that's the bottom line. I made no reference to the actual individual being of a better mindset than any other either - I'm not sure why you made that assumption. Go listen to a Jeff Foxworthy tape and tell me if it's soothing to ones ear. The twang of a southern drawl is not something one associates with a well-defined education?
Why not? Well, they can't pronounce aluminium for starters - another reason is they can't pronounce most other words correctly. When a language is spoken where they do not pronounce the words correctly, it does not sound very pleasing unless you are from that region and then it sounds normal I suppose.
Either way, you really seem no more qualified to speak about Spain or the Spanish language than myself. If all you can pull is statistics instead of life experience then that's bullshit. 99% of statistics can be changed to meet the persons usage. (And yes, that is a joke).
Dacels Jewelers can't be trusted.
I do find it funny when speaking spanish around here (California), I usually have to repeat myself (if they aren't from Spain). The whole point of me learning Spanish over other languages is Spanish was more useful. Ironic..
Dacels Jewelers can't be trusted.
I speak spanish fluently, so I understand where they're coming from with this, but on the other hand.. why are they the only ones to speak out on something like this? And don't they realise that EVERY OTHER LANGUAGE has to overcome the same english-language speed bump??
[sigh] I remember when I was in 4th grade in UK (I'm Indian) and we were learning about tidal waves. I had to explain to my teacher what a 'tsunami' was and her reply: "Is that a word in Indian?" ;-)
These British
My other sig is also a
I speak Italian and I know only a few words of Latin and Greek but when I listen to Spanish I think: OK, I can guess the meaning but that word sounds out of place. That's because Italian is more logically tied to Latin an Greek than Spanish. Spanish sounds like an evolution from Italian but with true meaning of the words lost in the way. With English it's suprisingly similar.. many times I can do right guesses of unsuspected but somewhat documented meanings of some words.
Every language morphs.. before was because of lack of communication means (no scools, no radio, no tv), now it's because of worldwide media (Internet). Preserve the culture but don't be afraid to improve the language.
I haven't heard a word of Spanish -- or Cantonese, or Japanese, or French, for that matter -- ever since I slipped my trusty Babel fish into my ear many years ago. It's great, really! You should try it...
(ba'bel fish, n.) "The Babel fish," said The Hitchhiker's Guide to the Galaxy quietly, "is small, yellow and leechlike, and probably the oddest thing in the Universe... if you stick a Babel fish in your ear you can instantly understand anything said to you in any form of language."
- Douglas Adams, "The Hitchhiker's Guide To The Galaxy"
--
"Give him head?"
- A.P.
--
* CmdrTaco is an idiot.
"Remember when the U.S. had a drug problem, and then we declared a War On Drugs, and now you can't buy drugs anymore?"
This backlash against the English language [?] must be taken in a wider context. English is silently creeping its way to Absolute World Domination, IT being only its last (and most powerful) Trojan horse.
20 years ago, when the first IT wave hit our side of the Ocean, the French tried (and managed) to prevent the linguistic tsunami by creating new words (or reusing old ones) for IT-related stuff, and these words were indeed quite good ("ordinateur" and "logiciel" sound nicer to our ears than "computer" and "software") and were quickly adopted. But at some point you have to face the obvious : The Internet is 90% English-speaking. Whatever the subject, documentation written in English may be ten times as abundant as in any other language. What can you do against that ?
This is especially frightening for us in a EU context : how long will we be able to carry on with the current policy, that is,translating any document in the 3 major languages (German, French and English) and as many documents as possible in the 11 (as of now) languages of the EU ? It's already cumbersome enough today - so what will it be like in a 30-members EU ? We feel that at some point the case for "English Everywhere" will become extremely strong, and to be honest we find it not only unfair (Britons would get a huge comparative advantage) but downright terrifying.
"One world, one economy, one language" (I wonder what it sounds like in German ?). Welcome to a Brave New World of civilization and progress, where the global elite will use its own language (American English), turning every other language into minor dialects used only by poorly educated locals.
Now this may sound like plain paranoia (and it is, to some point). But History shows that whenever local tongues are confronted with a mainstream language used by the cultural/technical/administrative elite, the latter wins. Think of Russia in the 17th-18th century (or even better, read "War and Peace" to see how close Russia came to becoming a French-speaking country, and why it didn't). The only major exception I can think of is Quebec - which survived as a cultural entity thanks to the federal nature of Canada.
There's a real fear here, and although I understand that it may look somewhat ridiculous when looked at from the good side of the Babel Fish, you should realize that it is nothing like nationalistic ranting. If we were machines, driven by purely rational goals such as productivity, efficiency, etc., we would all agree to speak the same language - be it English, Latin, SmallTalk, whatever.
We're not machines. We have a thing which we call culture, and that culture is the very definition of our identity (this is especially true for old European countries). The current "Anglicization" of the world is seen by some as a menace to our national identities, virtually undistinguishable from a military one. The Quebec example, which is now seen as an exception, might soon become the general standard.
After European peasants destroying McDonald's diners, who knows the next step of the transatlantic cold war won't be angry academics sacking cybercafés ?
Aren't there another 39,996,671 Spanish speakers in ... um ... Spain?
"Anybody remotely interesting is mad, in some way or another" - Doctor Who
I got this porno film were this chick is gettin off, and she speaks french and it really turns me on, dude I dont want french to go away then there would be no french porno chicks and that wouldnt be that cool
"Alcohol, cause of, and solution to, all of life's problems" -Homer Simpson
The figures are interesting but more than a little misleading. They only refer to first-languages, and not total speakers. Also, they don't have India listed among English-speaking countries, although English is one of the national languages of India - at least 100 million Indians speak English, closer to 200 million. Hindi has close to 500 mil. speakers (a billion people kinda skew things :-) And hey - 280 mil (US) + 60 mil (UK) by themselves add up to more than 332 mil (the figure for English). Even subtracting Spanish-speakers from the US total, the rest of those countries ought to add up to more than 332, right?
Now if they had counted all speakers of every language, English would be a lot higher up - probably overtaking Mandarin Chinese. It would be interesting to see where Spanish was.
Now I shall end my post... leaving the obvious chad joke unsaid.
My other sig is also a
Yup, that is my opinion.
:). However, I only know what 2 of the 4 acronyms mean in that sentence (raid and fsck) and the other stand for expensive good hard disks and inexpensive mediocre harddisks respectively.
Take for example:
Man, I just had a hd crash so I had to run fsck on both my scsi raid array and my ide drive (reserved for pr0n).
This is normal net speak in "english" about technology that I use on a daily basis (not the pr0n
The sample sentence would make no more sence if the english "words" were translated into spanish, japanese, or whatever. So I guess that the spanish speaking ppl simply need to cope like we do...
If you'd actually make any contribution to technology, maybe you could do it in your own language. The reason everything is in English is that Americans are the primary driving force in the high-tech world - we brought you IBM, Microsoft, and the internet. We brought you C. In any event, I think we should all speak Japanese. Or German. English as a last resort.
-lx
H3y dewd,
Kewl, but it aint just spanish. What abt 3nglish?
JK
You have to admit, the Spanish speaking world wreaked(sp-?) havoc on the globe there for a few centuries, assimilating and even destroying civilisations. They had their time in the sun but their power had faded by the 20th century. So, no longer in command of a huge empire and in posession of an outmoded caste system, the government of Spain - what would now be called 'Franco's government' as though he was the only one responsible - stepped up their predjudices and basic attacks on the Catalan cultures, among others. This is disgusting, but somehow not unexpected. So now what do you expect for the Spanish(re-Castilian) language? Immortality? Preservation in antiquity?
All I'm saying is that when you live by the sword.....
(I tend to shy away from controversial issues, so sorry if I've upset anyone...I'm probably unpracticed in diplomacy... 8)
Concrete analysis...
an english-based, universal language is coming whether people like it or not. our current path in technology clearly shows this and people better get comfy for the change.
~AP
I've never understood the people who cry for the preservation of the "purity" of the language. A language is a living thing. It's in its nature to change and to be influenced by the other languages. As long as you get understood, there's nothing wrong with using an impure language (riddled with "foreign" words, for instance).
Stating that a language should be protected from outside influences is, in fact, almost as screwed up as trying to preserve the "purity of a race" by force.
English *hasn't* survived. Not as it started, anyway. Anyone who's ever looked at a document written in Old English knows that it is VERY different from the language they've come to know and love now. Spanish could be argued as "dying" if it were taking on words for which there were already spanish ones, but for the most part I think the argument here is all the IT words that NOBODY really had any words for until they needed them and invented them for their purpose. How long has the english word "upload" been around? Probably since the first person got tired of saying "load it up" and started using the word around his/her friends. If it's beginning to be used in Spain and other Castillian-speaking countries and conjugated in a spanish fashion then it is no longer exclusively english but a word naturally incorporated into the Castillian language which incidentally has an english background, and if we bothered to check out the background of "up" and "load" we'd find that they were not originally english words at all, anyway.
I sure as hell wouldn't want to be paying taxes for yet another government office, esp. one that tries to be so anal as regulating language.
So sure, it may be common that countries have language ministries, but their popularity is no argument for why they are needed.
So why are they needed, then? In brasil, what is the value of this office?
Alcohol, Tobacco and Firearms should be the name of a store, not a government agency.
Se me ocurre que quieras decir "aprehensión". Pero coño, todo el mundo dice "miedo", no?
Are you adequate?
Like who gives a sh..
I mean - I live in Denmark and study Electronic Enginering. All of our books are in (US) English and I don't think that this destroys the danish language.
When it comes to technical terms its better just to keep it all in English. Then its easy to talk to people from other contries without a vocabulary.
Technical University of Denmark
Informatics and Mathematical Modelling Dept
Computer Engineering & Technolo
Spanish is going through the same fragmentation process that happened to Latin, even without the intervention of English words. Ask an Argentinian the Spanish word for "car": the answer will be "carro". A Spaniard would answer "coche".
Not that the spaniard conquistadores were saints-- they were far from it-- but what happened in the US was positively hellish in comparison.
Are you saying that people from mostly non-mixed backgrounds are bad?
Anyways you should study up on why latin America has such a mixed population. Lots of Spanish slaveowners raped/had sex with their black and indian slaves and that is one of the reasons why.
I dont know if anyone has started this thread - but here's a thought: Would the differening grammatical structures of various languages make it easier or harder to search the web? Some would argue that because languages other that english are more strict gramatically that ... well, blah blah blah, I don't think I know what I'm saying. We don't search in natural language yet anyway, so maybe I'm just speaking shit. But you know what I'm getting at ... hopefully someone can run with this ... ?
If you bothered to know what actually happened, you'd realize how stupid you look.
The Aztecs ruled a huge territory. A good deal many tribes in this territory wanted to free themselves from the Aztecs. The Spaniards managed to take over because they had support of other tribes.
And anyway, Spanish colonization was *very* different from English colonization. Just look at the ratio of mixed european/native/black ancestry in Latin American countries in general.
Not that the spaniard conquistadores were saints-- they were far from it-- but what happened in the US was positively hellish in comparison.
Are you adequate?
Surely you meant GilDot...
Like Slashdot, but in Portuguese.
http://barrapunto.com/ - News for nerds, en español
When you quoted me, you forgot the important part:
"~s~"
Which denotes sarcasm. Methinks you should learn standard symbols used in chats/bb's before getting offended and replying to a bb.
Or in short, RTFM!
And I love the fact that because of one commment, that makes you assume I'm a racist and want me to die. Now replace the word "racist" with "homosexual" in my last sentence, and see how the tables have turned...it is YOU who are the intolerant one, you are racist against racists! You certainly stereotype as much as your run of the mill racist. But this is inconsequential anyway, because I was being sarcastic. Again, read carefully before you post. You might find things to be not as they first seemed!
Being a rather fluid thing, languages are constantly evolving at the will of the people, not a government office. The French have been trying for years, for example, to get people over their to use some phrase like "sac explosif que cela se protège" instead of air bag . It isn't working. People say it air bag because it's shorter, and advertisers use it becuase it takes up less space on the page. I don't think it'll work for the spanish, either. Other countries always bitch about The United State's cultural and economic hegemony over much of the world. As most of such countries are far older than ours, they seem to have a short memory, forgetting that they already had their shot at world dominance and spreading their ways. England, Spain, Greece, Persia, Rome, and many others had their empires. Now it's our turn, and we don't have to blow anyone up to get our way.
We just spread our Generican Culture.
Alcohol, Tobacco and Firearms should be the name of a store, not a government agency.
You advocate monolingualism and monoculture, yet you call people with more than one language, and who understand more than one culture, "close minded"? Gee...
Are you adequate?
I was just relaying hearsay, which I denoted as such ("I've been told..."). Sorry it was wrong. And just because there are only English in Miami doesn't mean the majority of the signs aren't in Spanish. But I'm not confirming that they are, I've never been there.
"British lady"? "Traditional"? "Twang"? "Southern"? So, if your madame mutters a four-letter word, she suddenly becomes "less intelligent", does she? What is the nature of intelligence? Do you understand the concept of variant registers? What about prestige accents? What about accents at all? What happens when Group A's notion of a prestige accent is the same one that Group B for cultural reasons places at the other end of the spectrum altogether? What about the application of simple logic and reason with respect to intelligence?
It's clear that you understand language-related prejudice and bigotry: you are a poster child for the same. It's this kind of thing that promotes conflict and worse. Someone who doesn't speak the way you do is NOT less intelligent that you are! This is the oldest lie on earth, and you should be ashamed of promulgating this incredible bigotry.
I do not believe in the notion of "argument from a position of authority". One should be able to carry an argument on its own merit. You aren't going to believe someone who tells you that 2+2=5 just because they've a degree in Math.But since you've impugned my credentials, which appear to be of some import to you, permit me to display them for you.
Let's see. To start start, I happen to be licenciado en castellano. I attended the Facultad de Filosofía y Letras at the Complutense University in Madrid where I lived, during which time I studied filología española. I've also lived in the UK, have visited most of the countries of Europe, and have spent serious time on five continents. I have had Iberian roommates and SOs, some of whom spoke nothing whatsoever of English, and have gone weeks on end neither hearing nor speaking English. I have formally studied not merely English and Spanish, but also Latin, French, Italian, Portuguese, and German. I have done general studies in Romance Philology and graduate work in linguistics, specifically in natural language processing. I have studied Spanish history, art, poetry, music, and literature. I have taught classes in Spanish. I have passed quasi-delerious through the mystical madrugá of Semana Santa in Sevilla--and not as a tourist, either. I have travelled the length and breadth of the Iberian Peninsula, conversing with farmers in Gijón in their strange asturianu, with gypsies in Andalucía, with scholars in Salamanca, with Catalan-speaking school children in Andorra, and been out all night countless times losing myself in the bacchanalian festivities of the young and the restless in Madrid and Lisbon until I could no longer remember what language I was even speaking, or being spoken to in. I have read Bernal Diaz del Castillo and the Quixote in their original versions, not to mention the Lazarillo de Tormes and el Cantar de Mio Cid in the Per Abbat manuscript. I have stood upon before the foundations Seneca's home, climbed the Giralda, wandered aimlessly about the Museo del Prado for days unnumbered, pondered the sorrowful and indicting words of the emperor Carlos V regarding the Mezquita ("Hacéis lo que hay en otras muchas partes, y habéis deshecho lo que era único en el mundo"), quietly meditated in El Escorial, and beheld Granada from the Sospiro del Moro--and, like Boabdil, wept.
So, yes--I do think I've had enough life experience to speak up about Spain and about Spanish.
I don't know if you meant to include Gaeilge (or Erse, as the English so delightfully and confusingly dubbed it) in your statement....sometimes it's hard to tell, what with all these US English spelling gradually bringing us closer to the one word language of "Ugh!" - I know some people think 'Galic' means Celtic, but it really doesn't.
Anyway, just to let you know that Irish is dead, but isn't.
Delightfully, most Irish people can speak a cúpla focal na Gaeilge, interspersed with English...it lets you swear without swearing and confuses the hell out of people. But more importantly, you'd be surprised about how many 'English' words actually come from Irish and Scots words...even the word 'Tories' (the word used to describe the members of the conservative party of Britain) comes from an Irish word, but just say it to one of 'em and watch them foam at the mouth trying to denie it! 8)
Concrete analysis...
At present, it appears this situation will continue until not only are virtually all languages, cultures and peoples replaced by the spiritual equivalent of urban blight, but to the point that the very living systems upon which all depend are rendered inoperative. The best hope is that we can rid the planet of technological civiliation; preferably so as to disperse life allowing true diversity to survive on the earth while enjoying an evolutionary explosion throughout the solar system.
Seastead this.
If we all want to have a truly universal language, to better ourselves and preserve the bliss and joy we all live in, why don't we all start speaking whatever the hell language Mike Tyson uses? The cute little lisp, that devilish grin... Now there's a native tongue (complete with gnashing teeth?) we can all be proud of.
-- Timmy! 100% vitamin C per serving!!
Gee, the President of the North American Academy of the Spanish Language doesn't want people slowly migrating toward English.
This is about like the President of GM bitching about Honda outselling his products.
BTW, this guy's wife makes her living teaching English to Spanish-speakers in New York so they can get jobs. She's accepted it, why can't he?
-
In some ways, I do resent that somehow people who speak Spanish feel it is necessary to get Spanish spoken everywhere, that somehow Spanish is the only language that matters. Here in NYC, if you tell me that you are in fear of Spanish disappearing, I'd wack you in the head! About half (I exaggerate a little, but it sure seems that way) of the signs are in Spanish! If Spanish is disappearing, it must all be coming to New York!
Here's a link: The 50 Most Widely Spoken Languages in the World that gives you an idea of where things are. It doesn't show, of course, the language spoken by income or by technological level, but with Spanish being the number two language in the world, ahead of English, it is hardly in danger of disappearing. Methinks they are being a little alarmist. Personally, I think they should go to China and demand that half of the signs be in Spanish.
Nomadic makes a good point and there are even more historical examples. 13th century Sufi poet Rumi wrote in Persian because it made his work more commercial at the time. In China, the common language is Mandarin, but there are over 350 other dialects, Cantonese being the second most popular. What's worse is that they're usually mutually unintelligable. People in Hong Kong speak Cantonese, and unless they are well-educated (and sometimes, even if they are), they neither speak nor understand Mandarin. That became a big problem in 1997 when they rejoined the PRC. Rather than fretting over the "destruction" of dialects, China maintains the supremacy of Mandarin. If they didn't, the country would balkanize and lose its status as a world power really quickly.
As long as I receive spam in Spanish, I believe the language is safe!
(Spam is so easy to spot that the language doesn't matter... :-)
Barrapunto.com
It's not a transcription of Slashdot, but many of the same topics show up. I read it once in a blue moon, and this very topic is being hashed out over there.
Random Musings at Rum Smuggler
Re: "the unhappiness of some academics with the increasing use of English or English-influenced words in the tech world, which they say is hurting the education of Spanish speakers" and same expressed in article:
l f-ball-on-Funniest-Home-Videos sort of way).
1) Using words from another language is injurious to "education" now? That doesn't even bother to make sense on its way to being wrong, so forget that part.
2) Who cares about the language of "tech world," besides those who are in it (the same people responsible for this "corrupting" Anglo-ness of its language)? The use of French and German words in the English-speaking "philosophy world" hasn't been the ruin of English-as-a-whole; nor has the use of Latin words in the "science world." The use of "fuck" in the world-that-says-"fuck"-a-lot hasn't destroyed the English of, say, theology.
The whole "corruption" argument is silly, and linguistically ignorant. It's just base Anti-Anglo(-American) sentiment masked in the rhetoric of "purity" (see France--or even 1920s' America's "racial purity" laws). I wish they'd drop the façade (--corruption!--) and just say Americans are all fat and stupid a few thousand more times; at least that's entertaining (in a Sisyphean, another-guy-hitting-himself-in-the-nuts-with-a-go
(Any random spaces in this post are the result of the lameness of the Lameness filter.)
Your mouth is like Columbus Day.
In my country, Norway, they've been worried about english influence since as long as I can remembered, and we're only 4,2 million people. Spanish is one of the five most spoken languages of the world, I don't think they have any reason to be worried.
A penny for your thoughts.
A witty
no more than taco bell.
This really doesn't have a lot to do with the number of speakers (otherwise Mandarin and Hindi would be the be all/end all of languages) but more about ease of use.
This is not the way to build a lasting empire.
This is happening in all languages at all times. The establisment always seems to be unaware of the cliche and the fact that nobody (except orwellian regimes ;) ) can control the evolution of language, and that it's a pretty natural thing.
I'm sure somebody remembers more about this than I do, but I think the french were moaning about something like this a couple of years ago, too.
But, the cool thing is that the internet is now officially an agent of linguistic change!
Jack Valenti and the MPAA are to technology as the Boston strangler is to the woman home alone
Most other languages are as illogical as hell. Like somebody earlier said, there is no point in genders and for example, HOW MANY endings shall we have for German words? English is the most simple and easy language to use, it's just the number of different words it contains that people find difficult. I say we ban Spanish and the rest of these terrible tongues from our schools and force our children to speak the one decent language out there ie.ENGLISH (with proper English spellings not those crappy bastardiZed US English ones)!
'nuff said...
"Titanic was 3hr and 17min long. They could have lost 3hr and 17min from that."
IBM had PL/1, with syntax worse than JOSS,
And everywhere the language went, it was a total loss...
First of all, anytime somebody calls the northern Spain varieties "standard" (even if you attach no serious significance to the label, as you make explicit), it just drives me nuts. It's around 50 million speakers out of more or less 350 million who speak like that. Hell, there's about twice as many mexicans as people who pronounce the zeta.
So, in the rest of this post I'll refer to seseante dialects as standard.
When two or three sounds are this similar, something has to give. Either they grow closer and merge, or they grow further apart from one another. The seseo phenomenon is the first effect--that is, merging, wheras the differentiation of standard (read: Northern) Spanish is the second one.
Something implicit you could have stressed: contrary to common opinion, seseo does not consist of people losing or failing to make the distinction between ese and zeta. The speakers of the standard *never* had a zeta to begin with.
Spanish is full of fricatives, far more than in English.
I don't think so. (Only a precise knowledge of English phonetics, and the fact that my books are at my office, stops me from being sure.)
If you think of phonemes whose default realization is clearly fricative, Spanish has /f/, /th/ (only in nonstandard (i.e. Northern) Spanish), /s/, /x/, and only possibly one more (for the very variable realizations of what Spanish orthography writes "y"); that's 4, at most five. English has /th/ (the "th" in "thin"), /dh/ (the "th" in "this"), /f/, /v/, /s/, /z/, /S/ (as in "shop"), /Z/ (as in "Sean"), and /h/; that's 9 (unless I messed up and /th/, /dh/ are allophones, which would make it 8).
Of course, I'm not counting allophones here, while you did count fricative allophones of the Spanish voiced stops /b/, /d/, /g/, and the voiced allophone [z] of /s/. But how many allophones may we find of the English fricatives? My initial guess is that if we were to count allophones for the English fricatives, the more likely result is that English would still have more.
Are you adequate?
IDN should help with at least one barrier, multilingual domain names.
d
sig is
The physics of language implosion 1000 years ago are very different from the realities of today. Whereas each town and city was almost "Galapagos Island" like in it practical isolation of things like language, this is not true for most of the world today. Today it is much less likely that a language, such as English, will evolve undisturbed and uninfluenced in any part of the world to the point where it is no longer understandable.
What is different between today's reality and Latin's reality 1000 years ago? Instant communications and easy travel. We stumble into dialectic changes as we travel, hear about them through friends and business associates, we are exposed to all the varieties. Not as individuals, but as societies.
I don't think English will suffer the same fate as Latin. No more than Latin would have suffered its own fate if all the speakers had lived in the same small town.
--- -- - -
Give me LIBERTY, or give me a check.
Maybe in the Internet the English would be overwhelming other languages but out of there the mayor cities in the US are becoming more an more Spanish fluents.
Languages evolve. Languages are changed by the influence of other languages. So has it been, so shall it always be.
---Joe Merlino gnupg public key ID: 1E91EBAF
I agree with that... If I were going to live to Germany, heck, I'll learn some german, at least enough to get around while I pick up the rest of the language. The problem here is not about spanish speakers complaining... The Spanish language has always been very zealous in guarding their language, and they have done good, as it is a very rich and florid language, with very very precise words to explain what they exactly mean. We can't disregard that Spanish is one of the most widely spoken languages, too. There is no place in the USA that I have been to, where I don't find a spanish speaking person... even the few canadians I've met, they speak some Spanish. And from Mexico to all central america, all south america, including the Caribbean, Spain, and some African countries speak Spanish... that covers about half the world. Unfortunately, for those countries, computers are limited to a specific socio-economic stratus, and even then, universities there have relatively unqualified teachers. Once again, money limiting their possibilities. Of course, there are very important computer people that speak in spanish. Try project Lucas in Spain (Linux en Castellano/Linux in Spanish) and the Universidad Nacional Autonoma de Mexico (I don't recall the name of the developer for gnome stuff, a math major there). There are a lot more people... but unfortunately, there seems to be a certain lack of interest... but those who have the possibilities to access a computer and/or the internet, are usually the spanish speakers who also speak english, so there really is no big effort to try to come up with the real words. They come up with made-up terms (even when the real word exists. They say "password" instead of "contraseña", "user" instead of "usuario", "nickname" instead of "apodo" or "sobrenombre". Spain has been doing great efforts to maintain all these little words in Spanish, but Spain is too little to 'fight' all the rest of the spanish speaking countries, that invent words like "accesar" (doesn't exist) instead of "obtener acceso" or "ingresar" according to the case. The worst part is that when a spanish speaker person tries to read a book on some computer stuff in spanish, he/she ends up reading manuals and instructions in english or french or german. The "problem" is really complex... for measures, for example, some say "julios" instead of joules, and some books themselves don't even agree with themselves... in one example they say "20 julios" and the next page says "20 joules"; "vatios" for watts, etc... and it is the same always... And well... even the "official dictionaries" include frenchisms and englishisms and germanisms, etc... French-speakers say "cool" and "weekend" instead of "formidable" or "fin de la semaine" (or something among those lines...) It is just either a matter of fighting more and have all the spanish speaking countries united, or give up and join the "enemy".
This will help you to preserve your Spanish language - weird but wired.
- English (Australia)
- English (Canada)
- English (Ireland)
- English (Jamaica)
- English (New Zealand)
- English (South Africa)
- English (U.K.)
- English (U.S.)
- English (Zimbabwe)
...damn that word processor... it wont accept my "Thou"'s...what the hell happened to English (Shakespeare)?
The use of American is damaging the Englush language far more. French, Italian, Spanish et al are getting left behind but is that really such a bad thing. They will survive in a local context but as we globalise the global language must be English!!! I just wish those yanks could learn it.
I love stacking my barbecues in the shed at the end of summer - you can't beat a bit of grill on grill action.
"With the arrival of the Internet and e-mail," he wrote, "(U.S. Spanish speakers) have begun ... to adopt Spanish-ized terms for technical computer jargon: aplodear for 'upload,' chatear for 'chat,' printear for 'print,' and many others."
Is something like this a bigger threat to English or Spanish? Your answer is probably based on whether you see the linguistic glass as half-empty or half-full.
The English language is constantly embracing other languages, whether from foreign countries or from slang of our own streets. We adopt the language of our enemies and allies. Hell, we even adopt the language of our slaves and the Native Americans who have been so lucky to avoid our attempts at genocide. English is the "Embrace and extend" language of modern times.
The power of English comes from its innate flexibility and willingness to change by embracing the best in all languages. In a sense, it represents to openness of US culture to accept new ideas and the peoples of other lands. The power of English is multiplied when used within a cultural context that demands its ability to change quickly, combined with the willingness of the culture to accept that change.
Vintage computer games and RPG books available. Email me if you're interested.
What ever happened to this 'great technological cyber-punk nation' we were all supposed to become a part of, with tech speak being based around the Japanese and manderin (sp-?) languages? Maybe with even a bit of English thrown in there?
Where's this badly-lit neon future we were promised in movies like 'nemesis'? Where are the 'Cyber-Samurai'? Where are the cops that look either like soldiers or 1950's dectectives?
This was a future without Spears and her bubble-gum pink cohorts shoving sickly sweet products down our throats. This was a distopia for everyone but geeks, but that shouldn't have stopped us?! What went wrong? Did we lose a war or something?
Go on...what happened to this vision of 2000?
Concrete analysis...
America is one of the richest countries in the world, and many (most? anyone have stats on this?) of its citizens can afford computers, therefore the language has lots of room to proliferate...
Also, would it not be better for the world if we ALL spoke one language? Not necessarily English, but IMO a 'universal' language would hurt no one and benefit everyone.
I find this article HILARIOUS, though I admit I didn't follow the link and read the whole thing. You've got my family 1 to 3 generations above me bitching (all born, raised, and dying in Chicago) bitching because the Mexican immigrants are the first and only minority who refuse to learn the English language, so as a result they have Spanish phonebooks and stuff in certain areas. I've also heard reports from friends that have visited Miami that it's (understandably, but still) 99% Spanish signs and stuff. Now usually I'm not some sort of USA/English homer, but come on, LEARN THE FUCKING LANGUAGE (LTFL, my new acronym :) ). When in Rome, do as the Romans do, unless you outnumber the Romans. I wouldn't go to Spain and expect the people to speak my language, rather I'd take a crash course in Spanish about a month beforehand so I could at least get by. If you dirty Spaniards ~s~ don't like the proliferation of English on the internet, even when there are many websites in just Spanish AND many in both languages (not to mention the number of IRC channels), turn off your computer and go turn on your transeestor radio and pout.
Laws, police? There is no law to prevent people from speaking Catalan, nor police represion of any kind. The real fact is that Catalan is a mandatory subject in Catalan schools nowadays, that it is mandatory to get a job in Catalan public administration, and that people who are also spanish but non catalan speakers must learn them just to acomodate some strange rules created by Catalan politicians
Errrr....this may be paranoia, but who says the elected American government is really in control of things? Surely it's more likely to be the civil servants who don't get replaced in administrations but merely get pushed around on paper a bit. That's why you give almost three months(!) to protect their positions and fabricate excuses for retaining their positions?
Anyway, just to be cryptic: "Wheels within wheels, circles within circles. Have you ever followed the paper trail?"
8)
Concrete analysis...
I'd like to make sure that people understand that I'm not saying this is good or bad. It's just what's happening. Many times it's easier to use a word that already exists for something over trying to make up some technical sounding term just so it's using your native toung or character set.
Another stong case for this is when you intend to do business using that term with a huge consuming country like say, the USA. Business deals go much quicker when everyone knows what the other is talking about.
Chalk it up to the new gobal economy of which the Internet is an integral part. Certainly the Internet has made BIG strides in breaking down boarders, allowing citizens to see other cultures directly rather than hear through the propaganda of their country's leadership. And with that will come the enevitable sharing of cultures and terms. Most of thoes new terms will surely come from the most widely used language on the internet - English.
--
Mecworks BLOG
The question is whether the introduction of new IT related words will one day slow down so all non English languages get a chance to catch up, or if English word will continue to pollute all other languages until we're all basically speaking English, but using different grammar.
Please alter my pants as fashion dictates.
As a French speaker, I can relate to this concerns. On the other hand, both Spanish and French have the depth they need to come up with perfectly suitable native terms to match the English ones. It's just a matter of imagination and a little work. And pride too: to slavishly borrow, or make litteral translations from another tongue, just cheapens the language.
I think it is important to develop technical terminology based on the native concepts (le "génie de la langue") of Spanish or French. It's trickier than it seems, but also very satisfying, to design and adopt new words that seem to spring naturally from the language's own depth and richness.
I would be interested to know, for instance, how Spanish-speakers would translate the word "shell". Strangely enough, I haven't seen a French translation of that word yet that truly satisfied me ("Interpréteur de commandes"? How boring). As an example of something better: I once used a shell called "gulam", which means "servant" in Hindi(?). Perhaps a shell should be called a "valet" in French. :-)
I've always wanted to know, is it actually true that in American there's such a large amount(maybe a small percentile, but in human terms a large amount) of people who can't speak US English?
TV seems to imply their presence is accepted without any attempt to educate but getting truth from American TV is like trying to use 'McGyver' as a DIY manual!!!
8)
Concrete analysis...
I'm a french canadian and many people here in Quebec have the same concern about their language. But I don't share their opinion. I think that the main purpose of a language is to communicate and have other people understand you, not for keeping your identity. Maybe some wars would have never been if everybody would have spoken the same language. Maybe this is a bit rough, but I do think that soon or later, everybody will speak the same language and that will be perfect like that.
...the percentage of Enlish-speaking Americans declined while the percentage of Spanish-speaking Americans increased.
Hey, if timothy can post BS, I can too.
Stating on Slashdot that I like cheese since 1997.
Actually, it's cool to know another language or two passably enough to search for warez and roms in countries that aren't so anal about intellectual "property"--Spanish is a good one. (Also, the piracy fascists like the SPA/BSA/IDSA/RIAA/MPAA can't have as many people looking for non-English speaking web pages of this type!) I bet if I knew how to speak the Mandarin, Cantonese, Czech, I'd be in like Flynn!
CEE5210S The signal SIGHUP was received.
Where I see a REAL problem is with Germany. Use of English in their language is becoming increasingly hip. I was there this summer and about 6 years before that, and the amount of English phrases, words, and idioms being pushed on the German people largely by the media and entertainment industry is astounding. The cool thing to do was to attend the special screenings of American films that weren't dubbed... Radio advertises "Top Hits Today" and one of the major ice-cream brands in "Manhattan Ice Cream" which runs the absolutely funniest commercials with the worst American stereotypes. I also worked in a small firm for that summer, and mostly everyone knew a few phrases of business English, because they knew very well that that was THE language being used, even if they were to communicate with clients from China, Pakistan, or Canada.
I just remember this joke...
Q. What do you call a person who speaks three languages?
A. Tri-lingual.
Q. What do you call a person who speaks two languages?
A. B-lingual.
Q. What do you call a person who speaks one language?
A. American!
Small potatoes make the steak look bigger.
This reminds me of what seems to be happening to the French language here in Canada. Works like "hotdog", "hamburger" ect not to mention the huge number of computer-related buzzwords and jargon have successfully entered the language.
(Of course, this is exactly the kind of thing that the language police are trying to stop...)
If you look at it closely, this kind of thing is how languages eveolve. Rarely do you see one tongue uninfluenced by any others. Granted, this might be being ... excelerated.... by the dominance of the culture which uses English, but I still think that this is quite natural.
--
Cognosco: (Latin) To examine, enquire, learn
Cognosco: To examine, enquire, learn
http://cognosco©datablocks©net
C'mon... English is at least as hard as to learn/understand, with its wierd grammar, werid pronunciation, and made-up verbs and adjectives (like the one I just used :P), than other languages like Spanish (I live in Panama Rep.), Russian (my first language) or French ("studied" it on high school).
I think it's a matter of habits. A little kid will learn easily any language he/she's taught.
~
~
~
~
:wq
Biologically the transfer of traits between species via interbreeding is a driving force behind the resiliency of a species. The English language (Why de we continue to call it that, there is not much Englishness about it) takes up words from other languages and donates words in return, both languages remain distinct, yet share traits that give both streingth. If you were to limit the cultural sources a language can use to obtain new words you would doom it in much the same way you would doom a bilogically isolated population, without the option to make additions both would die from an inability to adapt to change. GATC! binary can kiss my ass.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
The internet is NOT destroying spannish, many IRC networks like darkfire.net have very large spannish speaking populations. Infact now a days it is pretty hard to find an english conversation someplaces.
... for a couple of reasons. First of all, as somebody else touched on briefly, languages mix all the time. There's an absolutely obscene number of English words that are derived (and obviously so) from other languages, including Spanish. Examples? How about, say, libertad and liberty? Don't like that one? How about argumento and argument? Heck, how about "no?" This seems like pretty good evidence that an influx of words from other languages doesn't destroy the first.
Second, if English is destroying Spanish... why on earth would it be the only language? Why aren't we English-speaking imperialists a danger to French? Or Russian? German? Japanese? so on, so forth.
inigima
Have you ever wondered why it's so hard to understand things written in English during the Middle Ages?
It was written in a language that was not the origin of today's modern English. It was written in Canturbury English. Today's english is based on London English, which was not particularly dominant at the time.
A few plague laters, and Middle English was a dead language. If something were to happen to the US -- say, some nuclear fallout which made the US no longer a superpower, and I'm sure that modern day, American English won't be so popular throughout the world, as there's no reason to teach some language from some now third world country to the kids growing up in what would then be the world's super powers.
Build it, and they will come^Hplain.
Hmmmph!
"Pater noster, qui es in caelis..."
Seems to me that the entire thing is blown up. I speak Latin only when I wish, my French is poor, my Spanish is corrupted with false cognates from French and English, and my German is very small. (Small as in nursery-language; my Grossmutter spoke it to me then, but only then.)
I am sorry for those who protest against the pollution of the pure language. I would rather have an adaptable language than a pure one.
Handy is typically used (in the U.S., at least) to refer to anything that makes life easier, as in, "Having a mobile phone is handier than having to use a payphone." I'm not sure the origin of that word.
Stating on Slashdot that I like cheese since 1997.
You neglect to consider some technology developed over the past 150 years that allows for the recording of the human voice.
As long as the rest of the world is listening to English-language music and television, they'll be tied to the standards set by the US and UK.
American TV is seen worldwide. BBC World Service is the only reliable radio news in much of the world. Listeners do and will continue to understand English as we know it. I can't see rebroadcasts of media in "malaysianglish" to accomodate locals who speak a pidgin.
Another point to make is that the Human mind works a lot better than current speech-recognition technology. I can say from experience (as a former volunteer teacher abroad) that no matter how bad the grammar or pronounciation, English is English, and can be understood if both parties care enough to listen.
Finally, your quip about the South Dakotan in Chicago is just rubbish (I'm sure you get the picture, even though rubbish is a British slander, and not an American one.) I imagine you're trying to say that you don't understand Black people. Go take a few social anthropology and linguistics classes. While the Black American Vernacular (or whatever it's being called by the academics this year) is hard to understand for people who aren't accustomed to hearing it, adjustment takes place the minute you actually listen to what's being said.
-JB
Sure, you can be like the french and create your own native language word for everything from ASP to Zorkmids, but that just builds a confusing barrier when French techs and non-French techs dialogue.
Time for people like Mr. Betanzos to wake up and smell the java. Languages have mixed and borrowed since the first fork of peoples (Oh, yeah? Well you go that way and we'll go this way, alright?) American English is a hodgepodge of everything, bearing little resemblance to its germanic origins. Give it a rest.
--
A feeling of having made the same mistake before: Deja Foobar
As an English speaking American Internet user, I just don't give a shit about destroying another language. English is a bit of a mish mash of other languages, anyway. In America, we have the Susuki Amigo to drive around if we choose. A car assembled in America for a Japanese company with a Spanish name.
Even if the Internet ends up like that language that Edward James Almos speaks in Bladerunner, I just don't care. I'd like to see whatever happens, however, *evolve* that way naturally and not another piece of uninformed legislation aimed at computing...
I am against this politics, or better to say "efforts", but I am biased, because I like English and I can read, write and speak fluently in this language. The last in not true for the 500.000.000 people whose mother tongue is Spanish.
If you analise the web pages of Latin American companies, the majority of them are written in English or have a translation to English. But this is not true for French or German companies, for example, although I don't have the right figures.
* But not for huge companies such as Microsoft, they have the same monopoly in spanish spoken countries, however the translation to Spanish of MS software is normally of bad quality and the spanish versions and service packs are released much later that their English or German counterparts.
--ricardo
sgis ddo ekil t'nod i
are you fucking kidding me? i can't believe this kind of neo-patriotism still gets air-time. live with it. spanish words have crept into the english language, and vice versa. instead of pissing and moaning, why not do something more constructive? now that we're out of the 1700's, languages are going to intermingle whether you like it or not. look at japanese. there is an *entire character set* for words loaned from other languages (mostly english.) this may very well be true for other languages. i can't believe things like this get space on /. almost as stupid as an autobiography by linus (i can see the fanboys now buying multiple copies to get autographed to sell on ebay. i would love to kick those people in the skull.)
Allow me to offer some insight, from the perspective of a native of a Spanish speaking country (Guatemala).
Actually, those with unrest regarding the situation of the Spanish language are but a small faction within the academics. The very president of the Real Academia Española de la Lengua (Royal Spanish Academy of the Language) has stated more than once that the Academia is not worried regarding the future of the language; actually, the goal of the Academia is to mold the Spanish language, by deciding which new words enter the language, and which don't.
And, for those who did not know, the Real Academia is the only authority regarding the Spanish language. What we are experiencing here is a very low signal-to-noise ratio: we are paying too much attention to the rants of a small percentage of the Spanish speakers of the world.